Previous Article | Next Article 
Molecular and Cellular Biology, April 2000, p. 2907-2914, Vol. 20, No. 8
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Biochemical and Genetic Interactions between
Drosophila Caspases and the Proapoptotic Genes
rpr, hid, and grim
Zhiwei
Song,1
Bo
Guan,1
Andreas
Bergman,1
Donald W.
Nicholson,2
Nancy A.
Thornberry,2
Erin P.
Peterson,2 and
Hermann
Steller1,*
Departments of Biology and Brain and
Cognitive Sciences, Howard Hughes Medical Institute, Massachusetts
Institute of Technology, Cambridge, Massachusetts
02139,1 and Department of Biochemistry
and Molecular Biology, Merck Frosst Centre for Therapeutic
Research, Pointe Claire, Dorval, Quebec H9R 4P8,
Canada2
Received 8 October 1999/Returned for modification 10 November
1999/Accepted 11 January 2000
 |
ABSTRACT |
In Drosophila melanogaster, the induction of apoptosis
requires three closely linked genes, reaper
(rpr), head involution defective
(hid), and grim. The products of these genes
induce apoptosis by activating a caspase pathway. Two very similar
Drosophila caspases, DCP-1 and drICE, have been previously
identified. We now show that DCP-1 has a substrate specificity that is
remarkably similar to those of human caspase 3 and Caenorhabditis
elegans CED-3, suggesting that DCP-1 is a death effector caspase.
drICE and DCP-1 have similar yet different enzymatic specificities. Although expression of either in cultured cells induces apoptosis, neither protein was able to induce DNA fragmentation in
Drosophila SL2 cells. Ectopic expression of a truncated
form of dcp-1 (
N-dcp-1) in the developing
Drosophila retina under an eye-specific promoter resulted
in a small and rough eye phenotype, whereas expression of the
full-length dcp-1 (fl-dcp-1) had little effect.
On the other hand, expression of either full-length drICE
(fl-drICE) or truncated drICE
(
N-drICE) in the retina showed no obvious eye phenotype.
Although active DCP-1 protein cleaves full-length DCP-1 and full-length
drICE in vitro, GMR-
N-dcp-1 did not enhance the eye
phenotype of GMR-fl-dcp-1 or GMR-fl-drICE
flies. Significantly, GMR-rpr and GMR-grim, but
not GMR-hid, dramatically enhanced the eye phenotype of
GMR-fl-dcp-1 flies. These results indicate that Reaper and
Grim, but not HID, can activate DCP-1 in vivo.
 |
INTRODUCTION |
Programmed cell death or apoptosis
is a gene-directed cell suicide process that is found in virtually all
metazoans to eliminate unwanted, damaged, or harmful cells (13,
19, 23). Many different stimuli can induce apoptosis, including
the binding of certain ligands to cell surface death receptors, removal
of extracellular survival signals, steroid hormones, DNA damage, and
viral infection (1, 6). Regardless of the stimulus, however,
cell killing is carried out by a family of well-conserved
cysteine proteases called caspases (Cys Asp protease) (21,
29). Caspases are synthesized as inactive or weakly active
proenzymes that have to be cleaved at conserved Asp residues to form
the active tetrameric protease (30, 34). A combinatorial
approach has been developed to determine the precise specificity of
each caspase (28). It has been proposed that caspases may
function in a proteolytic cascade consisting of "initiator
caspases" that process and thereby activate downstream "effector
caspases." According to this model, effector caspases are thought to
cleave proteins that are essential for maintaining cellular structure
and function (21, 28, 29).
A key question that is still incompletely understood is how caspases
are activated in response to many different proapoptotic signals.
One important biochemical event during caspase activation is the
removal of an inhibitory N-terminal prodomain. This step involves
cleavage at specific Asp residues. Many active caspases are able to
autoprocess their zymogens and those of other caspases in vitro.
However, in most cases it remains to be determined whether the
reactions that have been observed in vitro actually occur during
apoptosis in vivo.
In Drosophila melanogaster, the induction of apoptosis
requires the activity of three closely linked genes, reaper
(rpr), head involution defective
(hid), and grim (4, 10, 32). These
genes have a partially redundant function and kill by activating a
caspase pathway (33, 36). Although each gene is able to induce apoptosis independently, the regulation and function of these
three genes appear to be different. During development, rpr
and grim are specifically expressed in the cells that are doomed to die. hid, on the other hand, is also expressed in
many cells that are going to live (4, 10, 32).
Significantly, the proapoptotic activity of HID, but not of Reaper and
Grim, is inhibited by the Ras/mitogen-activated protein kinase
(MAPK) pathway (2). Furthermore, there is evidence
that cell death induced by Reaper and Grim is somewhat distinct from
HID-induced death (36). Therefore, it is possible that
rpr and hid activate different sets of caspases.
Two very similar Drosophila caspases, DCP-1 and drICE, have
been previously identified and characterized (7, 8, 22). The
two proteins have 57% amino acid identity, and they both have short
prodomains, indicating that they may function as effector caspases. One
difference between these two proteins is in the N-terminal portions of
their p20 subunits: drICE contains a higher number of Ser and Gly
residues in this region than DCP-1. DCP-1 has enzymological properties
very similar to those of CED-3 (22). DCP-1 can induce
apoptosis in insect and mammalian cells and apoptosis-like events in a
cell-free system. Loss of zygotic dcp-1 function causes larval lethality and melanotic tumors, indicating an essential role of
dcp-1 in development (22). dcp-1
function is also required for normal nurse cell death during oogenesis
in Drosophila (17). Overexpression of full-length
drICE sensitizes Drosophila cells to apoptotic stimuli,
and an N-terminally truncated version of drICE can induce apoptosis in
Drosophila SL2 cells. Moreover, treatment of SL2 cells with
different death inducers results in proteolytic processing of drICE
(7).
Ectopic expression of cell death genes under the control of
eye-specific promoters, such as GMR, is a useful system to define genetic interactions among different components of the cell death pathway in Drosophila (4, 10, 11, 33). In this
study, we have generated transgenic flies that carry either the
full-length or truncated forms (without the prodomain) of DCP-1 and
drICE under the control of the GMR promoter. We find that expression of
a truncated dcp-1 transgene, GMR-
N-dcp-1,
produces small and rough eye phenotypes due to extra cell death in the
developing eye. In contrast, flies carrying one copy of the full-length
dcp-1 transgene, GMR-fl-dcp-1, are almost normal.
Expression of either full-length or truncated drICE in the
developing retina had no obvious effect. Interestingly,
GMR-rpr and GMR-grim, but not GMR-hid, dramatically enhanced the eye phenotype of GMR-fl-dcp-1
flies, suggesting that dcp-1 may function downstream of
rpr and grim.
 |
MATERIALS AND METHODS |
Expression and purification of a truncated version of DCP-1
protein and a truncated version of drICE protein.
