Previous Article | Next Article 
Molecular and Cellular Biology, May 2000, p. 3187-3197, Vol. 20, No. 9
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Structure of a Polycomb Response Element and In Vitro Binding of
Polycomb Group Complexes Containing GAGA Factor
Béatrice
Horard,
Christophe
Tatout,
Sylvain
Poux, and
Vincenzo
Pirrotta*
Department of Zoology, University of Geneva,
CH1211 Geneva, Switzerland
Received 13 September 1999/Returned for modification 5 November
1999/Accepted 2 February 2000
 |
ABSTRACT |
Polycomb response elements (PREs) are regulatory sites that mediate
the silencing of homeotic and other genes. The bxd PRE region from the Drosophila Ultrabithorax gene can be
subdivided into subfragments of 100 to 200 bp that retain different
degrees of PRE activity in vivo. In vitro, embryonic nuclear extracts form complexes containing Polycomb group (PcG) proteins with these fragments. PcG binding to some fragments is dependent on consensus sequences for the GAGA factor. Other fragments lack GAGA binding sites
but can still bind PcG complexes in vitro. We show that the GAGA factor
is a component of at least some types of PcG complexes and may
participate in the assembly of PcG complexes at PREs.
 |
INTRODUCTION |
Polycomb group (PcG) proteins from
complexes in vivo at regulatory sites, the Polycomb response elements
(PREs), which mediate the silencing of neighboring genes. Transposons
containing PREs generate new binding sites for PcG proteins on polytene
chromosomes, indicating that PREs are the physical targets for PcG
complex formation. Chromatin cross-linking experiments have also shown that PcG proteins are bound to and in the vicinity of known PRE sites
(28, 35, 36). In these experiments, PcG proteins are found
cross-linked over a few kilobases centered over fragments with known
PRE activity, suggesting the possibility that a silencing complex
initiated at a PRE involves at least a few kilobases either because of
a cooperative spreading of the complex or because the PRE is in fact
not a site but a region containing multiple sequences that interact
with PcG proteins. None of the well-characterized PcG proteins can be
shown to bind to DNA in vitro. One simple explanation for the fact that
PcG complex formation appears to be specific for the PRE might be that
it depends on other hitherto-unknown PcG proteins. One such candidate,
the product of the pleiohomeotic (pho) gene, has
recently been identified (3). However, it has not been shown
yet that PHO interacts with other PcG proteins, and the presumptive
consensus sequence for the binding of PHO is not always present in DNA
fragments that have PRE activity, suggesting that other DNA-binding
proteins might be involved. Other possibilities are suggested by the
properties of PcG proteins and of PREs. Several of the PcG proteins can
interact with one another, and experiments with Pc protein targeted to
LexA or GAL4 binding sites indicate that a single PcG protein can
recruit a silencing complex (26; S. Poux, D. McCabe,
and V. Pirrotta, submitted for publication). Different genomic PcG
sites show different degrees of dependence on different members of the
PcG genes, both in the strength of the signal generated by
immunostaining and the effect of different PcG mutations on the
silencing of the accompanying genes. The silencing ability of a given
PRE is strongly dependent on the genomic context in which it is
introduced and on homologous pairing or the physical proximity to other
PRE sequences in the nucleus (5, 10, 17, 34). All these
observations suggest that the formation of a PcG complex at a PRE is
normally dependent on multiple interactions and that PcG complex
initiation is unlikely to be the result of a single sequence or a
single recruiting protein.
PRE activity has generally been found in DNA fragments of several
hundred to a few thousand base pairs. Such fragments often contain
other activities which may be associated with PRE function. For
example, the Fab-7 PRE region also contains a chromatin
insulator or boundary element (14, 25, 38). The
bxd PRE is flanked by embryonic enhancer elements
(30). Both the bxd and the Fab-7 PREs
are closely associated with target sites for the trithorax group (trxG)
proteins TRX and the GAGA factor, which are usually thought to
stimulate expression rather than silencing it (6, 7, 13). In
this work, we have dissected the region containing the bxd
PRE from the Ubx gene to show that residual PRE activity is
associated with multiple smaller fragments and to determine if the
different properties of the subfragments could help to identify
functional components that contribute to the silencing function. Are
different PcG proteins recruited to different parts of the PRE? Are
sequence motifs repeated in different subfragments with PRE activity or
does each fragment contribute distinct sequence elements that might be
conserved in other known PREs? Finally, with smaller characterized PRE
fragments, we hoped it might be possible to study the formation in
vitro of minimal PcG complexes from embryonic nuclear extracts. The
results presented here show that the bxd PRE is in fact a
compound structure composed of sequences with different PRE-like
activities and that many of its subfragments are able to interact in
vitro with PcG complexes present in nuclear extracts. Surprisingly, the
GAGA factor, often considered to be an activating protein and a member
of the trxG, is a component of some PcG complexes and is important for
their binding to PRE DNA in vitro.
 |
MATERIALS AND METHODS |
Fly strains and mutants.
All transgenic flies were produced
using the Df(1)w67c23 strain, which is
y
w
. The PcG mutations used were
Pc3, Psc1,
Su(z)21, and E(z)1.
TrlR85 is a null mutation and is homozygously
lethal, while Trl13C is a weaker allele that
gives rise to some viable homozygous escapers (9). Both were
provided by Gabriella Farkas. trxE2 is a strong,
homozygously lethal allele with dominant phenotypes. For descriptions
of the mutants, see reference 23.
Transposon constructs.
