Previous Article | Next Article 
Molecular and Cellular Biology, April 2000, p. 2592-2603, Vol. 20, No. 7
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Transcriptional Repression by Blimp-1 (PRDI-BF1)
Involves Recruitment of Histone Deacetylase
Jin
Yu,1
Cristina
Angelin-Duclos,2
Jessica
Greenwood,3
Jerry
Liao,2 and
Kathryn
Calame1,2,3,*
Departments of Biochemistry and Molecular
Biophysics1 and
Microbiology2 and the Integrated
Program in Biophysical, Cellular and Molecular
Studies,3 Columbia University College of
Physicians and Surgeons, New York, New York 10032
Received 1 September 1999/Returned for modification 12 October
1999/Accepted 13 January 2000
 |
ABSTRACT |
B-lymphocyte-induced maturation protein (Blimp-1) is a
transcriptional repressor that is considered to be a master regulator of terminal B-cell development because it is sufficient to trigger differentiation in the BCL1-cell model. Transcription of
the c-myc gene is repressed by Blimp-1 during B-cell
differentiation. In this study, we have explored the mechanism by which
Blimp-1 represses transcription by using Gal4-fusion protein assays and
assays in which Blimp-1 represses the natural c-myc
promoter. The results show that Blimp-1 represses the c-myc
promoter by an active mechanism that is independent of the adjacently
bound activator YY1. Blimp-1 contains two regions that independently
associate with histone deacetylase (HDAC) and endogenous Blimp-1 in
nuclear extracts binds in vitro to the c-myc Blimp-1 site
in a complex containing HDAC. The functional importance of recruiting
HDAC for Blimp-1-dependent repression of c-myc
transcription is supported by two experiments. First, the HDAC
inhibitor tricostatin A inhibits Blimp-1-dependent repression in
cotransfection assays. Second, a chromatin immunoprecipitation assay
shows that expression of Blimp-1 causes deacetylation of histone H3
associated with the c-myc promoter, and this deacetylation depends on the Blimp-1 binding site in the c-myc promoter.
 |
INTRODUCTION |
B-lymphocyte-induced maturation
protein (Blimp-1) is a 100-kDa protein which contains five zinc finger
motifs. Blimp-1 cDNA was originally isolated in a subtractive screen of
the BCL1 B-cell lymphoma cell line following treatment with
cytokines interleukin 2 and interleukin 5 (62). This
treatment causes BCL1 cells to undergo terminal
differentiation, evidenced by altered expression of various mRNAs and
cell surface proteins and secretion of immunoglobulin M
(62). Since ectopic expression of Blimp-1 alone is
sufficient to cause terminal differentiation of BCL1 cells,
Blimp-1 is considered to be a "master regulator" of terminal B-cell
development. The initial report showed that Blimp-1 expression was
limited to mature or terminally differentiated B cells (62).
Multiple differences in gene expression are known to exist between
postgerminal center B cells and terminally differentiated plasma cells,
the developmental stages thought to be represented by BCL1
cells before and after cytokine treatment. Plasma cells secrete large
amounts of immunoglobulin, and in BCL1 cells, J chain is
induced upon differentiation to allow secretion of immunoglobulin M
(3, 45). Cell surface proteins CD138 (Syndecan-1) and CD47 are also induced upon BCL1 cell differentiation. On the
other hand, expression of genes encoding proteins, such as c-Myc
(40), CD23 (55), CD22 (61), major
histocompatibility complex class II (4, 59), BSAP (Pax-5)
(54), early B-cell factor (18), and CIITA
(59), is repressed in plasma cells. Since Blimp-1 can
initiate the entire developmental cascade in BCL1 cells, it appears that all these genes are either direct targets of Blimp-1 or
are regulated by Blimp-1 target genes.
We have previously shown that c-myc is an important target
gene of Blimp-1 in BCL1 lymphoma cells (40).
c-Myc is required for cell cycle progression through the
G0-G1 and S-G2/M transitions (63). c-Myc expression correlates with cell proliferation,
being induced upon mitogen stimulation (30, 41, 44, 57) and shut down in quiescent or terminally differentiated cells (14, 23,
37). In addition, overexpression of c-Myc is known to block
terminal differentiation in some cell lines (6, 10, 49),
suggesting that repression of c-myc is crucial to achieve the nonproliferating state associated with terminal differentiation. Therefore, the fact that Blimp-1 represses c-myc
transcription is consistent with the role of Blimp-1 as a master
regulator in B-cell terminal differentiation.
The human homolog of Blimp-1, PRDI-BF1, was cloned by its ability to
bind the PRDI site in the human beta interferon (IFN-
) promoter
(31). PRDI-BF1 was shown to repress the IFN-
promoter, and induction of PRD1-BF1 late in the response to virus infection was
postulated to be important for limiting the IFN response
(31). Thus, for the only two currently established and
physiologically relevant target genes of Blimp-1, c-myc, and
IFN-
, Blimp-1 functions as a transcriptional repressor. We wished to
analyze the mechanism by which Blimp-1 represses transcription.
Mechanisms of transcriptional repression can be considered in two
categories: active repression and passive repression (7, 22, 24,
51). Passive repressors function by interfering with
transcriptional activators, either by competing for the same binding
site or by masking the function of their activation domains (42,
58). Active repressors repress independently; their activity is
not dependent upon interference with specific activators. They may
repress transcription by interacting with components of the general
transcription machinery, like Tag (19) and
even-skipped (25, 35). Alternatively, they may
function by recruiting corepressors with intrinsic repression activity.
One type of corepressor complex involves recruitment of histone
deacetylases (HDACs) (16, 48, 64). Many transcriptional
repressors associate with HDACs by bridging proteins that function as
corepressors (1, 20, 21, 33, 36, 47, 69). For example, Mad
recruits the Sin3 complex that includes mSin3A or -B, HDAC1 or -2, RbAp46 or -48, Ski, and at least two other polypeptides of unknown
function, SAP18 and SAP30 (20, 32, 33, 47, 69). The
repression complex associating with unliganded nuclear receptors
(36, 46), PLZF (8), PLZF-RAR
, and Bcl-6
(9) requires the presence of SMRT/NCoR in addition to mSin3
and HDAC. However, YY1 (66) and Rb family proteins Rb
(43), p107 (12), and p130 (12) all
interact directly with HDAC and no other corepressors are found in
their complexes. PLZF and Bcl-6 associate both with SMRT/NcoR and
directly with HDAC (9). Recruitment of HDAC to DNA appears
to alter nucleosome structure in a local region and inhibit
transcription, presumably because acetylation neutralizes the positive
charge on lysines in the histone tails and alters intra- and/or
internucleosomal structure. Other corepressors, such as Groucho and
Kap-1, have also been identified, but their mechanism of action is not
yet understood (13).
In this paper, we studied the repression mechanism of Blimp-1 by
testing whether Blimp-1 is an active or a passive repressor and by
exploring the possible role of HDAC in Blimp-1-dependent repression. On
the c-myc promoter, we found that Blimp-1 functions as an
active repressor independent of activator YY1, which binds nearby.
Also, we found that Blimp-1 associates with HDACs directly, suggesting
that it can recruit HDACs to promoters it binds. In addition,
inhibition of cellular HDAC activity relieved repression of Blimp-1 on
the c-myc promoter as well as the repression of a
Gal4-Blimp-1 fusion protein on a thymidine promoter with Gal4 binding
sites. Finally, by using a chromatin immunoprecipitation (ChIP) assay,
we show that expression of Blimp-1 causes deacetylation of histone H3
at the c-myc promoter. Taken together, these results suggest
that Blimp-1-dependent repression involves alteration of local
chromatin structure by recruitment of HDAC.
 |
MATERIALS AND METHODS |
Plasmids.
Luciferase reporters driven by the
c-myc promoter (
1100/+580), mPRF-c-myc promoter
(
1100/+580), (27), c-myc promoter (
424/+340), and mYY1-c-myc (
424/+340) (53), the Blimp-1
expression vector pBDP1-F, vector control pBDP1-B (Blimp-1 cDNA in
reverse orientation) (62), YY1 expression plasmid pCMV-YY1,
and vector control pCMV (53) have been previously described.
The expression constructs of hemagglutinin (HA)-tagged full-length
Blimp-1 (HA-Blimp-1) and deletion mutants H1 to H4 were cloned by PCR
amplification of Blimp-1 cDNA fragments by using pBDP1-F as the
template and using the primers shown below, followed by subsequent
ligation into the XbaI site on the pCGN vector
(29). DNA sequence analysis was performed to confirm the clones.
For HA-Blimp-1, the PCR primers used were
5'GTTCTAGATTTCTCAGATGTTGGAT and
3'CCTCTAGACACGAAACACTTATT. For H1, the PCR primers used were
5'AATCTAGAAAATACATAGTGAACGA and
3'CCTCTAGACACGAAACACTTATT. For H2, the PCR primers used were
5'AATCTAGAAATGGTATCAACAACT and 3'CCTCTAGACACGAAACACTTATT. For H3, the PCR primers used were
5'GTTCTAGATTTCTCAGATGTTGGAT and
3'AATCTAGAAGTTGCCCTTCAGGT. For H4, the PCR primers used were 5'GTTCTAGATTTCTCAGATGTTGGAT, 3'CCTCTAGACACGAAACACTTATT,
and 3'GGCTGAAGTTGTTGATACCATTCTCTTCAAACTCGGCCTCTGTC.
pBSK-Blimp-1 full length (B1) was cloned by inserting the
XhoI-
XhoI Blimp-1 cDNA from pBDP1-F into the
XhoI site of the pBluescript
SKII(+) (Stratagene). B2 to B5
were cloned by inserting
EcoRI-digested
Blimp-1 fragments
obtained by PCR using H1 to H4 as templates,
respectively, and using
5'GTTCTAGAGAATTCACCTCCATAGAA and
3'AATCTAGAGAATTCCCTGAAGTTCTC
as primers into the
EcoRI site on the pSK vector. B6 was cloned
by digesting B4
with
SmaI to delete a 500-bp Blimp-1 fragment
and religating
the remaining plasmid. B7 was made by inserting
a Blimp-1 fragment made
by PCR using B1 as the template and using
the PCR primers
5'AATCTAGAATGAAACAGAATGGCAAGAT and
3'AATCTAGAAGTTGCCCTTCAGGT
into the
XbaI site of
the pSK vector. B8 was made by digesting
B6 with
PmlI and
EcoRI to delete a 300-bp Blimp-1 cDNA fragment
and
end-filling and religating the remaining plasmid. B9 was made
by
replacing the 2.1-kb
PmlI-
PacI Blimp-1 fragment
on B1 with
the 1.6-kb
BsrB1-
PacI Blimp-1 fragment
cut from Blimp-1 cDNA.
B10 was cloned by digesting B9 with
EcoNI and
EcoRI to delete
the 1-kb Blimp-1
fragment and end-filling and religating the remaining
plasmid. B11 was
made by digesting B9 with
AvrII and
EcoRI to
delete the 1.5-kb Blimp-1 fragment and end-filling and religating
the
remaining plasmid. B12 was made by inserting the
EcoNI-
AvrII-digested
Blimp-1 fragment made by PCR
using B1 as the template and using
5'GAGGCATCCTTACCAAGGAACCTGCT
and 3'CAACCTAGGGGAGGGATTGGAGTCCAGTTTTAGAA
as primers
into
EcoNI-
AvrII-digested B9. All PCR products
used
in cloning procedures were confirmed by DNA sequencing.