A truncated
version of DCP-1 protein, with its N-terminal 33 amino acids removed
and a six-His tag linked to its C terminus, was expressed in
Escherichia coli and purified with Ni2+ columns
as described before (22). A truncated version of drICE, with
its N-terminal 28-amino-acid prodomain removed and a six-His tag
attached to the C terminus, was generated by PCR using drICE cDNA as
the template, with the upstream primer
5'GGCAAACATATGGCCCTGGGCTCCGTGGGATCC3' and the
downstream primer
5'CTCTCACATATGTCAGTGGTGGTGGTGGTGGTGAACCCGTCCGGCTGGAGCCAA3'. The PCR product was treated with NdeI and ligated into
NdeI- and phosphatase-treated pET3a vector (Novagen). The
clones with inserts in the correct orientation were amplified and
sequenced. The six-His-tagged truncated drICE protein was expressed in
E. coli BL21(ED3) by IPTG
(isopropyl-
-D-thiogalactopyranoside) induction and
purified with Ni2+ columns as described before
(22).
Determination of the substrate specificity of DCP-1.
The
synthesis and preparation of the positional scanning synthetic
combinatorial library used in this study have been described previously, and this library has been used to determine the proteolytic specificities of nine human caspases, Caenorhabditis elegans
CED-3, and cytotoxic T-lymphocyte-derived granzyme B (28).
The general structure of the library, Ac-[P4]-[P3]-[P2]-Asp-AMC,
permits the determination of caspase amino acid preferences in P2, P3,
and P4 positions. Asp is kept invariant at P1, owing to the stringent P1 Asp specificity of all caspases, and the fluorogenic AMC moiety was
incorporated in the P1 position to monitor proteolysis. The entire
library contains 60 mixtures of 400 compounds each (20 × 20) thus
yielding 8,000 distinct peptides, each in triplicate. Each of the 60 mixtures was prepared as a 10 mM stock in dimethyl sulfoxide. To
determine protease specificity, an enzyme was added to each of the 60 reaction mixtures, which consisted of 100 µM substrate mixture (0.25 µM concentration of each of the 400 distinct peptides), 100 mM
HEPES-KOH (pH 7.5), and 10 mM dithiothreitol (DTT) in a total volume of
100 µl. The liberation of AMC, as a measure of proteolytic activity,
was monitored by continuous fluorescence spectroscopy using an
excitation wavelength of 380 nm and an emission wavelength of 460 nm.
In vitro translation of human PARP, full-length DCP-1, and
full-length drICE.
35S-labeled poly(adenosine
diphosphate-ribose) polymerase (PARP) protein was synthesized as
described before (22). Full-length DCP-1 and full-length
drICE genes were generated by PCR, blunt-ended, and cloned into
SmaI-treated Bluescript. The clones with insertion downstream of the T7 promoter of Bluescript were amplified, and the
plasmid DNA was isolated and sequenced. The full-length DCP-1 and
full-length drICE proteins were synthesized and labeled with [35S]methionine using the TNT T7 coupled reticulocyte
lysate system (Promega) following the manufacturer's instructions. For
generating a full-length DCP-1 gene PCR fragment, the two primers used
were the upstream primer 5'CGCAAAAGATCTCATATGACCGACGAGTGCGTA3'
and the downstream primer
5'GTGGTGGTCGACGGATCCCTCTTCCTAGCCAGCCTT3'. The two primers
that were used for generating the full-length drICE gene PCR fragment
were the upstream primer 5'GCCAAACATATGGACGCCACTAACAATGGA3' and the downstream primer
5'GCGACATCTAGATCAAACCCGTCCGGCTGGAGC3'.
Digestion of [35S]methionine-labeled human PARP,
full-length DCP-1, and full-length drICE with purified DCP-1 or drICE
protein.
One microliter of each labeled protein was incubated with
1 µg of Ni2+ column-purified DCP-1 or drICE in 4 µl of
incubation buffer {25 mM HEPES, 5 mM EDTA, 2 mM DTT, 0.1%
3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS),
pH 7.5}. The reaction mixture was incubated at 37°C for 30 min and
then subjected to sodium dodecyl sulfate-10% polyacrylamide gel
electrophoresis (SDS-10% PAGE) under reducing conditions. The gels
were dried and exposed to X-ray films for visualization.
Western blot analysis for cleavage of Drosophila
lamin Dm0 and human lamins by DCP-1 and drICE.
Drosophila SL2 cells were homogenized, and the nuclear
fraction was collected by centrifugation. The nuclei were washed with phosphate-buffered saline three times and resuspended in the reaction buffer (25 mM HEPES, 5 mM EDTA, 2 mM DTT, 1% CHAPS, pH 7.5) with the
ratio of 1 volume of packed nuclei to 3 volumes of reaction buffer.
Fifteen microliters of this nuclear suspension was incubated with 1 µg of purified DCP-1 or drICE protein at 37°C for 1 h. Nuclei
from Hela cells were isolated and treated with DCP-1 or drICE protein
in the same manner. After incubation, the reaction mixtures were
solubilized with 1% SDS and the proteins were separated by SDS-PAGE
under reducing conditions. The separated proteins in the gel were
transferred onto polyvinylidene difluoride membranes (Bio-Rad) and
probed with specific monoclonal antibodies. The monoclonal antibody
against the head region of Drosophila lamin Dm0
(mAb84.12) (25) was kindly provided by P. Fisher. The
monoclonal anti-lamin B antibody was purchased from Calbiochem. The
monoclonal antibody against the N-terminal portions of lamins A and C
was a kind gift from F. McKeon (16). The bands on the
membrane recognized by the monoclonal antibodies were visualized by
horseradish peroxidase-labeled rabbit anti-mouse immunoglobulin G
antibody and the ECL (GIBCO/BRL) system.
DNA fragmentation assays in the cell-free systems.
Cell
homogenates were made from Hela cells, Schneider cells (SL2 cells) and
Sf9 cells as described before (22). Active DCP-1 or drICE
protein was incubated with these homogenates at 37°C for 3 h.
After incubation, the DNA in these mixtures was isolated and analyzed
with a 1% agarose gel.
Construction of eye expression vectors and generation of
transgenic flies.
The full-length dcp-1, the
full-length drICE, a truncated version of dcp-1,
and a truncated version of drICE were generated by PCR and
cloned into the eye expression vector pGMR (11). For
generating the full-length dcp-1, the 5' end primer used for PCR was GGCGGCAGATCTCAAGAACTTAAGCAAGAA. For the truncated
version of dcp-1, the sequence encoding the N-terminal 33 amino acids of DCP-1 was removed by using 5'-end-specific primer
GGGAAAAGATCTAACAAAATGGCCAAGGGCTGTACGCCGGAG. The 3' end
primers for both dcp-1 constructs were the same:
GTGGTGAGATCTCTCTTCCTAGCCAGCCTT. For generating the
full-length drICE, the 5' end PCR primer was GAGACCAGATCTCACAAAATGGACGCCACTAACAAT. To generate the
truncated form of drICE, the sequence encoding the
N-terminal 28 amino acids of drICE was removed by using the 5' primer
GAGACCAGATCTCACAAAATGGCCCTGGGCTCCGTGGGA. The 3' end primers
for both drICE constructs were the same:
GGCCTTAGATCTTCAAACCCGTCCGGCTGG. Each primer contained a
BglII site for cloning. A Kozak consensus sequence was added
upstream of the initial methionine codon in 5' end primers. All four
PCR products were treated with BglII and ligated into
BglII- and phosphatase-treated pGMR vector. Clones with
correct insertions and sequences were used for injections. Each pGMR
construct plasmid DNA was purified by Qiagen columns and mixed with the
injection helper DNA p
25.7wc
2-3 in the ratio of 5:2. This DNA
mixture (0.7 µg/µl) was microinjected into yw embryos
according to standard procedures.
