Previous Article | Next Article 
Molecular and Cellular Biology, April 2000, p. 2569-2580, Vol. 20, No. 7
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Promoter-Proximal Pausing on the hsp70
Promoter in Drosophila melanogaster Depends on the
Upstream Regulator
Hongbing
Tang,
Yingyun
Liu,
Lakshmi
Madabusi, and
David S.
Gilmour*
Center for Gene Regulation, Department of
Biochemistry and Molecular Biology, The Pennsylvania State
University, University Park, Pennsylvania 16802
Received 15 September 1999/Returned for modification 4 November
1999/Accepted 10 January 2000
 |
ABSTRACT |
RNA polymerase II pauses in the promoter-proximal region of many
genes during transcription. In the case of the hsp70
promoter from Drosophila melanogaster, this pause is
long-lived and occurs even when the gene is not induced. Paused
polymerase escapes during heat shock when the transcriptional activator
heat shock factor associates with the promoter. However, pausing is
still evident, especially when induction is at an intermediate
level. Yeast Gal4 protein (Gal4p) will induce transcription of the
hsp70 promoter in Drosophila when binding sites
for Gal4p are positioned upstream from the hsp70 TATA
element. To further our understanding of promoter-proximal pausing, we
have analyzed the effect of Gal4p on promoter-proximal pausing in
salivary glands of Drosophila larvae. Using permanganate genomic footprinting, we observed that various levels of Gal4p induction resulted in an even distribution of RNA polymerase throughout the first 76 nucleotides of the transcribed region. In contrast, promoter-proximal pausing still occurs on endogenous and transgenic hsp70 promoters in salivary glands when these promoters are
induced by heat shock. We also determined that mutations introduced
into the region where the polymerase pauses do not inhibit pausing in a
cell-free system. Taken together, these results indicate that
promoter-proximal pausing is dictated by the regulatory proteins interacting upstream from the core promoter region.
 |
INTRODUCTION |
Gene expression can be regulated at
the level of transcriptional elongation in metazoans (24,
43). There are possibly several distinct mechanisms of elongation
control. Transcription reconstitution studies with purified components
provide evidence for a TFIIH-dependent phase in elongation that occurs
8 to 14 nucleotides downstream from the transcription start site
(9, 10, 20). The ability to transcribe the entire length of
a gene could be under the control of activators that bind near the promoter of the gene (3, 55). In the case of the human
immunodeficiency virus (HIV) promoter, the virally encoded factor Tat
modifies the polymerase to a highly processive form so that the
polymerase is able to transcribe the entire 10 kb of the HIV genome
(54).
For numerous genes, RNA polymerase has been found to pause while
elongating 20 to 50 nucleotides downstream from the transcription start
site (5, 14, 19, 30, 34). The best-characterized example is
the hsp70 heat shock gene promoter of Drosophila
melanogaster (24). Under normal growth conditions when
the gene is not being actively transcribed, RNA polymerase is found
paused in a region 20 to 40 nucleotides downstream from the
transcription start site. Analysis of the pause in vitro indicates that
the polymerase can remain stably paused for at least 30 min
(23). This gene is rapidly induced in response to heat
shock, and induction is dependent on binding during heat shock of heat
shock factor (HSF) to numerous sites located upstream from the TATA
element. Even under induced conditions, paused polymerase is evident
(14, 33). This suggests that pausing remains rate limiting
and that the release of paused polymerase is the target of HSF. Not
surprisingly, genomic footprinting analysis shows that TFIID is also
associated with the promoter before and during heat shock (14,
51).
The basis for promoter-proximal pausing is not known. Sequences located
upstream and downstream from the TATA element of the hsp70
promoter contribute to the level of paused polymerase in vivo (22,
51). Mutation of a GAGA element in the upstream region of
hsp70 decreased the level of paused polymerase by fourfold. GAGA factor, which binds the GAGA element, has been shown to remodel chromatin and may be involved in rendering the DNA in chromatin accessible to the transcriptional machinery (41, 45, 46). Successive deletions of sequences downstream from the hsp70
TATA box also diminished the level of paused polymerase
(22). One significant difficulty in assessing the relevance
of these observations to pausing is that these mutations also inhibit
initiation. In vitro, the region downstream from the TATA element
contributes to binding of TFIID (35). The region upstream
from the TATA box, which contains the GAGA elements, contributes to
initiation (23). Therefore, the decrease in paused
polymerase caused by the mutations might be due to effects on
initiation rather than direct effects on elongation.
To obtain more insight into the mechanism of promoter-proximal pausing,
we have examined the behavior of polymerase on the hsp70
promoter when the promoter is placed under control of the yeast
activator Gal4p. Flies producing the yeast activator Gal4p have been
widely used to drive expression of genes placed downstream from an
hsp70 core promoter flanked by five Gal4p binding sites (4). In addition, a variety of other activators have been
found to induce transcription of the hsp70 promoter when
binding sites for the activators are substituted for the regulatory
region normally found upstream from the TATA box (1, 2, 16, 17,
48). A key question we wanted to address was whether there would
be any evidence of paused polymerase in the presence or absence of Gal4p, as is the case for the normal hsp70 promoter before
and after heat shock induction.
 |
MATERIALS AND METHODS |
DNA constructs and transgenic flies.
A promoter construct
fusing five Gal4p binding sites upstream from the hsp70
promoter at position
44 was generated by PCR. The five Gal4p binding
sites were derived from the plasmid pG5E4T (7), and the
hsp70 promoter region spanning position
44 to +84 was
derived from the plasmid 70ZT (
194/+84) (50). The promoter fragment was placed upstream from the
-galactosidase-encoding sequences found in the transformation vector Car20ZT.2 (50). A large fragment containing the new promoter construct was transferred into a second transformation vector called CaSpeR (44). The fragment that was transferred encompassed most of the rosy gene followed by the new promoter region and then by
-galactosidase-encoding sequences. The final plasmid called pG5-70w
was transformed into yw flies and expression of the white gene was used
as a selectable marker for transformation. Four transformed lines were
established (see Fig. 5 for comparison of promoter activities), and two
were studied in detail by permanganate footprinting. The fly lines were
designated G5-70w.
Two Gal4p-expressing lines were used in this study. hs-GAL42-1 has a
heat shock-inducible version of the Gal4p gene located on chromosome
III. Mz-1087.hx has an enhancer trap version of the gene located on the
X chromosome, and it is expressed most strongly in salivary glands.
-Galactosidase assays.
-Galactosidase activity was
measured using the chromogenic substrate CPRG as previously described
(42). In some cases, the salivary glands were removed with
fine forceps prior to homogenizing the remaining larval tissues.
Genomic footprinting with potassium permanganate.
Genomic
footprinting was performed as previously described (51). In
all cases presented here, the glands were treated for 2 min with 40 mM
potassium permanganate. Purified genomic DNA (naked DNA) was treated
for 0, 30, and 90 s to assess the reactivity of the DNA in the
absence of proteins. The primers TR-1, TR-2, and TR-3 were used to
detect permanganate modifications on the nontranscribed strand of the
transgene in the region spanning positions
150 to +70. The primers
Endo A, Endo B, and Endo C were used to detect permanganate
modifications on the nontranscribed strand of the endogenous
hsp70 promoter.
A new set of primers (TR-4, TR-5, and TR-6) was developed for detecting
polymerase between positions +1 and +266. This set
of primers spans
sequences from position +303 to +267, meaning
that the primers reside
in the

-galactosidase coding region of
the transgene. The sequences
and annealing temperatures (in parentheses)
of the primers used in the
PCR were as follows: TR-4, CTTCTGGTGCCGGAAACCAG
(60°C);
TR-5 GCCGGAAACCAGGCAAAGCG (65°C); and TR-6
CCAGGCAAAGCGCCATTCGCC
(68°C).