Gal4-Blimp-1
was made by inserting Blimp-1 cDNA resulting from
ScaI-
BamHI-digested
B1, after end-filling, into
the
SmaI site of the pGal4(1-147)
vector (
29).
Expression plasmids for Blimp-1 fused to Gal4 DNA
binding domains
(Gal4DBDs) (G1 to G4) were made by inserting the
respective PCR
fragments obtained by using B1 as the template
and using the pairs of
primers shown below, after
BamHI-
XbaI digestion,
into the
BamHI and
XbaI sites of pGal4(1-147).
Again, all PCR-generated
fragments were confirmed by DNA sequencing.
For G1, the PCR primers
used were 5'CGGGATCCGTTGGATCTTCTCTTGGA
and 3'GTTCTAGAAGGCAGCCAGGTTTTGCTCC.
For G2, the PCR
primers used were 5'AAAGGATCCGCGTGGTAAGTAAGGAGT
and
3'TTCTCTAGACTTTCCGTTTGTGTGAGA. For G3, the PCR primers used
were 5'AAAGGATCCTGGCCTATGGGATGGAGA and
3'AAGTCTAGAGGCTGCTGCCACTAAGGA.
For G4, the PCR primers used
were 5'GCGGATCCAACTGAAGGGCAACTGC
and
3'CCTCTAGACACGAAACACTTATT. Gal4-Blimp-1 (amino acids [aa]
557 to 714) and Gal4DBD fused to Blimp-1 with both binding domains
deleted were generated by inserting the respective Blimp-1 fragments
obtained from B8 and B12 into pGal4(1-147).
Cell lines and culture.
293T human kidney fibroblast cells
were maintained in Dulbecco's modified Eagle's medium with 10% fetal
bovine serum (Gemini). 18-81 pre-B cells were grown in RPMI 1640 medium
with 10% heat-inactivated fetal bovine serum and 50 µM
-mercaptoethanol.
Transfections and luciferase assay.
Transient DNA
transfections were performed by calcium phosphate precipitation in 293T
cells. Briefly, cells were split at a density of 5 × 105 cells/10-cm plate the day before transfection and the
cells were fed 3 h before transfection. DNA was added as a
Ca3(PO4)2 precipitate (25 mM HEPES,
140 mM NaCl, 750 µM Na2HPO4) to the medium.
Twelve hours later, the medium was changed, and 36 h later, cells
were harvested. Transient DNA transfections were performed by
electroporation in 18-81 pre-B cells. For each transfection, 5 × 106 log-phase cells were collected by centrifugation,
washed in RPMI medium, resuspended in 300 µl of the same medium, and
transferred to a 0.4-cm electrode gap gene pulser cuvette (BTX). After
addition of DNA, the samples were gently shaken and subjected to
electroporation at 960 µF and 240 V with a GenePulser apparatus
(Bio-Rad). After electroporation, samples were diluted with 10 ml of
RPMI culture medium and incubated at 37°C with 5% CO2.
For experiments using trichostatin A (TSA), transfected cells were
split into two dishes immediately after electroporation: one plate
remained untreated and the other was treated with TSA (100 ng/ml).
Cells were harvested for the luciferase assay 16 h after electroporation.
For the luciferase assay, 10 ml of transfected cells was harvested and
centrifuged at 2,000 rpm (500 ×
g) at 4°C for 5 min.
The cell pellets were lysed (25 mM glycylglycine [pH 7.8], 12
mM
MgSO
4, 4 mM EGTA, 1 mM dithiothreitol [DTT] and 1%
Triton)
and then centrifuged. One hundred microliters of each
supernatant
was mixed with 500 µl of luciferase substrate buffer (5 mM glycylglycine
[pH 7.8], 15 mM MgSO
4, 4 mM EGTA, 1 mM
DTT, 15 mM K
2HPO
4, and
2 mM ATP) and 20 µl of
luciferin solution (1 mM luciferin, 25
mM glycylglycine [pH 7.8], 15 mM MgSO
4, 4 mM EGTA, and 1 mM DTT),
and the luminescence
was measured with a Berthold Lumat LB9501
luminometer.
Immunoprecipitation and Western blot analysis.
An aliquot
containing 107 transfected 293T cells was washed with 1×
phosphate-buffered saline and subsequently lysed in PBS plus 0.1%
NP-40 containing protease inhibitors. The lysates were sonicated,
clarified by centrifugation, and immunoprecipitated at 4°C with the
indicated antibodies and protein A-agarose beads (Santa Cruz). The
immunoprecipitations were washed five times with PBS plus 0.1% NP-40
and then resolved on sodium dodecyl sulfate (SDS)-polyacrylamide gels,
electrotransferred to nitrocellulose membranes, and examined by Western
blot analysis. Membranes, after transfer, were blocked in 5% dry milk
in PBS for 1 h and then incubated with indicated primary
antibodies in PBS plus 2% dry milk for 2 h, followed by
incubation with appropriate secondary antibodies in PBS plus 2% dry
milk for 1 h. The membranes were washed in PBS plus 0.2% Tween 20 between each step, developed by using an enhanced chemiluminescence
detection kit (Pierce), and exposed to X-ray film.
GST fusion proteins and in vitro binding assays.
Glutathione
S-transferase (GST) fusion proteins were expressed from the
appropriate pGEX recombinant vectors in transformed Escherichia
coli XL-1 Blue and were purified by immobilization on a
glutathione-agarose matrix as previously described (17) except for two modifications. First, bacteria were grown at 30°C. Second, cells were lysed in a solution containiing 10 mM Tris-HCl, pH
8.0, 150 mM NaCl, 1 mM EDTA, 100 µg of lysozyme/ml, 5 mM DTT, 1.5%
N-lauryl sarcosine, the protease inhibitors (each at 2 µg/ml) aprotinin, pepstatin, and leupeptin, and 100 mM
phenylmethylsulfonyl fluoride (PMSF). 35S-radiolabeled
Blimp-1 proteins were synthesized by a coupled in vitro
transcription-translation protocol (TnT; Promega) and incubated with a
50% slurry of the corresponding immobilized GST fusion protein in
buffer B (20 mM HEPES [pH 7.6], 100 mM NaCl, 4 mg of dry milk/ml, 5 mM DTT, the protease inhibitors [each at 2 µg/ml] aprotinin,
pepstatin, and leupeptin, and 1 mM PMSF) for 2 h at 4°C with
gentle rocking. The agarose beads were then washed five times with 1 ml
(each time) of PBS plus 0.1% NP-40. Bound proteins were eluted in 20 µl of SDS-polyacrylamide gel electrophoresis (PAGE) loading buffer,
resolved by SDS-PAGE, and exposed to X-ray film.
EMSA.
P3X nuclear extracts were prepared as previously
described (27). Probes were labeled with
[
-32P]ATP. An electrophoretic mobility shift assay
(EMSA) was performed as previously described (70). Unlabeled
competitor oligonucleotides (50-fold molar excess) or
HDAC1 antibody
(Santa Cruz) were incubated with nuclear extracts on ice for 30 min
prior to the addition of probe.
ChIP assays.
ChIP assays were performed essentially
according to the protocol for the Acetyl-Histone H3 ChIP Assay Kit
(Upstate Biotechnology). Twenty-four hours after transfection, 2.5 × 107 18-81 cells were cross-linked by addition of
formaldehyde directly into the medium to achieve a final concentration
of 1% and incubated for 30 min at 37°C. Formaldehyde was then
quenched with 0.125 M glycine. Cells were washed, suspended in PIPES
buffer (5 mM PIPES [pH 8.0], 85 mM KCl, 0.5% NP-40) containing
protease inhibitors, pelleted, and resuspended in SDS lysis buffer (1%
SDS, 10 mM EDTA, 50 mM Tris-HCl [pH 8.1]) with protease inhibitors.
The lysates were subsequently subjected to sonication to reduce DNA
length to between 200 and 1,000 bp. Samples were then diluted 10-fold by using dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA,
16.7 mM Tris-HCl [pH 8.1], 167 mM NaCl) and precleared by incubating
with protein A beads overnight; anti-acetyl histone H3 antibody
(Upstate Biotechnology) was added and immunoprecipitation was done
overnight at 4°C with rotation. Immunocomplexes were collected with
protein A agarose beads and eluted after extensive washing, and
cross-links were reversed by heating at 65°C. Samples were subjected
to proteinase K treatment. DNA was recovered by phenol-chloroform
extraction, ethanol precipitated, and used as a template for PCR
(twofold serial dilutions for 25 cycles) using c-myc
promoter-specific primers (5'CAACCGTACAGAAAGGGAAAGGACTAGCGC3' and 5'TCCCTTCCCCACCTCTCTCTATTTTTTTC3'). PCR products
were transferred onto a nylon membrane and hybridized with a specific
probe. The linearity of the PCR was verified by phosphorimager analysis.
 |
RESULTS |
Blimp-1-dependent repression of the c-myc promoter does
not involve YY1.
The Blimp-1 binding site, located 290 bp 5' of
the P1 transcriptional start site on the murine c-myc
promoter (40), is adjacent to a binding site for YY1, which
activates c-myc transcription (52, 53). Earlier
studies showed that proteins binding these two sites were able to bind
simultaneously and suggested that the proteins binding these sites
might bind cooperatively (26, 27). Therefore, we wished to
test directly whether the ability of Blimp-1 to repress
c-myc transcription involved effects on either the DNA
binding or the transcriptional activation properties of YY1. First, an
EMSA was used to study whether YY1 and Blimp-1 bind cooperatively on
the c-myc promoter. A 213-bp fragment of the
c-myc promoter which contains both the Blimp-1 and the 3' YY1 binding sites was used as a probe in these experiments (26, 53). Recombinant Blimp-1 and YY1, synthesized in vitro, were incubated with the probe. Both Blimp-1 and YY1 alone yielded a single
retarded band, shown to represent sequence-specific binding since each
was competed away by a specific, but not by a nonspecific, competitor
(Fig. 1A, lanes 2 to 5). When Blimp-1 and
YY1 were incubated together with the probe under conditions of probe
molar excess, both single-protein complexes were observed. However, no
slower mobility complex, which would have indicated cooperative binding
of Blimp-1 and YY1, was observed (Fig. 1A, lane 8). Therefore, these
proteins appear to bind independently on the c-myc promoter.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 1.
