Previous Article | Next Article 
Molecular and Cellular Biology, April 2000, p. 2466-2474, Vol. 20, No. 7
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Placental Failure in Mice Lacking the Mammalian
Homolog of Glial Cells Missing, GCMa
Jörg
Schreiber,
Eva
Riethmacher-Sonnenberg,
Dieter
Riethmacher,
Elisabeth E.
Tuerk,
Janna
Enderich,
Michael R.
Bösl, and
Michael
Wegner*
Zentrum für Molekulare Neurobiologie,
Universität Hamburg, D-20246 Hamburg, Germany
Received 23 December 1999/Accepted 6 January 2000
 |
ABSTRACT |
The GCM family of transcription factors consists of
Drosophila melanogaster GCM, an important regulator of
gliogenesis in the fly, and its two mammalian homologs, GCMa and GCMb.
To clarify the function of these mammalian homologs, we deleted GCMa in
mice. Genetic ablation of murine GCMa (mGCMa) is embryonic lethal, with mice dying between 9.5 and 10 days postcoitum. At the time of death, no
abnormalities were apparent in the embryo proper. Nervous system
development, in particular, was not impaired, as might have been
expected in analogy to Drosophila GCM. Instead, placental failure was the cause of death. In agreement with the selective expression of mGCMa in labyrinthine trophoblasts, mutant placentas did
not develop a functional labyrinth layer, which is necessary for
nutrient and gas exchange between maternal and fetal blood. Only a few
fetal blood vessels entered the placenta, and these failed to thrive
and branch normally. Labyrinthine trophoblasts did not differentiate.
All other layers of the placenta, including spongiotrophoblast and
giant cell layer, formed normally. Our results indicate that mGCMa
plays a critical role in trophoblast differentiation and the signal
transduction processes required for normal vascularization of the placenta.
 |
INTRODUCTION |
Drosophila melanogaster
Glial Cells Missing (GCM) (15, 18, 39) and its mammalian
homologs, GCMa/GCM1 and GCMb/GCM2 (1, 3), form a small
family of transcription factors. The defining feature of these proteins
is a highly conserved domain in the amino-terminal region which has
been referred to as the gcm box and constitutes the DNA-binding domain
(1, 32). The close resemblance of the DNA-binding domains is
also reflected in the very similar DNA-binding specificities of GCM
proteins (31, 36). Additional structural features shared by
GCM proteins include the presence of a transactivation domain in the
extreme carboxy terminus and high turnover rates with half-lives
ranging between 0.5 h (for GCMb) and 2 h (for GCMa) (29,
32, 36).
The function of Drosophila GCM is understood quite well. It
is expressed in both the hemocyte lineage (8) and the
developing nervous system (15, 18, 39). In the latter, GCM
expression is restricted to prospective glial cells. In fact, GCM is by
far the earliest marker for glial cells in Drosophila, and
analysis of mutant flies has shown that GCM is both necessary and
sufficient to induce glial fate in an uncommitted neural precursor
(15, 18, 39). GCM thus functions as a master regulator of
gliogenesis in Drosophila.
If one assumes that generation of glial cells from neural precursors is
mediated by an evolutionarily conserved mechanism, one might expect
that mammalian GCM homologs would also play a role in the generation of
glial cells throughout the mammalian nervous system (4).
Backing this hypothesis, ectopic expression of a GCMa transgene in the
developing nervous system of Drosophila led to a significant
increase in glial cells at the expense of neurons (21, 29).
GCMb failed to cause a comparable neuron-to-glia transformation under
similar experimental conditions (21).
However, expression of both GCMa and GCMb in the mammalian nervous
system was detected only by sensitive PCR methods (3, 6,
21). The only site where expression of GCMb was readily detectable was the developing parathyroid (21). GCMa was
primarily detected in the developing placenta (3, 6, 17,
21). Here, GCMa expression started early in the chorion
(6). During development of the placenta, the chorion
collapses onto the ectoplacental cone and fuses with the allantois to
develop into the labyrinth. The labyrinth functions as the site of gas
and nutrient exchange between fetal and maternal blood once the yolk
sac circulation can no longer meet the increasing metabolic demand of
the embryo. To that end, the labyrinth contains juxtaposed maternal
blood sinuses and fetal blood vessels separated only by a
three-cell-layered barrier of partially syncytial labyrinthine
trophoblasts. Fetal blood vessels are derived from the allantoic
mesenchyme, whereas the labyrinthine trophoblasts stem from the
chorion. Trophoblasts of the labyrinth layer express murine GCMa
(mGCMa), as do their chorionic precursors (6). Expression
decreases only after 15.5 days postcoitum (d.p.c.) but remains
detectable until 17.5 d.p.c.
Expression patterns of GCMa and GCMb are more compatible with a
function of mammalian GCM proteins outside the nervous system. To
clarify the function of mammalian GCM proteins, we deleted the GCMa
gene by targeted mutagenesis in mice. Here we report that genetic
ablation of GCMa leads to early embryonic lethality which results from
placental defects, in particular from a failure of labyrinth layer formation.
 |
MATERIALS AND METHODS |
Construction of targeting vector.
Genomic sequence from the
GCMa locus of 129/Sv mice was obtained by screening a lambda phage
library. A 2.2-kb NotI/NruI PCR fragment starting
in intron 1 and ending in exon 3 was used as 5' homology region and was
placed in front of a lacZ marker such that a continuous open
reading frame was generated between the 32 amino-terminal residues of
GCMa and LacZ. A 3.8-kb EcoRI fragment downstream of the
known untranslated region of exon 6 was used as 3' homology region.
Both the combination of 5' homology region and lacZ and the
3' homology region were inserted in pPNT(37) on either side
of the neomycin resistance cassette (Fig. 1A). The targeting vector
thus replaced the complete open reading frame of GCMa downstream of
amino acid 32 with a lacZ marker gene (Fig. 1B). The
construct was linearized with NotI before electroporation.
Gene targeting and generation of mouse mutants.
The
linearized construct was electroporated into R1 embryonic stem (ES)
cells which were then selected with G418 (200 µg per ml) and
ganciclovir (2 µM). Selected ES cell clones were screened by Southern
blotting with a 0.4-kb 5' probe, which recognizes a 7.1-kb fragment in
the case of the wild-type allele and an 8.2-kb fragment in the case of
the targeted allele in genomic DNA digested with HindIII
(Fig. 1A and B). Four clones among the 150 tested exhibited the pattern
expected for homologous recombination of one allele. Appropriate
integration of the 3' end of the targeting construct was verified in
the four positive clones using a 1.2-kb 3' probe on
PvuII-digested ES cell DNA. This probe hybridized to a
7.3-kb fragment in the targeted allele as opposed to a 7.6-kb fragment
in the wild-type allele (Fig. 1A and B). Hybridization with a
neo probe confirmed that only a single integration event had
occurred. Two targeted ES cell lines were injected into blastocysts to
generate chimeras. Chimeric males from two independent clones transmitted the targeted allele to their offspring. No differences were
detected between mice derived from the two different ES cell lines.
Homozygous mutant embryos were generated by heterozygote intercrosses.
Genotyping was routinely performed by PCR analysis using a common upper
primer located at the border of intron 2 and exon 3 (5'CAGAACGTGAAAACGACTGACTGG3') and two lower primers located
within exon 3 (5'CACTCTGCTGCTTCTGTCTGGCTT3') and
lacZ (5'GATAGGTTACGTTGGTGTAGATGG3'),
respectively. DNA was obtained from tail tips or, in the case of
embryos, from yolk sacs. PCR was performed in 30-µl reaction mixtures
containing standard buffer and 0.5 µM (each) primer. The cycling
conditions consisted of an initial 2-min denaturing step at 94°C,
followed by 35 cycles of 30 s at 94°C, 30 s at 65°C, and
30 s at 72°C. A 260-bp fragment was indicative of the wild-type
allele, and a 350-bp fragment was indicative of the targeted allele.
In situ hybridization, lacZ staining, histology, and
microscopy.