Most transposon constructs were
assembled in the CaSpeR4 vector (29). Other vectors used
were the S2 Ubx-lacZ construct (30), containing
the S2 enhancer of the Ubx gene, and the YG CaSpeR construct
in which the yellow gene is separated from the polylinker-miniwhite portion by a gypsy insulator element
(34). In most cases, subfragments of the PRE region were
oligomerized to produce 3, 4, or 6 tandem copies before being inserted
into the transposon construct as indicated in Table 1. A transposon containing the LexA-PC gene (4) was constructed using the
C4Y-hs vector (Poux et al., submitted). This vector uses the intronless yellow gene (12) as a marker and places the
LexA-PC sequence under control of the hsp70 promoter
(details available upon request).
Histochemical staining.
Embryos were collected overnight,
fixed, stained, and mounted as described previously (20).
Rabbit anti-
-galactosidase antibody (Cappel) was preadsorbed with
fixed wild-type embryos. A biotinylated goat anti-rabbit second
antibody and a Vectastain ABC horseradish peroxidase kit (Vector Labs)
were used to reveal the antibody complexes. The effect of
Trl mutations was determined by crossing to
TrlR85/TM3 hb-lacZ, where the
balancer chromosome is marked with a lacZ inserted in the
hb gene. Mutant embryos lack lacZ expression in the anterior region.
Antibodies.
Polyclonal antibodies against PcG proteins were
raised in rabbits using glutathione S-transferase (GST)-PcG
fusion proteins containing amino acids 191 to 354 of PC and amino acids
819 to 926 of PSC. The fusion proteins were expressed in BL21 bacteria and purified on glutathione-Sepharose as described by the manufacturer (Pharmacia). The rabbit sera were affinity purified by passing first
through a GST-Sepharose column. The flowthrough was passed over the
respective PcG-Sepharose columns, washed with phosphate-buffered saline
(PBS) and eluted with 0.1 M glycine, pH 2.8. The antibodies were
dialyzed overnight against PBS, aliquoted, and stored frozen at
20°C.
In vitro band shift and immunoprecipitation assays.
Embryonic nuclear extracts were prepared from overnight embryo
collections. For LexA-PC extracts, overnight collections of embryos
carrying the hsp70-LexA-PC gene were heat shocked at 37°C for 40 min. The isolation of nuclei and the preparation of the extracts
were carried out essentially as described in reference 2. For the band shift assays, the PRE fragments were
end-labeled with Klenow DNA polymerase. The binding reaction mixture,
in a volume of 20 µl, contained 0.3 µg of nuclear extract, 1 to 2 fmol of end-labeled fragment, and 1.75 µg of poly(dI-dC) in band
shift buffer (12 mM HEPES [pH 7.9], 4 mM Tris [pH 7.9], 60 mM KCl,
5 mM MgCl2, 0.1 mM EDTA, 0.5 mM dithiothreitol, 10%
glycerol). After being incubating on ice for 15 min, the reaction
mixture was analyzed by electrophoresis on a 4.5% nondenaturing
acrylamide gel. For antibody supershift assays, 1 µl of the antibody
was added to the reaction mixture. Extracts from bacteria containing a
pET3-GAGA expression plasmid or the pET3 vector alone were made as
described by reference 32.
For the immunoprecipitation assays, the binding reaction was scaled up
to 100 µl and supplemented with 0.1% bovine serum albumin and 0.1%
NP40. The binding reaction mixture was then incubated with protein
A-Sepharose beads to which had been attached the appropriate antibody.
After 2 h at 4°C, the beads were washed three times with 100 µl of bandshift buffer, pelleted, incubated for 1 h in 0.5%
sodium dodecyl sulfate-0.2 µg of proteinase K/ml and extracted with
phenol-chloroform before precipitation. The results were analyzed on a
5% nondenaturing acrylamide gel. As a control for nonspecific binding,
the reaction mixtures contained an equimolar amount of one or more
similarly sized fragments isolated from the Bluescript plasmid vector.
For competition assays, a 150-fold molar excess of unlabeled competitor
fragment was added to the binding reaction mixtures. The
immunoprecipitation reactions involving a synthetic GAGA binding site
were done using the sequence AAAGAGAGCCCGGGAGAGAGAAA, cloned
in four copies in the SmaI site of the Bluescript vector and
excised using EcoRI and EagI. For use as a
competitor, the GAGA oligonucleotide was oligomerized with ligase and
the ladder of products was used. For each binding reaction, the ratios
between the test fragment and the control fragment in the input and
bound fraction were determined by scanning the gel with a Bio-Rad
Molecular Imager to determine the selectivity of the binding. The
Ubx promoter fragment was a 561-bp fragment from position
201 to +360 from the transcription start and contained three GAGA
binding sites. For the binding reaction, this fragment was cleaved with
DdeI to generate three fragments. The hsp70
promoter fragment was a 456-bp XbaI-XmnI fragment
starting 250 bp upstream of the transcription start site and containing
five GAGAG sites. The LexA target fragment was made from an
oligonucleotide with sequence ACTTGATACTGTATGAGCATACAGTATAACCA
oligomerized in four copies.
Construction of the mutated BP fragment.
The GAGA site
mutations indicated in Fig. 5 were introduced using two primers, M1
(CCGTAAAGCGCTAGCGATCCGA) and M2
(AACCGTATCTGGCCCTATTTCCGCAGTCG), each containing alterations
in a GAGA consensus site. To introduce the mutations in the BP
fragment, M2 was first used in a PCR with primer
ACAGTTATGGCGACGGAGCTGCAG to generate a fragment containing the PstI end of the fragment, including 18 bp of the
adjacent PF fragment. This fragment was then used together with the M1 oligonucleotide in a PCR that generated the PstI half of the
BP fragment with both GAGA sites mutated. This fragment was used in
turn for a third PCR in combination with primer
CACGGAAGCCATAACGGCAGAAC from the BglI end of the
fragment, including 7 bp from the AB region, just preceding the
BglI site. The resulting fragment was cloned in the
Bluescript vector and used to prepare the BP* mutant fragment for the
binding assays. The two halves of the BP fragment were generated using
the primer GCACCATAATGGCTGCG or its complement from the
central part of the BP sequence (Fig. 5) in PCRs together with the
primers from the PstI end and from the BglI end,
respectively. The GAGA oligonucleotide, containing two consensus
sequences was made by annealing AAAGAGAGCCCGGGAGAGAGAAA and
its complement. To produce the mutant GAGA oligonucleotide, the first
AGAGAG was replaced by TTCAAG, leaving a single
GAGAG consensus.