Blimp-1 and YY1 act independently on the
c-myc promoter. (A) A 213-bp probe
(SmaI-HapII) from the murine c-myc
gene (26) encompassing both the Blimp-1 site and the 3' YY1
site was used with in vitro-translated Blimp-1 (lanes 2 to 4) or YY1
(lanes 5 to 7) or both (lane 8) in the presence of no competitor (lanes
2, 5, and 8), specific competitor (lanes 3 and 6), or nonspecific
competitor (lanes 4 and 7) in EMSA. The competitors were added in
50-fold molar excess. (B) One microgram of a luciferase reporter fused
with wild-type c-myc promoter ( 424/+340) or a
c-myc promoter with both two YY1 sites mutated ( 424/+340)
(53) was transfected into 18-81 cells by electroporation
together with 10 µg of a Blimp-1 expression plasmid or control
plasmid with Blimp-1 c-DNA inserted in the reverse orientation. The
transfected cells were harvested 16 h after transfection, and
luciferase activity was then measured. (C) One microgram of a
luciferase reporter fused with the wild-type c-myc promoter
( 1100/+580) or a promoter containing a mutation in the Blimp-1 site
( 1100/+580) (27, 40) was transfected into 18-81 cells by
electroporation together with 10 µg of pCMV-YY1, a YY1 expression
construct, or a pCMV vector control. Transfection results are averages
of three or more independent transfections, and the error bars show 1 standard deviation from the mean.
|
|
A transient-transfection assay was used to determine if or how Blimp-1
and YY1 affect one another's regulation of c-
myc promoter
activity. Cotransfection of a Blimp-1 expression plasmid into
18-81 pre-B cells with a luciferase reporter that is dependent
on either a
wild-type c-
myc promoter fragment or a fragment containing
a
mutation of both YY1 sites resulted in similar amounts of
transcriptional
repression (Fig.
1B). Thus, repression of the
c-
myc promoter by
Blimp-1 is independent of the YY1 binding
sites or binding of
endogenous YY1. Similarly, cotransfections of a YY1
expression
plasmid activated a c-
myc promoter containing a
mutated Blimp-1
binding site as well as it activated a wild-type
promoter (Fig.
1C). When YY1 and Blimp-1 expression plasmids were
cotransfected
together with a reporter dependent on a wild-type
c-
myc promoter,
their activities were additive (data not
shown). Thus, we conclude
that Blimp-1 represses and YY1 activates the
c-
myc promoter independently
of one another. These data are
consistent with the idea that Blimp-1
repression occurs by an active
rather than a passive mechanism
since it is independent of
YY1.
Multiple regions of Blimp-1 are involved in its repression
activity.
One characteristic of repressors that work by an active
mechanism is that DNA binding alone is not sufficient to mediate
repression; additional domains of the protein are required. To learn
more about the mechanism of Blimp-1 repression, we tested which domains of the protein were required for repression of the c-myc
promoter. Expression plasmids for four Blimp-1 mutants were made, in
which identifiable structural motifs of Blimp-1 were removed. Blimp-1 contains two acidic regions, one located at each of the N and C
termini, a PR region which is homologous to a region on an
Rb-associating protein called Riz (5), a proline-rich
domain, and a region containing five zinc finger motifs which confer
DNA binding (62) (Fig. 2A).
Expression of HA-tagged mutant proteins in cells transiently transfected with expression plasmids was monitored by immunoblotting with a monoclonal antibody to the HA tag (Fig. 2B). The repression activity of the Blimp-1 mutants was subsequently tested by
cotransfection into 18-81 pre-B cells by using a luciferase reporter
dependent on the c-myc promoter (Fig. 2A). Blimp-1 lacking
the N-terminal 90 amino acids (H1) failed to repress the
c-myc promoter. Also, a larger N-terminal truncation,
removing aa 1 to 464 (H2), which includes the N-terminal acidic, PR,
and proline-rich domains, also resulted in the loss of repressor
activity and showed modest activation. C-terminal truncation of aa 738 to 856, which removed the C-terminal acidic domain (H3), impaired but
did not abolish Blimp-1 repression activity. An internal deletion
mutant that retained the N-terminal acidic region but lacked the PR and
proline-rich domains (H4) showed loss of repression and modest
transcriptional activation. These data suggest that multiple regions of
Blimp-1, including the N-terminal acidic domain and the region between aa 90 and 464, are required for Blimp-1 to repress the c-myc
promoter. The data are also consistent with our supposition that
Blimp-1 repression proceeds by an active mechanism, since DNA binding is not sufficient to yield repression.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 2.
Mutational analysis of Blimp-1 domains required for
repression of the c-myc promoter. (A) One microgram of a
luciferase reporter driven by the c-myc promoter
( 1100/+580) was transfected into 18-81 cells with plasmids encoding
full-length HA-Blimp-1 (wt) or various HA-tagged Blimp-1 deletion
mutants (H1 to H4) (schematic structures of mutations are shown at
left) or a vector with Blimp-1 cDNA inserted in a reverse direction
(Control). Cells were harvested 16 h after transfection, and
luciferase activity was measured. (B) Ten micrograms of the HA-tagged
Blimp-1 deletion constructs (H1 to H4) shown in panel A was transfected
into 293T cells. Thirty-six hours later, whole-cell extracts were made
and subjected to immunoblotting with a monoclonal antibody recognizing
the HA tag (12CA5). The HA-tagged proteins are indicated by arrows.
Transfection results are averages of three or more independent
transfections, and error bars show 1 standard deviation from the
mean.
|
|
Another characteristic of active repressors is that they can repress
transcription in a Gal4-fusion protein assay in which
DNA binding is
mediated by a heterologous domain. Therefore, the
ability of Blimp-1
fused to the Gal4DBD (Gal4DBD-Blimp-1) to repress
a synthetic thymidine
kinase (tk) promoter containing four Gal4
binding sites,
(Gal4)
4-tk, was tested. We also fused the Blimp-1
N-terminal acidic domain, the PR domain, the proline-rich domain,
and
the C-terminal acidic domain with the Gal4DBD and confirmed
their
expression following transient transfection into 293T cells
by
immunoblotting with antibody recognizing Gal4DBD (Fig.
3A).
Full-length Blimp-1-Gal4DBD
repressed the (Gal4)
4-tk promoter
(Fig.
3B), but not a tk
promoter lacking Gal4 binding sites (data
not shown), upon
cotransfection into 18-81 pre-B cells. However,
none of the fusion
proteins containing individual Blimp-1 domains
showed complete
repression (Fig.
3B). Partial repression was observed
with the
N-terminal acidic and PR domains. Interestingly, the
isolated
C-terminal acidic domain activated the (Gal4)
4-tk promoter
(Fig.
3B). Thus, these data also support the notion that Blimp-1
is an
active repressor and show that complete repression in this
assay
requires portions of the Blimp-1 protein not included in
the individual
domain fusion proteins we tested.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 3.
Repression by Blimp-1 in a Gal4 fusion protein assay.
(A) Ten micrograms of expression plasmids encoding proteins with
wild-type Blimp-1 (wt) or different structural motifs of Blimp-1 (G1,
N-terminal acidic domain; G2, PR domain; G3, proline-rich domain; G4,
C-terminal acidic domain) (schematic diagram of mutations are shown in
panel B) fused to the Gal4DBD or, as a control, Gal4DBDs
(28) were transfected into 293T cells. Whole-cell extracts
made 36 h after transfection were subjected to immunoblotting with
a polyclonal antibody recognizing Gal4DBD. Fusion proteins are
indicated by arrows. (B) 18-81 cells were transfected with a luciferase
reporter fused to a tk promoter which harbors four Gal4 DNA binding
sites and with 10 µg of wild-type Blimp-1 (wt) or various Gal4-fusion
Blimp-1 domains (G1 to G4) or an empty vector which expressed only
Gal4DBD (28). Sixteen hours later, cells were harvested and
luciferase activity was measured. Transfection results are averages of
three or more independent transfections, and error bars show 1 standard
deviation from the mean.
|
|
Blimp-1 associates directly with HDAC2 through two independent
association domains.
The mechanism of action of some active
repressors involves recruitment of HDACs (16, 48, 64).
Therefore, we wished to determine if recruitment of HDAC was involved
in Blimp-1-dependent repression. First, we used a coimmunoprecipitation
assay to determine whether ectopically expressed Blimp-1 and HDAC2
associated in vivo. HA-tagged Blimp-1 and Flag-tagged HDAC2 were
expressed in transiently transfected 293T cells. When Blimp-1 was
immunoprecipitated with a monoclonal antibody against the HA epitope,
HDAC-2 in the immunoprecipitate was easily detected by a monoclonal
antibody recognizing the Flag tag (Fig.
4A, lane 6); however, a control Flag-tagged protein was not detected in the immunoprecipitate (Fig. 4A,
lane 5). In addition, when HDAC2 was immunoprecipitated with Flag
monoclonal antibody, Blimp-1, detected by the HA monoclonal antibody,
was present in the immunoprecipitate (Fig. 4B). Similar results were
obtained with Flag-tagged HDAC1 in the coimmunoprecipitation assay
(data not shown). HDAC family proteins (HDAC1 to -3) are more than 50%
homologous and ubiquitously expressed (67); thus, we assume
that they function similarly. These data show that Blimp-1 and HDAC1 or
HDAC2 are present in the same complex under these experimental
conditions.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 4.
In vivo association between Blimp-1 and HDAC2. (A) 293T
cells were cotransfected with an expression plasmid encoding HA-Blimp-1
(lanes 2, 3, 5, and 6) or, as a control, empty vector (lanes 1 and 4)
and Flag-HDAC2 (lanes 1, 3, 4, and 6) or an expression plasmid encoding
Flag tag control protein Flag-p125 (lanes 2 and 5). Immunoblots were
developed with M2 monoclonal antibody to the Flag epitope on either
lysates of transfected cells (left) or immunoprecipitates (IP) using
monoclonal antibody 12CA5 against the HA epitope from transfected cells
(right). Positions of expected Flag-tagged proteins are marked with
arrows. (B) 293T cells were cotransfected with HA-Blimp-1 expression
plasmids (lanes 1 and 2) and Flag-HDAC2 (lane 2) or an expression
construct of Flag tag control protein Flag-p125 (lane 1). Immunoblots
were developed with monoclonal 12CA5 HA antibody on immunoprecipitates
(IP) using monoclonal M2 Flag antibody from transfected cells.
|
|
Most repressors recruit HDACs via bridging molecules (
1,
20,
21,
33,
36,
46,
69). However, we were unable to
detect association of
Blimp-1 with Sin3 by using coimmunoprecipitation
and a yeast two-hybrid
assay (data not shown) or with NCoR by
using a coimmunoprecipitation
assay (data not shown). Therefore,
we asked if Blimp-1 associated
directly with HDAC2 by using a
GST fusion protein assay (
2).
In this experiment, a GST-HDAC2
fusion protein was expressed in
bacteria and purified by binding
to glutathione agarose beads.
35S-labeled Blimp-1 and mutant forms of Blimp-1,
synthesized in
vitro, were adjusted to be present at comparable amounts
in the
reaction mixtures, which were subsequently tested for their
ability
to associate with the immobilized GST-HDAC2 (Fig.
5A).
Blimp-1
was retained by the GST-HDAC2
matrix but not by the control GST
matrix (Fig.
5B, lanes B1). Similar
results were obtained with
GST-HDAC1 (data not shown). We also observed
binding of HDAC2
to Blimp-1 by using HA-tagged Blimp-1 that was
immunopurified
from transiently transfected 293T cells by using beads
coated
with antibody against the epitope tag (data not shown). These
data strongly suggest that Blimp-1 binds directly to HDAC1 and
HDAC2;
however, we cannot formally rule out the possibility that
a tightly
bound bridging protein, present in the in vitro synthesis
reaction
mixture and tightly bound during immunopurification,
is involved. The
data are also consistent with the hypothesis
that Blimp-1 represses
transcription by recruiting HDACs.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 5.