Entire conceptus and placentas were isolated at 8.5 to
13.5 d.p.c. from staged pregnancies. Staining for
-galactosidase activity was performed essentially as described
previously (14). After fixation for 2 h in 4%
paraformaldehyde, material was incubated at 37°C in 1% X-Gal
(5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside) for 1 to 6 h.
For in situ hybridization, placentas were fixed overnight at 4°C in
4% paraformaldehyde, dehydrated, bleached, rehydrated, and embedded in
20% gelatin. After a second overnight fixation in 4%
paraformaldehyde, placentas were sectioned on a vibrating-blade microtome (vibratome) (100 µm). Digoxigenin-labeled riboprobes were
produced with a digoxigenin-RNA labeling kit (Roche Diagnostics). Whole-mount in situ hybridization on vibratome slices was performed essentially as described previously (41) with probes for
Flt1 (23), germ cell nuclear factor (GCNF) (34),
and Dlx3 (28).
For histological analysis, placentas were fixed overnight at 4°C in
4% paraformaldehyde, dehydrated, and embedded in Technovit 7100 resin
(Kulzer); 6-µm sections were stained with eosin-hematoxylin or with
eosin only in the case of prior
-galactosidase staining.
 |
RESULTS |
Targeted mutagenesis of mGCMa.
The mGCMa gene was targeted by
homologous recombination in R1 ES cells with a vector that replaced
most of exon 3 as well as exons 4 to 6 with the lacZ open
reading frame followed by a neomycin selection cassette (Fig.
1A). Transcription of the neomycin resistance gene was in the same direction as transcription of mGCMa,
and insertion of the lacZ gene was such that its open
reading frame was fused in frame with the amino-terminal 32 residues of mGCMa (Fig. 1B). Because all other mGCMa residues were removed, the
resulting mutant allele is null. ES cell clones in which homologous recombination of one allele had occurred were identified by Southern blot analysis with probes flanking the sequence included in the targeting vector (Fig. 1C). Two independent recombinant ES cell clones
were used to generate chimeric mice. Germ line transmission was
achieved with chimeras from both ES cell clones as evident from
Southern blots (Fig. 1C), and identical results were obtained with mice
obtained from both ES cell clones.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 1.
Targeted disruption of mGCMa in mice. (A) Schematic
representation of the mGCMa wild-type locus (top) and the targeting
vector (bottom). mGCMa exons are marked by Roman numerals. (B) Targeted
mGCMa allele. Localizations of the probes and the diagnostic
restriction fragments before and after homologous recombination are
shown. (C) Southern blot analysis of DNA from ES cells (ES) and
9.5-day-old mouse embryos (9.5 d.p.c.) digested with
HindIII for use of the 5' probe and PvuII for
use of the 3' probe. The positions of bands corresponding to the
wild-type allele (wt) and the targeted allele (rec) are indicated. (D)
Macroscopic appearance of mutant (I and III) and wild-type (II and IV)
embryos recovered at 9.5 (I and II) and 11.5 (III and IV) d.p.c.
|
|
Heterozygous mice were viable and fertile. In matings of heterozygous
to wild-type mice, the mutant allele was detected in approximately 50%
of progeny (data not shown). They exhibited no obvious phenotypic
defects. These results suggest that heterozygosity of mGCMa is
phenotypically inapparent and that mGCMa is not imprinted.
Matings of heterozygous pairs, however, did not generate any live
births of homozygous mutant mice. Thus, loss of both mGCMa alleles is
embryonic lethal. To identify the time of death, embryos derived from
heterozygous intercrosses were genotyped at various stages of gestation
and phenotypically analyzed. At 9.5 d.p.c., homozygous embryos
were detectable (Fig. 1C). They were alive and present in the expected
Mendelian frequency (Table 1). Their phenotypic appearance was indistinguishable from that of wild-type and
heterozygous littermates (Fig. 1D, I and II). Their yolk sac appeared
histologically normal. At 10.5 d.p.c., homozygous embryos were
still present in expected numbers but dead (Table 1). The number of
somites in homozygous mutant embryos indicated that fetal death
occurred between 9.5 and 10 d.p.c. No gross abnormalities were
detectable in the embryo proper up to the time of death. At 11.5 d.p.c., the homozygous mutant embryos were already smaller and showed
signs of resorption (Fig. 1D, III and IV).
At this developmental stage, no mGCMa expression could be detected in
the embryo proper (data not shown). There is, however, a strong
expression of mGCMa in parts of the developing placenta from 7.5 d.p.c. onwards (3, 6, 21). Expression is restricted to
extraembryonic ectoderm, in particular chorionic trophoblast and later
trophoblast cells of the labyrinth (6). Exclusive expression
in trophoblasts and the absence of gross morphological abnormalities in
mutant embryos at the time of their death pointed to a placental defect.
Placental morphology of mGCMa knockout mice.
Gross
morphological examination of the placenta at 8.5 d.p.c. revealed
no significant difference between homozygous mutant and wild-type mice
(Fig. 2A and B). The chorion had
collapsed onto the ectoplacental cone, and fusion between chorion and
allantois had occurred. At this level of resolution, mutant placentas
still looked fairly normal at 9.5 d.p.c. (Fig. 2C and D). By 10.5 and 11.5 d.p.c., abnormalities were clearly evident in the mutant placenta. The wild-type placenta had acquired the typical three-layered appearance with the labyrinth layer being the inner layer, the spongiotrophoblast being the middle layer, and the giant cells forming
the outer layer and interface with the maternal decidua (Fig. 2F and
H). Spongiotrophoblast and giant cell layer appeared normal in the
homozygous placenta. The region corresponding to the labyrinth layer,
however, exhibited a severe reduction in thickness (Fig. 2E and G). The
overall shape of the placenta had changed due to the substantial size
reduction of the labyrinth such that the majority of mutant placentas
after being cut in half had a convex rather than a concave shape.

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 2.
Effects of mGCMa ablation on placental morphology.
Transverse sections (6 µm) of Technovit-embedded placentas stained
with eosin-hematoxylin at low magnification. (A, C, E, and G) Mutant.
(B, D, F, and H) Wild type. (A and B) 8.5 d.p.c. (C and D)
9.5 d.p.c. (E and F) 10.5 d.p.c. (G and H) 11.5 d.p.c.
The labyrinth layer is marked by brackets. Note the altered shape of
the mutant placenta at later stages.
|
|
A more detailed histological analysis under higher magnification
confirmed and extended these observations (Fig.
3). At higher resolution, defects
became apparent earlier. At 9.5 d.p.c., chorionic trophoblasts
were found densely packed at the base of the placenta in homozygous
mutant embryos (Fig. 3A), whereas chorionic trophoblasts in age-matched
wild-type and heterozygous placentas had already started to spread
inwards and participate in the formation of the labyrinth layer
together with the angiogenic allantoic mesenchyme (Fig. 3B). Fetal
blood vessels, identified by their containing nucleated embryonic blood
cells, started entering the prospective labyrinth from the base. Their
number was strongly reduced in mutant placentas compared to normal
placentas (compare Fig. 4A to B). Those
fetal blood vessels that were detected in the mutant were either
outside the placenta or
when in the placenta
had formed exclusively
near the base where the surrounding trophoblast tissue was very compact
(Fig. 4A). In contrast to the normal placenta (compare with Fig. 4B),
fetal blood vessels in the mutant placenta were never found in the
immediate vicinity of maternal blood sinuses. These developed normally.
The tight apposition of fetal blood vessels and maternal sinuses seen
in the normal placenta is, however, a key prerequisite for the function
of the labyrinth in the exchange of gas and nutrients between fetal and
maternal blood.

View larger version (94K):
[in this window]
[in a new window]
|
FIG. 3.
Effects of mGCMa ablation on placental histology. Higher
magnification of transverse sections (6 µm) of Technovit-embedded
mutant (A, C, and E) and wild-type (B, D, and F) placentas at various
developmental ages. (A and B) 9.5 d.p.c. (C and D) 10.5 d.p.c. (E and F) 11.5 d.p.c. Localizations of labyrinth layer (l),
spongiotrophoblast layer (s), and maternal decidua (d) are indicated.