Protein immunoprecipitation.
Antibodies were attached to
protein A-Sepharose beads and cross-linked with dimethyl pimelimidate
as described in reference 15. The beads were then
washed once before use with 1 ml of interaction buffer (12 mM HEPES
[pH 7.9], 4 mM Tris [pH 7.9], 5 mM MgCl2, 60 mM KCl,
0.1 mM EDTA, 0.5 mM dithiothreitol, 0.1 mg of bovine serum albumin/ml,
0.1% NP-40) and incubated with embryonic nuclear extract containing
200 µg of protein in 100 µl of interaction buffer for 2 h at
4°C. The supernatant was removed, and the beads were washed three
times with 100 µl of interaction buffer. The bound protein was
released by incubation with 0.1 M glycine, pH 2.8, and analyzed by
Western blotting with the appropriate antibody, together with 10 µg
of input extract.
 |
RESULTS |
PRE fragments variegate miniwhite.
The
bxd PRE activity was initially found in 6.5-kb
HindIII fragment 2212H6.5 located about 20 kb from the
transcription start site of the Ubx gene, in a region that
contains several parasegmental enhancers (5). Previous
mapping had shown that the principal PRE activity is contained in the
1.5-kb interval between the StyI and the EcoRI
sites in Fig. 1. Fragments to the left or
to the right of this interval did not by themselves produce either
variegation of miniwhite gene expression or maintenance of
the anterior repression of a Ubx-lacZ construct, though they
are likely to contribute to silencing when part of a larger fragment
(see, e.g., reference 37). The 1.5-kb
EcoRI-StyI fragment induces variegation of the miniwhite gene in more than 60% of the lines; it maintains
repression of a Ubx-lacZ construct in embryos and creates a
new site of PcG protein binding on polytene chromosomes. To determine
whether different parts of this sequence could make independent
contributions to PcG silencing, we subdivided it into smaller fragments
and tested each for its ability to induce variegation of the
miniwhite gene. Considering that the smaller fragments might
be less efficient in establishing the repressive complex, we
oligomerized them and tested arrays of 3 to 6 copies. The different
fragments have recognizably different effects on the expression of the
miniwhite gene (Fig. 1 and Table
1). The strongest activity in terms of
strength of variegation and frequency of lines displaying it was found
in the two central fragments: a 180-bp BglI-PstI
fragment (BP) and the adjacent 78-bp PstI-HinfI
fragment (PF). The nonuniform pigmentation induced by the
AvaII-BglI fragment (AB) was not of the usual
highly variable mosaic type but generally in the form of an
anterior-posterior gradient (Fig. 2A). A
significant frequency of variegation was also obtained with the HA,
HH2, and HS fragments, although more often in the form of a more
general partial repression with faint spots of stronger pigmentation. A
400-bp fragment from the EcoRI end that includes the HH1
subfragment gave a frequency of variegation of marginal significance (4 of 30 lines). For comparison, the PRE fragment found most important for
effective silencing in a recent paper by Tillib et al. (37),
their fragment C, is delimited by nucleotide positions 218835 to 219249 of the BX-D sequence (24) and contains part of AB (positions
218822 to 219127) and part of BP (positions 219128 to 219318). Two
other fragments found important in that study, fragments B and D, lie
within the S2 fragment and the S1 fragment, respectively. In our
experiments, neither S2 nor S1 had detectable PRE activity by itself.

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 1.
Map of PRE region and subfragments. The bxd
PRE region is shown with a scale marked in kilobases centered at the
EcoRI site which corresponds to position 218241 in the BX-C
sequence (24), while the StyI site is at position
219797. The Ubx promoter in this scale would lie at position
+24. The positions of the embryonic enhancers S1 and S2 are indicated
by boxes below the line. The map also shows the approximate positions
of GAGAG sequences (G) and of Zeste binding sites (Z). The
subfragments, whose sizes in base pairs are indicated, were prepared
using restriction enzymes EcoRI (E), HinfI (Hf),
AvaII (Av), BglI (Bg), PstI (P),
StyI (St), and KpnI (K).
|
|

View larger version (68K):
[in this window]
[in a new window]
|
FIG. 2.
Variegation and maintenance activities. (A) Top, S2
Ubx-lacZ construct and the insertion site for PRE fragments;
bottom, expression patterns of the S2 enhancer construct in embryos at
(from left to right) early extension, extended, and retracted germ band
stages. Arrowheads indicate PS6. (B) Representative eye variegation
patterns of constructs AB×6, BP×6, and PF×4 are shown together with
embryos containing the corresponding S2 Ubx-lacZ reporter
constructs. The embryos are shown at the late germ band retraction
stage. Maintenance of early repression was obtained only with the BP×6
construct, in which expression continued to be repressed anterior of
parasegment 6 (arrowhead) and in which the pattern was arrested at the
pair rule stage.
|
|
If a fragment has high PRE activity, multiple copies might completely
silence the
miniwhite marker gene, preventing the recovery
of many transgenic fly lines. To evaluate the importance of this
effect, we constructed a transposon (YGBP×6) containing six copies
of
the BP fragment and including, as an independent marker for
transformation, the
yellow gene, protected against PRE
silencing
by a gypsy insulator element which, when interposed between
the
PRE and the marker gene, has been shown to block silencing very
efficiently (
34). YGBP×6 lines show an even higher
frequency
of repression of the
miniwhite gene. Six copies of
BP are in fact
able to repress completely the expression of the
miniwhite gene
in 12 of 23 lines heterozygous for the
transposon. This means
that half of the lines would not have been
recovered in the absence
of the
yellow marker. For
comparison, an analogous transposon
(YGBP) containing a single copy of
BP induces variegation at a
much lower frequency (Table
1).