Blimp-1 contains two regions which independently
associate with HDAC2. (A) Autoradiograph of
[35S]Met-labeled full-length Blimp-1 (B1) and deletion
mutants (B2 to B12) synthesized in vitro after resolution on SDS-PAGE
gel (panel C, schematic diagram of the various mutations). The in
vitro-translated Blimp-1 full-length and deletion mutants are indicated
by arrows. (B) Equivalent amounts of glutathione beads with immobilized
and purified GST-HDAC2 (lanes H) or GST control (lanes G) were mixed
with equivalent amounts of the in vitro-translated Blimp-1 proteins.
The beads were washed thoroughly, and bound proteins were eluted with
SDS loading buffer before analysis on SDS-PAGE gels. The retained
signals of Blimp-1 full-length and deletion mutants are marked by
arrows. (C) Summary of Blimp-1 deletion mutations and their abilities
to associate with HDAC2 in this assay. The two domains required for
HDAC2 binding were shown on the bottom labeled as AD1 and AD2; only AD1
has been shown to be sufficient to mediate the association.
|
|
The GST assay was also used to identify the domains of Blimp-1 which
were required for association with HDAC2 by testing a
series of Blimp-1
truncation and deletion mutants. Mutant B8 (aa
557 to 714), which
includes most of the Blimp-1 Zn finger region
and 51 amino acids
N-terminal to the first zinc finger, was identified
as a minimal
fragment of Blimp-1, which was sufficient to associate
with HDAC2 (Fig.
5B, lanes B6 to B8). This region contains the
two zinc finger domains
that are essential for sequence-specific
DNA binding (
31).
However, when a Blimp-1 mutant with an internal
deletion of this HDAC
association domain, B9 (

aa 557 to 714),
was tested, it still
associated with HDAC2 (Fig.
5B). This suggested
the existence of
another, independent HDAC2 association domain
in Blimp-1. Therefore, a
second series of Blimp-1 mutants, all
containing the aa 557-to-714
deletion, was tested for their ability
to associate with HDAC2. This
study revealed another HDAC2 association
domain located between aa 312 and 492, which spans the proline-rich
region (Fig.
5B, lanes B10 and
B11). A Blimp-1 mutant with both
domains deleted, B12, lost its ability
to associate with HDAC2,
suggesting that there are no more HDAC2
association domains in
Blimp-1. These data, summarized in Fig.
5C,
identified two domains
of Blimp-1 which associate independently with
HDAC2 and showed
that aa 557 to 714 comprise a minimal HDAC association
domain.
We also wished to determine if Blimp-1 and HDAC associated when the
proteins were present at endogenous levels in vivo. Nuclear
extracts
from P3X plasmacytoma cells, which express Blimp-1, were
used in EMSA
experiments with an oligonucleotide probe containing
the
c-
myc Blimp-1 site. Two complexes that competed with
specific
but not with nonspecific oligonucleotide competitors were
observed
(Fig.
6, lanes 2 to 4). Previous
work has shown that antiserum
against Blimp-1 ablates all complexes
which bind specifically
to this site (
40). Antibody against
HDAC1, but not a control
antibody, strongly inhibited formation of both
Blimp-1 complexes
(Fig.
6, lanes 5 and 6). However, neither anti-HDAC1
nor control
antiserum altered an unrelated protein-DNA complex formed
on the
µE3 site from the immunoglobulin heavy chain intronic enhancer
(Fig.
6, lanes 7 to 9), demonstrating that anti-HDAC1 does not
ablate
protein-DNA complexes nonspecifically. We conclude that
endogenous
HDAC1, or protein immunologically related to it, is
present in these
complexes containing DNA and Blimp-1. Ablation
of binding by antibodies
to HDAC is consistent with our finding
that one domain of Blimp-1 which
associates with HDAC completely
overlaps the zinc finger motifs that
confer DNA binding (
31).
The components of the minor, lower
mobility complex are not known;
it could contain Blimp-1 associated
with two molecules of HDAC,
Blimp-1 associated with both HDAC and
Groucho (
50), or Blimp-1
associated with HDAC and an
unidentified protein. The absence
of a higher mobility complex binding
the probe shows that free
Blimp-1, not associated with HDAC, is not
detectable in this assay,
implying nearly stoichiometric association of
Blimp-1 with HDAC.
These data show that Blimp-1 and HDAC, present at
endogenous concentrations
in plasmacytoma cells, associate with one
another and that Blimp-1
can recruit HDAC to DNA.

View larger version (94K):
[in this window]
[in a new window]
|
FIG. 6.
Blimp-1 associated with HDAC binds to the
c-myc promoter. In lanes 1 to 6, [ -32P]ATP-labeled oligonucleotides corresponding to
the c-myc Blimp-1 binding site
(5'CGCGTACAGAAAGGGAAAGGACTAG3' and
5'CGCGCTAGTCCTTTCCCTTTCTGTA3') were used with P3X nuclear
extracts in the presence or absence of unlabeled oligonucleotide
competitors or anti-HDAC1 or control antiserum, as indicated. The
competitors were added in 50-fold molar excess. S, specific competitor;
NS, nonspecific competitor. In lanes 7 to 9, [ -32P]ATP-labeled oligonucleotides corresponding to
the µE3 site of the immunoglobulin heavy chain enhancer were used
with P3X nuclear extracts in the presence of anti-HDAC1 or control
antiserum, as indicated.
|
|
Blimp-1-dependent repression requires HDAC activity.
The
association between Blimp-1 and HDAC2 suggested that Blimp-1 might
repress transcription by recruiting HDACs to the target promoter. To
test this hypothesis, we first measured the ability of GAL4DBD-Blimp-1
fusion proteins to repress the (Gal4)4-tk promoter in the
presence of TSA, an inhibitor of HDAC activity (60, 68). Full-length Blimp-1 fused to the Gal4DBD repressed the
(Gal4)4-tk promoter upon cotransfection into 18-81 pre-B
cells in a Gal4 binding site-dependent manner (Fig.
7A). However, in the presence of 100 ng
of TSA/ml, Blimp-1-dependent repression was abolished (Fig. 7A).


View larger version (1211K):
[in this window]
[in a new window]
|
FIG. 7.
Recruitment of HDAC is sufficient for Blimp-1 repression
in the Gal4 assay. (A) Expression plasmids encoding Gal4DBD-Blimp-1
fusion protein (Gal4-Blimp-1) or a vector which expresses only Gal4DBD
(Control) were cotransfected into 18-81 cells with the
(Gal4)4-tk promoter driving the luciferase gene or tk-Luc
(which lacks Gal4DNA binding sites). Where indicated, transfected cells
were treated with the HDAC inhibitor TSA at 100 ng/ml after
transfection. Cells were harvested 16 h after transfection, and
luciferase activities were measured. (B) Ten micrograms of expression
plasmid encoding Gal4DBD-Blimp-1 with internal deletions of aa 312 to
492 and aa 557 to 714 (which cannot bind HDAC2; refer to Fig. 5) or
Gal4-Blimp-1 containing only aa 557 to 714 (which is sufficient to bind
HDAC2; refer to Fig. 5) was cotransfected into 18-81 cells with 2 µg
of (Gal4)4-tkLuc. A plasmid which expresses full-length
Blimp-1 fused to Gal4DBD (Gal4-Blimp-1) was used as a positive control,
and one which expresses Gal4DBD (Control) was used as a vector control.
Transfection results are averages of three or more independent
transfections, and error bars show 1 standard deviation from the
mean.
|
|
We also tested whether the association of Blimp-1 with HDAC2 correlated
with its ability to repress transcription. Gal4DBD
fusion proteins were
made with the minimal Blimp-1 fragment (aa
574 to 714), which
associates with HDAC2 (Fig.
7B) and the association
defective deletion
mutant of Blimp-1 (Fig.
5C, 12). Expression
of both fusion proteins
was confirmed by immunoblotting after
transient transfection into 293T
cells (data not shown). Upon
cotransfection, Gal4DBD-Blimp-1(574-714)
repressed the (Gal4)
4-tk
promoter as well as wild-type
Blimp-1 while the association-defective
mutant B12 failed to repress
transcription (Fig.
7B). Repression
by Gal4-Blimp-1 (574-714) was also
inhibited in the presence of
TSA (data not shown). Thus,
Blimp-1-dependent repression in this
assay correlates with the ability
of Blimp-1 to associate with
HDAC2. We conclude that deacetylase
activity is required for Blimp-1
repression on the synthetic
(Gal4)
4-tk promoter and that recruitment
of HDAC is one
mechanism by which Blimp-1 represses
transcription.
However, a more physiologically relevant question is whether HDAC
activity is required for Blimp-1 repression on the c-
myc promoter, which is a natural target for Blimp-1 repression during
terminal differentiation of B lymphocytes (
40). A similar
approach
using the inhibitor TSA in a cotransfection assay was employed
to test this possibility. The results show that treatment of 18-81
pre-B cells with TSA significantly inhibits Blimp-1-dependent
repression of the c-
myc promoter (Fig.
8). These data suggest
that recruitment
of HDAC is required for Blimp-1-dependent repression
of a natural
target, the c-
myc promoter.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 8.
HDAC activity is required for Blimp-1 repression on the
c-myc promoter. Ten micrograms of Blimp-1 expression plasmid
or a control with Blimp-1 cDNA inserted in reverse orientation were
transfected into 18-81 cells with 1 µg of the c-myc
promoter ( 1100/+580) driving a luciferase reporter. Immediately after
transfection, cells were split into two parts and were subjected to
either treatment with 100 ng of TSA/ml or no treatment before being
harvested 16 h later. Data shown are the averages of nine
independent transfections, and error bars show 1 standard deviation
from the mean.
|
|
Blimp-1 expression causes deacetylation of histone H3 bound to the
c-myc promoter.
To test further the hypothesis that
histone deacetylation is involved in Blimp-1-dependent repression of
c-myc transcription, we employed the recently developed ChIP
approach (43). In this assay, histones in chromatin are
cross-linked to DNA and acetylated histone H3 in chromatin is
immunoprecipitated; DNA sequences of interest are then amplified by
PCR. Under these conditions, a decrease in the amount of the PCR
product will reflect a decrease in acetylated histone H3 bound to the
amplified sequence. 18-81 cells were cotransfected with luciferase
reporters dependent on either a wild-type c-myc promoter or
a c-myc promoter containing a mutation in the Blimp-1
binding site (27) and with an expression plasmid for Blimp-1
or a control plasmid. As previously reported (40),
luciferase assays showed that Blimp-1 repressed the c-myc promoter approximately fivefold (data not shown). Transfected cells
were treated with formaldehyde to covalently cross-link histones to
DNA, and chromatin was isolated, fragmented, and immunoprecipitated with antibodies to acetylated histone H3, as previously described (43). Acetylated chromatin in the immunoprecipitates was
purified, and following removal of the cross-links, c-myc
promoter DNA sequences in the immunoprecipitates were detected by PCR
using specific primers for the transfected promoter. The linearity of
the PCR was obtained by amplification of twofold serial dilutions of
the DNA samples, and PCR products were quantitated by a phosphorimager. c-myc sequences were readily amplified after the ChIP assay
was performed on cells cotransfected with the c-myc promoter
and a control plasmid; in contrast, expression of Blimp-1 caused an approximately 70% decrease in the amount of c-myc promoter
sequences associated with acetylated histone H3 (Fig.