Permanganate analysis of cell-free transcription reactions.
Mutations were introduced into the hsp70 promoter region
spanning positions
194 to +84 using standard oligonucleotide-directed mutagenesis procedures. Each mutant was sequenced to verify its composition, and all DNA preparations were purified by CsCl
centrifugation (38). Reconstitution of pausing in a nuclear
extract from Drosophila embryos and permanganate analysis
were performed as previously described (23).
 |
RESULTS |
Gal4p induces expression of an hsp70-
-galactosidase
transgene with no evidence of promoter-proximal pausing.
Previously, we showed that paused polymerase could be detected on an
hsp70 promoter that had been introduced into the fly by P
element-mediated transformation (51). The paused polymerase was detected by performing genomic footprinting on salivary glands with
potassium permanganate. Permanganate preferentially oxidizes thymines
situated in single-stranded regions of DNA, such as those associated
with a transcription bubble (14, 49). We showed that a
transgene containing the promoter region from positions
194 to +84
had a level of paused polymerase comparable to that of the endogenous
hsp70 promoter. Deletion of the region upstream from the
TATA element greatly diminished the level of paused polymerase.
To examine the influence of Gal4p, we used the strategy shown in Fig.
1. Five binding sites for Gal4p were
substituted for
the region upstream from the
hsp70 TATA box
where GAGA factor
and HSF normally bind. The
hsp70 sequences
were fused with the
coding region for

-galactosidase at position
+84. Transgenic
lines carrying the target were produced by P
element-mediated
transformation. Importantly, this procedure stably
integrates
a single copy of the transgene into the fly genome.
Flies from
lines carrying the target were mated with flies from
lines expressing
the Gal4p activator (hs-GAL42-1 or Mz-1087.hx) so that
Gal4p and
the target would be present in the progeny. Salivary glands
were
dissected from third-instar larvae and treated for 2 min with
potassium permanganate. Piperidine treatment cleaved the DNA backbone
at the oxidized thymines, and sites of cleavage were determined
using
ligation-mediated PCR.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 1.
Overview of the experimental approach. To place the
hsp70 core promoter under the control of the Gal4p
activator, sequences normally found upstream from the TATA box of
hsp70 beginning at position 44 were replaced with five
binding sites for the yeast Gal4p activator. The fusion of sequences
encoding -galactosidase was made at position +84. Transgenic flies
containing this construct were mated with flies that expressed the
yeast Gal4p activator. Two Gal4p-expressing lines of flies were used in
this study. hsGAL42-1 is a fly line that has the Gal4p gene under the
control of the hsp70 heat shock gene promoter. Mz-1087.hx is
an enhancer trap fly line that specifically expresses Gal4p in salivary
glands. In this case, the Gal4p gene resides on the X chromosome. The
salivary glands of third-instar larvae from various matings were
analyzed by permanganate genomic footprinting. The glands were
dissected from the larvae and treated for 2 min with 40 mM
permanganate. Genomic DNA was isolated and heated with piperidine to
cleave the DNA backbone at oxidized thymine residues. The pattern of
cleavage was then determined by ligation-mediated PCR.
|
|
The results shown in Fig.
2 demonstrate
that permanganate detects RNA polymerase on the
hsp70 target
only when Gal4p is present.
In this case, synthesis of Gal4p in the
larvae was induced by
heat shock. Strong permanganate hyperreactivity
was evident when
larvae containing the Gal4p gene were heat shocked for
30 min
followed by a 1-h period of recovery at room temperature (Fig.
2, lanes 8 and 10). This permanganate hyperreactivity was not
observed
when larvae were not subjected to heat shock (Fig.
2,
lanes 7 and 9) or
when the larvae lacked the Gal4p gene altogether
(Fig.
2, lanes 5 and
6). Similar results were obtained for two
fly lines (designated line 1 and line 2) in which the targets
were in different locations in the
genome. Note that the binding
sites for HSF in the target gene were
replaced by binding sites
for Gal4p. Hence, the target gene was no
longer inducible by heat
shock in the absence of Gal4p.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 2.
Recruitment of polymerase by heat shock-inducible Gal4p.
The pattern of G/A cleavage is shown (lane 1); the pattern of
permanganate reactivity was assessed for protein-free DNA (lanes 2 through 4) and for salivary glands from larvae that lacked Gal4p (lanes
5 and 6) or contained a heat shock-inducible Gal4p (lanes 7 through 10). The designations line 1 and line 2 refer to two separate
fly lines that carry the same target construct in different locations
in the genome. Samples in lanes 5 and 6 provide a control for the
effects of heat shock in the absence of the heat shock-inducible Gal4p
gene. Samples in lanes 7 and 9 were derived from larvae that had
not been subjected to heat shock;consequently, they did not
express Gal4p. Samples in lanes 8 and 10 were derived from the larvae
that had been subjected to a 30-min heat shock and were then allowed to
recover from heat shock for 1 h. During this time, Gal4p was
expressed and induced expression of the target gene. The numbers
identify thymines on the nontranscribed strand located downstream
from the transcription start site. The label "5 UAS" indicates the
Gal4p binding sites, and the TATA box is also shown. Asterisks
indicate nucleotides at which decreased permanganate reactivity was
observed. NH, non-heat-shocked larvae; HS, heat-shocked larvae.
|
|
Close inspection of the permanganate patterns in the region
encompassing the Gal4p binding sites suggests that this region
could be
associated with something in the absence of Gal4p. We
have highlighted
three thymine residues in Fig.
2, lanes 5 and
6, that are
hyperreactive to permanganate. We do not know what
causes this
hyperreactivity, but it is clear that the source does
not cause
recruitment of RNA polymerase in the absence of Gal4p.
This activity
should not significantly influence the conclusions
we draw from the
work presented here; it does, however, complicate
any conclusions that
might be made concerning the mechanism by
which Gal4p interacts with a
chromatin template in vivo. We also
note that the interaction of Gal4p
with the five binding sites
seems to be evident when Gal4p is present.
This is suggested by
the decrease in permanganate reactivity at some
nucleotides (Fig.
2, compare lanes 7 and 9 to lanes 8 and
10).
We were intrigued that any evidence of paused polymerase seemed to be
lacking from the pattern of permanganate reactivity.
Permanganate
reactivity at sites flanking each side of the region
from positions +20
to +40 was equal to or greater than that apparent
in the region where
polymerase normally pauses. This was unexpected,
since previous work on
the
hsp70 promoter indicated that pausing
occurs even when
the
hsp70 promoter is induced (
14,
33).
Pausing persists on the normal hsp70 promoter in
salivary glands after heat shock induction.
Lis and O'Brien
previously reported that a higher density of the polymerase resided in
the promoter region of hsp70 than in regions further
downstream when Drosophila cells were subjected to an
intermediate heat shock (33). This suggested that pausing persisted on the endogenous hsp70 promoter as a
rate-limiting step, even under conditions of induction. The results of
this previous work contrasted with what we observed for Gal4p. Since the previous work was performed with Drosophila tissue
culture cells, we were concerned that the endogenous hsp70
promoter might behave differently in salivary gland cells. Therefore,
we examined the distribution of polymerase on the endogenous
hsp70 promoter in salivary glands after larvae had been
induced at intermediate heat shock temperatures. The results shown in
Fig. 3 indicate that pausing occurs at
intermediate levels of induction. In every case, the level of
permanganate reactivity at positions +8 and +67 was less than the
level of reactivity at position +22 (Fig. 3, lanes 5 to 8). Even when
the endogenous hsp70 gene was fully induced, the reactivity
at position +67 was less than the reactivity at position +22 (Fig. 3,
lane 8).