Genetic interactions.
Might different PRE subfragments
interact preferentially with some subset of PcG proteins? When we
tested the dominant effects of different PcG mutations on the
variegation induced by the different subfragments, we did not observe
such specificities. For all constructs, some lines are affected by a
given PcG mutation and some are not (Table 1). A line affected by
mutations in one PcG gene might not respond to mutations in another PcG
gene. In no case was the variegation dependent on Suvar(2)5,
indicating that the tandem repeats contained in these transposons do
not induce the heterochromatin-like silencing observed by Dorer and
Henikoff (8) with arrays of white transposons.
While the PRE region has an overall silencing activity, it also
contains targets for some trxG proteins. A 400-bp region immediately
upstream of the
PstI site and corresponding to our fragment
AB
plus BP has been reported to interact with
trx (
6,
7); the
central part of the PRE is extremely rich in consensus
binding
sequences for the GAGA factor; a set of three
zeste
binding sites
is immediately adjacent to the PRE core fragments. We
tested a
selection of the lines of the different PRE fragments for the
effect of mutations in these three factors. Loss-of-function mutations
in the
zeste gene (
za) or the
z1 mutation have no effect on transposons that
do not include the
zeste binding sites
(
EcoRI-
StyI or smaller PRE fragments). However,
single copies of transposons that include the PRE Zeste sites
(
EcoRI-
KpnI or larger) become more strongly
repressed in the presence
of either of the
zeste mutations
(not shown). In contrast, when
Zeste is overexpressed from a heat shock
promoter,
miniwhite gene
expression from these transposons
is strongly stimulated (not
shown). The presence of the rest of the PRE
region is not necessary
since transposons containing the S1 fragment,
which contains the
Zeste binding sites but no PRE activity, also
respond to
zeste (not shown). The interaction with Zeste is
independent of silencing
and does not require pairing since it affects
flies heterozygous
for the
transposon.
Heterozygous mutations in the
trx gene decreased the
expression of the
white gene in several AB lines and, to a
lesser extent,
in BP lines, indicating that
trx function
stimulates expression
in a dosage-dependent way. As with the PcG
mutations, both the
presence and the strength of the effect are
strongly dependent
on the site of insertion. Although the
bxd PRE contains clusters
of GAGA sites, mutations in the
Trl gene, encoding the GAGA factor,
had little effect in the
majority of our lines. Surprisingly,
however, in contrast with the
generally positive effect of the
GAGA factor on gene expression, a few
lines displayed a detectable
increase in eye pigmentation when
heterozygous for the null mutation
TrlR85
(
9), suggesting that it contributes to repression. This was
seen in one of eight BP lines and in three of six YGBP×6 lines
tested,
indicating that, in some cases, a decrease in GAGA factor
reduces the
silencing effect of the PRE fragment. A similar involvement
of GAGA
factor in promoting effective PcG silencing has been shown
for the
Fab-7 PRE (
13).
Immunochemical staining of polytene chromosomes provides a direct test
for the ability of a transposon construct to recruit
a given PcG
protein. Polytene chromosome binding at the insertion
site was observed
with BP and PF constructs but not with AB. The
ability to induce
detectable PcG protein binding at the site of
insertion depended on the
site: it was visible in some BP and
PF lines but not in others. In
summary, then, we could detect
no differential interactions of
individual PcG proteins with any
one fragment. Although a given line
might interact with one PcG
mutation but not another or show binding to
one protein but not
another, these specificities were site dependent
and not fragment
dependent, suggesting that at different chromosomal
sites different
PcG proteins make different contributions to the
formation of
the
complex.
Maintenance of repression in embryos.
The strict functional
test of bxd PRE activity is its ability to maintain the
pattern of repression of a Ubx promoter construct in the
embryo. To test this, we assembled three constructs, placing the AB6,
BP6, or PF4 fragment oligomers in front of a Ubx-lacZ reporter gene under the control of the Ubx S2 enhancer (Fig.
2A) (5, 30). This enhancer has a pair rule pattern of
expression in the even-numbered parasegments when it is first activated
at the syncytial blastoderm but shifts to an all-parasegment pattern in
the course of germ band extension (Fig. 2B). Five of 13 BP6 lines
tested showed effective maintenance of the S2 pattern of expression:
the even-numbered PS pattern persists in the late embryo and expression
anterior of PS6 never develops. In contrast, maintenance was not seen
in five PF4 lines and six AB6 lines tested, although in most cases the
adults showed variegated or nonuniform eye coloration.
The ability to maintain repression conferred by the BP6 oligomer was
lost in embryos homozygous for a
Pc mutation, resulting
in
the appearance of expression in the thoracic segments at the
end of
germ band extension. A much weaker and less consistent
derepressing
effect was observed in embryos homozygous for the
TrlR85 null mutation or in embryos homozygous
for the weaker
Trl13C mutation, obtained by
crossing males containing the reporter
transposon with female escapers
homozygous for the
Trl13C mutation to minimize
the maternal
Trl contribution (
1). However,
since
some embryos show incomplete maintenance even in a
Trl+ background and since the degree of
maintenance varies from one
experiment to another, we could not
consider the effect
significant.