9, top panels). However, expression of
Blimp-1 did not alter the amount of acetylated histone H3 associated
with the c-myc promoter lacking a Blimp-1 binding site (Fig.
9, lower panels), thus showing that the observed changes in histone H3
acetylation depend on binding of Blimp-1 to its cognate site in the
c-myc promoter.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 9.
Blimp-1 expression causes deacetylation of histone H3
bound to the c-myc promoter. Top, a luciferase reporter
driven by the c-myc promoter was cotransfected into 18-81 pre-B cells along with control (left) or Blimp-1 expression (right)
plasmids. Bottom, a luciferase reporter driven by the c-myc
promoter containing a mutation in the Blimp-1 site was cotransfected
into 18-81 pre-B cells along with control (left) or Blimp-1 expression
(right) plasmids. Transfected cells were cross-linked and subjected to
the ChIP assay. The chromosomal immunoprecipitations were performed
with either anti-acetylated histone H3 ( Ac-H3) or control antibody
(Ab) (as indicated). Twofold serial dilutions of DNA recovered after
immunoprecipitation with the indicated antibody were amplified by PCR
assay using primers specific for the c-myc promoter. PCR
products were analyzed by Southern blot hybridization with an internal
probe recognizing the amplified c-myc promoter.
|
|
We conclude that Blimp-1 causes deacetylation of histone H3 associated
with the c-
myc promoter in vivo. These data are consistent
with the TSA-dependent inhibition of Blimp-1 repression shown
in Fig.
7
and provide additional support for the idea that recruitment
of HDAC is
important for Blimp-1-dependent repression of the c-
myc promoter in
vivo.
 |
DISCUSSION |
Blimp-1 is a transcriptional repressor that is capable of
initiating a program of terminal differentiation in BCL1
lymphoma cells (62). The c-myc gene is a
physiologically important target for Blimp-1 in B cells
(40), and it is therefore reasonable to study the mechanism
of Blimp-1 repression in the context of c-myc transcription.
We have presented data showing that Blimp-1 is an active repressor of
the c-myc promoter and that its activity is independent of
an adjacently bound activator, YY1. We identified two regions of the
Blimp-1 protein that associate with HDACs and showed that endogenous
Blimp-1 and HDAC associate and that the complexes bind DNA. Finally, we
showed that HDAC activity is necessary for Blimp-1-dependent repression
and that Blimp-1 expression causes deacetylation of histone H3
associated with the c-myc promoter. Thus, our study shows
that recruitment of HDACs is one mechanism by which Blimp-1 represses transcription.
Active repression by Blimp-1.
Several lines of evidence
indicate that Blimp-1 is an active repressor that does not mediate
repression simply by interfering with the binding or function of an
activator. First, even though Blimp-1 binds very close to the activator
YY1 on the c-myc promoter, Blimp-1 and YY1 act independently
of one another. Blimp-1 repression does not depend on binding or
transcriptional activating properties of YY1 (Fig. 1). Secondly,
truncation mutants of Blimp-1 that retain the ability to bind DNA are
unable to repress the c-myc promoter (Fig. 2), showing that
DNA binding is not sufficient to cause transcriptional repression.
Finally, both full-length Blimp-1 and an isolated domain of Blimp-1 (aa
557 to 714) are sufficient to repress transcription in the Gal4-fusion
protein assay (Fig. 3), demonstrating that repression is independent of binding to a Blimp-1 site and can occur on a synthetic promoter where
YY1 and other c-myc transcriptional activators do not bind.
However, these data do not rule out the possibility that Blimp-1 may
also repress transcription on some promoters by interfering
with the
binding of a transcriptional activator. Blimp-1 binding
sites in both
the c-
myc and INF-

promoters are very similar to
interferon-stimulated response element sites (
11,
27,
31,
34) and Blimp-1 might displace or compete with interferon
regulatory
factor 1 (IRF-1), interferon-stimulated gene factor 3, or
other
activators which recognize the same sites. Our previous studies
failed to detect any protein other than Blimp-1 binding to the
Blimp-1
site in the c-
myc promoter in B-cell lines (
27,
40),
so this mechanism does not appear to play a role for
c-
myc repression.
However, the human homolog of Blimp-1,
PRD1-BF1, binds to a site
on the IFN-

promoter that is also
recognized by the activators
IRF-1 and IRF-3 (
38,
56). It
has been suggested that Blimp-1
displaces positive regulatory proteins
to limit the expression
of IFN-

following viral infection. It is
possible that in other
Blimp-1 target genes yet to be identified, the
Blimp-1 site can
be recognized by IRF family activators as well as by
Blimp-1.
In these cases, Blimp-1 would repress transcription by a
combination
of active and passive
mechanisms.
Blimp-1 repression domains.
In the context of the
c-myc promoter, multiple domains of Blimp-1 appear to be
required for repression (Fig. 2). As discussed below, a role for HDAC
activity is established by the inhibitor studies and the ChIP assay.
However, recruitment of HDAC was not sufficient for Blimp-1 to repress
the c-myc promoter since Blimp-1 mutants H1 and H2 contain
one or both domains which associate with HDAC but are unable to repress
transcription (Fig. 2). It may be that HDAC is the only protein which
needs to associate with Blimp-1 for it to act as a repressor and the
truncation and deletion mutants which retain HDAC association domains
have an abnormal three-dimensional conformation which does not allow
efficient recruitment of HDAC on the c-myc promoter. This is
consistent with the finding that some domains required for repression,
such as the N-terminal acidic region, were unable or only partially able to repress transcription independently in the Gal4-fusion protein
assay, whereas one HDAC association domain of Blimp-1 (aa 557 to 714)
was sufficient to repress in this assay (Fig. 7). However, it is not
consistent with our demonstration that mutant forms of Blimp-1
associate with HDAC in the GST assay in vitro (Fig. 5) and in the
coimmunoprecipitation assay in vivo (data not shown). These data
indicate that the truncation and deletion mutants of Blimp-1 do retain
the ability to associate with HDAC.
Therefore, we favor an alternate explanation, which is that mechanisms
in addition to recruitment of HDAC are required for
Blimp-1-dependent
repression in the context of the c-
myc promoter.
The
c-
myc promoter has binding sites for multiple
transcriptional
activators and is subject to complex regulation
(
44) and is
thus more complicated than that of the synthetic
(Gal4)
4-tk promoter,
where recruitment of HDAC appears to
be sufficient for transcriptional
repression (Fig.
7). The fact that
TSA treatment did not completely
inhibit Blimp-1 repression on the
c-
myc promoter (Fig.
8) also
supports the notion that
Blimp-1 has more than one repression
mechanism. Additional proteins may
associate with Blimp-1 to mediate
other mechanisms of repression in the
context of the c-
myc promoter.
Consistent with this
suggestion, a yeast two-hybrid screen has
recently shown that the
proline-rich region of Blimp-1 associates
with the murine homolog of
Groucho (
50). We do not currently
know how association with
Groucho may affect the ability of Blimp-1
to associate with HDAC, but
since Blimp-1 contains two domains
that can associate with HDAC, it
seems likely that Groucho and
HDAC could associate simultaneously with
Blimp-1. There is precedent
for proteins mediating transcriptional
repression to associate
with HDAC and other proteins since the
corepressor SMRT has been
shown to recruit both HDAC and TFIIB
(
65).
HDAC recruitment and Blimp-1 repression.
Our work shows that
for Blimp-1, like several other transcriptional repressors (16,
48, 64), HDAC activity is important for transcriptional
repression. Most currently described transcription factors that repress
transcription via HDACs require corepressors such as Sin3, SMRT/NcoR,
RbAp-46, RbSp-48, Ski, SAP18, or SAP30 (1, 8, 9, 20, 21, 32, 33,
36, 46, 47, 69). These corepressors act as a bridge between the
DNA binding protein and HDACs. However, Blimp-1 appears to associate
directly with HDAC1 and HDAC2 (Fig. 5), and we have been unable to
detect association between Blimp-1 and Sin3 or NcoR. Thus, Blimp-1 is
similar to proteins such as the Rb family proteins, YY1, PLZF, and
Bcl-6, that have been reported to associate directly with HDAC. Our
EMSAs further show that Blimp-1 and HDAC, present at endogenous levels in plasmacytoma nuclear extracts, associate with one another (Fig. 6).
Similar studies have been used to show the association of NF-
B p65
with CBP/p300 (70). These data provide direct evidence that
Blimp-1 recruits HDAC to DNA.
The two HDAC association domains on Blimp-1, a proline-rich region and
a Zn finger region, show no obvious homology with the
other currently
identified HDAC association motifs, such as the
LXCXE-like motif on Rb
family proteins (
12), a 30-amino-acid
glycine-rich region on
YY1 (
66), or the POZ domains on Bcl6
and PLZF (
9,
15,
39). Different protein association surfaces
of HDACs may be
involved in association with different partners,
or the association
motifs on the partners may have a common three-dimensional
structure
which is not readily apparent by inspection of their
primary sequences.
Alternatively, a bridging protein might be
involved since for Blimp-1,
as well as other proteins such as
Rb and YY1, the possible involvement
of a bridging protein has
not been definitively ruled out. Further
analyses will be necessary
to define the precise protein-protein
interactions and domains
involved between HDAC and its
partners.
The HDAC inhibitor TSA inhibits Blimp-1's ability to repress
transcription, both in a Gal4 assay and when assayed with the
natural
c-
myc promoter (Fig.
8). In addition, our ChIP studies
show
that expression of Blimp-1 leads to deacetylation of histone
H3 bound
to the c-
myc promoter and to concommitant repression
of
c-
myc promoter activity (Fig.
9). Both histone deacetylation
and transcriptional repression of this promoter depend on the
presence
of the Blimp-1 binding site. Thus, the functional importance
of HDAC
recruitment by Blimp-1 is supported by two different but
complementary
experimental
approaches.
 |
ACKNOWLEDGMENTS |
We are grateful to Gerald Siu and Xiaoming Zou for critically
reading the manuscript and to Dimitrios Thanos and members of the
Calame laboratory for many helpful discussions. We thank Wen-Ming Yang
and Edward Seto for HDAC2 cDNA, Christian Hassig and Stuart Schrieber
for HDAC1 cDNA, and Leila Alland and Ron DePinho for testing the
interaction between Blimp-1 and mSin3. We are grateful to D. Thanos and
T. Maniatis and members of their laboratories for advice on the ChIP
assay and to S. Ghosh and members of his lab for advice on EMSA protocol.
This work was supported by USPHS grant RO1 AI 43576 to K.C.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Dept. of
Microbiology, Columbia Univ. College of Physicians & Surgeons, 1208 Hammer Hlth. Sci. Ctr., MB 122, 701 West 168th St., New York, NY 10032. Phone: (212) 305-3504. Fax: (212) 305-1468. E-mail:
KLC1{at}columbia.edu.
 |
REFERENCES |
| 1.
|
Alland, L.,
R. Muhle,
H. Hou, Jr.,
J. Potes,
L. Chin,
N. Schreiber-Agus, and R. A. DePinho.
1997.