Large cell-free areas in the abnormal labyrinth layer of the mutant are
marked by arrows.
|
|

View larger version (113K):
[in this window]
[in a new window]
|
FIG. 4.
Placental anomalies in mGCMa-deficient conceptus.
Transverse sections (6 µm) of Technovit-embedded placentas. At
9.5 d.p.c. (A and B), few fetal blood vessels (arrowheads) were
found within the prospective labyrinth of the mutant placenta (A)
compared to the wild-type placenta (B). Maternal blood sinuses (arrows)
were present in normal numbers but were never close to embryonal
vessels at any time during development as observed for the wild type (B
and D). At 10.5 d.p.c. (C to E), fetal blood vessels (arrowheads)
were present in the labyrinth of normal placentas (D) but absent from
the mutant (C) and were detected only outside the placenta (E).
Amorphous material (am) was frequently deposited within the labyrinth
layer of mutant placentas (12.5 d.p.c. in panel F). Giant cells (gl)
are indistinguishable between mutant (G) and wild type (H) at 10.5 d.p.c. and later stages of development.
|
|
At 10.5 d.p.c., the typical structure of the labyrinth was already
visible in wild-type mice (Fig. 3D). In homozygous mutant mice, there
was a drastic reduction in the size of this layer, and the number of
cells in the mutant layer was decreased. The lower cell number and the
invading maternal blood sinuses had given parts of the layer a
sponge-like appearance (Fig. 3C). Near the base of the placenta, the
layer remained compact. By 10.5 d.p.c., fetal blood vessels were
completely missing from mutant placentas, whereas an intricate network
of fetal blood vessels had developed in juxtaposition to maternal blood
sinuses in normal placentas (compare Fig. 4C to D). In the homozygous
mutant, fetal blood vessels were detected only on the outside of the
placenta underlying the compact layer of chorionic trophoblasts (Fig.
4E). The elongated differentiated trophoblasts that form the
hemotrichorial barrier around the fetal blood vessels were undetectable
in the mutant placenta. With increasing developmental age, amorphous material was detected throughout the mutant placenta (shown for 12.5 d.p.c. in Fig. 4F). Such deposits were absent from normal placentas. Even at this level of resolution, the giant cell layer (Fig.
4G and H) and the spongiotrophoblast layer appeared normal. If
anything, there might have been a slight hypertrophy of the spongiotrophoblast layer (Fig. 3C to F).
As shown for 11.5 d.p.c., the same defects became even more
pronounced at later points in development with the labyrinth layer growing significantly in size in normal placentas (Fig. 3F) but keeping
a constant size in mutant placentas (Fig. 3E). We conclude from these
observations that a functional labyrinth layer never forms in the
mutant and that the resulting failure to supply the embryo with
nutrients and oxygen is responsible for the observed embryonic lethality.
Analysis of trophoblast marker gene expression in mutant
placentas.
For a better characterization of the placental defect,
we next compared the expression of several trophoblast markers in
mutant and normal placentas (Fig. 5).
From 9.5 d.p.c. onwards, the receptor tyrosine kinase Flt1 is a
marker for the spongiotrophoblast (23). At all embryonic
stages examined, Flt1 expression was very similar in normal and mutant
placentas (Fig. 5B, E, H, K, N, and Q). In agreement with morphological
analysis, the Flt1-positive spongiotrophoblast layer seemed on average
slightly enlarged in mutant placentas.

View larger version (77K):
[in this window]
[in a new window]
|
FIG. 5.
Expression of placental markers. Transverse sections
(100 µm) of paraformaldehyde-fixed placentas were hybridized with
GCNF, Flt1, and Dlx3 probes as indicated. Analyzed were mutant (A to C,
G to I, and M to O) and wild-type (D to F, J to L, and P to R)
placentas from 9.5 (A to F), 10.5 (G to L), and 11.5 (M to R) d.p.c.
Localizations of spongiotrophoblast (s) and labyrinth layer (l) are
indicated.
|
|
Two markers were employed to study the labyrinth layer, in particular
its trophoblast component. Both the orphan nuclear receptor GCNF and
the mammalian Distal-less homolog Dlx3 are expressed in
overlapping, but not identical, subsets of labyrinthine trophoblast cells (28, 34). At 9.5 d.p.c., cells expressing Dlx3 or
GCNF were detected in normal and mutant placentas. In mutant placentas (Fig. 5A and C), they were arranged in a more compacted layer than in
normal placentas (Fig. 5D and F). By 10.5 d.p.c., the area with
Dlx3- and GCNF-expressing cells had expanded substantially in the
normal placenta as expected for the labyrinth layer (Fig. 5J and L).
The speckled distribution of the hybridization signal indicated that
within the labyrinth Dlx3- and GCNF-positive trophoblasts had
intermingled with Dlx3- and GCNF-negative cells derived from the
allantoic mesenchyme. In contrast, Dlx3- and GCNF-expressing cells had
remained in a narrow, compact layer in mutant placentas (Fig. 5G and
I). Staining of this layer was uniform, indicating the absence of
significant numbers of interspersed cells which did not express Dlx3 or
GCNF. This layer corresponded to the densely packed chorionic
trophoblasts at the base of the placenta but also contained material
from the sponge-like structure between chorionic trophoblast layer and
spongiotrophoblast, as this structure is not preserved during vibratome
sectioning. These phenotypic changes were even more apparent at 11.5 and 12.5 d.p.c. (Fig. 5M to R and data not shown), indicating that
the observed defect is of permanent rather than transient nature. In
agreement with histological analyses, these results indicate that a
typical labyrinth structure never formed. Chorionic trophoblasts as
defined by expression of typical markers were, however, present in
significant numbers in the absence of mGCMa expression.
Analysis of
-galactosidase expression in mutant placentas.
Inclusion of the lacZ coding sequence in our target
construct and its in-frame fusion with the amino terminus of mGCMa
allowed us to monitor the fate of mGCMa-expressing cells in
heterozygous normal and homozygous mutant placentas by
-galactosidase staining (Fig. 6).
-Galactosidase activity was already detected in chorionic trophoblasts around the time of chorion-allantois fusion in both mutant
and normal placentas (Fig. 6A and B and data not shown). In the
heterozygous placenta,
-galactosidase-expressing cells increased
steadily in number up to 11.5 d.p.c. and were spread over the
whole area of the labyrinth (Fig. 6D, F, H, J, L, and N). Variations in
staining intensities in different parts of the labyrinth indicated that
-galactosidase expression was not uniform throughout this layer, as
already reported for GCNF and Dlx3 (Fig. 5). This expression pattern is
caused by selective
-galactosidase expression in trophoblasts of the
labyrinth and is very similar to the in situ hybridization pattern
observed for mGCMa. We conclude that our lacZ marker
faithfully mimicks the temporal and spatial expression of mGCMa in the
developing placenta.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 6.
-Galactosidase staining of normal and mutant
placentas. Paraformaldehyde fixed placentas were transversely cut in
half at 8.5 (A and B), 9.5 (C to F), 10.5 (G to J), and 11.5 (K to N)
d.p.c. and stained for -galactosidase activity. A view from the
sectioned side is shown in low (A, C, D, G, H, K, and L) and high (B,
E, F, I, J, M, and N) magnification for both heterozygous normal (A, B,
D, F, H, J, L, and N) and homozygous mutant (C, E, G, I, K, and M)
placentas.
|
|
Closer microscopic examination on thin sections indeed confirmed that
lacZ is not expressed in mesenchymal components of the labyrinth layer (Fig. 7B and D). In
agreement with previous in situ hybridization results using an mGCMa
probe (6),
-galactosidase was detected in two
morphologically distinct types of labyrinthine trophoblast (Fig. 7D).
The first were cuboidal mononuclear cells. The second were elongated
cells of the three-cell-layered hemotrichorial barrier between fetal
blood vessels and maternal blood sinuses. Of the three layers, the two
closest to the fetal blood vessels consist of syncytial trophoblasts
whereas the layer closest to the maternal sinuses is cellular.