Immunoprecipitation of PcG complexes.
The in vivo experiments
show that the PRE region is composed of multiple fragments with
silencing activities that appear to differ both quantitatively and
qualitatively. We next tested the different fragments for their ability
to bind in vitro to PcG proteins present in embryonic nuclear extracts.
All the PRE fragments shown in Fig. 1 interact with the nuclear
extracts, resulting in a low-mobility complex when tested in gel
mobility shift assays (not shown). To determine whether PcG proteins
are present in these complexes, we used immunoprecipitation. For
comparison, the immunoprecipitation reaction mixtures contained one or
more reference DNA fragments from the plasmid vector or from other Ubx regions, and in all experiments the results were scanned
and quantitated to determine the degree of selective enrichment in the
immunoprecipitate relative to the input. Figure
3A shows that most of the subfragments
from the EcoRI-StyI region are selectively immunoprecipitated both by anti-PC and by anti-PSC antibody, albeit with different efficiencies. Fragments BP, HH2, and HS, which contain
GAGA sites, are more efficiently precipitated by anti-PC, while HH1,
HA, and AB, which lack multiple GAGA sites, are more efficiently
precipitated by anti-PSC. The only fragment that clearly fails to
immunoprecipitate with either of the two antibodies is PF, although in
vivo it has strong PRE activity as determined by the ability to induce
PcG-dependent variegation of the miniwhite gene. Although
the PF fragment is only 78 bp long, the failure to immunoprecipitate is
not due to its small size since smaller fragments can be efficiently
precipitated in this assay (see experiments below).

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 3.
Immunoprecipitation binding assay. (A) For each
fragment, a mixture including one or more control fragments (*) was
incubated with nuclear extract (NE) and with beads without antibody
( ) or with anti-PC antibody ( Pc) or anti-PSC antibody ( Psc).
The radioactivity bound to the beads was analyzed by gel
electrophoresis together with an aliquot of the input mixture (i). (B)
Binding to the Mcp PRE. The locations of the Mcp
PRE in the bithorax complex and the region containing the major DNase
hypersensitive sites (16) are shown. The two Mcp
fragments indicated were incubated with nuclear extract and
immunoprecipitated with anti-PC or anti-PSC.
|
|
We also examined the interactions of the S1 and S2 fragments that flank
the PRE region and that contain embryonic enhancer
activities to see if
they might also contribute to the assembly
of PcG complexes. These
fragments were split into two at the
KpnI
and
HincII sites, respectively (Fig.
1). Both halves of S2 show
significant immunoprecipitation with both PC and PSC antibodies.
For
S1, a weak interaction with the SK fragment but not with the
KS
fragment was found (not shown). For comparison, we tested the
binding
to another PRE from the bithorax complex, the
Mcp PRE
(Fig.
3B). The 822-bp
SalI-
XbaI
Mcp
fragment, which contains only
a single GAGA consensus sequence
(
16), was cut with
AflII into
two fragments, both
of which are efficiently immunoprecipitated
by anti-PSC but only very
poorly by anti-PC, resembling in this
respect the behavior of the
GAGA-less fragments of the
bxd PRE.
In contrast, no
immunoprecipitation was observed with the
Ubx PBX, BXD, or
BX enhancers (
30-32) (results not
shown).
Involvement of GAGA sequences.
As expected from the presence
of multiple GAGA sites, the BP fragment also forms complexes that are
efficiently immunoprecipitated by anti-GAGA antibody (not shown) and
competed by excess unlabeled GAGA oligonucleotide. In the course of
these experiments we found that, surprisingly, the interaction of the
BP fragment with PC or with PSC is also efficiently competed by an
oligonucleotide containing GAGA consensus sequences, suggesting that it
might be mediated by a factor that binds to this sequence. Three other PRE fragments contain GAGA sites and interact with the bacterially produced GAGA factor in band shift assays (not shown), while two others
have neither property. We tested the ability of the GAGA oligonucleotide to compete for the immunoprecipitation of each of the
PRE fragments with anti-PC antibody. Figure
4A shows that the oligonucleotide
efficiently competes for the binding of the GAGA-containing fragments
but has little or no effect with the HH1 and HA fragments, which have
no GAGA sites, and has only a slight effect with AB, which has only one
GAGA site. These results suggest that at least two kinds of PcG
complexes are detected by the immunoprecipitation assay: one dependent
on the GAGA factor and one independent.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 4.
Binding competition. (A) The binding detected by the
anti-PC antibody (Pc) was competed by the presence of an unlabeled
oligonucleotide containing the GAGA consensus (ga). Strong competition
was observed with the BH, HH2, and HS fragments, weak competition was
observed with AB, and none was observed with HH1, HA, or AB. (B) The
immunoprecipitation of the BP fragment with anti-PC was carried out in
the presence of unlabeled DNA of the various other fragments as the
competitor or of an unlabeled oligonucleotide containing the Hunchback
consensus binding sequence (Hb oligo). (C) BP fragment does not compete
with the binding of HH1 or HA. No competitor ( ) or GAGA
oligonucleotide (ga), BP, HH1, or HA unlabeled competitors were added
as indicated.
|
|
To verify the existence of two mechanisms of interaction with DNA, we
tested the ability of different fragments to compete
with one another.
We first examined the effect on the immunoprecipitation
of BP of
unlabeled competing DNA from the other fragments (Fig.
4B). The
GAGA-containing fragments HS, HH2, and BP themselves
are good
competitors. The AB fragment, containing a single GAGA
site, competes
weakly. No competition was observed with an oligonucleotide
containing
a Hunchback (HB) consensus binding sequence. We then
looked in more
detail into the competition between BP and the
non-GAGA-containing
fragments HH1 and HA (Fig.