Drosophila stocks and genetic crosses.
GMR-rpr (33) and GMR-hid
(10) flies were generated in the Steller laboratory by K. White and J. Agapite, respectively. GMR-grim (4)
flies were provided by J. Abrams. GMR-p35 (11) flies were provided by B. Hay. Fly culture and crosses were carried out
at 25°C by standard procedures.
 |
RESULTS |
DCP-1 has a substrate specificity that is very similar to those of
human caspase 3 and C. elegans cell death protein
CED-3.
To determine the precise protease specificity of
DCP-1, a six-His-tagged, truncated version of DCP-1 with its
N-terminal 33 amino acids removed was expressed in E. coli and purified by Ni2+ columns as described before
(22). The substrate specificity for DCP-1 was determined
using a synthetic, positional scanning combinatorial substrate library
which has been used previously to define the subsite preferences for
the human caspase family and the C. elegans caspase, CED-3
(28) (Fig. 1). DCP-1 has a substrate specificity that is nearly indistinguishable from those of
other death effector caspases, including caspase 3 and CED-3. It has a
nearly absolute requirement for Asp in P4 and a strong preference for
Glu in P3. DCP-1 is tolerant of several substitutions in P2, making it
promiscuous at this subsite. The preferred recognition motif for DCP-1,
DEVD, is the same as those of other group II caspases (caspases 2, 3, and 7 and CED-3) and is consistent with an important role of DCP-1 as
an effector caspase during apoptosis.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 1.
Substrate specificity of DCP-1. The substrate
specificity for recombinant DCP-1 was determined using an
Ac-[P4]-[P3]-[P2]-Asp-AMC positional scanning synthetic
combinatorial library. The y axis represents the rate of
proteolytic release of AMC for each of the indicated positionally
defined amino acids. DCP-1 is a group II (DEVD-selective) caspase and
has a substrate specificity profile that is remarkably similar to those
of human caspase 3 and C. elegans CED-3. Data from the
latter two enzymes are derived and reproduced, with permission, from
reference 28.
|
|
drICE and DCP-1 have similar yet different protease
specificities.
A truncated version of drICE, with its N-terminal
28 amino acids removed and a six-His tag at its C terminus, was also
expressed in E. coli and purified by Ni2+
columns. In the original report on drICE, the authors made a truncation
by removing the N-terminal 80 amino acids (7). Based on the
conserved cleavage site for removal of the prodomains, the amino acid
sequence 25DHTDA29 in the drICE protein matches
the conserved cleavage site sequence DXXDA (where X can be any amino
acid), whereas the sequence surrounding Asp80,
77MVTDR81, does not seem to match any conserved
sequence. Therefore, we made the truncation by removing the N-terminal
28 amino acids as the prodomain. The purified drICE and DCP-1 were
incubated with in vitro-translated
[35S]methionine-labeled human PARP. The cleaved products
were analyzed by SDS-10% PAGE. As shown in Fig.
2A, both DCP-1 and drICE cleaved PARP and
the cleaved fragments migrate the same distance in the SDS-PAGE gel,
indicating that they both recognize the same cleavage site in the PARP
protein.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 2.
A comparison of protease specificities between DCP-1 and
drICE. (A) Both DCP-1 and drICE cleave human PARP with similar
patterns. 35S-labeled human PARP was incubated with 1 µg
of purified DCP-1 or drICE at 37°C for 30 min. The cleavage of PARP
was analyzed by SDS-PAGE under reducing conditions. (B) DCP-1 and drICE
cleave Drosophila nuclear lamin Dm0 with similar
patterns. SL2 cell nuclear fractions were incubated with purified DCP-1
or drICE. The treated nuclei were solubilized with SDS, and the
proteins were separated by SDS-PAGE under reducing conditions. The
lamin Dm0 molecules and the cleaved fragments were probed
by an N-terminal-specific monoclonal antibody and were visualized by
standard Western blotting. (C) DCP-1, not drICE, cleaves human lamins.
Hela cell nuclear fractions were incubated with DCP-1 or drICE. The
treated nuclei were solubilized with SDS, and the proteins were
separated by SDS-PAGE. The lamin cleavage was analyzed by Western
blotting using monoclonal antibodies specific to human lamin B and
lamins A and C.
|
|
Nuclear lamins are the major structural components of the nuclear
lamina and are important to maintain nuclear structure,
chromatin
organization, nuclear growth, and DNA replication (
26).
The
caspase-mediated proteolysis of lamins appears to be largely
responsible for the nuclear changes during apoptosis (
20).
In
mammalian cells, caspase 6, but not caspase 3 or caspase 7, has
been
shown to be able to cleave lamin A (
18,
27). In
Drosophila,
drICE has been reported to cleave lamin
Dm
0 (
7). We incubated
a
Drosophila
SL2 cell nuclear fraction with DCP-1 or drICE protein.
After
incubation, the nuclei were solubilized with SDS and the
proteins were
separated by SDS-PAGE. As shown in Fig.
2B, Western
blot analysis with
a monoclonal antibody against the N-terminal
portion of
Drosophila lamin Dm
0 (
25) showed that
both DCP-1
and drICE cleave
Drosophila lamin
Dm
0, possibly at the same sites.
These results suggest that
DCP-1 and drICE have similar specificities
towards lamin
Dm
0 and that both DCP-1 and drICE may initiate the
nuclear
changes during apoptosis. However, the specificities of
DCP-1 and drICE
are not identical. As shown in Fig.
2C, only DCP-1,
not drICE, was able
to cleave human lamin B and lamins A and C.
In these experiments, a
Hela cell nuclear fraction was incubated
with DCP-1 or drICE, followed
by Western analysis using monoclonal
antibodies against lamin B and
lamins A and C. Since lamins A
and C are derived from the same lamin A
gene (
14), they have
the same N-terminal sequence.
Therefore, cleavage of both lamins
A and C by DCP-1 should produce
identical N-terminal fragments.
We conclude that DCP-1 and drICE have
different biochemical
specificities.
Neither DCP-1 nor drICE can induce DNA fragmentation in a
Drosophila cell-free system.
Chromosomal DNA
fragmentation is commonly observed during apoptosis, and the activation
of specific nucleases that degrade chromosomal DNA is mediated by
caspase activity (5, 15). We have previously reported that
DCP-1 can induce DNA fragmentation in a Hela cell-free system
(22). We show now that DCP-1 can also induce DNA
fragmentation in Sf9 cells, a lepidopteran cell line. On the other
hand, drICE failed to do so in either system (Fig.