-Galactosidase activity was higher in the syncytial trophoblasts
closest to the fetal blood vessels and comparatively lower in the
cellular trophoblasts lining the maternal blood sinuses. Expression in
syncytial trophoblasts was also corroborated by the diffuse appearance
of the
-galactosidase staining pattern. lacZ expression
in the labyrinth layer remained strong until 12.5 d.p.c., which
was the last developmental age analyzed in our study.

View larger version (124K):
[in this window]
[in a new window]
|
FIG. 7.
High-resolution mapping of lacZ-expressing
cells in the placenta. Close microscopic examination of 6-µm sections
from lacZ-stained placentas at 10.5 d.p.c.
counterstained with eosin. (A and C) Homozygous mutant placenta; (B and
D) heterozygous normal placenta. Cuboidal mononuclear cells are marked
by arrows, and syncytial trophoblasts close to fetal blood vessels are
marked by arrowheads. mb, maternal blood sinus; fb, fetal blood.
|
|
Mutant placentas exhibited a vastly different lacZ
expression pattern. From 9.5 d.p.c., lacZ-expressing
cells were strongly reduced (Fig. 6C and E). Those
lacZ-expressing cells that were still present remained in
the compact layer close to the base of the placenta and did not spread
into the prospective labyrinth layer. Intriguingly, there were
significantly fewer lacZ-expressing cells than GCNF- and
Dlx3-expressing cells in the mutant placenta, indicating that mGCMa is
not essential for obtaining the trophoblast fate. Up until 10.5 d.p.c., the lacZ expression remained fairly stable, despite
the fact that the placenta increased dramatically in size during that
same period (Fig. 6G and I). Thus, lacZ-expressing cells
persisted in the mutant placenta until 10.5 d.p.c. or even slightly increased in number. From 11.5 d.p.c. onwards, however, lacZ expression was hardly detectable despite significant
levels of Dlx3 and GCNF (Fig. 6K and M). Close inspection of thin
sections furthermore revealed that the lacZ-expressing cells
in the mutant placenta were confined to the compact layer at the inner
side of the placenta (Fig. 7A and C). They corresponded exclusively to
mononuclear, cuboidal cells, in agreement with the fact that differentiated elongated trophoblasts were not detected in the mutant placenta.
 |
DISCUSSION |
In this paper, we describe the result of targeted deletion of the
mGCMa gene. mGCMa is one of the two mammalian homologs of the
Drosophila GCM gene that have been identified in extensive searches over the last several years (1, 3, 6, 19-21, 31).
Interest in these mammalian GCM homologs stemmed from the expected role
of these proteins as master regulators of gliogenesis in mammals
(4). The Drosophila GCM had previously been shown to be the earliest regulator involved in fate determination of glial
cells (15, 18, 39). GCM proved to be quite potent in that
function as ectopic expression of GCM resulted in transformation of
cell fate towards a glial fate, whereas loss of GCM expression invariably led to an extensive loss of glial cells in both peripheral and central nervous systems and a concomitant increase in neurons (2, 7, 15, 18, 39).
Given the fact that homologous proteins often have conserved functions
between species, it was expected that at least one of the two mammalian
GCM homologs has a role in gliogenesis. Biochemical analyses and
overexpression studies in flies indicated that GCMa was a better
candidate than GCMb. For one thing, GCMa behaved much more like GCM in
transfection studies than did GCMb (29). Additionally, GCMa
was able to transform cells in the Drosophila embryo to
cells with a glial phenotype, whereas GCMb failed to do so (21,
29).
Thus, we were surprised by the result of genetic mGCMa ablation.
Instead of a defect in nervous system development, we obtained a severe
placental defect that led to early embryonic lethality between 9.5 and
10 d.p.c. At the time of death, no major defects were detectable
in the development of the nervous system or any other parts of the
embryo proper. In effect, we were unable to detect expression of mGCMa
in any part of the embryo including the nervous system either by in
situ hybridization or by lacZ staining up until 13.5 d.p.c., which was the latest developmental stage analyzed in this
study. Currently, we cannot exclude a role of mGCMa in later stages of
nervous system development. This can be answered only by tetraploid
aggregation experiments. However, if there is a role in nervous system
development, it cannot be the one of a master regulator or an early
determination switch, because glial progenitors are already formed and
recognizable by marker gene expression at 13.5 d.p.c. both in the
peripheral and in the central nervous system, i.e., at a time when
mGCMa expression cannot be detected in the embryo proper. Thus, mGCMa does not seem to belong to those genes, in which function has been
conserved during evolution.
In other respects, the placental phenotype was not unexpected, as this
is the only tissue in which significant mGCMa expression had been
detected by in situ hybridization analysis (6, 21). mGCMa
expression has been reported for extraembryonic ectoderm of the chorion
as early as 7.5 d.p.c. (6). Later, mGCMa expression is
confined to the labyrinth layer of the placenta and therein to
labyrinthine trophoblasts. Allantois-derived mesenchyme scores negative
for mGCMa. The labyrinthine trophoblasts form a heterogenous population
with two morphologically distinct cell types, cuboidal mononuclear
cells which are believed to possess stem cell character (35)
and elongated cells that separate fetal vessels and the maternal blood
sinuses and are believed to represent the differentiated labyrinthine
trophoblast stage. mGCMa is expressed in both the cuboidal and the
elongated cells. This mGCMa expression pattern is faithfully
recapitulated by the lacZ marker that we integrated into the
mGCMa locus as part of our gene targeting strategy down to the cellular
level. We first observed lacZ expression in the chorion
around the time of chorion-allantois fusion. Later on, the
lacZ marker was exclusively expressed in the trophoblast
cells of the labyrinth. In heterozygous normal placentas, we detected it in both cuboidal and elongated labyrinthine trophoblasts. Thus, we
believe that our lacZ marker will provide a useful tool to study fate and lineage relationships of labyrinthine trophoblasts. We
can also conclude from our observation that no essential regulatory regions are present between exon 3 and exon 6 of mGCMa, as loss of this
region did not interfere with correct spatial and temporal expression
of the lacZ marker.
In accord with the strong and selective expression of mGCMa in the
labyrinth, we found a major defect in labyrinth layer formation in the
mGCMa knockouts which impaired chorioallantoic circulation. This defect
is sufficient to explain the observed embryonic lethality. Due to their
growing size, mouse embryos start to depend on the chorioallantoic
circulation at 9.5 to 10 d.p.c., the exact time of death of the
homozygous mutant embryos.
The defect in the labyrinth layer is not due to the loss of either
chorion or allantois. In fact, both form normally. Thus, the defect in
mGCMa knockouts occurs at a later stage than the one in the Ets2
knockout, in which there are no detectable chorion and allantoic
membranes (22). Chorion and allantois were not only present;
they also fused. Chorion-allantois fusion is an important prerequisite
for formation of the labyrinth layer which is disturbed in a number of
other mouse models with placental defects including knockouts for
vascular cell adhesion molecule 1,
4 integrin, Mrj, and the nuclear
orphan receptor Err2/Err
(12, 16, 25, 42).
Following chorion-allantois fusion, the labyrinth layer forms with
allantoic mesenchyme invading the placenta, forming the fetal blood
vessels, and trophoblasts forming the three-cell-layered hemotrichorial
barrier which separates fetal blood vessels and maternal blood sinuses
and mediating the nutrient exchange. We observed severe anomalies in
the establishment and maintenance of the fetal vascular network in the
mGCMa knockouts. Allantoic blood vessels invaded the chorion in already
dramatically reduced numbers, remained near the base of the placenta,
and failed to elaborate into the vascular network typical of the
labyrinth layer. By 10.5 d.p.c., fetal blood vessels were
essentially absent from the mutant placenta and were detected only on
the outside of the placental base.