4C). The immunoprecipitation
of HH1 or HA is
not competed either by GAGA oligonucleotide or
BP DNA, while the BP
complex is inhibited by both of these but
not by either HH1 or HA
competitor DNA. HH1 and HA do not compete
with BP, but they do compete
with each other (not shown). These
results confirm the existence of at
least two modes for the binding
of PcG complexes to DNA in
vitro.
Mutated GAGA sites abolish binding.
Footprinting experiments
show that BP contains five sites that can interact with the bacterially
produced GAGA factor in vitro (not shown). Sites 1, 3, 4, and 5 (Fig.
5A) are typical consensus sequences
containing a GAGAG core; site 2 is noncanonical. When probes
corresponding to the two halves of BP are incubated with nuclear
extract and tested for immunoprecipitation with anti-PC, the right half
(-P) shows good binding, though it is apparently weaker than that shown
by the intact BP fragment, while the left half (B-) does not interact
visibly (Fig. 5C). Band shift and supershift experiments (Fig. 5B) show
that -P still forms low-mobility complexes that are supershifted by
anti-GAGA antibody. The B- fragment is responsible for the
higher-mobility complex seen already with BP, but this complex contains
no GAGA protein and is not supershifted by anti-PC antibody. The B-
fragment still interacts well with bacterially produced GAGA protein
but only very weakly with GAGA in the nuclear extract. In fact, a very
faint, low-mobility band that is supershifted by anti-GAGA antibody is
still visible.

View larger version (80K):
[in this window]
[in a new window]
|
FIG. 5.
Dissection of the BP fragment. (A) The sequence from the
BglI site to the PstI site is shown with the GAGA
consensus sites boxed. Site 2, which is not a canonical consensus, is
boxed by a dashed line. The nucleotides mutated in the BP* fragment
are shown above the sequence and the extents of the two half fragments
are indicated by the line above the sequence (B-) and below the
sequence (-P). (B) Band shift analysis of BP, its two halves, and the
mutant BP* fragment. NE, nuclear extract alone; -GA, NE plus
anti-GAGA; -Pc, NE plus anti-PC; pGA, binding to extracts of
bacteria containing pET-GAGA; p, extracts containing the pET vector
alone; i, input mixture. (C) Immunoprecipitation analysis of BP, B-,
P-, and BP* fragments. White asterisk, control fragment i, input; ,
no antibody; Pc, bound with anti-PC. (D) Binding of fragments
containing only GAGA site 3, site 4 (+5), or sites 1 to 3, obtained by
cleavage at the Sau3A site between GAGA sites 3 and 4.
|
|
To determine whether the GAGA consensus sequences on the right half of
the fragment are responsible for the interactions,
we mutated them
(Fig.
5A) and tested the mutated BP fragment (BP*).
The BP* fragment,
still containing one canonical GAGAG and one
noncanonical site, is no
longer immunoprecipitated by anti-PC
antibody (Fig.
5C), and the band
shift experiment reveals only
a weak residual affinity for
GAGA-containing complexes (Fig.
5C).
Cleavage with
Sau3A,
which separates site 3 from sites 4 and 5,
shows that while sites 4 and
5 suffice for binding to PC-containing
complexes, site 3 alone does
not. However, a fragment containing
sites 1, 2, and 3 can bind (Fig.
5D). These results suggest that
at least two consensus GAGAG sequences
are necessary for interaction
with either the endogenous GAGA factor or
with a PC-containing
complex. The mutated BP* fragment does not bind in
vitro to a
PcG complex either in single copy or when
oligomerized.
If GAGA binding sites are the targets of PcG complexes in vitro, are
they sufficient? We examined this question by testing
other DNA
fragments known to interact with the GAGA factor in
vivo. The
hsp70 promoter contains prominent GAGA sites that are
important for its heat shock-inducible promoter activity
(
22).
When an
hsp70 promoter fragment was tested
in our assay, it was
efficiently immunoprecipitated by anti-PC antibody
(Fig.
6). The
Ubx promoter
contains a set of GAGA sites that are important for
its promoter
activity both in vivo and in vitro (
2,
19).
A DNA fragment
from the
Ubx promoter containing these sites is
also
efficiently immunoprecipitated in our assay. Note, however,
that
another fragment, just downstream of the
Ubx transcription
start site, also binds in this assay although it contains no GAGAG
sequence. Even an oligomer consisting of four copies of a synthetic
oligonucleotide containing two GAGA binding sites is strongly
immunoprecipitated (Fig.
6). This oligonucleotide binds well also
as a
monomer, but the introduction of two nucleotide changes in
one of the
GAGA consensus sites destroys the binding activity.
These results show
that two nearby consensus sequences are necessary
and sufficient in
vitro to interact with PcG complexes present
in nuclear extracts,
though they are not sufficient to recruit
a PcG complex in vivo. Two or
more GAGA sites separated by the
entire length of the fragment, as in
BP* oligomers, do not support
in vitro binding (not shown).

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 6.
Binding to other GAGA-containing sequences. Shown are
anti-PC immunoprecipitation reactions with fragments containing the
hsp70 promoter, the Ubx promoter, and a synthetic
GAGA consensus oligonucleotide oligomerized to four copies (GAGA ol.).
Note that the Ubx promoter fragment (nucleotides 201 to
+360 surrounding the transcription start) was cut into three fragments
with DdeI. The largest fragment, containing three GAGAG
sites, binds strongly, but another fragment, downstream of the
transcription start, also immunoprecipitates though it contains no
GAGAG. A control fragment, where included, is marked with a white
asterisk. i, input mixture; Pc, anti-PC antibody.
|
|
When the BP* mutant fragment, oligomerized in six copies, was
incorporated in a reporter construct containing the
Ubx S2
enhancer
and
Ubx-lacZ gene, only 1 of 9 transgenic lines was
able to partly
maintain the repressed pattern of S2 expression,
compared to 5
of 13 maintaining lines found for the wild-type BP
construct.