3). This provides additional evidence
that these two caspases are biochemically distinct. Surprisingly,
neither DCP-1 nor drICE was able to induce DNA fragmentation in the
Drosophila SL2 cell-free system (Fig. 3). Likewise, both
caspases failed to trigger DNA fragmentation in a cell-free system made
from Drosophila embryos (data not shown). Therefore, it is
possible that DCP-1 and drICE alone are unable to activate the nuclease
responsible for DNA fragmentation in Drosophila cells. When
DCP-1 treated Sf9 cell or Hela cell cytosol was incubated with purified
SL2 cell nuclei, we observed the classical DNA fragmentation (data not
shown). Treatment of SL2 cells with cycloheximide induced apoptosis
with typical DNA fragmentation (data not shown). These observations suggest that a caspase(s) in Drosophila other than DCP-1 and
drICE may be responsible for DNA fragmentation. Another possibility is
that there is a very potent inhibitor of DCP-1 in Drosophila cells, whereas the lysates made from Hela and Sf9 cells may lack such
an inhibitor.

View larger version (109K):
[in this window]
[in a new window]
|
FIG. 3.
Neither DCP-1 nor drICE induces DNA fragmentation in
Drosophila SL2 cells. DCP-1, not drICE, induces DNA
fragmentation in Hela and Sf9 cell-free systems. Cell homogenates made
from Hela cells, Sf9 cells, and SL2 cells were incubated with DCP-1 or
drICE. After incubation, DNA from each reaction mixture was isolated
and analyzed with 1% agarose gel.
|
|
DCP-1 cleaves full-length DCP-1 and full-length drICE in
vitro.
We investigated whether DCP-1 and drICE can cleave each
other in vitro. Full-length DCP-1 and drICE were synthesized by in vitro translation and were radioactively labeled with
[35S]methionine. The labeled full-length DCP-1 and
full-length drICE were incubated with purified active DCP-1 or drICE.
After digestion, the reaction mixtures were analyzed by SDS-PAGE. As
shown in Fig. 4, DCP-1 cleaved
full-length DCP-1 and full-length drICE. drICE showed weak activity
towards full-length DCP-1 but completely failed to cleave full-length
drICE. These data suggest that DCP-1 has the potential to autoactivate,
whereas drICE cannot activate itself. Therefore, it is possible that
DCP-1 is required to activate drICE in vivo.

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 4.
DCP-1 cleaves full-length DCP-1 and full-length drICE,
but drICE does not cleave full-length drICE. 35S-labeled
full-length DCP-1 and full-length drICE were incubated with the
purified active form of DCP-1 or drICE at 37°C for 30 min. After
incubation the proteins were separated by SDS-10% PAGE under reducing
conditions. The gels were dried and exposed to X-ray films for
visualization. (A) 35S-labeled full-length DCP-1 was
treated with active DCP-1 or active drICE; (B) 35S-labeled
full-length drICE was treated with active DCP-1 or active drICE.
|
|
Ectopic expression of the truncated form of dcp-1
induces apoptosis in the Drosophila eye.
In order to
study the genetic interactions between caspases and other
Drosophila cell death genes in vivo, we generated transgenic flies that carry either the full-length or truncated dcp-1
and drICE under the control of the GMR promoter. In this
way, the associated proteins can be specifically expressed in the
developing Drosophila retina. Two different dcp-1
constructs, one with the full length dcp-1
(GMR-fl-dcp-1) and the other encoding a protein with the
N-terminal prodomain removed (GMR-
N-dcp-1), were
microinjected into yw embryos. Fourteen different
GMR-
N-dcp-1 lines and seven GMR-fl-dcp-1 lines
were obtained from these experiments. As shown in Fig.
5, GMR-
N-dcp-1 flies showed
a small and rough eye phenotype which was dosage dependent. Flies
carrying two copies of GMR-
N-dcp-1 (Fig. 5B) have a much
stronger eye phenotype than flies that carry only one copy of the same
transgene (Fig. 5A). The dcp-1-induced eye phenotype was
suppressed by crossing these flies to GMR-p35 flies
(11) (Fig. 5C). Since p35 has been shown to be a specific inhibitor of caspases (3, 35), these results confirm that the phenotypes observed in the dcp-1 transgenic flies are
indeed the result of caspase activity. Flies carrying one copy of
GMR-fl-dcp-1 had almost-normal eye morphology. However, with
two copies of GMR-fl-dcp-1, a weak but reproducible eye
phenotype was obtained (Fig. 6H). This indicates that the full-length
DCP-1 may have weak protease activity.

View larger version (102K):
[in this window]
[in a new window]
|
FIG. 5.
dcp-1 can induce apoptosis in vivo. Ectopic
expression of N-dcp-1 in the Drosophila eye
causes partial eye ablation, and this phenotype is completely
suppressed by coexpression of a caspase inhibitor, the viral protein
p35. (A) Flies carrying one copy of GMR- N-dcp-1 have a
small and rough eye phenotype. (B) Flies carrying two copies of
GMR- N-dcp-1 have a much stronger eye phenotype. (C) Eye
of a fly carrying one copy of GMR- N-dcp-1 and one copy of
GMR-p35, showing that the dcp-1-induced eye
phenotype was suppressed. (D) Wild-type fly eye. Bar, 100 µm.
|
|
N-dcp-1 does not enhance the eye phenotype of
GMR-fl-drICE or GMR-fl-dcp-1 flies.
Transgenic flies that each carry a full-length drICE
transgene (GMR-fl-drICE) or the truncated version of
drICE encoding a protein with its N-terminal 28 amino acids
removed (GMR-
N-drICE) were also generated. Flies carrying
either one or two copies of the GMR-fl-drICE or
GMR-
N-drICE transgene had no detectable abnormalities (Fig. 6A, B, D, and E). We generated 14 GMR-fl-drICE lines and 5 GMR-
N-drICE lines,
but none of them showed any eye phenotype. Flies carrying a different
drICE transgene encoding a protein with its N-terminal 80 amino acids truncated, as described by Fraser and Evan (7)
did not show any eye phenotype either (data not shown). One explanation
for these observations is that drICE cannot cleave the drICE protein
itself. If so, both the truncated and full-length drICE proteins would
remain inactive upon overexpression in the eye. Since we have found
that active DCP-1 can cleave full-length DCP-1 and drICE in vitro (Fig.
4), we examined whether GMR-
N-dcp-1 would enhance the eye
phenotype of GMR-
N-drICE or GMR-fl-drICE flies. As shown in Fig. 6C and F, the truncated form of
dcp-1 did not enhance the eye phenotype of either
GMR-
N-drICE or GMR-fl-drICE flies (compare to
Fig. 5A). One copy of GMR-fl-dcp-1 had essentially no effect
on eye morphology (Fig. 6G), but two copies of the same transgene
produced a weak but significant eye defect (Fig. 6H). The coexpression
of GMR-
N-dcp-1 and GMR-fl-dcp-1 in flies did not significantly enhance the eye phenotype either (Fig. 6I; compare to
Fig. 5B). These data indicate that results obtained from caspase cleavage in vitro cannot be simply extrapolated to the situation in
vivo. It is possible that both caspases do not have full access to each
other because of, for example, different subcellular localizations. Also, the protein concentrations in vitro may be much higher than those
in vivo, and this situation may be further complicated due to the
presence of specific inhibitors in vivo. In any event, the results from
our genetic interaction studies illustrate the limitations of in vitro
experiments to establish a cascade of caspase function during
apoptosis.