Role for N-CoR and histone deacetylase in Sin3-mediated transcriptional repression.
Nature
387:49-55[CrossRef][Medline].
|
| 2.
|
Artandi, S., and K. Calame.
1993.
Association of DNA-binding transcription activators in solution, p. 267-279.
In
K. Adolph (ed.), Methods in molecular genetics., vol. I. Academic Press, New York, N.Y.
|
| 3.
|
Blackman, M. A.,
M. A. Tigges,
M. E. Minie, and M. E. Koshland.
1986.
A model system for peptide hormone action in differentiation: interleukin 2 induces a B lymphoma to transcribe the J chain gene.
Cell
47:609-617[CrossRef][Medline].
|
| 4.
|
Boss, J. M.
1997.
Regulation of transcription of MHC class II genes.
Curr. Opin. Immunol.
9:107-113[CrossRef][Medline].
|
| 5.
|
Buyse, I. M.,
G. Shao, and S. Huang.
1995.
The retinoblastoma protein binds to RIZ, a zinc-finger protein that shares an epitope with the adenovirus E1A protein.
Proc. Natl. Acad. Sci. USA
92:4467-4471[Abstract/Free Full Text].
|
| 6.
|
Coppola, J. A., and M. D. Cole.
1986.
Constitutive c-myc oncogene expression blocks mouse erythroleukaemia cell differentiation but not commitment.
Nature
320:760-763[CrossRef][Medline].
|
| 7.
|
Cowell, I. G.
1994.
Repression versus activation in the control of gene transcription.
Trends Biochem. Sci.
19:38-42[CrossRef][Medline].
|
| 8.
|
David, G.,
L. Alland,
S. H. Hong,
C. W. Wong,
R. A. DePinho, and A. Dejean.
1998.
Histone deacetylase associated with mSin3A mediates repression by the acute promyelocytic leukemia-associated PLZF protein.
Oncogene
16:2549-2556[CrossRef][Medline].
|
| 9.
|
Dhordain, P.,
R. J. Lin,
S. Quief,
D. Lantoine,
J. P. Kerckaert,
R. M. Evans, and O. Albagli.
1998.
The LAZ3(BCL-6) oncoprotein recruits a SMRT/mSIN3A/histone deacetylase containing complex to mediate transcriptional repression.
Nucleic Acids Res.
26:4645-4651[Abstract/Free Full Text].
|
| 10.
|
Dmitrovsky, E.,
W. M. Kuehl,
G. F. Hollis,
I. R. Kirsch,
T. P. Bender, and S. Segal.
1986.
Expression of a transfected human c-myc oncogene inhibits differentiation of a mouse erythroleukaemia cell line.
Nature
322:748-750[CrossRef][Medline].
|
| 11.
|
Fan, C. M., and T. Maniatis.
1989.
Two different virus-inducible elements are required for human beta-interferon gene regulation.
EMBO J.
8:101-110[Medline].
|
| 12.
|
Ferreira, R.,
L. Magnaghi-Jaulin,
P. Robin,
A. Harel-Bellan, and D. Trouche.
1998.
The three members of the pocket proteins family share the ability to repress E2F activity through recruitment of a histone deacetylase.
Proc. Natl. Acad. Sci. USA
95:10493-10498[Abstract/Free Full Text].
|
| 13.
|
Fisher, A. L., and M. Caudy.
1998.
Groucho proteins: transcriptional corepressors for specific subsets of DNA-binding transcription factors in vertebrates and invertebrates.
Genes Dev.
12:1931-1940[Free Full Text].
|
| 14.
|
Geraudie, J.,
J. Hourdry,
S. Vriz,
M. Singer, and M. Mechali.
1990.
Enhanced c-myc gene expression during forelimb regenerative outgrowth in the young Xenopus laevis.
Proc. Natl. Acad. Sci. USA
87:3797-3801[Abstract/Free Full Text].
|
| 15.
|
Grignani, F.,
S. De Matteis,
C. Nervi,
L. Tomassoni,
V. Gelmetti,
M. Cioce,
M. Fanelli,
M. Ruthardt,
F. F. Ferrara,
I. Zamir,
C. Seiser,
M. A. Lazar,
S. Minucci, and P. G. Pelicci.
1998.
Fusion proteins of the retinoic acid receptor-alpha recruit histone deacetylase in promyelocytic leukaemia.
Nature
391:815-818[CrossRef][Medline].
|
| 16.
|
Grunstein, M.
1997.
Histone acetylation in chromatin structure and transcription.
Nature
389:349-352[CrossRef][Medline].
|
| 17.
|
Guan, K. L., and J. E. Dixon.
1991.
Eukaryotic proteins expressed in Escherichia coli: an improved thrombin cleavage and purification procedure of fusion proteins with glutathione S-transferase.
Anal. Biochem.
192:262-267[CrossRef][Medline].
|
| 18.
|
Hagman, J.,
C. Belanger,
A. Travis,
C. W. Turck, and R. Grosschedl.
1993.
Cloning and functional characterization of early B-cell factor, a regulator of lymphocyte-specific gene expression.
Genes Dev.
7:760-773[Abstract/Free Full Text].
|
| 19.
|
Hansen, U.,
D. G. Tenen,
D. M. Livingston, and P. A. Sharp.
1981.
T antigen repression of SV40 early transcription from two promoters.
Cell
27:603-613[CrossRef][Medline].
|
| 20.
|
Hassig, C. A.,
T. C. Fleischer,
A. N. Billin,
S. L. Schreiber, and D. E. Ayer.
1997.
Histone deacetylase activity is required for full transcriptional repression by mSin3A.
Cell
89:341-347[CrossRef][Medline].
|
| 21.
|
Heinzel, T.,
R. M. Lavinsky,
T. M. Mullen,
M. Soderstrom,
C. D. Laherty,
J. Torchia,
W. M. Yang,
G. Brard,
S. D. Ngo,
J. R. Davie,
E. Seto,
R. N. Eisenman,
D. W. Rose,
C. K. Glass, and M. G. Rosenfeld.
1997.
A complex containing N-CoR, mSin3 and histone deacetylase mediates transcriptional repression.
Nature
387:43-48[CrossRef][Medline].
|
| 22.
|
Herschbach, B. M., and A. D. Johnson.
1993.
Transcriptional repression in eukaryotes.
Annu. Rev. Cell Biol.
9:479-509[CrossRef].
|
| 23.
|
Hoffman, L. B., and D. A. Liebermann.
1991.
Suppression of c-myc and c-myb is tightly linked to terminal differentiation induced by IL6 or LIF and not growth inhibition in myeloid leukemia cells.
Oncogene
6:903-909[Medline].
|
| 24.
|
Johnson, A. D.
1995.
The price of repression.
Cell
81:655-658[CrossRef][Medline].
|
| 25.
|
Johnson, F. B., and M. A. Krasnow.
1992.
Differential regulation of transcription preinitiation complex assembly by activator and repressor homeo domain proteins.
Genes Dev.
6:2177-2189[Abstract/Free Full Text].
|
| 26.
|
Kakkis, E., and K. Calame.
1987.
A plasmacytoma-specific factor binds the c-myc promoter region.
Proc. Natl. Acad. Sci. USA
84:7031-7035[Abstract/Free Full Text].
|
| 27.
|
Kakkis, E.,
K. J. Riggs,
W. Gillespie, and K. Calame.
1989.
A transcriptional repressor of c-myc.
Nature
339:718-721[CrossRef][Medline].
|
| 28.
|
Kang, T.,
T. Martins, and I. Sadowski.
1993.
Wild type GAL4 binds cooperatively to the GAL1-10 UASG in vitro.
J. Biol. Chem.
268:9629-9635[Abstract/Free Full Text].
|
| 29.
|
Kaplan, J., and K. Calame.
1997.
The ZiN/POZ domain of ZF5 is required for both transcriptional activation and repression.
Nucleic Acids Res.
25:1108-1116[Abstract/Free Full Text].
|
| 30.
|
Kato, G. J., and C. V. Dang.
1992.
Function of the c-Myc oncoprotein.
FASEB J.
6:3065-3072[Abstract].
|
| 31.
|
Keller, A. D., and T. Maniatis.
1991.
Identification and characterization of a novel repressor of beta-interferon gene expression.
Genes Dev.
5:868-879[Abstract/Free Full Text].
|
| 32.
|
Laherty, C. D.,
A. N. Billin,
R. M. Lavinsky,
G. S. Yochum,
A. C. Bush,
J. M. Sun,
T. M. Mullen,
J. R. Davie,
D. W. Rose,
C. K. Glass,
M. G. Rosenfeld,
D. E. Ayer, and R. N. Eisenman.
1998.
SAP30, a component of the mSin3 corepressor complex involved in N-CoR-mediated repression by specific transcription factors.
Mol. Cell
2:33-42[CrossRef][Medline].
|
| 33.
|
Laherty, C. D.,
W. M. Yang,
J. M. Sun,
J. R. Davie,
E. Seto, and R. N. Eisenman.
1997.
Histone deacetylases associated with the mSin3 corepressor mediate mad transcriptional repression.
Cell
89:349-356[CrossRef][Medline].
|
| 34.
|
Levy, D. E.,
D. S. Kessler,
R. Pine,
N. Reich, and J. E. Darnell, Jr.
1988.
Interferon-induced nuclear factors that bind a shared promoter element correlate with positive and negative transcriptional control.
Genes Dev.
2:383-393[Abstract/Free Full Text].
|
| 35.
|
Li, C., and J. L. Manley.
1998.
Even-skipped represses transcription by binding TATA binding protein and blocking the TFIID-TATA box interaction.
Mol. Cell. Biol.
18:3771-3781[Abstract/Free Full Text].
|
| 36.
|
Li, H.,
C. Leo,
D. J. Schroen, and J. D. Chen.
1997.
Characterization of receptor interaction and transcriptional repression by the corepressor SMRT.
Mol. Endocrinol.
11:2025-2037[Abstract/Free Full Text].
|
| 37.
|
Liebermann, D. A., and B. Hoffman.
1994.
Differentiation primary response genes and proto-oncogenes as positive and negative regulators of terminal hematopoietic cell differentiation.
Stem Cells (Dayton)
12:352-369[Abstract].
|
| 38.
|
Lin, R.,
A. Mustafa,
H. Nguyen,
D. Gewert, and J. Hiscott.
1994.
Mutational analysis of interferon (IFN) regulatory factors 1 and 2. Effects on the induction of IFN-beta gene expression.
J. Biol. Chem.
269:17542-17549[Abstract/Free Full Text].
|
| 39.
|
Lin, R. J.,
L. Nagy,
S. Inoue,
W. Shao,
W. H. Miller, Jr., and R. M. Evans.
1998.
Role of the histone deacetylase complex in acute promyelocytic leukaemia.
Nature
391:811-814[CrossRef][Medline].
|
| 40.
|
Lin, Y.,
K. Wong, and K. Calame.
1997.
Repression of c-myc transcription by Blimp-1, an inducer of terminal B cell differentiation.
Science
276:596-599[Abstract/Free Full Text].
|
| 41.
|
Littlewood, T. D., and G. I. Evan.
1990.
The role of myc oncogenes in cell growth and differentiation.