In the normal placenta, trophoblasts and mesenchyme are not only
intricately intertwined within the labyrinth layer; they also influence
each other's development. Allantoic blood vessels induce the
differentiation of the labyrinthine trophoblasts into cells of the
hemotrichorial barrier (13, 38). Labyrinthine trophoblasts,
on the other hand, express important mitogens required for normal
vasculogenesis such as vascular endothelial growth factor
(9). Defects in trophoblasts can therefore affect the development of the allantoic mesenchyme (33) and vice versa (38). With the absence of allantoic mesenchyme in the
prospective labyrinth of mGCMa-deficient mice, trophoblasts failed to
differentiate into the hemotrichorium that normally surrounds the fetal
blood vessels. Instead, trophoblasts remained densely packed except in
those regions invaded by maternal blood sinuses. Although there was a
clear reduction in trophoblasts, significant numbers remained present
and detectable.
Other processes which take place in the developing placenta, such as
the formation of the secondary giant cells and the spongiotrophoblast from the ectoplacental cone, remained unaltered. If anything, there
might have been a slight increase in the size of the spongiotrophoblast as indicated both by histological analysis and by in situ hybridization with a spongiotrophoblast-specific probe. However, given the fact that
mGCMa was not found to be expressed in the spongiotrophoblast at any
time of development, it seems likely that possible minor effects on
spongiotrophoblast development are non-cell-autonomous and secondary to
defects in the labyrinth layer.
Other mouse mutants have been described that exhibit defects in
labyrinth layer formation. In the Mash-2 mutant, for instance, the
labyrinth is not properly vascularized (11). However, in this case, it was shown that the labyrinth defect is secondary to a
failure of the spongiotrophoblast to form because of the defective
development of diploid stem cells in the ectoplacental cone
(35).
In the RXR
-RXR
double knockouts, the defect is intrinsic to the
labyrinth layer (40). In this case, a markedly decreased proliferation and hence shortage of diploid trophoblast cells is
responsible for labyrinth agenesis. After deletion of the Von Hippel-Landau tumor suppressor, allantoic vessels fail to enter the
chorion altogether (10).
The phenotype of Dlx3-deficient mice shares obvious similarities to the
phenotype described here for mGCMa in the time of embryonic death, the
reduced vascularization, and the compact morphology of the labyrinth
(28). The similarities in phenotypes are not unexpected, as
both transcription factors are expressed in the same cell type in a
temporally and spatially overlapping pattern. However, there are also
differences between the two types of knockout mice. In addition to the
labyrinth defect, Dlx3-deficient mice show a severe reduction in the
size of the spongiotrophoblast layer, which was unaffected or even
increased in size after genetic ablation of mGCMa. Furthermore, we
never observed in GCMa-deficient mice the alterations in marker gene
expression described in reference 28 for the Dlx3
knockouts. These phenotypic differences are paralleled by differences
in expression. Especially during early phases of labyrinth formation,
there are many more trophoblasts expressing Dlx3 than GCMa, with GCMa
expression increasing only at later times. Thus, Dlx3 expression is
possible in the absence of GCMa, arguing that both transcription
factors are regulated differently in the same group of cells and likely
perform separate functions.
Mice deficient for nuclear receptor PPAR
and the basic
helix-loop-helix transcription factor Tfeb have the phenotype most similar to our GCMa knockout mice (5, 33). Fetal blood
vessels invade the placenta, but rarely. Significant numbers of
chorionic trophoblasts remain detectable, but they fail to undergo
terminal differentiation in the vicinity of the fetal blood vessels.
Maternal blood sinuses are dilated. No functional labyrinth forms. At
present, it is unclear whether GCMa, Tfeb, and PPAR
are members of
the same differentiation pathway and whether they are coordinately regulated during trophoblast differentiation. Expression studies of
PPAR
and Tfeb in the mGCMa knockout (and vice versa) will clarify
this issue.
Clearly different from the effects of mGCMa ablation are the phenotypic
manifestations of Esx1, Wnt-2, and hepatocyte growth factor/scatter
factor (HGF/SF) knockouts (24, 27, 30, 38). Compared to
mGCMa, their effects become apparent only at later times of embryonic
development. The defects in the labyrinth layer are less severe. In the
HGF/SF knockout, there is a shortage of labyrinthine trophoblasts and a
concomitant increase of allantoic mesenchyme. As a consequence of this
unbalance, formation of the hemotrichorial barrier from trophoblasts is
disturbed (38). In the case of Esx1 and Wnt-2, the fetal
vasculature is affected, with reduced numbers of fetal capillaries in
the Wnt-2 knockout and aberrant branching patterns in the Esx1 knockout
(24, 27). In both latter cases, the placenta is edematous
and contains large pools of maternal blood. In the Esx1-deficient mice,
wedges of spongiotrophoblast reach deep into the labyrinth layer, while giant cells can be found in the Wnt-2 knockouts throughout the labyrinth all the way to the chorionic plate. Comparable breaches of
layer integrity have never been observed in the mGCMa knockout.
What could be the function of mGCMa in trophoblasts? As already
mentioned, the pattern of mGCMa expression in chorionic and later in
labyrinthine trophoblasts is not indicative of a role as a master
regulator of the trophoblast fate. There are many more cells that are
positive for the trophoblast-specific markers Dlx3 and GCNF in the
early placenta than there are mGCMa-expressing cells. Also, trophoblast
fate is maintained in the absence of mGCMa as evident from the
persistence of significant numbers of Dlx3- and GCNF-positive cells in
the mutant placenta.
Strikingly, mGCMa expression in labyrinthine trophoblasts correlated
well with their proximity to allantoic mesenchyme. At the time of
chorion-allantois fusion, all mGCMa-expressing cells were found in the
chorionic plate in close contact with the allantois. In the Mrj mutant,
loss of chorioallantoic fusion correlated with a strong reduction in
mGCMa expression (16). Later, mGCMa-expressing cells started
to appear in inner regions of the placenta in close association with
fetal blood vessels, with the highest levels of expression in
differentiated, syncytial trophoblasts that surround the fetal blood
vessels. Thus, it is tempting to speculate that mGCMa is part of the
existing cross-regulation between allantoic mesenchyme and
extraembryonic ectoderm that is needed to fine-tune the development of
the labyrinth layer. Our results point to an induction of mGCMa in
chorionic trophoblasts in response to an allantois-derived signal. The
existence of such signals has been documented during various phases of
placental development. Interaction of the vascular cell adhesion
molecule 1 ligand on allantoic mesenchyme with the
4 integrin
receptor on chorionic trophoblast, for instance, is an important step
during chorion-allantois fusion (12). Later on, both Wnt-2
and HGF/SF are secreted by allantoic mesenchyme and influence
development of the labyrinthine trophoblasts (27, 38).
In addition to induction of mGCMa in trophoblasts by allantoic
mesenchyme, we postulate a consecutive role for mGCMa in trophoblast differentiation, mediating changes in trophoblast gene expression that
allow vasculogenesis and that ultimately lead to the formation of the
hemotrichorial barrier around the fetal vessels. Such a model would be
compatible with most of our observations. It would explain the
localization of mGCMa- and lacZ-expressing cells. At the
time of chorioallantoic fusion, mGCMa- and lacZ-expressing cells would first be confined to the contact zone at the base of the
placenta. Later, during the period of active vessel formation, mGCMa-
and lacZ-expressing cells would spread throughout the
labyrinth of the normal placenta and dramatically increase in number
concomitant with vasculogenesis. In the mutant placenta,
lacZ-expressing cells would also appear first at the base of
the placenta. Their failure to differentiate in the absence of mGCMa
would prevent the allantoic vessels from adequately invading the
prospective labyrinth and from expanding. The base of the mutant
placenta would remain the only site where chorionic trophoblasts stay
in contact with allantoic mesenchyme and would therefore be the only
region that contains lacZ-expressing trophoblasts in the
mutant. This is indeed the case. Because lacZ expression is
lost in the mutant placenta from 12.5 d.p.c. onwards, we
furthermore have to postulate a disappearance of the inducing
mesenchymal signal. It is possible that the resorption of the mutant
conceptus is the primary cause for this disappearance. Alternatively,
the allantois-derived paracrine signal might normally be turned off at
this time of development and be replaced by a positive autoregulatory
feedback loop as has been shown to exist for Drosophila GCM
(26). Maintenance of mGCMa expression would then be
dependent on mGCMa itself, and absence of mGCMa in the mutant would
cause a gradual extinction of mGCMa expression. The existence of an
autoregulatory mechanism and the identification of additional
downstream targets will be the focus of future experiments and will
help us to understand mGCMa function in the placenta. Whether mGCMa has
an additional role at later times during development or in the adult
will be clarified only once tetraploid rescue experiments have been performed.
 |
ACKNOWLEDGMENTS |
J.S., E.R.-S., and D.R. contributed equally to the work.