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 3.
Permanganate footprinting analysis of the normal
hsp70 promoter induced at various temperatures. The pattern
of G/A cleavage is shown (lane 1), as is the pattern of permanganate
reactivity of protein-free DNA (lanes 2 to 4). The effects of inducing
the endogenous hsp70 promoter at various temperatures were
evaluated. Larvae were incubated at 25, 29, 33, or 37°C (lanes 5 through 8, respectively) for 30 min and then immediately subjected to
permanganate analysis (no period of recovery was allowed).
|
|
The pattern of permanganate reactivity for the Gal4p-induced
hsp70 promoter also seemed to differ from what had been
observed
previously for a heat shock-inducible transgenic version of
the
hsp70 promoter (
51). We refer to the heat
shock-inducible transgene
from the above-mentioned previous study as an
HSF-inducible transgene
in order to avoid confusing it with the heat
shock-inducible form
of Gal4p. The HSF-inducible transgenic promoter
spanned the region
from positions

194 to +84 and contained numerous
GAGA elements
and heat shock elements located upstream from the TATA
box. To
directly compare this transgenic promoter to the
Gal4p-inducible
one and to extend our previous work, we developed a set
of ligation-mediated
PCR (LM-PCR) primers that allowed us to compare
the pattern of
permanganate reactivity from the transcription start
site to position
+266.
The permanganate reactivity of the Gal4p- and HSF-inducible promoters
is shown in Fig.
4. We examined the
promoters under
induced and noninduced conditions. Several interesting
differences
are evident. First, there is clearly an activator-dependent
increase
in permanganate reactivity at numerous sites downstream from
position
+60 for both promoters. For example, bands at positions +67,
+147,
+207, and +262 are readily detected above background, as shown
in
Fig.
4, lanes 6, 8, 14, and 16, but not in Fig.
4, lanes 5,
7, 13, and
15. Since these bands correlate with transcriptional
activation, they
are most likely due to elongation complexes distributed
throughout the
first 260 nucleotides of the transcription unit.

View larger version (82K):
[in this window]
[in a new window]
|
FIG. 4.
Comparison of permanganate reactivity associated with
the Gal4-induced hsp70 transgene and an HSF-induced
hsp70 transgene. Patterns of G/A cleavage are shown (lanes 1 and 9), as are patterns of reactivity of protein-free DNA (lanes 2 through 4 and 10 through 12). The HSF-inducible transgene contains the
hsp70 promoter region spanning positions 194 to +84. Its
permanganate reactivity under active (lanes 8 and 16) and inactive
(lanes 7 and 15) conditions was compared to that of the Gal4p-inducible
promoter under active (lanes 6 and 14) and inactive (lanes 5 and 13)
conditions. Both constructs are identical in sequence over the region
extending downstream from position 44. Gal4p-induction was done as
described for Fig. 2. Heat shock induction of the transgene at position
194 was done by incubating larvae for 20 min in a 37°C incubator
prior to dissecting the salivary glands. The products of the LM-PCR
were run for two different lengths of time so as to view the entire
region from positions +1 to +266. The numbers identify thymines. Many
are hyperreactive only under induced conditions, suggesting that they
are hyperreactive because of elongation complexes.
|
|
The intensities of most of the bands downstream from position +60 for
the two induced promoters are similar. This suggests
that similar
densities of polymerase are located in the region
distal to
promoter-proximal pausing. In contrast, comparison of
the permanganate
reactivity in the first 53 nucleotides for the
induced versions of the
two promoters suggests that the polymerase
is distributed differently
in this region (Fig.
4, compare lanes
6 and 8 and lanes 14 and 16). In
the case of Gal4p induction,
permanganate reactivity at position +8 is
greater than the permanganate
reactivity at position +22, whereas the
reactivity at these two
sites is equal for the HSF-induced promoter.
Also, the reactivity
at position +53 is equal to the reactivity at
position +30 for
the Gal4p-induced promoter, whereas the reactivity at
position
+53 is less than the reactivity at position +30 for the
HSF-induced
promoter. The results for the HSF-inducible promoter agree
with
observations reported previously (
51). These results
are consistent
with there being paused polymerase on the HSF-induced
promoter
but not on the Gal4p-induced promoter. We note that
intermediate
heat shock treatments of the HSF-inducible promoter
yielded results
similar to those presented in Fig.
3 for the endogenous
hsp70 promoter (data not
shown).
Comparison of the permanganate reactivity in the first 53 nucleotides
of the inactive versions of the Gal4p- and HSF-inducible
promoters
shows striking differences in permanganate reactivity
(Fig.
4, compare
lane 5 to 7). Under the noninduced conditions,
the permanganate
reactivity at positions +22 and +30 for the HSF-inducible
promoter is
greater than the permanganate reactivity for the Gal4p-inducible
promoter. The pattern for the HSF-inducible promoter indicates
that
paused polymerase is present before induction, whereas the
pattern for
the Gal4p-inducible promoter indicates that polymease
is absent before
induction.
Induction by Gal4p to intermediate levels occurs without
promoter-proximal pausing.
Since pausing was readily detected at
intermediate levels of heat shock induction of the HSF-inducible
promoter (Fig. 3 and data not shown), we wondered if such pausing might
be apparent under conditions of intermediate induction by Gal4p. The
fly line Mz-1087.hx offered an opportunity to explore this. Mz-1087.hx is an enhancer trap line that has the Gal4p gene inserted on the X
chromosome (57). Moreover, Gal4p appears to be expressed
only in the salivary glands. Dosage compensation appears to cause the level of Gal4p expressed in males to be twice that in females. That
this is so is indicated by the comparison of
-galactosidase activity
detected in male and female larvae containing one copy of the Gal4p
gene on the X chromosome and one copy of our target gene on an
autosome. The level of
-galactosidase activity provides an
indirect measurement of the level of transcription. As shown in Fig. 5, the level of
-galactosidase
in males is approximately twice that found in females for the target
gene when it is located in four different chromosomal locations.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 5.
-Galactosidase expression in male and female larvae
suggests dosage compensation for the Gal4p gene located on the X
chromosome. The graph shows levels of -galactosidase activity
detected in lysates derived from larvae. The negative control is a
lysate derived from a fly line lacking any transgenes. The female and
male controls are lysates derived from larvae after the salivary glands
had been removed. The larvae contained both the target gene and the
Gal4p gene. The low level of -galactosidase activity observed in
these controls indicates that most of the expression occurs in the
salivary glands. This has been confirmed by staining tissues for
-galactosidase activity (data not shown). The remaining whole-larvae
lysates are derived from larvae that contain both the target gene and
the Gal4p gene. Note that these lysates included the salivary glands.
All measurements have been normalized for protein concentration in the
lysates.
|
|
We performed permanganate footprinting on salivary glands from male and
female larvae to determine how different levels of
Gal4p
influenced the interaction of RNA polymerase II. We observed
that the
level of permanganate reactivity was approximately two
times higher in
males than in females (Fig.
6, compare
lanes 2
and 5 to lanes 3 and 6). Although the reactivity detected in
females
is quite low, it was clearly greater than the background that
occurs in the absence of Gal4p (Fig.
6, lanes 1 and 4). Significantly,
the pattern of permanganate reactivity gave no indication that
promoter-proximal pausing was occurring. If promoter-proximal
pausing
were occurring, we would have expected strong permanganate
reactivity
at positions +22, +30, and +34 and little or no reactivity
elsewhere
(for example, Fig.
3, lane 5). Instead, the level of
permanganate
reactivity throughout the region from positions +8
to +67 was quite
even.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 6.