Adv. Dent. Res.
4:69-79[Abstract/Free Full Text].
|
| 42.
|
Liu, Y.,
N. Yang, and C. T. Teng.
1993.
COUP-TF acts as a competitive repressor for estrogen receptor-mediated activation of the mouse lactoferrin gene.
Mol. Cell. Biol.
13:1836-1846[Abstract/Free Full Text].
|
| 43.
|
Luo, R. X.,
A. A. Postigo, and D. C. Dean.
1998.
Rb interacts with histone deacetylase to repress transcription.
Cell
92:463-473[CrossRef][Medline].
|
| 44.
|
Marcu, K. B.,
S. A. Bossone, and A. J. Patel.
1992.
myc function and regulation.
Annu. Rev. Biochem.
61:809-860[CrossRef][Medline].
|
| 45.
|
Matsui, K.,
K. Nakanishi,
D. I. Cohen,
T. Hada,
J. Furuyama,
T. Hamaoka, and K. Higashino.
1989.
B cell response pathways regulated by IL-5 and IL-2. Secretory microH chain-mRNA and J chain mRNA expression are separately controlled events.
J. Immunol.
142:2918-2923[Abstract].
|
| 46.
|
Nagy, L.,
H. Y. Kao,
D. Chakravarti,
R. J. Lin,
C. A. Hassig,
D. E. Ayer,
S. L. Schreiber, and R. M. Evans.
1997.
Nuclear receptor repression mediated by a complex containing SMRT, mSin3A, and histone deacetylase.
Cell
89:373-380[CrossRef][Medline].
|
| 47.
|
Nomura, T.,
M. M. Khan,
S. C. Kaul,
H. D. Dong,
R. Wadhwa,
C. Colmenares,
I. Kohno, and S. Ishii.
1999.
Ski is a component of the histone deacetylase complex required for transcriptional repression by Mad and thyroid hormone receptor.
Genes Dev.
15:412-423.
|
| 48.
|
Pazin, M. J., and J. T. Kadonaga.
1997.
What's up and down with histone deacetylation and transcription?
Cell
89:325-328[CrossRef][Medline].
|
| 49.
|
Prochownik, E. V., and J. Kukowska.
1986.
Deregulated expression of c-myc by murine erythroleukaemia cells prevents differentiation.
Nature
322:848-850[CrossRef][Medline].
|
| 50.
|
Ren, B.,
K. J. Chee,
T. H. Kim, and T. Maniatis.
1999.
PRDI-BF1/Blimp-1 repression is mediated by corepressors of the Groucho family of proteins.
Genes Dev.
13:125-137[Abstract/Free Full Text].
|
| 51.
|
Renkawitz, R.
1990.
Transcriptional repression in eukaryotes.
Trends Genet.
6:192-197[CrossRef][Medline].
|
| 52.
|
Riggs, K. J.,
K. T. Merrell,
G. Wilson, and K. Calame.
1991.
Common factor 1 is a transcriptional activator which binds in the c-myc promoter, the skeletal alpha-actin promoter, and the immunoglobulin heavy-chain enhancer.
Mol. Cell. Biol.
11:1765-1769[Abstract/Free Full Text].
|
| 53.
|
Riggs, K. J.,
S. Saleque,
K. K. Wong,
K. T. Merrell,
J. S. Lee,
Y. Shi, and K. Calame.
1993.
Yin-yang 1 activates the c-myc promoter.
Mol. Cell. Biol.
13:7487-7495[Abstract/Free Full Text].
|
| 54.
|
Rinkenberger, J. L.,
J. J. Wallin,
K. W. Johnson, and M. E. Koshland.
1996.
An interleukin-2 signal relieves BSAP (Pax5)-mediated repression of the immunoglobulin J chain gene.
Immunity
5:377-386[CrossRef][Medline].
|
| 55.
|
Ruzek, M. C., and A. Mathur.
1995.
Plasma cells tumors decrease CD23 mRNA expression in vivo in murine splenic B cells.
Eur. J. Immunol.
25:2228-2233[Medline].
|
| 56.
|
Sato, M.,
N. Tanaka,
N. Hata,
E. Oda, and T. Taniguchi.
1998.
Involvement of the IRF family transcription factor IRF-3 in virus-induced activation of the IFN-beta gene.
FEBS Lett
425:112-116[CrossRef][Medline].
|
| 57.
|
Schmid, P.,
W. A. Schulz, and H. Hameister.
1989.
Dynamic expression pattern of the myc protooncogene in midgestation mouse embryos.
Science
243:226-229[Abstract/Free Full Text].
|
| 58.
|
Schule, R.,
K. Umesono,
D. J. Mangelsdorf,
J. Bolado,
J. W. Pike, and R. M. Evans.
1990.
Jun-Fos and receptors for vitamins A and D recognize a common response element in the human osteocalcin gene.
Cell
61:497-504[CrossRef][Medline].
|
| 59.
|
Silacci, P.,
A. Mottet,
V. Steimle,
W. Reith, and B. Mach.
1994.
Developmental extinction of major histocompatibility complex class II gene expression in plasmocytes is mediated by silencing of the transactivator gene CIITA.
J. Exp. Med.
180:1329-1336[Abstract/Free Full Text].
|
| 60.
|
Taunton, J.,
C. A. Hassig, and S. L. Schreiber.
1996.
A mammalian histone deacetylase related to the yeast transcriptional regulator Rpd3p.
Science
272:408-411[Abstract].
|
| 61.
|
Tedder, T. F.,
J. Tuscano,
S. Sato, and J. H. Kehrl.
1997.
CD22, a B lymphocyte-specific adhesion molecule that regulates antigen receptor signaling.
Annu. Rev. Immunol.
15:481-504[CrossRef][Medline].
|
| 62.
|
Turner, C. A., Jr.,
D. H. Mack, and M. M. Davis.
1994.
Blimp-1, a novel zinc finger-containing protein that can drive the maturation of B lymphocytes into immunoglobulin-secreting cells.
Cell
77:297-306[CrossRef][Medline].
|
| 63.
|
Vincent, S.,
L. Marty,
L. Le Gallic,
P. Jeanteur, and P. Fort.
1993.
Characterization of late response genes sequentially expressed during renewed growth of fibroblastic cells.
Oncogene
8:1603-1610[Medline].
|
| 64.
|
Wolffe, A. P.
1997.
Transcriptional control. Sinful repression.
Nature
387:16-17[CrossRef][Medline].
|
| 65.
|
Wong, C. W., and M. L. Privalsky.
1998.
Transcriptional repression by the SMRT-mSin3 corepressor: multiple interactions, multiple mechanisms, and a potential role for TFIIB.
Mol. Cell. Biol.
18:5500-5510[Abstract/Free Full Text].
|
| 66.
|
Yang, W. M.,
C. Inouye,
Y. Zeng,
D. Bearss, and E. Seto.
1996.
Transcriptional repression by YY1 is mediated by interaction with a mammalian homolog of the yeast global regulator RPD3.
Proc. Natl. Acad. Sci. USA
93:12845-12850[Abstract/Free Full Text].
|
| 67.
|
Yang, W. M.,
Y. L. Yao,
J. M. Sun,
J. R. Davie, and E. Seto.
1997.
Isolation and characterization of cDNAs corresponding to an additional member of the human histone deacetylase gene family.
J. Biol. Chem.
272:28001-28007[Abstract/Free Full Text].
|
| 68.
|
Yoshida, M.,
M. Kijima,
M. Akita, and T. Beppu.
1990.
Potent and specific inhibition of mammalian histone deacetylase both in vivo and in vitro by trichostatin A.
J. Biol. Chem.
265:17174-17179[Abstract/Free Full Text].
|
| 69.
|
Zhang, Y.,
R. Iratni,
H. Erdjument-Bromage,
P. Tempst, and D. Reinberg.
1997.
Histone deacetylases and SAP18, a novel polypeptide, are components of a human Sin3 complex.
Cell
89:357-364[CrossRef][Medline].
|
| 70.
|
Zhong, H.,
R. E. Voll, and S. Ghosh.
1998.
Phosphorylation of NF-kappa B p65 by PKA stimulates transcriptional activity by promoting a novel bivalent interaction with the coactivator CBP/p300.
Mol. Cell
1:661-671[CrossRef][Medline].
|
Molecular and Cellular Biology, April 2000, p. 2592-2603, Vol. 20, No. 7
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Wang, X., Belguise, K., O'Neill, C. F., Sanchez-Morgan, N., Romagnoli, M., Eddy, S. F., Mineva, N. D., Yu, Z., Min, C., Trinkaus-Randall, V., Chalbos, D., Sonenshein, G. E.
(2009). RelB NF-{kappa}B Represses Estrogen Receptor {alpha} Expression via Induction of the Zinc Finger Protein Blimp1. Mol. Cell. Biol.
29: 3832-3844
[Abstract]
[Full Text]
-
Su, S.-T., Ying, H.-Y., Chiu, Y.-K., Lin, F.-R., Chen, M.-Y., Lin, K.-I
(2009). Involvement of Histone Demethylase LSD1 in Blimp-1-Mediated Gene Repression during Plasma Cell Differentiation. Mol. Cell. Biol.
29: 1421-1431
[Abstract]
[Full Text]
-
Lord, C. A., Savitsky, D., Sitcheran, R., Calame, K., Wright, J. R., Ting, J. P.-Y., Williams, K. L.
(2009). Blimp-1/PRDM1 Mediates Transcriptional Suppression of the NLR Gene NLRP12/Monarch-1. J. Immunol.
182: 2948-2958
[Abstract]
[Full Text]
-
Smith, J., Davidson, E. H.
(2008). Gene Networks in Development and Evolution Special Feature Sackler Colloquium: Gene regulatory network subcircuit controlling a dynamic spatial pattern of signaling in the sea urchin embryo. Proc. Natl. Acad. Sci. USA
105: 20089-20094
[Abstract]
[Full Text]
-
Wang, L., van Panhuys, N., Hu-Li, J., Kim, S., Le Gros, G., Min, B.
(2008). Blimp-1 Induced by IL-4 Plays a Critical Role in Suppressing IL-2 Production in Activated CD4 T Cells. J. Immunol.
181: 5249-5256
[Abstract]
[Full Text]
-
Kurimoto, K., Yabuta, Y., Ohinata, Y., Shigeta, M., Yamanaka, K., Saitou, M.
(2008). Complex genome-wide transcription dynamics orchestrated by Blimp1 for the specification of the germ cell lineage in mice. Genes Dev.
22: 1617-1635
[Abstract]
[Full Text]
-
Lin, F.-R., Kuo, H.-K., Ying, H.-Y., Yang, F.-H., Lin, K.-I
(2007). Induction of Apoptosis in Plasma Cells by B Lymphocyte Induced Maturation Protein-1 Knockdown. Cancer Res.
67: 11914-11923
[Abstract]
[Full Text]
-
Robertson, E. J., Charatsi, I., Joyner, C. J., Koonce, C. H., Morgan, M., Islam, A., Paterson, C., Lejsek, E., Arnold, S. J., Kallies, A., Nutt, S. L., Bikoff, E. K.
(2007). Blimp1 regulates development of the posterior forelimb, caudal pharyngeal arches, heart and sensory vibrissae in mice. Development
134: 4335-4345
[Abstract]
[Full Text]
-
Doody, G. M., Stephenson, S., McManamy, C., Tooze, R. M.