View larger version (120K):
[in this window]
[in a new window]
|
FIG. 6.
Flies carrying GMR-fl-drICE or
GMR- N-drICE do not have obvious eye phenotypes.
GMR- N-dcp-1 does not enhance the eye phenotype of
GMR-fl-drICE or GMR-fl-dcp-1 flies. Flies
carrying one copy (A) or two copies (B) of GMR- N-drICE
have normal eyes. Flies carrying one copy of GMR- N-drICE
and one copy of GMR- N-dcp-1 (C) have the same eye
phenotype as those carrying only one copy of GMR- N-dcp-1.
Flies carrying one copy (D) or two copies (E) of
GMR-fl-drICE have normal eyes. Flies carrying one copy of
GMR-fl-drICE and one copy of GMR- N-dcp-1 (F)
have the same eye phenotype as those carrying only one copy of
GMR- N-dcp-1. Flies carrying one copy of
GMR-fl-dcp-1 show an almost-normal eye phenotype (G). Two
copies of GMR-fl-dcp-1 show a clear effect on the eye (H).
Flies with one copy of GMR-fl-dcp-1 and one copy of
GMR- N-dcp-1 (I) show the additive effect of the two
transgenes. Bar, 100 µm.
|
|
rpr and grim, but not hid,
activate full-length DCP-1 in the Drosophila eye.
The
proapoptotic proteins encoded by rpr, hid, and
grim all require caspase activity to kill cells. We wanted
to know whether dcp-1 or drICE or both are
involved in the death pathways activated by any of these genes. In
particular, we investigated whether coexpression of caspases and these
proapoptotic genes could lead to significantly enhanced cell killing.
For this purpose, flies carrying GMR-rpr,
GMR-hid, and GMR-grim were crossed to
GMR-fl-dcp-1 and GMR-fl-drICE flies. Two
different GMR-fl-dcp-1 transgenic fly lines were crossed to
GMR-rpr46, GMR-hid1M, and GMR-grim
flies, with identical results. Likewise, two GMR-fl-drICE
transgenic fly lines were crossed to GMR-rpr46,
GMR-hid1M, and GMR-grim flies, again with
identical results. As shown in Fig. 7,
flies carrying one copy of GMR-fl-dcp-1 or
GMR-fl-drICE have almost normal eye morphology (Fig. 7B and
C). Flies transgenic for GMR-hid1M, GMR-grim, or
GMR-rpr46 have a mild but easily detectable eye phenotype
(Fig. 7D, G, and J). The coexpression of hid and full-length
drICE produced no obvious enhancement of the eye phenotype,
but rather an additive effect of the two transgenes (Fig. 7F). Also,
the expression of hid together with full-length
dcp-1 enhanced the eye phenotype only weakly (Fig. 7E),
comparable to what is seen for coexpression of many other proapoptotic
gene combinations (data not shown). In stark contrast, expression of
either rpr or grim together with GMR-fl-dcp-1 yielded a dramatically enhanced eye phenotype
that cannot be simply explained by additive effects (Fig. 7H and K). In
our hands, rpr produced a stronger effect than
grim. The expression of rpr also enhanced the eye
phenotype of GMR-fl-drICE flies (Fig. 7L), whereas
grim was not very effective (Fig. 7I). This finding is
consistent with the observation that drICE is activated in rpr-transfected S2 cells (8). Among the different
cell types of the Drosophila retina, the pigment cells
appear to be particularly sensitive to DCP-1. Both the truncated and
the full-length DCP-1 caused pigment cell death (Fig. 5A and B and 6H).
Judging by the complete loss of eye color, all pigment cells were
eliminated in flies that coexpressed DCP-1 with either rpr
and grim (Fig. 7H and K). In order to further investigate
the specificity of this interaction, we also crossed
GMR-fl-dcp-1 flies to a transgenic line with strong
hid expression, GMR-hid 10 flies. Again, the eye
phenotype observed for this combination was not significantly enhanced.
Overall, we found that rpr and grim interact with
dcp-1 much more strongly than hid and interact
more effectively with dcp-1 than with drICE.
Taken together, these observations suggest that dcp-1 is
rate limiting for cell killing by rpr and grim, but not hid. Therefore, we propose that rpr and
grim function upstream of dcp-1 in vivo.

View larger version (86K):
[in this window]
[in a new window]
|
FIG. 7.
rpr and grim, but not
hid, enhance the eye phenotype of GMR-fl-dcp-1
flies. The effect of rpr and grim on
dcp-1 is much stronger than their effect on
drICE. (A) Wild-type fly eye. Flies carrying one copy of
GMR-fl-dcp-1 (B) or one copy of GMR-fl-drICE (C)
have an almost-normal eye phenotype. (D) Eyes from flies carrying one
copy of GMR-hid1M; (G) eyes from flies carrying one copy of
GMR-grim; (J) eyes from flies carrying one copy of
GMR-rpr46. GMR-hid1M does not enhance the eye
phenotype of either GMR-fl-dcp-1 (E) or
GMR-fl-drICE flies (F). GMR-grim strongly
enhances the eye phenotype of GMR-fl-dcp-1 flies (H),
whereas it has little effect on that of GMR-fl-drICE flies
(I). GMR-rpr enhances the phenotype of both
GMR-fl-dcp-1 (K) and GMR-fl-drICE flies (L).
Clearly, rpr interacts with dcp-1 much more
strongly than with drICE. Bar, 100 µm.
|
|
 |
DISCUSSION |
A key biochemical event during apoptosis is the activation of
caspases. At least in some cases, proteolysis of specific target proteins can explain some of the discrete morphological changes that
are commonly observed during apoptosis (24). Both DCP-1 and
drICE appear to be effector caspases, since their enzymological and
structural properties, including a short prodomain, are shared with
mammalian effector caspases. In this report we show that DCP-1 has a
specificity almost identical to those of caspase 3 and C. elegans cell death protein CED-3. drICE and DCP-1 have similar yet
different enzymatic specificities. DCP-1 can cleave itself efficiently
in vitro, but drICE cannot. This may explain why expression of DCP-1 in
the Drosophila retina can cause cell death, whereas drICE
failed to do so. Finally, we found that rpr and
grim, but not hid, dramatically enhanced the eye
phenotype of GMR-fl-dcp-1 flies. This finding is consistent
with the idea that dcp-1 is a downstream target for cell
killing by rpr and grim.