Dosage-compensated Gal4p. Pausing is not evident at the
hsp70 promoter when activation is mediated by a moderate
level of Gal4p. The hsp70 target promoter was induced by
Gal4p expressed from an enhancer trap located on the X chromosome. Due
to dosage compensation, the amount of Gal4p produced in males is
expected to be twice that detected in females. Lanes 1 and 4, samples
derived from larvae that contained only the target gene and no Gal4p;
Lanes 2 and 5, samples derived from female larvae that contained both
the target gene and an X-linked Gal4p gene; lanes 3 and 6, samples
derived from male larvae that contained both the target gene and an
X-linked Gal4p gene.
|
|
Various physiological conditions used to modulate the level of
Gal4p-dependent induction did not alter behavior of endogenous
hsp70 promoter.
We have identified three different
levels of Gal4p induction that do not appear to be accompanied by
promoter-proximal pausing. This is in contrast to the behavior of the
endogenous promoter or an HSF-inducible transgenic promoter (Fig. 3 and
4). However, the physiology associated with these three different
conditions of Gal4p induction could be quite different: male versus
female and recovery from heat shock versus no heat shock. We were
concerned that these physiological differences might introduce
additional variables into the experiment. Therefore, we examined the
pattern of permanganate reactivity on the endogenous hsp70
promoter by analyzing the same set of DNA preparations for which
results are shown in Fig. 2 and 6 with LM-PCR primers that were
specific for the endogenous gene. As shown in Fig.
7, there was no significant difference
between the patterns of permanganate reactivity. Notably, paused
polymerase was present on the endogenous hsp70 promoter in
each case. The pattern and intensity of permanganate reactivity in
larvae that had been allowed to recover for 1 h from a heat shock
(Fig. 7, lanes 2, 4, and 6) were similar to those found in larvae that
had not been heat shocked (Fig. 7, lanes 1, 3, and 5). The 1-h recovery
appears to have been sufficient to reset the hsp70 promoter
to the uninduced state. Also, there was no difference in the pattern or
intensity of reactivity observed between males and females (Fig. 7,
lanes 7 to 12). We conclude that the behavior of the Gal4p-inducible
transgene is being influenced by differences in the level of Gal4p and
not by other physiological differences.

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 7.
Endogenous hsp70. Different physiological
conditions do not alter the behavior of the endogenous hsp70
promoter. Portions of DNA from samples shown in Fig. 2 and 6 were
analyzed so that the endogenous hsp70 promoter could be
seen. Note that the heat-shocked larvae were allowed to recover for
1 h before the dissections. The promoters had returned to the
uninduced state. Lanes 1 to 6 correspond respectively to DNA from
samples shown in lanes 5 to 10 of Fig. 2. Lanes 7 to 12 correspond
respectively to DNA from samples shown in lanes 1 to 6 in Fig. 6. The
results for naked DNA are not shown, but they were identical to the
results shown in Fig. 3. NH, non-heat-shocked larvae; HS & R,
heat-shocked larvae allowed to recover; C, control; F, female; M,
male.
|
|
Mutations in promoter-proximal region did not inhibit
promoter-proximal pausing in a cell-free system.
Our results
suggest that the upstream regulator plays a significant role in
dictating whether pausing occurs in the promoter-proximal region. We were interested in determining if sequences in the region where the polymerase pauses were essential for promoter-proximal pausing. Previous work addressing this issue had relied on the analysis
of various 3' deletions (22, 23). One problem with these
studies is that the more severe 3' deletions affected several contacts
made by TFIID, so these mutations significantly reduced initiation
(11, 47). Therefore, we analyzed the effect of several
localized mutations placed in various places where the polymerase
pauses. The effects of these mutations were assessed in a cell-free
system (23). As shown in Fig.
8, promoter-proximal pausing was evident
on all the mutant promoters. Various hsp70 promoter
constructs were incubated in a nuclear extract from non-heat-shocked embryos. To detect paused polymerase, the reactions were treated with
permanganate. The oxidized thymines were monitored by a primer extension reaction using Taq polymerase (49). On
a normal promoter, permanganate hyperreactivity is evident at positions
+22 and +30 when the transcription reaction is done in the presence of
all four ribonucleotides (Fig. 8, lane 4). The presence of
alpha-amanitin diminishes the level of reactivity at positions +22 and
+30 but increases the reactivity at position +3 (Fig. 8, lane 3).
Alpha-amanitin inhibits elongation and traps the polymerase in an open
complex at the transcription start. Similar results were obtained for each of the mutants. Changes in the pattern of permanganate reactivity are due to changes in the location of thymine residues. It should be
noted that a deletion of the TATA box eliminates all of the permanganate hyperreactive sites observed in Fig. 8, lanes 3 and 4, presumably because this deletion blocks initiation (26).

View larger version (98K):
[in this window]
[in a new window]
|
FIG. 8.
Mutations in the promoter-proximal region do not
eliminate pausing on the hsp70 promoter in a cell-free
system. Purified plasmid DNA containing mutations in the
hsp70 promoter region were incubated in a nuclear extract
from non-heat-shocked Drosophila embryos. Following a 30-min
incubation, the samples were treated with permanganate. The pattern of
permanganate reactivity was then determined by primer extension with
Taq polymerase. Lane 1, material recovered from the nuclear
extract when no template was added to the extract; lanes 2, 5, 8, 11, and 14, the background of bands detected for each template when no
nucleotide triphosphates were added to the transcription reaction;
lanes 3, 6, 9, 12, and 15, the results when alpha-amanitin was present
at a concentration of 5 µg/ml during the transcription reaction (all
of the promoters exhibited an increase in permanganate reactivity at
position +3 due to the formation of an open complex); lanes 4, 7, 10, 13, and 16, the results when all four nucleotide triphosphates were
present during the transcription reaction. All of the promoters
exhibited an increase in permanganate reactivity at thymines situated
in the region 20 to 40 nucleotides downstream from the start site
(designated by asterisks). The pattern of permanganate reactivity for
different promoters varied because the mutations changed the location
of some of the thymine residues. The results shown are representative
of three experiments performed on these promoters. Part of the sequence
of each mutant is shown at the bottom. Each of the promoter encompassed
sequences from positions 184 to +84.
|
|
 |
DISCUSSION |
We have analyzed the effect of the yeast Gal4p activator on the
interaction between RNA polymerase II and the hsp70 promoter in vivo. We detected a Gal4p-dependent increase in the permanganate reactivity associated with an hsp70 transgene that had Gal4p
binding sites substituted for the normal regulatory region. The same
results were obtained for this transgene in two different locations in the genome. In contrast to the normal hsp70 promoter, we
find no indication of promoter-proximal pausing even when Gal4p
provides moderate levels of activation. At three different levels of
induction, the permanganate reactivity at positions +8 and +67 was
comparable to the level at position +22. For the endogenous
hsp70 promoter, moderate levels of activation caused by
intermediate heat shock temperatures resulted in levels of permanganate
reactivity at positions +8 and +67 that were less than the level of
reactivity at position +22. Side-by-side comparison of HSF-inducible
and Gal4p-inducible transgenes also yielded results consistent with the
conclusion that pausing occurs in the HSF-inducible case but not the
Gal4p-inducible case. These observations have led us to the hypothesis
that promoter-proximal pausing is dictated by the factors recognizing
sequences normally found upstream from the TATA element. Furthermore,
we provide evidence that pausing does not require specific sequences in
the region where polymerase pauses. This latter observation extends
results showing that pausing does not require specific sequences
downstream from where the polymerase pauses (23).