We thank U. Borgmeyer for providing in situ hybridization probes. T. Mordhorst is acknowledged for expert technical assistance.
This work was supported by a grant from the Deutsche
Forschungsgemeinschaft (SFB 444) to M.W.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: ZMNH,
Martinistr. 52, D-20246 Hamburg, Germany. Phone: 49 40 42803 6274. Fax:
49 40 42803 6602. E-mail:
wegner{at}plexus.uke.uni-hamburg.de.
 |
REFERENCES |
| 1.
|
Akiyama, Y.,
T. Hosoya,
A. M. Poole, and Y. Hotta.
1996.
The gcm-motif: a novel DNA-binding motif conserved in Drosophila and mammals.
Proc. Natl. Acad. Sci. USA
93:14912-14916[Abstract/Free Full Text].
|
| 2.
|
Akiyama-Oda, Y.,
T. Hosoya, and Y. Hotta.
1998.
Alteration of cell fate by ectopic expression of Drosophila glial cells missing in non-neural cells.
Dev. Genes Evol.
208:578-585[CrossRef][Medline].
|
| 3.
|
Altshuller, Y.,
N. G. Copeland,
D. J. Gilbert,
N. A. Jenkins, and M. A. Frohman.
1996.
Gcm1, a mammalian homolog of Drosophila glial cells missing.
FEBS Lett.
393:201-204[CrossRef][Medline].
|
| 4.
|
Anderson, D. J.
1995.
A molecular switch for the neuron-glia developmental decision.
Neuron
15:1219-1222[Medline].
|
| 5.
|
Barak, Y.,
M. C. Nelson,
E. S. Ong,
Y. Z. Jones,
P. Ruiz-Lozano,
K. R. Chien,
A. Koder, and R. M. Evans.
1999.
PPAR gamma is required for placental, cardiac, and adipose tissue development.
Mol. Cell
4:585-595[CrossRef][Medline].
|
| 6.
|
Basyuk, E.,
J. C. Cross,
J. Corbin,
H. Nakayama,
P. Hunter,
B. Nait-Oumesmar, and R. A. Lazzarini.
1999.
Murine Gcm1 gene is expressed in a subset of placental trophoblast cells.
Dev. Dyn.
214:303-311[CrossRef][Medline].
|
| 7.
|
Bernardoni, R.,
A. A. Miller, and A. Giangrande.
1998.
Glial differentiation does not require a neural ground state.
Development
125:3189-3200[Abstract].
|
| 8.
|
Bernardoni, R.,
V. Vivancos, and A. Giangrande.
1997.
glide/gcm is expressed and required in the scavenger cell lineage.
Dev. Biol.
191:118-130[CrossRef][Medline].
|
| 9.
|
Dumont, D. J.,
G. H. Fong,
M. C. Puri,
G. Gradwohl,
K. Alitalo, and M. L. Breitman.
1995.
Vascularization of the mouse embryo: a study of flk-1, tek, tie, and vascular endothelial growth factor expression during development.
Dev. Dyn.
203:80-92[Medline].
|
| 10.
|
Gnarra, J. R.,
J. M. Ward,
F. D. Porter,
J. R. Wagner,
D. E. Devor,
A. Grinberg,
M. R. Emmert-Buck,
H. Westphal,
R. D. Klausner, and W. M. Linehan.
1997.
Defective placental vasculogenesis causes embryonic lethality in VHL-deficient mice.
Proc. Natl. Acad. Sci. USA
94:9102-9107[Abstract/Free Full Text].
|
| 11.
|
Guillemot, F.,
A. Nagy,
A. Auerbach,
J. Rossant, and A. L. Joyner.
1994.
Essential role of Mash-2 in extraembryonic development.
Nature
371:333-336[CrossRef][Medline].
|
| 12.
|
Gurtner, G. C.,
V. Davis,
H. Li,
M. J. McCoy,
A. Sharpe, and M. I. Cybulsky.
1995.
Targeted disruption of the murine VCAM1 gene: essential role of VCAM-1 in chorioallantoic fusion and placentation.
Genes Dev.
9:1-14[Abstract/Free Full Text].
|
| 13.
|
Hernandez-Verdun, D., and C. Legrand.
1975.
In vitro study of chorionic and ectoplacental trophoblast differentiation in the mouse.
J. Embryol. Exp. Morphol.
34:633-644[Medline].
|
| 14.
|
Hogan, B.,
B. Beddington,
F. Constantini, and E. Lacy.
1994.
Manipulating the mouse embryo.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 15.
|
Hosoya, T.,
K. Takizawa,
K. Nitta, and Y. Hotta.
1995.
glial cells missing: a binary switch between neuronal and glial determination in Drosophila.
Cell
82:1025-1036[CrossRef][Medline].
|
| 16.
|
Hunter, P. J.,
B. J. Swanson,
M. A. Haendel,
G. E. Lyons, and J. C. Cross.
1999.
Mrj encodes a DnaJ-related co-chaperone that is essential for murine placental development.
Development
126:1247-1258[Abstract].
|
| 17.
|
Janatpour, M. J.,
M. F. Utset,
J. C. Cross,
J. Rossant,
J. Dong,
M. A. Israel, and S. J. Fisher.
1999.
A repertoire of differentially expressed transcription factors that offers insight into mechanisms of human cytotrophoblast differentiation.
Dev. Genet.
25:146-157[CrossRef][Medline].
|
| 18.
|
Jones, B. W.,
R. D. Fetter,
G. Tear, and C. S. Goodman.
1995.
glial cells missing: a genetic switch that controls glial versus neuronal fate.
Cell
82:1013-1023[CrossRef][Medline].
|
| 19.
|
Kammerer, M.,
B. Pirola,
S. Giglio, and A. Giangrande.
1999.
GCMB, a second human homolog of the fly glide/gcm gene.
Cytogenet. Cell Genet.
84:43-47[CrossRef][Medline].
|
| 20.
|
Kanemura, Y.,
S. Hiraga,
N. Arita,
T. Ohnishi,
S. Izumoto,
K. Mori,
H. Matsumura,
M. Yamasaki,
S. Fushiki, and T. Yoshimine.
1999.
Isolation and expression analysis of a novel human homologue of the Drosophila glial cells missing (gcm) gene.
FEBS Lett.
442:151-156[CrossRef][Medline].
|
| 21.
|
Kim, J.,
B. W. Jones,
C. Zock,
Z. Chen,
H. Wang,
C. S. Goodman, and D. J. Anderson.
1998.
Isolation and characterization of mammalian homologs of the Drosophila gene glial cells missing.
Proc. Natl. Acad. Sci. USA
95:12364-12369[Abstract/Free Full Text].
|
| 22.
|
Klaes, A.,
T. Menne,
A. Stollwerk,
H. Scholz, and C. Klämbt.
1994.
The ETS transcription factors encoded by the Drosophila gene pointed direct glial cell differentiation in the embryonic CNS.
Cell
78:149-160[CrossRef][Medline].
|
| 23.
|
Lescisin, K. R.,
S. Varmuza, and J. Rossant.
1988.
Isolation and characterization of a novel trophoblast-specific cDNA in the mouse.
Genes Dev.
2:1639-1646[Abstract/Free Full Text].
|
| 24.
|
Li, Y., and R. R. Behringer.
1998.