(2007). PRDM1/BLIMP-1 Modulates IFN-{gamma}-Dependent Control of the MHC Class I Antigen-Processing and Peptide-Loading Pathway. J. Immunol.
179: 7614-7623
[Abstract]
[Full Text]
-
Zhao, W., Cha, E. N., Lee, C., Park, C. Y., Schindler, C.
(2007). Stat2-Dependent Regulation of MHC Class II Expression. J. Immunol.
179: 463-471
[Abstract]
[Full Text]
-
Savitsky, D., Calame, K.
(2006). B-1 B lymphocytes require Blimp-1 for immunoglobulin secretion. JEM
203: 2305-2314
[Abstract]
[Full Text]
-
Tooze, R. M., Stephenson, S., Doody, G. M.
(2006). Repression of IFN-{gamma} Induction of Class II Transactivator: A Role for PRDM1/Blimp-1 in Regulation of Cytokine Signaling. J. Immunol.
177: 4584-4593
[Abstract]
[Full Text]
-
Mercader, N., Fischer, S., Neumann, C. J.
(2006). Prdm1 acts downstream of a sequential RA, Wnt and Fgf signaling cascade during zebrafish forelimb induction. Development
133: 2805-2815
[Abstract]
[Full Text]
-
Tam, W., Gomez, M., Chadburn, A., Lee, J. W., Chan, W. C., Knowles, D. M.
(2006). Mutational analysis of PRDM1 indicates a tumor-suppressor role in diffuse large B-cell lymphomas. Blood
107: 4090-4100
[Abstract]
[Full Text]
-
Berberich-Siebelt, F., Berberich, I., Andrulis, M., Santner-Nanan, B., Jha, M. K., Klein-Hessling, S., Schimpl, A., Serfling, E.
(2006). SUMOylation Interferes with CCAAT/Enhancer-Binding Protein beta-Mediated c-myc Repression, but Not IL-4 Activation in T Cells.. J. Immunol.
176: 4843-4851
[Abstract]
[Full Text]
-
Davis, C. A., Haberland, M., Arnold, M. A., Sutherland, L. B., McDonald, O. G., Richardson, J. A., Childs, G., Harris, S., Owens, G. K., Olson, E. N.
(2006). PRISM/PRDM6, a Transcriptional Repressor That Promotes the Proliferative Gene Program in Smooth Muscle Cells.. Mol. Cell. Biol.
26: 2626-2636
[Abstract]
[Full Text]
-
Pasqualucci, L., Compagno, M., Houldsworth, J., Monti, S., Grunn, A., Nandula, S. V., Aster, J. C., Murty, V. V., Shipp, M. A., Dalla-Favera, R.
(2006). Inactivation of the PRDM1/BLIMP1 gene in diffuse large B cell lymphoma.. JEM
203: 311-317
[Abstract]
[Full Text]
-
Shapiro-Shelef, M., Lin, K.-I, Savitsky, D., Liao, J., Calame, K.
(2005). Blimp-1 is required for maintenance of long-lived plasma cells in the bone marrow. JEM
202: 1471-1476
[Abstract]
[Full Text]
-
Duan, Z., Zarebski, A., Montoya-Durango, D., Grimes, H. L., Horwitz, M.
(2005). Gfi1 Coordinates Epigenetic Repression of p21Cip/WAF1 by Recruitment of Histone Lysine Methyltransferase G9a and Histone Deacetylase 1. Mol. Cell. Biol.
25: 10338-10351
[Abstract]
[Full Text]
-
Vincent, S. D., Dunn, N. R., Sciammas, R., Shapiro-Shalef, M., Davis, M. M., Calame, K., Bikoff, E. K., Robertson, E. J.
(2005). The zinc finger transcriptional repressor Blimp1/Prdm1 is dispensable for early axis formation but is required for specification of primordial germ cells in the mouse. Development
132: 1315-1325
[Abstract]
[Full Text]
-
Kuo, T. C., Calame, K. L.
(2004). B Lymphocyte-Induced Maturation Protein (Blimp)-1, IFN Regulatory Factor (IRF)-1, and IRF-2 Can Bind to the Same Regulatory Sites. J. Immunol.
173: 5556-5563
[Abstract]
[Full Text]
-
Kallies, A., Hasbold, J., Tarlinton, D. M., Dietrich, W., Corcoran, L. M., Hodgkin, P. D., Nutt, S. L.
(2004). Plasma Cell Ontogeny Defined by Quantitative Changes in Blimp-1 Expression. JEM
200: 967-977
[Abstract]
[Full Text]
-
Laduron, S., Deplus, R., Zhou, S., Kholmanskikh, O., Godelaine, D., De Smet, C., Hayward, S. D., Fuks, F., Boon, T., De Plaen, E.
(2004). MAGE-A1 interacts with adaptor SKIP and the deacetylase HDAC1 to repress transcription. Nucleic Acids Res
32: 4340-4350
[Abstract]
[Full Text]
-
Arimura, A., van Peer, M., Schroder, A. J., Rothman, P. B.
(2004). The Transcriptional Co-activator p/CIP (NCoA-3) Is Up-regulated by STAT6 and Serves as a Positive Regulator of Transcriptional Activation by STAT6. J. Biol. Chem.
279: 31105-31112
[Abstract]
[Full Text]
-
Sciammas, R., Davis, M. M.
(2004). Modular Nature of Blimp-1 in the Regulation of Gene Expression during B Cell Maturation. J. Immunol.
172: 5427-5440
[Abstract]
[Full Text]
-
Chittka, A., Arevalo, J. C., Rodriguez-Guzman, M., Perez, P., Chao, M. V., Sendtner, M.
(2004). The p75NTR-interacting protein SC1 inhibits cell cycle progression by transcriptional repression of cyclin E. JCB
164: 985-996
[Abstract]
[Full Text]
-
Baluchamy, S., Rajabi, H. N., Thimmapaya, R., Navaraj, A., Thimmapaya, B.
(2003). Repression of c-Myc and inhibition of G1 exit in cells conditionally overexpressing p300 that is not dependent on its histone acetyltransferase activity. Proc. Natl. Acad. Sci. USA
100: 9524-9529
[Abstract]
[Full Text]
-
Johnson, K., Angelin-Duclos, C., Park, S., Calame, K. L.
(2003). Changes in Histone Acetylation Are Associated with Differences in Accessibility of VH Gene Segments to V-DJ Recombination during B-Cell Ontogeny and Development. Mol. Cell. Biol.
23: 2438-2450
[Abstract]
[Full Text]
-
Gyory, I., Fejer, G., Ghosh, N., Seto, E., Wright, K. L.
(2003). Identification of a Functionally Impaired Positive Regulatory Domain I Binding Factor 1 Transcription Repressor in Myeloma Cell Lines. J. Immunol.
170: 3125-3133
[Abstract]
[Full Text]
-
Skov, S., Rieneck, K., Bovin, L. F., Skak, K., Tomra, S., Michelsen, B. K., Odum, N.
(2003). Histone deacetylase inhibitors: a new class of immunosuppressors targeting a novel signal pathway essential for CD154 expression. Blood
101: 1430-1438
[Abstract]
[Full Text]
-
Lee, D., Lim, C., Seo, T., Kwon, H., Min, H., Choe, J.
(2002). The Viral Oncogene Human Papillomavirus E7 Deregulates Transcriptional Silencing by Brm-related Gene 1 via Molecular Interactions. J. Biol. Chem.
277: 48842-48848
[Abstract]
[Full Text]
-
Deplus, R., Brenner, C., Burgers, W. A., Putmans, P., Kouzarides, T., Launoit, Y. d., Fuks, F.
(2002). Dnmt3L is a transcriptional repressor that recruits histone deacetylase. Nucleic Acids Res
30: 3831-3838
[Abstract]
[Full Text]
-
Barnes, B. J., Kellum, M. J., Field, A. E., Pitha, P. M.
(2002). Multiple Regulatory Domains of IRF-5 Control Activation, Cellular Localization, and Induction of Chemokines That Mediate Recruitment of T Lymphocytes. Mol. Cell. Biol.
22: 5721-5740
[Abstract]
[Full Text]
-
Lin, K.-I, Angelin-Duclos, C., Kuo, T. C., Calame, K.
(2002). Blimp-1-Dependent Repression of Pax-5 Is Required for Differentiation of B Cells to Immunoglobulin M-Secreting Plasma Cells. Mol. Cell. Biol.
22: 4771-4780
[Abstract]
[Full Text]
-
Degenhardt, Y. Y., Silverstein, S.
(2001). Interaction of Zyxin, a Focal Adhesion Protein, with the E6 Protein from Human Papillomavirus Type 6 Results in Its Nuclear Translocation. J. Virol.
75: 11791-11802
[Abstract]
[Full Text]
-
Au, W.-C., Pitha, P. M.
(2001). Recruitment of Multiple Interferon Regulatory Factors and Histone Acetyltransferase to the Transcriptionally Active Interferon A Promoters. J. Biol. Chem.
276: 41629-41637
[Abstract]
[Full Text]
-
Wotton, D., Knoepfler, P. S., Laherty, C. D., Eisenman, R. N., Massague, J.
(2001). The Smad Transcriptional Corepressor TGIF Recruits mSin3. Cell Growth Differ.
12: 457-463
[Abstract]
[Full Text]
-
Tunyaplin, C., Shapiro, M. A., Calame, K. L.
(2000). Characterization of the B lymphocyte-induced maturation protein-1 (Blimp-1) gene, mRNA isoforms and basal promoter. Nucleic Acids Res
28: 4846-4855
[Abstract]
[Full Text]
-
Magner, W. J., Kazim, A. L., Stewart, C., Romano, M. A., Catalano, G., Grande, C., Keiser, N., Santaniello, F., Tomasi, T. B.
(2000). Activation of MHC Class I, II, and CD40 Gene Expression by Histone Deacetylase Inhibitors. J. Immunol.
165: 7017-7024
[Abstract]
[Full Text]
-
Lin, K.-I, Lin, Y., Calame, K.
(2000). Repression of c-myc Is Necessary but Not Sufficient for Terminal Differentiation of B Lymphocytes In Vitro. Mol. Cell. Biol.
20: 8684-8695
[Abstract]
[Full Text]
-
Zabel, M. D., Byrne, B. L., Weis, J. J., Weis, J. H.
(2000). Cell-Specific Expression of the Murine CD21 Gene Depends on Accessibility of Promoter and Intronic Elements. J. Immunol.
165: 4437-4445
[Abstract]
[Full Text]
-
Ghosh, N., Gyory, I., Wright, G., Wood, J., Wright, K. L.
(2001). Positive Regulatory Domain I Binding Factor 1 Silences Class II Transactivator Expression in Multiple Myeloma Cells. J. Biol. Chem.
276: 15264-15268
[Abstract]
[Full Text]
-
Barnes, B. J., Moore, P. A., Pitha, P. M.
(2001). Virus-specific Activation of a Novel Interferon Regulatory Factor, IRF-5, Results in the Induction of Distinct Interferon alpha Genes. J. Biol. Chem.
276: 23382-23390
[Abstract]
[Full Text]