These numbers are too low to be statistically significant.
That
the mutations at best only reduce the frequency of maintaining
lines might be explained if BP* still contains other determinants
for
PRE activity and suggests that, while the GAGA sites may contribute,
they are not the only sequences involved in recruiting a PcG complex
in
vivo.
GAGA factor is a constituent of a PcG complex.
The preceding
experiments show that PcG complexes bind in vitro to sites containing
GAGA consensus sequences and are able to bind the GAGA factor. Is the
in vitro binding of PcG complexes to these sites mediated by the GAGA
factor itself or does some other PcG component recognize the same GAGA
consensus sequence? We used two approaches to ask if the GAGA factor
was in fact associated with the multiprotein PcG complexes present in
the nuclear extract. Anti-PC antibody immunoprecipitates the GAGA
protein from Drosophila embryonic extracts (Fig.
7A) but does not interact with the GAGA protein expressed in bacteria (not shown). Conversely, an anti-GAGA antibody immunoprecipitates the PC protein from the embryonic extracts.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 7.
Coimmunoprecipitation of PC and the GAGA factor. (A)
Nuclear extract proteins were immunoprecipitated with beads containing
no antibody ( ), with anti-PC beads (ipPc), or with anti-GAGA beads
(ipGA). The material recovered from the beads was analyzed by Western
blotting; blots were developed with anti-PC ( -Pc) or with anti-GAGA
( -GA). Additional bands in the anti-PC blot (middle) are due to the
immunoglobulins present in the immunoprecipitate. i, input nuclear
extract. (B) Nuclear extracts (NE) from embryos expressing LexA-PC
cause binding of a PSC-containing complex to a DNA fragment containing
four LexA binding sites (LexA), while wild-type extracts do not bind.
Immunoprecipitation with anti-GAGA shows that the GAGA factor is also
contained in this complex. SK250, a control fragment from the
Bluescript vector; i, input.
|
|
To confirm the participation of the GAGA factor in PcG complexes, we
used another approach. A construct expressing a chimeric
PC protein
fused to the LexA DNA-binding domain was expressed
in flies under
control of the
hsp70 promoter. The LexA-PC protein
is
functional in vivo and participates in PcG complexes, as shown
by
immunostaining of polytene chromosomes and by its ability to
repress in
vivo a reporter construct containing LexA binding sites
(Poux et al.,
submitted). When nuclear extracts from embryos expressing
LexA-PC are
used in the binding reactions, anti-PC or anti-PSC
antibodies can
precipitate a DNA probe containing four LexA binding
sites, while no
binding occurs with wild-type extracts (Fig.
7B),
showing that the
LexA-PC protein can recruit a PcG complex to
the LexA target sequence.
In a parallel experiment, anti-GAGA
antibodies immunoprecipitated the
LexA probe in the presence of
the LexA-PC extract but not in the
presence of wild-type extract.
These experiments confirm that the GAGA
factor is a constituent
of at least some PcG complexes formed in
vivo.
 |
DISCUSSION |
PRE activity in vivo.
Dissection of the PRE reveals that it is
a compound region containing several sequences that are able to
different extents to induce variegated expression of the
miniwhite gene, respond to PcG mutations, and create new
binding sites for PcG proteins on polytene chromosomes. The separate
fragments are definitely weaker in activity than the whole. A single
copy of a fragment containing BP, AB, and part of HA silences very
effectively (34), indicating that the different sequences
normally cooperate to achieve more-complete silencing to a degree that
is not attained by multiple tandem copies of one fragment. The
different subfragments most likely contribute complementary functions,
but it has not been possible to demonstrate that different PcG proteins
interact with different subfragments. As with the entire PRE, the
response to different PcG mutations depends strongly on the site of
insertion of the transposon construct. The genomic context makes
therefore a strong contribution not only to the strength of the
silencing but also to the relative importance of the different PcG
components of the silencing complex. The activity of PRE-containing
transposons inserted at different sites suggests that this contribution
is due not only to sequences flanking the insertion site but also to
the interaction in trans with other genomic PRE sites
(34).
Only one of the three subfragments tested in embryos, BP, was able to
maintain repression of the
Ubx-lacZ reporter gene. This
could be due simply to the relative PRE strengths of the different
fragments. That is, increasing the number of copies of the other
fragments might achieve the same silencing strength. Another
possibility
is that the complex formed at the BP fragment is
qualitatively
different from that recruited by the other fragments; for
example,
it might be able to recruit PcG proteins sufficiently early in
embryonic development to have an effect on the
Ubx-lacZ
gene,
while other PRE fragments might be able to institute silencing
only at later stages. Different affinities for PcG complexes could
also
account for the different abilities to create binding sites
for PcG
proteins on polytene chromosomes. However, the fact that
the PF
fragment, though able to induce variegation at a high rate
and to bind
PcG proteins on polytenes, failed to show any detectable
PcG complex
formation in the immunoprecipitation assays suggests
that the nature
and composition of the complexes and/or the mode
and timing of their
recruitment are likely to differ for the different
fragments.
The role of the GAGA factor.
The in vitro experiments show
that GAGAG-containing sequences are binding sites for PcG complexes and
that the GAGA factor is associated with PcG complexes present in the
nuclear extracts. Ion exchange chromatography of nuclear extracts
confirms that, while PcG proteins elute over a broad range of salt
concentrations, the in vitro binding activity constitutes a small
minority and copurifies with the GAGA factor (B. Horard and V. Pirrotta, unpublished experiments). The multiplicity and heterogeneity
of PcG complexes present in nuclear extracts would not be detected in
affinity-based purification schemes such as that used by Shao et al.