Esx1 is an X-chromosome-imprinted regulator of placental development and fetal growth.
Nat. Genet.
20:309-311[CrossRef][Medline].
|
| 25.
|
Luo, J.,
R. Sladek,
J. A. Bader,
A. Matthyssen,
J. Rossant, and V. Giguere.
1997.
Placental abnormalities in mouse embryos lacking the orphan nuclear receptor ERR-beta.
Nature
388:778-782[CrossRef][Medline].
|
| 26.
|
Miller, A. A.,
R. Bernardoni, and A. Giangrande.
1998.
Positive autoregulation of the glial promoting factor glide/gcm.
EMBO J.
21:6316-6326[CrossRef].
|
| 27.
|
Monkley, S. J.,
S. J. Delaney,
D. J. Pennisi,
J. H. Christiansen, and B. J. Wainwright.
1996.
Targeted disruption of the Wnt2 gene results in placentation defects.
Development
122:3343-3353[Abstract].
|
| 28.
|
Morasso, M. I.,
A. Grinberg,
G. Robinson,
T. D. Sargent, and K. A. Mahon.
1999.
Placental failure in mice lacking the homeobox gene Dlx3.
Proc. Natl. Acad. Sci. USA
96:162-167[Abstract/Free Full Text].
|
| 29.
|
Reifegerste, R.,
J. Schreiber,
S. Gulland,
A. Ludemann, and M. Wegner.
1999.
mGCMa is a murine transcription factor that overrides cell fate decisions in Drosophila.
Mech. Dev.
82:141-150[CrossRef][Medline].
|
| 30.
|
Schmidt, C.,
F. Bladt,
S. Goedecke,
V. Brinkmann,
W. Zschiesche,
M. Sharpe,
E. Gherardi, and C. Birchmeier.
1995.
Scatter factor/hepatocyte growth factor is essential for liver development.
Nature
373:699-702[CrossRef][Medline].
|
| 31.
|
Schreiber, J.,
J. Enderich, and M. Wegner.
1998.
Structural requirements for DNA binding of GCM proteins.
Nucleic Acids Res.
26:2337-2343[Abstract/Free Full Text].
|
| 32.
|
Schreiber, J.,
E. Sock, and M. Wegner.
1997.
The regulator of early gliogenesis Glial Cells Missing is a transcription factor with a novel type of DNA-binding domain.
Proc. Natl. Acad. Sci. USA
94:4739-4744[Abstract/Free Full Text].
|
| 33.
|
Steingrimsson, E.,
L. Tessarollo,
S. W. Reid,
N. A. Jenkins, and N. G. Copeland.
1998.
The bHLH-Zip transcription factor Tfeb is essential for placental vascularization.
Development
125:4607-4616[Abstract].
|
| 34.
|
Süsens, U.,
J. B. Aguiluz,
R. M. Evans, and U. Borgmeyer.
1997.
The germ cell nuclear factor mGCNF is expressed in the developing nervous system.
Dev. Neurosci.
19:410-420[Medline].
|
| 35.
|
Tanaka, M.,
M. Gertsenstein,
J. Rossant, and A. Nagy.
1997.
Mash2 acts cell autonomously in mouse spongiotrophoblast development.
Dev. Biol.
190:55-65[CrossRef][Medline].
|
| 36.
|
Tuerk, E. E.,
J. Schreiber, and M. Wegner.
2000.
Protein stability and domain topology determine the transcriptional activity of the mammalian Glial Cells Missing homolog, GCMb.
J. Biol. Chem.
275:4774-4782[Abstract/Free Full Text].
|
| 37.
|
Tybulewicz, V. L.,
C. E. Crawford,
P. K. Jackson,
R. T. Bronson, and R. C. Mulligan.
1991.
Neonatal lethality and lymphopenia in mice with a homozygous disruption of the c-abl proto-oncogene.
Cell
65:1153-1163[CrossRef][Medline].
|
| 38.
|
Uehara, Y.,
O. Minowa,
C. Mori,
K. Shiota,
J. Kuno,
T. Noda, and N. Kitamura.
1995.
Placental defect and embryonic lethality in mice lacking hepatocyte growth factor/scatter factor.
Nature
373:702-705[CrossRef][Medline].
|
| 39.
|
Vincent, S.,
J.-L. Vonesch, and A. Giangrande.
1996.
glide directs glial fate commitment and cell fate switch between neurones and glia.
Development
122:131-139[Abstract].
|
| 40.
|
Wendling, O.,
P. Chambon, and M. Mark.
1999.
Retinoid X receptors are essential for early mouse development and placentogenesis.
Proc. Natl. Acad. Sci. USA
96:547-551[Abstract/Free Full Text].
|
| 41.
|
Wilkinson, D. G.
1992.
In situ hybridization: a practical approach.
Oxford University Press-IRL Press, Oxford, United Kingdom.
|
| 42.
|
Yang, J. T.,
H. Rayburn, and R. O. Hynes.
1995.
Cell adhesion events mediated by alpha 4 integrins are essential in placental and cardiac development.
Development
121:549-560[Abstract].
|
Molecular and Cellular Biology, April 2000, p. 2466-2474, Vol. 20, No. 7
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Simmons, D. G., Natale, D. R. C., Begay, V., Hughes, M., Leutz, A., Cross, J. C.
(2008). Early patterning of the chorion leads to the trilaminar trophoblast cell structure in the placental labyrinth. Development
135: 2083-2091
[Abstract]
[Full Text]
-
Schubert, S. W., Abendroth, A., Kilian, K., Vogler, T., Mayr, B., Knerr, I., Hashemolhosseini, S.
(2008). bZIP-Type transcription factors CREB and OASIS bind and stimulate the promoter of the mammalian transcription factor GCMa/Gcm1 in trophoblast cells. Nucleic Acids Res
36: 3834-3846
[Abstract]
[Full Text]
-
Schubert, S. W., Lamoureux, N., Kilian, K., Klein-Hitpass, L., Hashemolhosseini, S.
(2008). Identification of Integrin-{alpha}4, Rb1, and Syncytin A as Murine Placental Target Genes of the Transcription Factor GCMa/Gcm1. J. Biol. Chem.
283: 5460-5465
[Abstract]
[Full Text]
-
Kimura, A. P., Sizova, D., Handwerger, S., Cooke, N. E., Liebhaber, S. A.
(2007). Epigenetic Activation of the Human Growth Hormone Gene Cluster during Placental Cytotrophoblast Differentiation. Mol. Cell. Biol.
27: 6555-6568
[Abstract]
[Full Text]
-
Chou, C.-C., Chang, C., Liu, J.-H., Chen, L.-F., Hsiao, C.-D., Chen, H.
(2007). Small Ubiquitin-like Modifier Modification Regulates the DNA Binding Activity of Glial Cell Missing Drosophila Homolog a. J. Biol. Chem.
282: 27239-27249
[Abstract]
[Full Text]
-
Gheorghe, C. P., Mohan, S., Oberg, K. C., Longo, L. D.
(2007). Gene Expression Patterns in the Hypoxic Murine Placenta: A Role in Epigenesis?. Reproductive Sciences
14: 223-233
[Abstract]
-
Soustelle, L., Trousse, F., Jacques, C., Ceron, J., Cochard, P., Soula, C., Giangrande, A.
(2007). Neurogenic role of Gcm transcription factors is conserved in chicken spinal cord. Development
134: 625-634
[Abstract]
[Full Text]
-
Jiang, F., Herman, G. E.
(2006). Analysis of Nsdhl-deficient embryos reveals a role for Hedgehog signaling in early placental development. Hum Mol Genet
15: 3293-3305
[Abstract]
[Full Text]
-
de Bruijn, D.R.H., Peters, W.J.M., Chuva de Sousa Lopes, S.M., van Dijk, A.H.A., Willemse, M.P., Pfundt, R., de Boer, P., Geurts van Kessel, A.
(2006). Targeted disruption of the synovial sarcoma-associated SS18 gene causes early embryonic lethality and affects PPARBP expression. Hum Mol Genet
15: 2936-2944
[Abstract]
[Full Text]
-
Gheorghe, C., Moham, S., Longo, L. D.