We infer that the permanganate hyperreactivity represents RNA
polymerase for the following reasons. First, the level of permanganate reactivity coincides with the level of transcription deduced from expression of the
-galactosidase reporter gene when Gal4p is expressed in a manner that exhibits dosage compensation (Fig. 5).
Second, primer extension analysis indicates that the Gal4p-mediated site of transcriptional initiation coincides with the beginning of the
region of permanganate hyperreactivity (data not shown). Third,
mutations that reduce transcription levels cause a concomitant decrease
in the permanganate reactivity (51). Finally, the results of
this type of analysis performed on the endogenous hsp70
promoter corroborate results from in vivo cross-linking and nuclear
run-on assays (24).
Promoter-proximal pausing contrasts with prokaryotic
paradigms.
Control of elongation is common in prokaryotes. In most
cases, it appears that direct interactions between RNA polymerase and
particular nucleic acid sequences or structures play a key role in
regulating elongation. Polymerase pauses in the promoter-proximal region of the lambda late promoter as a result of a sequence-specific interaction between the sigma subunit and the nontranscribed strand of
the DNA (37). Many elongation controls rely on the RNA
structure in the immediate vicinity of the polymerase or on the
stability of the RNA-DNA heteroduplex (31). It appears that
nucleic acid interactions can cause the polymerase to translocate along
the DNA in a manner that disengages the 3' end of the RNA from the catalytic center of the enzyme (21). Realignment of the 3'
end is required to resume elongation.
Based on the prokaryotic paradigms, it was reasonable to
anticipate that specific sequences in the region of pausing might
be important for pausing. In support of this hypothesis, Lee et
al.
(
22) showed that deleting sequences in the promoter-proximal
region of the
hsp70 promoter resulted in a decrease in the
level
of paused polymerase associated with the mutant promoter in
flies.
Our results suggest that pausing in the promoter-proximal region
does not require a specific sequence element in the region where
polymerase pauses. In support of this, we showed that several
different
mutations in the region from positions +14 to +35 did
not inhibit
promoter-proximal pausing in a cell free reaction.
Additional
observations support this hypothesis. Promoter-proximal
pausing occurs
on a variety of promoters in
Drosophila and mammals,
and
there does not appear to be a conserved sequence in the region
of the
pause. A conserved sequence element was noted in the region
where
pausing occurs on the
hsp70,
hsp26, and tubulin
promoters
(
14). It is unlikely that this element is involved
in pausing,
since we mutated this element in the experiment for which
results
are presented in Fig.
8. Moreover, the element is not present
in the YP1 promoter, yet paused polymerase can be established
on the
YP1 promoter by placing the upstream regulatory region
of
hsp70 adjacent to the YP1 core promoter region
(
22). The
reason mutations in the promoter-proximal region
of
hsp70 were
previously found to diminish the level of
paused polymerase is
probably that the level of initiation was reduced.
Sequences in
the promoter-proximal region contribute to the association
of
TFIID (
11,
35).
Upstream regulators play a key role in whether or not
promoter-proximal pausing occurs.
Our results indicate that
proteins interacting with sequences upstream from the core promoter
region dictate whether promoter-proximal pausing will occur. Here, we
show that replacing the upstream region with sequences that bind Gal4p
results in transcription activation that fails to exhibit pausing. This
result complements a previous observation of Lee et al.
(22). They showed that inserting multiple copies of the
sequence residing from positions
38 to
89 of hsp70
upstream from the TATA box of the YP1 gene results in promoter-proximal
pausing on the YP1 gene. No pausing was detected on the normal YP1
gene, although it should be noted that the normal YP1 promoter could
have been repressed at a step preceding initiation during the
conditions that were analyzed (22, 36). The only factors
known to recognize the region of positions
38 to
89 are GAGA factor
and HSF. Since the analysis was performed on flies that had not been
heat shocked, GAGA factor is probably key to establishing the paused
state on the hsp70 promoter.
How might GAGA factor establish promoter-proximal pausing? There is no
evidence that GAGA factor directly interacts with the
transcriptional
machinery. Rather, GAGA factor might promote association
of the
transcriptional machinery by directing changes in histone
interactions
to increase the accessibility of DNA in chromatin
(
46) or by
shaping the DNA topology in a fashion that promotes
association of the
general transcription machinery (
18). Transcription
might
progress to a default state that involves pausing. Progression
beyond
this stage could then require the action of an activator
such as
HSF.
Promoter-proximal pausing has been observed on a variety of genes in
Drosophila and mammals. In many cases, pausing is present
even under conditions when the gene is active, as is the case
when
hsp70 has been induced by a moderate heat shock. We suggest
that the pausing results because of a two-stroke mechanism. Pausing
is
observed when the second stroke of the mechanism, escape of
the
polymerase, occurs much more slowly than the first stroke,
initiation.
Several possibilities are provided in Fig.
9. Some
regulators might effectively
mediate initiation but poorly mediate
the escape of the polymerase from
the paused state. Other regulators
could mediate escape of the
polymerase. Because of the modular
nature of transcription factors,
domains that facilitate initiation
and elongation could reside in one
protein or in distinct proteins.
For example, recent evidence indicates
that human HSF1 has distinct
domains that stimulate initiation and
elongation (
6). The duration
of the pause depends on the
balance between initiation and escape
from the pause. In the case of
the uninduced
hsp70 promoter, we
suspect that the pause is
quite stable and that very little escape
occurs (
23). This
could be due to the inability of GAGA to mediate
escape and because HSF
activity is repressed under normal growth
conditions.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 9.
Model for a two-stroke mechanism where distinct domains
or proteins control initiation and promoter-proximal pausing.
Promoter-proximal pausing could result from a two-stroke mechanism
shown on the left side of the diagram. In the first stroke, a regulator
(small black oval) would cause polymerase (light gray oval) to initiate
and advance to the paused state. The three curved lines between the
regulator and polymerase represent this step. GAGA factor might
exemplify such a regulator. In the second stroke, regulators (striped
oval) mediate the escape of the polymerase. This is represented by the
large arrow. HSF could exemplify this form of regulator. The right side
of the diagram shows possible scenarios where the initiation and escape
of paused polymerase might occur at equal rates. The functions of
initiation and escape could be built into a single protein or be
associated with distinct proteins. Detection of pausing would depend on
the relative rates of initiation and escape. Promoter-proximal pausing
occurs when the rate of initiation is faster than the rate of escape.
The hsp70 promoter could represent an extreme case in which
the factor required for escape (HSF) is not present until after heat
shock. In the case of Gal4p, we propose that initiation and escape from
the pause occur at equal rates.
|
|
We propose that Gal4p contains both types of domains so that initiation
and escape from the pause occur at equal rates. Gal4p
appears to
contain at least two different activation domains (
25)
and
possibly a third one which is incorporated into the DNA binding
domain
(
8). The activation domain at the carboxy terminus interacts
with TATA-binding protein (TBP) and ADA2 (
29). ADA2 is part
of a histone acetyltransferase complex and might function in chromatin
remodeling before initiation (
15). One feature of the
Gal4p-TBP
interaction is particularly interesting with respect to its
possible
function in polymerase escape. Lis and colleagues have
proposed
a mechanism for promoter-proximal pausing and escape which
involves
competition between the H domain of the largest RNA polymerase
II subunit and an activator for a common site on TBP (
28,
52).
According to this hypothesis, the RNA polymeraseII-TBP
interaction
might contribute to the pause. The activator would mediate
escape
by displacing the H domain from TBP. It is interesting that the
same mutation in TBP (L114K) reduces the affinity between TBP
and both
HSF and the carboxy-terminal activation domain of Gal4p
(
28,
29). If this model of "tether and compete" is correct,
the
activation domain at the C terminus of Gal4p could serve to
disrupt the
interaction between TBP and RNA polymerase
II.