The substrate specificity for DCP-1 determined by the combinatorial
library revealed that DCP-1 specifically recognizes the DEVD motif,
indicating that, like caspase 3 and CED-3, DCP-1 plays an important
role as a death effector during apoptosis by cleaving key protein
targets. Like caspase 3, DCP-1 may also function downstream of
different pathways activated by distinct death signals. drICE is very
similar to DCP-1, both in structure and protease specificity. Both
DCP-1 and drICE cleave PARP and Drosophila nuclear lamin Dm0 with the same patterns. However, only DCP-1, not drICE,
was able to cleave human lamins. Although this finding has no direct physiological relevance, it indicates that DCP-1 and drICE have somewhat distinct enzymological properties.
Chromosomal DNA fragmentation is a hallmark of apoptosis. In
nonapoptotic cells, the nuclease responsible for DNA fragmentation forms an inactive complex with its inhibitor. During apoptosis, this
inhibitor is cleaved by a caspase and the nuclease is released from the
complex. The free nuclease then enters the nucleus and causes DNA
fragmentation (5, 15). DCP-1 was able to induce DNA
fragmentation in a Hela and Sf9 cell-free systems. On the other hand,
drICE was unable to induce DNA fragmentation in either cell-free
system. Surprisingly, neither DCP-1 nor drICE was able to induce DNA
fragmentation in Drosophila cell-free systems, including one
made from Drosophila embryos. However, DCP-1 could induce DNA laddering of Drosophila nuclei in the presence of HeLa
cell cytosol. This eliminates the possibility that
Drosophila nuclei are somehow resistant to DNA
fragmentation. Rather, it appears that DCP-1 alone is insufficient to
promote DNA fragmentation in Drosophila cells. However, a
relevant DNase activity can be induced in Drosophila SL2,
since we did observe DNA fragmentation upon treatment with cycloheximide.
In the original report, the N-terminal 80 amino acids of drICE were
considered the prodomain and were truncated for generating active drICE
(7). While that truncated version of drICE showed protease
activity and induced apoptosis in transfected cells, we believe that
the DHTDA sequence from amino acids 25 to 29 in drICE protein is the
cleavage site for removal of the prodomain, because it matches the
DXXDA conserved sequence. It is also very similar to the sequence of
the cleavage site in DCP-1, which is DNTDA. Therefore, it appears that
both DCP-1 and drICE have short prodomains with only 33 and 28 amino
acids, respectively. Although DCP-1 cleaves full-length DCP-1 and
full-length drICE in vitro, GMR-
N-dcp-1 did not enhance
the eye phenotype of GMR-fl-drICE flies. This indicates that
DCP-1 did not activate drICE under these conditions in vivo. On the
other hand, expression of rpr did enhance the eye phenotype
of GMR-fl-drICE flies, demonstrating that this construct was
functional. We conclude that dcp-1 activity is insufficient
to activate drICE in vivo.
A major difference between DCP-1 and drICE in our experiments was in
the proteolytic processing of both proenzymes. At low concentrations,
active DCP-1 cleaved full-length DCP-1, whereas active drICE did not
cleave full-length drICE. Apparently, autoprocessing of truncated drICE
requires very high concentrations. Therefore, it appears that
processing of pro-drICE into the active enzyme does not occur readily
in vitro. This property may explain why expression of drICE in the
Drosophila retina fails to induce apoptosis, whereas
dcp-1 is capable of doing so. At this point it is unclear whether DCP-1 and drICE act in a proteolytic cascade. If they do, our
results would place drICE downstream from dcp-1
in this cascade.
The eye phenotype of GMR-fl-dcp-1 flies was strongly
enhanced by rpr and grim, but not by
hid. Among the different cell types in the
Drosophila eye, pigment cells appear to be particularly sensitive to DCP-1-mediated cell killing. Flies with one copy of the
GMR-
N-dcp-1 transgene lacked most pigment cells (Fig. 5A), and two copies of GMR-
N-dcp-1 eliminated them
completely (Fig. 5B). Likewise, expression of either rpr or
grim with fl-dcp-1 completely eliminated all
pigment cells (Fig. 7H and K), whereas hid was unable to do
so. These results indicate that Reaper and Grim, but not Hid, can lead
to DCP-1 activation. Several other observations also indicate that
rpr and grim have cell killing properties that
are distinct from those of hid. For example, the Ras/MAPK
pathway inhibits hid-induced cell death but has no effect on
rpr- or grim-induced death (2). In
addition, we have isolated mutations in the diap1 gene of
Drosophila that enhance rpr- and grim-induced cell killing but suppress
hid-induced cell killing (J. Agapite, K. McCall, and H. Steller, unpublished data). The easiest interpretation of all these
observations is that rpr and grim kill cells by
activating the same (set of) caspases and that hid activates
a distinct caspase (Fig. 8). Since it has
been recently shown that rpr, hid, and
grim induce cell death by inhibiting the antiapoptotic
activity of diap1 (9, 31), diap1 must
control at least two distinct caspase pathways. According to this
model, Reaper and Grim and HID would interact selectively with specific DIAP1-(pro)caspase complexes. The binding of Reaper, Grim, or HID to
the relevant DIAP1-(pro)caspase complex is thought to result in caspase
activation. This model is consistent with a variety of findings from
both invertebrate and vertebrate systems. However, the possibility that
rpr and grim may also activate DCP-1 through a
DIAP1-independent pathway cannot be ruled out. Although several Drosophila caspases have been described, our results
indicate that additional caspases, in particular ones activated by HID, remain to be identified.

View larger version (7K):
[in this window]
[in a new window]
|
FIG. 8.
Model of caspase activation and apoptosis in
Drosophila. In living cells, caspases are inhibited by
forming complexes with DIAP1 protein. In response to various apoptotic
stimuli, the binding of Reaper, Grim, and HID to DIAP1-(pro)caspase
complexes leads to caspase activation. Reaper and Grim, but not Hid,
appear to specifically activate DCP-1, perhaps through directly binding
to DIAP1-DCP-1 complexes. In addition, the Ras/MAPK pathway inhibits
the function of HID, but not Reaper or Grim. The caspase that is
activated by HID, caspase X, remains unknown. Likewise, details of the
presumptive proteolytic cascade(s) that may result from the activation
of an apical caspase remain to be determined.
|
|
 |
ACKNOWLEDGMENTS |
We thank P. Fisher and F. McKeon for the monoclonal antibodies
against Drosophila lamin Dm0 and human lamins A
and C, respectively. We are grateful to J. M. Abrams for providing
the GMR-grim flies, to A. Fraser and G. Evan for drICE cDNA,
and to B. Hay for the GMR-p35 flies. We thank Julie Agapite
and Lei Zhou and other members of this laboratory for their discussion
and suggestions.
Z.S. was supported in part by the Merck/MIT Fellowship. H.S. is an
investigator of the Howard Hughes Medical Institute. Part of this work
was supported by NIH grant R01 GM60124-01.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Howard Hughes
Medical Institute, Massachusetts Institute of Technology, Departments of Biology and Brain and Cognitive Sciences, 77 Massachusetts Ave.,
68-430, Cambridge, MA 02139. Phone: (617) 253-6359. Fax: (617)
258-9430. E-mail: hsteller{at}mit.edu.
 |
REFERENCES |
| 1.
|
Ashkenazi, A., and V. M. Dixit.