(2006). Gene Expression Patterns in the Developing Murine Placenta. Reproductive Sciences
13: 256-262
[Abstract]
-
Urano, Y., Iiduka, M., Sugiyama, A., Akiyama, H., Uzawa, K., Matsumoto, G., Kawasaki, Y., Tashiro, F.
(2006). Involvement of the Mouse Prp19 Gene in Neuronal/Astroglial Cell Fate Decisions. J. Biol. Chem.
281: 7498-7514
[Abstract]
[Full Text]
-
Chuang, H.-C., Chang, C.-W., Chang, G.-D., Yao, T.-P., Chen, H.
(2006). Histone deacetylase 3 binds to and regulates the GCMa transcription factor. Nucleic Acids Res
34: 1459-1469
[Abstract]
[Full Text]
-
Chang, C.-W., Chuang, H.-C., Yu, C., Yao, T.-P., Chen, H.
(2005). Stimulation of GCMa Transcriptional Activity by Cyclic AMP/Protein Kinase A Signaling Is Attributed to CBP-Mediated Acetylation of GCMa. Mol. Cell. Biol.
25: 8401-8414
[Abstract]
[Full Text]
-
Baumber, L, Tufarelli, C, Patel, S, King, P, Johnson, C A, Maher, E R, Trembath, R C
(2005). Identification of a novel mutation disrupting the DNA binding activity of GCM2 in autosomal recessive familial isolated hypoparathyroidism. J. Med. Genet.
42: 443-448
[Full Text]
-
Yang, C.-S., Yu, C., Chuang, H.-C., Chang, C.-W., Chang, G.-D., Yao, T.-P., Chen, H.
(2005). FBW2 Targets GCMa to the Ubiquitin-Proteasome Degradation System. J. Biol. Chem.
280: 10083-10090
[Abstract]
[Full Text]
-
Dupressoir, A., Marceau, G., Vernochet, C., Benit, L., Kanellopoulos, C., Sapin, V., Heidmann, T.
(2005). Syncytin-A and syncytin-B, two fusogenic placenta-specific murine envelope genes of retroviral origin conserved in Muridae. Proc. Natl. Acad. Sci. USA
102: 725-730
[Abstract]
[Full Text]
-
Schubert, S. W., Kardash, E., Khan, M. A., Cheusova, T., Kilian, K., Wegner, M., Hashemolhosseini, S.
(2004). Interaction, Cooperative Promoter Modulation, and Renal Colocalization of GCMa and Pitx2. J. Biol. Chem.
279: 50358-50365
[Abstract]
[Full Text]
-
Begay, V., Smink, J., Leutz, A.
(2004). Essential Requirement of CCAAT/Enhancer Binding Proteins in Embryogenesis. Mol. Cell. Biol.
24: 9744-9751
[Abstract]
[Full Text]
-
Lotz, K., Pyrowolakis, G., Jentsch, S.
(2004). BRUCE, a Giant E2/E3 Ubiquitin Ligase and Inhibitor of Apoptosis Protein of the trans-Golgi Network, Is Required for Normal Placenta Development and Mouse Survival. Mol. Cell. Biol.
24: 9339-9350
[Abstract]
[Full Text]
-
Brodsky, D., Christou, H.
(2004). Current Concepts in Intrauterine Growth Restriction. J Intensive Care Med
19: 307-319
[Abstract]
-
Hashemolhosseini, S., Wegner, M.
(2004). Impacts of a new transcription factor family: mammalian GCM proteins in health and disease. J. Cell Biol.
166: 765-768
[Abstract]
[Full Text]
-
Milchanowski, A. B., Henkenius, A. L., Narayanan, M., Hartenstein, V., Banerjee, U.
(2004). Identification and Characterization of Genes Involved in Embryonic Crystal Cell Formation During Drosophila Hematopoiesis. Genetics
168: 325-339
[Abstract]
[Full Text]
-
Moser, M., Li, Y., Vaupel, K., Kretzschmar, D., Kluge, R., Glynn, P., Buettner, R.
(2004). Placental Failure and Impaired Vasculogenesis Result in Embryonic Lethality for Neuropathy Target Esterase-Deficient Mice. Mol. Cell. Biol.
24: 1667-1679
[Abstract]
[Full Text]
-
Kronenberg, H. M.
(2004). GCMB--Another Serendipitous Gift from Evolution to Clinical Investigators. J. Clin. Endocrinol. Metab.
89: 6-7
[Full Text]
-
Maret, A., Bourdeau, I., Ding, C., Kadkol, S. S., Westra, W. H., Levine, M. A.
(2004). Expression of GCMB by Intrathymic Parathyroid Hormone-Secreting Adenomas Indicates Their Parathyroid Cell Origin. J. Clin. Endocrinol. Metab.
89: 8-12
[Abstract]
[Full Text]
-
Rodriguez, T. A., Sparrow, D. B., Scott, A. N., Withington, S. L., Preis, J. I., Michalicek, J., Clements, M., Tsang, T. E., Shioda, T., Beddington, R. S. P., Dunwoodie, S. L.
(2004). Cited1 Is Required in Trophoblasts for Placental Development and for Embryo Growth and Survival. Mol. Cell. Biol.
24: 228-244
[Abstract]
[Full Text]
-
Iwasaki, Y., Hosoya, T., Takebayashi, H., Ogawa, Y., Hotta, Y., Ikenaka, K.
(2003). The potential to induce glial differentiation is conserved between Drosophila and mammalian glial cells missing genes. Development
130: 6027-6035
[Abstract]
[Full Text]
-
Calestani, C., Rast, J. P., Davidson, E. H.
(2003). Isolation of pigment cell specific genes in the sea urchin embryo by differential macroarray screening. Development
130: 4587-4596
[Abstract]
[Full Text]
-
Nait-Oumesmar, B., Stecca, B., Fatterpekar, G., Naidich, T., Corbin, J., Lazzarini, R. A.
(2003). Ectopic expression of Gcm1 induces congenital spinal cord abnormalities. Development
129: 3957-3964
[Abstract]
[Full Text]
-
Mo, F.-E, Muntean, A. G., Chen, C.-C., Stolz, D. B., Watkins, S. C., Lau, L. F.
(2002). CYR61 (CCN1) Is Essential for Placental Development and Vascular Integrity. Mol. Cell. Biol.
22: 8709-8720
[Abstract]
[Full Text]
-
Yu, C., Shen, K., Lin, M., Chen, P., Lin, C., Chang, G.-D., Chen, H.
(2002). GCMa Regulates the Syncytin-mediated Trophoblastic Fusion. J. Biol. Chem.
277: 50062-50068
[Abstract]
[Full Text]
-
Cross, J. C., Anson-Cartwright, L., Scott, I. C.
(2002). Transcription Factors Underlying the Development and Endocrine Functions of the Placenta. Recent Prog Horm Res
57: 221-234
[Abstract]
[Full Text]
-
Paratore, C., Goerich, D. E., Suter, U., Wegner, M., Sommer, L.
(2001). Survival and glial fate acquisition of neural crest cells are regulated by an interplay between the transcription factor Sox10 and extrinsic combinatorial signaling. Development
128: 3949-3961
[Abstract]
[Full Text]
-
Mudgett, J. S., Ding, J., Guh-Siesel, L., Chartrain, N. A., Yang, L., Gopal, S., Shen, M. M.
(2000). Essential role for p38alpha mitogen-activated protein kinase in placental angiogenesis. Proc. Natl. Acad. Sci. USA
10.1073/pnas.180316397v1
[Abstract]
[Full Text]
-
Mudgett, J. S., Ding, J., Guh-Siesel, L., Chartrain, N. A., Yang, L., Gopal, S., Shen, M. M.
(2000). Essential role for p38alpha mitogen-activated protein kinase in placental angiogenesis. Proc. Natl. Acad. Sci. USA
97: 10454-10459
[Abstract]
[Full Text]