The model illustrated in Fig.
9 proposes that some activators function
to release the paused polymerase. It is also possible
that the
activators recruit a version of polymerase that never
pauses in the
first place. We do not favor this model for the
hsp70
promoter because an additional step would be required to
remove a
paused polymerase before the resistant form could initiate
transcription. However, there has yet to be evidence of
promoter-proximal
pausing in yeast (
24). The
hsp82 gene and the Gal1 and Gal10
genes of yeast exhibit
permanganate hyperreactivity only under
conditions of active
transcription. The permanganate reactivity
falls upstream from the
transcription start site, unlike that
expected of a paused polymerase
(
12,
13). Should promoter-proximal
pausing prove to be
absent in yeast, then it would seem unlikely
that Gal4p contains
information required to release a paused polymerase
unless it is
targeted at a highly conserved interaction such as
the interaction
described above for the H domain of polymerase
and
TBP.
Promoter-proximal pausing versus premature termination.
The
notion that initiation and elongation could be influenced by distinct
proteins or distinct parts of an individual activator has been
previously proposed. Transcriptional activators have been separated
into three categories based on how they influenced initiation and
elongation in transient transfection assays (3). One
category was effective at promoting initiation but not at promoting
elongation. Sp1 was included in this category. A second category of
activator was effective at promoting elongation but not initiation. HIV
Tat was placed in this category. It is interesting that in vitro
transcription results also support the idea that Sp1 functions
primarily in initiation, whereas Tat functions primarily in
elongation (56). A third category of activator
promotes both initiation and elongation. Gal4-VP16 was placed in this
category. Interestingly, those activators that promote elongation
were found to associate with TFIIH. TFIIH phosphorylates the
carboxy-terminal domain of RNA polymerase, and other work has suggested
that phosphorylation of the carboxy-terminal domain increases the
processivity of RNA polymerase (27).
The model shown in Fig.
9 resembles the model proposed by Blau et al.
(
3). However, there are potentially significant differences
that must be recognized. Our work has focused on promoter-proximal
pausing as defined by the permanganate assay. The analysis of
Blau et
al. (
3) focused on the behavior of the polymerase after
it
had escaped the promoter-proximal region. In their study, RNase
protection assays were used to compare the relative amounts of
prematurely terminated transcripts and read-through transcripts.
It is
likely that the RNase protection assay monitors a feature
of elongation
control that is distinct from promoter-proximal
pausing. The sizes of
many of the prematurely terminated transcripts
exceeded the sizes of
the nascent transcripts that would be associated
with a polymerase
paused in the region of positions +20 to +40.
Moreover, the
prematurely terminated transcripts were likely to
have suffered
some trimming of their lengths prior to the RNase
protection assay. Our
permanganate analysis has allowed us to
look for differences in
polymerase densities out to position +260
(Fig.
4). No striking
differences were evident except for the
region within the first 53 nucleotides. Hence, polymerases induced
by Gal4p and by HSF seem to be
equally competent at maintaining
association with the template for the
first 260
nucleotides.
How promoter-proximal pausing could be a default step in
transcription with a metazoan promoter lacking the appropriate
activator.
Our model proposes that pausing is dictated by the
regulators of the core promoter rather than the core promoter itself.
Pausing would be observed if two criteria were met. First, regulators involved in establishing a preinitiation complex would have to act at a
promoter. These regulators would include factors that modulate the
accessibility of DNA in chromatin and that recruit TFIID and the rest
of the general transcriptional machinery. If this criterion were not
met, then paused polymerase would not be observed because there
would be no opportunity for initiation. Second, once polymerase
has initiated, promoter-proximal pausing would depend on whether or
not an activation domain involved in escape were present and how
efficiently the activation domain were functioning.
Several mechanisms could cause the pause in a fashion that is
independent of the core promoter sequence. Recent work has identified
two factors, DSIF and NELF, that inhibit elongation (
53). In
reconstituted transcription reactions, these factors appear to
begin
acting on elongation complexes after the complexes have
generated
nascent transcripts of approximately 30 nucleotides.
DSIF and NELF will
also inhibit elongation when purified RNA polymerase
II is allowed to
transcribe a tailed template in the absence of
any other general
transcription factors. Perhaps the type of regulators
located upstream
of the start control the window of opportunity
in which DSIF and NELF
can act. Another recent study indicates
that RNA polymerase II
undergoes a structural transition as the
elongation complex traverses
the region 20 to 40 nucleotides downstream
from the transcription start
site (
39). This appears to be independent
of sequence, and
it has been suggested that this structural transition
might accompany
the point when the nascent transcript is of sufficient
length to appear
on the surface of the elongation complex. A potential
rate-limiting
step in elongation occurs 8 to 14 nucleotides downstream
from the
transcription start site (
9,
10,
20,
53). Transition
through
this phase of elongation requires TFIIH and ATP hydrolysis
and appears
to rely on the helicase rather than kinase activity
of TFIIH (
32,
40). This transition has been observed in vitro
with several
promoters, suggesting that it is not dependent on
any particular
sequence located in the core promoter region. Several
other
possibilities that could be independent of the core promoter
region
have been discussed by Rasmussen and Lis (
36).
Novel strategy for investigating promoter-proximal pausing and
transcriptional control.
Our approach involving transgenic flies
and genomic footprinting with permanganate provides a novel means
for future investigations into the relationship between regulators,
promoter-proximal pausing, and elongation. The results with Gal4p
emphasize the importance of the upstream regulators in controlling
pausing. We are particularly interested in testing fusions between the
DNA binding domain of Gal4p and other parts of proteins to identify
protein domains capable of establishing the paused state.
Identification of pausing domains in the regulators could provide a new
route towards understanding the mechanism of promoter-proximal pausing.
In addition, our approach may be more broadly applied to investigate
the action of activators and repressors in living cells.
 |
ACKNOWLEDGMENTS |
This work was supported by research grant MCB-9723537 from the
National Science Foundation and research grant GM47477 from NIH.
We thank Renato Paro for providing the Gal4p-expressing fly lines
Mz-1087.hx and hs-GAL42-1 and John Lis for providing comments on the
manuscript. We also thank Jim Alvarez and Scott Auerbach for
experiments done at the early stages of this project.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Center for Gene
Regulation, Department of Chemistry and Molecular Biology, The
Pennsylvania State University, University Park, PA 16802. Phone: (814)
863-8905. Fax: (814) 863-7024. E-mail: dsg11{at}psu.edu.
 |
REFERENCES |
| 1.
|
Bello, B.,
D. Resendez-Perez, and W. J. Gehring.
1998.
Spatial and temporal targeting of gene expression in Drosophila by means of a tetracycline-dependent transactivator system.
Development
125:2193-2202[Abstract].
|
| 2.
|
Bieschke, E. T.,
J. C. Wheeler, and J. Tower.
1998.
Doxycycline-induced transgene expression during Drosophila development and aging.
Mol. Gen. Genet.
258:571-579[CrossRef][Medline].
|
| 3.
|
Blau, J.,
H. Xiao,
S. McCracken,
P. O'Hare,
J. Greenblatt, and D. Bentley.
1996.
Three functional classes of transcriptional activation domain.
Mol. Cell. Biol.
16:2044-2055[Abstract].
|
| 4.
|
Brand, A. H., and N. Perrimon.
1993.
Targeted gene expression as a means of altering cell fates and generating dominant phenotypes.
Development
118:401-415[Abstract].
|
| 5.
|
Brown, S. A.,
A. N. Imbalzano, and R. E. Kingston.
1996.