1998.
Death receptors: signaling and modulation.
Science
281:1305-1308[Abstract/Free Full Text].
|
| 2.
|
Bergmann, A.,
J. Agapite,
K. McCall, and H. Steller.
1998.
The Drosophila gene hid is a direct molecular target of ras-dependent survival signaling.
Cell
95:331-341[CrossRef][Medline].
|
| 3.
|
Bump, N. J., et al.
1995.
Inhibition of ICE family proteases by baculovirus antiapoptotic protein p35.
Science
269:1885-1888[Abstract/Free Full Text].
|
| 4.
|
Chen, P.,
H. Nordstrom,
B. Gish, and J. M. Abrams.
1996.
grim, a novel cell death gene in Drosophila.
Genes Dev.
10:1773-1782[Abstract/Free Full Text].
|
| 5.
|
Enari, M.,
H. Sakahira,
H. Yokoyama,
K. Okawa,
A. Iwamatsu, and S. Nagata.
1998.
A caspase-activated DNase that degrades DNA during apoptosis, and its inhibitor ICAD.
Nature
391:43-50[CrossRef][Medline].
|
| 6.
|
Evan, G., and T. Littlewood.
1998.
A matter of life and cell death.
Science
281:1317-1322[Abstract/Free Full Text].
|
| 7.
|
Fraser, A., and G. I. Evan.
1997.
Identification of a Drosophila melanogaster ICE/CED-3-related protease, drICE.
EMBO J.
16:2805-2813[CrossRef][Medline].
|
| 8.
|
Fraser, A.,
N. J. McCarthy, and G. I. Evan.
1997.
drICE is an essential caspase required for apoptotic activity in Drosophila cells.
EMBO J.
16:6192-6199[CrossRef][Medline].
|
| 9.
| Goyal, L., K. McMall, J. Agapite, E. Hartwieg, and H. Steller. Induction of apoptosis by Drosophila reaper,
hid, and grim through inhibition of IAP function.
EMBO J., in press.
|
| 10.
|
Grether, M. E.,
J. M. Abrams,
J. Agapite,
K. White, and H. Steller.
1995.
The head involution defective gene of Drosophila melanogaster functions in programmed cell death.
Genes Dev.
9:1694-1708[Abstract/Free Full Text].
|
| 11.
|
Hay, B. A.,
T. Wolff, and G. M. Rubbin.
1994.
Expression of baculovirus P35 prevents cell death in Drosophila.
Development
120:2121-2129[Abstract].
|
| 12.
|
Hay, B. A.,
D. A. Wassarman, and G. M. Rubin.
1995.
Drosophila homologs of baculovirus inhibitor of apoptosis proteins function to block cell death.
Cell
83:1253-1262[CrossRef][Medline].
|
| 13.
|
Jacobson, M. D.,
M. Weil, and M. C. Raff.
1997.
Programmed cell death in animal development.
Cell
88:347-354[CrossRef][Medline].
|
| 14.
|
Lin, F., and H. J. Worman.
1993.
Structural organization of the human gene encoding nuclear lamin A and nuclear lamin C.
J. Biol. Chem.
268:16321-16326[Abstract/Free Full Text].
|
| 15.
|
Liu, X.,
H. Zou,
C. Slaughter, and X. Wang.
1997.
DFF, a heterodimeric protein that functions downstream of caspase-3 to trigger DNA fragmentation during apoptosis.
Cell
89:175-184[CrossRef][Medline].
|
| 16.
|
Loewinger, L., and F. McKeon.
1988.
Mutations in the nuclear lamin proteins resulting in their aberrant assembly in the cytoplasm.
EMBO J.
7:2301-2309[Medline].
|
| 17.
|
McCall, K., and H. Steller.
1998.
Requirement for DCP-1 caspase during Drosophila oogenesis.
Science
279:230-234[Abstract/Free Full Text].
|
| 18.
|
Orth, K.,
M. Chinnaiyan,
M. Garg,
C. J. Froelich, and V. M. Dixit.
1996.
The CED-3/ICE-like protease Mch2 is activated during apoptosis and cleaves the death substrate lamin A.
J. Biol. Chem.
271:16443-16446[Abstract/Free Full Text].
|
| 19.
|
Raff, M.
1998.
Cell suicide for beginners.
Nature
396:119-122[CrossRef][Medline].
|
| 20.
|
Rao, L.,
D. Perez, and E. White.
1996.
Lamin proteolysis facilitates nuclear events during apoptosis.
J. Cell Biol.
135:1441-1455[Abstract/Free Full Text].
|
| 21.
|
Salvesen, G. S., and V. M. Dixit.
1997.
Caspases: intracellular signaling by proteolysis.
Cell
91:443-446[CrossRef][Medline].
|
| 22.
|
Song, Z.,
K. McCall, and H. Steller.
1997.
DCP-1, a Drosophila cell death protease essential for development.
Science
275:536-540[Abstract/Free Full Text].
|
| 23.
|
Steller, H.
1995.
Mechanisms and genes of cellular suicide.
Science
267:1445-1449[Abstract/Free Full Text].
|
| 24.
|
Stroh, C., and K. Schulze-Osthoff.
1998.
Death by a thousand cuts: an ever increasing list of caspase substrates.
Cell Death Differ.
5:997-1000[CrossRef][Medline].
|
| 25.
|
Stuurman, N.,
N. Maus, and P. A. Fisher.
1995.
Interphase phosphorylation of the Drosophia lamin: site-mapping using a monoclonal antibody.
J. Cell Sci.
108:3137-3144[Abstract].
|
| 26.
|
Stuurman, N.,
S. Heins, and U. Aebi.
1998.
Nuclear lamins: their structure, assembly, and interactions.
J. Struct. Biol.
122:42-66[CrossRef][Medline].
|
| 27.
|
Takahashi, A.,
E. S. Alnemeri,
Y. A. Lazebnik,
T. Fernandes-Alnemeri,
G. Litwack,
R. D. Moir,
R. D. Goldman,
G. G. Poirier,
S. H. Kaufmann, and W. C. Earnshaw.
1996.
Cleavage of lamin A by Mch2 but not CPP32: multiple interleukin 1 -converting enzyme-related proteases with distinct substrate recognition properties are active in apoptosis.
Proc. Natl. Acad. Sci. USA
93:8395-8400[Abstract/Free Full Text].
|
| 28.
|
Thornberry, N. A.,
T. A. Rano,
E. P. Peterson,
D. M. Rasper,
T. Timkey,
M. Garcia-Calvo,
V. M. Houtzager,
P. A. Nordstrom,
S. Roy,
J. P. Vaillancourt,
K. T. Chapman, and D. W. Nicholson.
1997.
A combinatorial approach defines specificities of members of the caspase family and granzyme B J.
Biol. Chem.
272:17907-17911[Abstract/Free Full Text].
|
| 29.
|
Thornberry, N. A., and Y. Lazebnik.
1998.
Caspases: enemies within.
Science
281:1312-1316[Abstract/Free Full Text].
|
| 30.
|
Walker, N. P.,
R. V. Talanian,
K. D. Brady,
L. C. Dang,
N. J. Bump,
C. R. Ferenz,
S. Franklin,
T. Ghayur,
M. C. Hackett,
L. D. Hammill,
L. Herzog,
M. Hugunin,
W. Houy,
J. A. Mankovich,
L. McGuiness,
E. Orlewicz,
M. Paskind,
C. A. Pratt,
P. Reis,
A. Summani,
M. Terranova,
J. P. Welch,
L. Xiong,
A. Moller,
D. E. Tracey,
R. Kamen, and W. W. Wong.
1994.
Crystal structure of the cysteine protease interleukin-1 -converting enzyme: a (p20/p10) homodimer.
Cell
78:343-352[CrossRef][Medline].
|
| 31.
|
Wang, S. L.,
C. J. Hawkins,
S. J. Yoo,
H.-A. Muller, and B. A. Hay.
1999.
The Drosophila caspase inhibitor DIAP1 is essential for cell survival and is negatively regulated by HID.
Cell
98:453-563[CrossRef][Medline].
|
| 32.
|
White, K.,
M. E. Grether,
J. M. Abrams,
L. Young,
K. Farrell, and H. Steller.
1994.
Genetic control of programmed cell death in Drosophila.
Science
264:677-6683[Abstract/Free Full Text].
|
| 33.
|
White, K.,
E. Tahaoglu, and H. Steller.
1996.
Cell killing by the Drosophila gene reaper.
Science
271:805-807[Abstract].
|
| 34.
|
Wilson, K. P.,
J.-A. F. Black,
J. A. Thomson,
E. E. Kim,
J. P. Griffith,
M. A. Navia,
M. A. Murcko,
S. P. Chambers,
R. A. Aldape,
S. A. Raybuck, and D. J. Livingston.
1994.
Structure and mechanism of interleukin-1 -converting enzyme.
Nature
370:270-275[CrossRef][Medline].
|
| 35.
|
Xue, D., and H. R. Horvitz.
1995.
Inhibition of the Caenorhabditis elegans cell-death protease CED-3 by a CED-3 cleavage site in baculovirus p35 protein.
Nature
377:248-251[CrossRef][Medline].
|
| 36.
|
Zhou, L.,
A. Schnitzler,
J. Agapite,
L. M. Schwartz,
H. Steller, and J. R. Nambu.
1997.
Cooperative function of the reaper and head involution defective genes in the programmed cell death of Drosophila central nervous system medline cells.
Proc. Natl. Acad. Sci. USA
94:5131-5136[Abstract/Free Full Text].
|
Molecular and Cellular Biology, April 2000, p. 2907-2914, Vol. 20, No. 8
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ribeiro, P. S., Kuranaga, E., Tenev, T., Leulier, F., Miura, M., Meier, P.
(2007). DIAP2 functions as a mechanism-based regulator of drICE that contributes to the caspase activity threshold in living cells. JCB
179: 1467-1480
[Abstract]
[Full Text]
-
Yi, C. H., Sogah, D. K., Boyce, M., Degterev, A., Christofferson, D. E., Yuan, J.
(2007). A genome-wide RNAi screen reveals multiple regulators of caspase activation. JCB
179: 619-626
[Abstract]
[Full Text]
-
Chandraratna, D., Lawrence, N., Welchman, D. P., Sanson, B.
(2007). An in vivo model of apoptosis: linking cell behaviours and caspase substrates in embryos lacking DIAP1. J. Cell Sci.
120: 2594-2608
[Abstract]
[Full Text]
-
Anderson, J., Bhandari, R., Kumar, J. P.
(2005). A Genetic Screen Identifies Putative Targets and Binding Partners of CREB-Binding Protein in the Developing Drosophila Eye. Genetics
171: 1655-1672
[Abstract]
[Full Text]
-
Yokokura, T., Dresnek, D., Huseinovic, N., Lisi, S., Abdelwahid, E., Bangs, P., White, K.
(2004). Dissection of DIAP1 Functional Domains via a Mutant Replacement Strategy. J. Biol. Chem.
279: 52603-52612
[Abstract]
[Full Text]
-
Kohyama-Koganeya, A., Sasamura, T., Oshima, E., Suzuki, E., Nishihara, S., Ueda, R., Hirabayashi, Y.
(2004). Drosophila Glucosylceramide Synthase: A NEGATIVE REGULATOR OF CELL DEATH MEDIATED BY PROAPOPTOTIC FACTORS. J. Biol. Chem.
279: 35995-36002
[Abstract]
[Full Text]
-
Laundrie, B., Peterson, J. S., Baum, J. S., Chang, J. C., Fileppo, D., Thompson, S. R., McCall, K.
(2003). Germline Cell Death Is Inhibited by P-Element Insertions Disrupting the dcp-1/pita Nested Gene Pair in Drosophila. Genetics
165: 1881-1888
[Abstract]
[Full Text]
-
Peterson, C., Carney, G. E., Taylor, B. J., White, K.
(2003). reaper is required for neuroblast apoptosis during Drosophila development. Development
129: 1467-1476
[Abstract]
[Full Text]
-
Hunter, A. M., Kottachchi, D., Lewis, J., Duckett, C. S., Korneluk, R. G., Liston, P.
(2003). A Novel Ubiquitin Fusion System Bypasses the Mitochondria and Generates Biologically Active Smac/DIABLO. J. Biol. Chem.
278: 7494-7499
[Abstract]
[Full Text]
-
Arnt, C. R., Chiorean, M. V., Heldebrant, M. P., Gores, G. J., Kaufmann, S. H.
(2002). Synthetic Smac/DIABLO Peptides Enhance the Effects of Chemotherapeutic Agents by Binding XIAP and cIAP1 in Situ. J. Biol. Chem.
277: 44236-44243
[Abstract]
[Full Text]
-
Ekert, P. G., Silke, J., Hawkins, C. J., Verhagen, A. M., Vaux, D. L.
(2001). Diablo Promotes Apoptosis by Removing Miha/Xiap from Processed Caspase 9. JCB
152: 483-490
[Abstract]
[Full Text]
-
Heinrich, J. C., Scott, M. J.
(2000). A repressible female-specific lethal genetic system for making transgenic insect strains suitable for a sterile-release program. Proc. Natl. Acad. Sci. USA
10.1073/pnas.140142697v1
[Abstract]
[Full Text]
-
Hawkins, C. J., Yoo, S. J., Peterson, E. P., Wang, S. L., Vernooy, S. Y., Hay, B. A.
(2000). The Drosophila Caspase DRONC Cleaves following Glutamate or Aspartate and Is Regulated by DIAP1, HID, and GRIM. J. Biol. Chem.
275: 27084-27093
[Abstract]
[Full Text]
-
Heinrich, J. C., Scott, M. J.
(2000). A repressible female-specific lethal genetic system for making transgenic insect strains suitable for a sterile-release program. Proc. Natl. Acad. Sci. USA
97: 8229-8232
[Abstract]
[Full Text]