Activator-dependent regulation of transcriptional pausing on nucleosomal templates.
Genes Dev.
10:1479-1490[Abstract/Free Full Text].
|
| 6.
|
Brown, S. A.,
C. S. Weirich,
E. M. Newton, and R. E. Kingston.
1998.
Transcriptional activation domains stimulate initiation and elongation at different times and via different residues.
EMBO J.
17:3146-3154[CrossRef][Medline].
|
| 7.
|
Carey, M.,
Y.-S. Lin,
M. R. Green, and M. Ptashne.
1990.
A mechanism for synergistic activation of a mammalian gene by GAL4 derivatives.
Nature
345:361-364[CrossRef][Medline].
|
| 8.
|
Corton, J. C.,
E. Moreno, and S. A. Johnston.
1998.
Alterations in the GAL4 DNA-binding domain can affect transcriptional activation independent of DNA binding.
J. Biol. Chem.
273:13776-13780[Abstract/Free Full Text].
|
| 9.
|
Dvir, A.,
R. C. Conaway, and J. W. Conaway.
1996.
Promoter escape by RNA polymerase II. A role for an ATP cofactor in suppression of arrest by polymerase at promoter-proximal sites.
J. Biol. Chem.
271:23352-23356[Abstract/Free Full Text].
|
| 10.
|
Dvir, A.,
S. Tan,
J. W. Conaway, and R. C. Conaway.
1997.
Promoter escape by RNA polymerase II. Formation of an escape-competent transcriptional intermediate is a prerequisite for exit of polymerase from the promoter.
J. Biol. Chem.
272:28175-28178[Abstract/Free Full Text].
|
| 11.
|
Emanuel, P. A., and D. S. Gilmour.
1993.
TFIID recognizes DNA sequences downstream of the TATA element in the hsp 70 heat shock gene.
Proc. Natl. Acad. Sci. USA
90:8449-8453[Abstract/Free Full Text].
|
| 12.
|
Giardina, C., and J. T. Lis.
1993.
DNA melting on yeast RNA polymerase II promoters.
Science
261:759-762[Abstract/Free Full Text].
|
| 13.
|
Giardina, C., and J. T. Lis.
1995.
Dynamic protein-DNA architecture of a yeast heat shock promoter.
Mol. Cell. Biol.
15:2737-2744[Abstract].
|
| 14.
|
Giardina, C.,
M. Perez-Riba, and J. T. Lis.
1992.
Promoter melting and TFIID complexes on Drosophila genes in vivo.
Genes Dev.
6:2190-2200[Abstract/Free Full Text].
|
| 15.
|
Grant, P. A.,
L. Duggan,
J. Cote,
S. M. Roberts,
J. E. Brownell,
R. Candau,
R. Ohba,
T. Owen-Hughes,
C. D. Allis,
F. Winston,
S. L. Berger, and J. L. Workman.
1997.
Yeast Gcn5 functions in two multisubunit complexes to acetylate nucleosomal histones: characterization of an Ada complex and the SAGA (Spt/Ada) complex.
Genes Dev.
11:1640-1650[Abstract/Free Full Text].
|
| 16.
|
Hiromi, Y., and W. J. Gehring.
1987.
Regulation and function of the Drosophila segmentation gene fushi tarazu.
Cell
50:963-974[CrossRef][Medline].
|
| 17.
|
Hoch, M.,
C. Schroder,
E. Seifert, and H. Jackle.
1990.
Cis-acting control elements for Krupple expression in the Drosophila embryo.
EMBO J.
9:2587-2595[Medline].
|
| 18.
|
Katsani, K. R.,
M. A. Hajibagheri, and C. P. Verrijzer.
1999.
Co-operative DNA binding by GAGA transcription factor requires the conserved BTB/POZ domain and reorganizes promoter topology.
EMBO J.
18:698-708[CrossRef][Medline].
|
| 19.
|
Krumm, A.,
T. Meulia,
M. Brunvand, and M. Groudine.
1992.
The block to transcriptional elongation within the human c-myc gene is determined in the promoter-proximal region.
Genes Dev.
6:2201-2213[Abstract/Free Full Text].
|
| 20.
|
Kumar, K. P.,
S. Akoulitchev, and D. Reinberg.
1998.
Promoter-proximal stalling results from the inability to recruit transcription factor IIH to the transcription complex and is a regulated event.
Proc. Natl. Acad. Sci. USA
95:9767-9772[Abstract/Free Full Text].
|
| 21.
|
Landick, R.
1997.
RNA polymerase slides home: pause and termination site recognition.
Cell
88:741-744[CrossRef][Medline].
|
| 22.
|
Lee, H.,
K. W. Kraus,
M. F. Wolfner, and J. T. Lis.
1992.
DNA sequence requirements for generating paused polymerase at the start of hsp70.
Genes Dev.
60:284-295.
|
| 23.
|
Li, B.,
J. A. Weber,
Y. Chen,
A. L. Greenleaf, and D. S. Gilmour.
1996.
Analyses of promoter-proximal pausing by RNA polymerase II on the hsp70 heat shock gene promoter in a Drosophila nuclear extract.
Mol. Cell. Biol.
16:5433-5443[Abstract].
|
| 24.
|
Lis, J.
1998.
Promoter-associated pausing in promoter architecture and postinitiation transcriptional regulation.
Cold Spring Harbor Symp. Quant. Biol.
63:347-356[CrossRef][Medline].
|
| 25.
|
Ma, J., and M. Ptashne.
1987.
Deletion analysis of GAL4 defines two transcriptional activating segments.
Cell
48:847-853[CrossRef][Medline].
|
| 26.
|
Madabusi, L. V.
1998.
Studies on the Drosophila hsp70 core promoter: role of the downstream TFIID contacts in transcription and pausing. Ph.D. thesis.
The Pennsylvania State University, University Park, Pa.
|
| 27.
|
Marshall, N. F.,
J. Peng,
Z. Xie, and D. H. Price.
1996.
Control of RNA polymerase II elongation potential by a novel carboxyl-terminal domain kinase.
J. Biol. Chem.
271:27176-27183[Abstract/Free Full Text].
|
| 28.
|
Mason, P. B., Jr., and J. T. Lis.
1997.
Cooperative and competitive protein interactions at the hsp70 promoter.
J. Biol. Chem.
272:33227-33233[Abstract/Free Full Text].
|
| 29.
|
Melcher, K., and S. A. Johnston.
1995.
GAL4 interacts with TATA-binding protein and coactivators.
Mol. Cell. Biol.
15:2839-2848[Abstract].
|
| 30.
|
Mirkovitch, J., and J. E. J. Darnell.
1992.
Mapping of RNA polymerase on mammalian genes in cells and nuclei.
Mol. Cell. Biol.
3:1085-1094.
|
| 31.
|
Mooney, R. A.,
I. Artsimovitch, and R. Landick.
1998.
Information processing by RNA polymerase: recognition of regulatory signals during RNA chain elongation.
J. Bacteriol.
180:3265-3275[Free Full Text].
|
| 32.
|
Moreland, R. J.,
F. Tirode,
Q. Yan,
J. W. Conaway,
J. M. Egly, and R. C. Conaway.
1999.
A role for the TFIIH XPB DNA helicase in promoter escape by RNA polymerase II.
J. Biol. Chem.
274:22127-22130[Abstract/Free Full Text].
|
| 33.
|
O'Brien, T., and J. T. Lis.
1991.
RNA polymerase II pauses at the 5' end of the transcriptionally induced Drosophila hsp70 gene.
Mol. Cell. Biol.
11:5285-5290[Abstract/Free Full Text].
|
| 34.
|
Pinaud, S., and J. Mirkovitch.
1998.
Regulation of c-fos expression by RNA polymerase elongation competence.
J. Mol. Biol.
280:785-798[CrossRef][Medline].
|
| 35.
|
Purnell, B. A.,
P. A. Emanuel, and D. S. Gilmour.
1994.
TFIID sequence-recognition of the initiator and sequences further downstream in Drosophila class II genes.
Genes Dev.
8:830-842[Abstract/Free Full Text].
|
| 36.
|
Rasmussen, E. B., and J. T. Lis.
1995.
Short transcripts of the ternary complex provide insight into RNA polymerase II elongational pausing.
J. Mol. Biol.
252:522-535[CrossRef][Medline].
|
| 37.
|
Ring, B. Z., and J. W. Roberts.
1994.
Function of a nontranscribed DNA strand site in transcription elongation.
Cell
78:317-324[CrossRef][Medline].
|
| 38.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 39.
|
Samkurashvili, I., and D. S. Luse.
1998.
Structural changes in the RNA polymerase II transcription complex during transition from initiation to elongation.
Mol. Cell. Biol.
18:5343-5354[Abstract/Free Full Text].
|
| 40.
|
Serizawa, H.,
J. W. Conaway, and R. C. Conaway.
1993.
Phosphorylation of C-terminal domain of RNA polymerase II is not required in basal transcription.
Nature
363:371-374[CrossRef][Medline].
|
| 41.
|
Shopland, L. S.,
K. Hirayoshi,
M. Fernandes, and J. T. Lis.
1995.
HSF access to heat shock elements in vivo depends critically on promoter architecture defined by GAGA factor, TFIID, and RNA polymerase II binding sites.
Genes Dev.
9:2756-2769[Abstract/Free Full Text].
|
| 42.
|
Simon, J. A., and J. T. Lis.
1987.
A germline transformation analysis reveals flexibility in the organization of heat shock consensus elements.
Nucleic Acids Res.
15:2971-2988[Abstract/Free Full Text].
|
| 43.
|
Spencer, C. A., and M. Groudine.
1990.
Transcription elongation and eucaryotic gene regulation.
Oncogene
5:777-785[Medline].
|
| 44.
|
Thummel, C. S.,
A. M. Boulet, and H. D. Lipshitz.
1988.
Vectors for Drosophila P-element-mediated transformation and tissue culture transfection.
Gene
74:445-456[CrossRef][Medline].
|
| 45.
|
Tsukiyama, T.,
P. B. Becker, and C. Wu.
1994.
ATP-dependent nucleosome disruption at a heat-shock promoter mediated by binding of GAGA transcription factor.
Nature
367:525-532[CrossRef][Medline].
|
| 46.
|
Tsukiyama, T., and C. Wu.
1995.
Purification and properties of an ATP-dependent nucleosome remodeling factor.
Cell
83:1011-1020[CrossRef][Medline].
|
| 47.
|
Verrijzer, C. P.,
J. L. Chen,
K. Yokomori, and R. Tjian.
1995.
Binding of TAFs to core elements directs promoter selectivity by RNA polymerase II.
Cell
81:1115-1125[CrossRef][Medline].
|
| 48.
|
Vincent, J.-P.,
J. A. Kassis, and P. H. O'Farrell.
1990.
A synthetic homeodomain binding site acts as a cell type specific, promoter specific enhancer in Drosophila embryos.
EMBO J.
9:2573-2578[Medline].
|
| 49.
|
Wang, W.,
M. Carey, and J. D. Gralla.
1992.
Polymerase II promoter activation: closed complex formation and ATP-driven start site opening.
Science
255:450-453[Abstract/Free Full Text].
|
| 50.
|
Weber, J. A., and D. S. Gilmour.
1995.
Genomic footprinting of the hsp70 and histone H3 promoters in Drosophila embryos reveal novel protein-DNA interactions.
Nucleic Acids Res.
23:3327-3334[Abstract/Free Full Text].
|
| 51.
|
Weber, J. A.,
D. J. Taxman,
Q. Lu, and D. S. Gilmour.
1997.
Molecular architecture of the hsp70 promoter after deletion of the TATA box or the upstream regulation region.
Mol. Cell. Biol.
17:3799-3808[Abstract].
|
| 52.
|
Xiao, H.,
J. D. Friesen, and J. T. Lis.
1994.
A highly conserved domain of RNA polymerase II shares a functional element with acidic activation domains of upstream transcription factors.
Mol. Cell. Biol.
14:7507-7516[Abstract/Free Full Text].
|
| 53.
|
Yamaguchi, Y.,
T. Takagi,
T. Wada,
K. Yano,
A. Furuya,
S. Sugimoto,
J. Hasegawa, and H. Handa.
1999.
NELF, a multisubunit complex containing RD, cooperates with DSIF to repress RNA polymerase II elongation.
Cell
97:41-51[CrossRef][Medline].
|
| 54.
|
Yankulov, K., and D. Bentley.
1998.
Transcriptional control: Tat cofactors and transcriptional elongation.
Curr. Biol.
8:R447-R449[CrossRef][Medline].
|
| 55.
|
Yankulov, K.,
J. Blau,
T. Purton,
S. Roberts, and D. L. Bentley.
1994.
Transcriptional elongation by RNA polymerase II is stimulated by transactivators.
Cell
77:749-759[CrossRef][Medline].
|
| 56.
|
Zhou, Q., and P. A. Sharp.
1995.
Novel mechanism and factor for regulation by HIV-Tat.
EMBO J.
14:321-328[Medline].
|
| 57.
|
Zink, D., and R. Paro.
1995.
Drosophila Polycomb-group regulated chromatin inhibits the accessibility of a trans-activator to its target DNA.
EMBO J.
14:5660-5671[Medline].
|
Molecular and Cellular Biology, April 2000, p. 2569-2580, Vol. 20, No. 7
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Wang, Y. V., Tang, H., Gilmour, D. S.
(2005). Identification In Vivo of Different Rate-Limiting Steps Associated with Transcriptional Activators in the Presence and Absence of a GAGA Element. Mol. Cell. Biol.
25: 3543-3552
[Abstract]
[Full Text]
-
Malagon, F., Tong, A. H., Shafer, B. K., Strathern, J. N.
(2004). Genetic Interactions of DST1 in Saccharomyces cerevisiae Suggest a Role of TFIIS in the Initiation-Elongation Transition. Genetics
166: 1215-1227
[Abstract]
[Full Text]
-
Corey, L. L., Weirich, C. S., Benjamin, I. J., Kingston, R. E.
(2003). Localized recruitment of a chromatin-remodeling activity by an activator in vivo drives transcriptional elongation. Genes Dev.
17: 1392-1401
[Abstract]
[Full Text]
-
Wu, C.-H., Yamaguchi, Y., Benjamin, L. R., Horvat-Gordon, M., Washinsky, J., Enerly, E., Larsson, J., Lambertsson, A., Handa, H., Gilmour, D.
(2003). NELF and DSIF cause promoter proximal pausing on the hsp70 promoter in Drosophila. Genes Dev.
17: 1402-1414
[Abstract]
[Full Text]
-
Cheng, C., Sharp, P. A.
(2003). RNA Polymerase II Accumulation in the Promoter-Proximal Region of the Dihydrofolate Reductase and {gamma}-Actin Genes. Mol. Cell. Biol.
23: 1961-1967
[Abstract]
[Full Text]
-
Lakhotia, S. C., Prasanth, K. V.
(2002). Tissue- and development-specific induction and turnover of hsp70 transcripts from loci 87A and 87C after heat shock and during recovery in Drosophila melanogaster. J. Exp. Biol.
205: 345-358
[Abstract]
[Full Text]