(33), who did not find the GAGA factor to be a constituent
of their PRC1 PcG complex. In contrast, Hodgson and Brock (submitted
for publication) find the GAGA factor, along with PH, in a multiprotein complex that binds in vitro to PRE regions corresponding to ours. We
cannot exclude the possibility that some other PcG protein also
recognizes the GAGA consensus sequence, but the association of the GAGA
factor with PcG complexes shows that it is most likely involved in at
least one mode of PcG binding to PRE DNA. Does this reflect a role for
the GAGA factor in PcG silencing in vivo? The GAGA factor was
originally identified as a transcription-stimulating factor both in
vivo and in vitro and was classified as a trxG protein because it
stimulated the activity of homeotic genes while its mutants had
phenotypes indicative of homeotic insufficiency (2, 9).
However, some evidence suggests that it can also be associated with
repressive functions. The GAGA factor, together with another activator,
NTF-1, also binds to an 11-bp element required for the repression of
tailless by the torso-dependent pathway
(22). Evidence that it might be involved in PRE function was
presented by Hagstrom et al. (13), who found that GAGA
mutations decrease the silencing effected by the Fab-7 PRE.
In the Ubx gene, the bxd PRE region contains the
largest concentration of GAGA binding sites. If we take each continuous
G(AG)n stretch as one binding site, the 1-kb interval containing the
core of the PRE contains 13 sites while the next highest concentration
(8 sites) is found in a 1-kb region containing the bx PRE
(not to be confused with the BX enhancer). Chromatin cross-linking and
immunoprecipitation experiments confirm that these regions bind the
GAGA factor in vivo (34). Our results suggest that at these
sites the GAGA factor is not an antagonist of silencing and is not
simply an accessory or a facilitator of PcG complex formation but may,
in concert with other factors, contribute to targeting PcG complexes.
It was surprising, in view of our in vitro results, that the effects of
Trl mutations on either
miniwhite variegation or
the
silencing of the
Ubx-lacZ reporter were sporadic and
strongly
dependent on the insertion site. One possible explanation is
that,
in vivo, the GAGA factor is only one of a set of DNA-binding
recruiting
proteins and that, while it contributes to, it is not
essential
for, the assembly of PcG complexes. Chromatographic
fractionation
of nuclear extracts indicates in fact that only a
fraction of
the PcG complexes present in embryonic extracts are
associated
with the GAGA factor (B. Horard and V. Pirrotta, unpublished
results).
Furthermore, embryos contain an important maternal supply of
the
GAGA factor, which would mask the effect of a reduced zygotic
contribution. Later, other recruiting factors might be involved.
Finally, our results cannot exclude the possibility that, although
the
GAGA factor is a component of PcG complexes, can target their
binding
in vitro, and is apparently important for the function
of the
Fab-7 PRE (
13), it is not primarily involved in
recruitment
at the
bxd PRE. Its role might be instead
primarily architectural.
Katsani et al. (
18) have shown that
the GAGA factor binds to
DNA as a multimer that recognizes clustered
GAGA consensus sequences,
and they argue that such binding would be
expected to bend DNA
in a way incompatible with nucleosome assembly.
GAGA binding would
then clear the PRE core of nucleosomes and bend it
to facilitate
interactions among other DNA-binding
components.
PcG complexes with other GAGA binding sites.
The presence of
GAGA binding sites alone appears to be sufficient in vitro to bind a
PcG complex since not only the PRE fragments but also the
Ubx promoter and the hsp70 promoter bind in our
experiments though they have no known PcG silencing activity in vivo.
In addition, a GAGA-containing oligonucleotide also binds efficiently
to PcG complexes. Nevertheless, GAGA protein binding to a DNA sequence is not sufficient to recruit PcG complexes in vivo. Clearly the in
vitro binding reaction does not reflect the in vivo activity. The most
probable explanation of this discrepancy is that the binding detected
in vitro is due to complexes that are preassembled in vivo and are then
dissociated from the chromatin during the preparation of nuclear
extracts. If the nature and composition of PcG complexes are templated
by the PREs at which they are assembled, GAGA-containing PcG complexes
would be efficiently targeted to GAGA binding sites in vitro while, in
vivo, complex formation would require the de novo recruitment and
assembly of PcG complexes, involving other DNA binding components or
cofactors. We favor this interpretation because it would also explain
the variable compositions of PcG complexes detected at different
chromosomal sites. In vivo, the large majority of GAGA binding sites
visible on polytene chromosomes are not associated with PcG binding,
suggesting that only a small fraction of the GAGA protein is involved
in PcG complexes. This interpretation also accounts for the fact that
the LexA-GAGA protein cannot recruit PcG complexes to LexA binding
sites (Poux et al., submitted). We note also that the target of PcG
complexes in vivo is chromatin, not naked DNA. The presence of
nucleosomes might normally increase the selectivity, allowing PcG
complexes to assemble only at sites where other recruiting or
architectural proteins are also bound.
In view of these results, the existence of GAGA sites at the
Ubx promoter raises other possibilities. In the presence of
a
PRE, a GAGA factor bound at the
Ubx promoter might
participate
in the silencing activity by interacting with
GAGA-containing
PcG complexes recruited at the PRE, mediating or
contributing
to promoter silencing. Both the
hsp70 and
hsp26 promoters are
efficiently repressed by the presence of
a PRE in the same transposon
construct (V. Pirrotta, unpublished
results). The GAGA factor
might contribute to silencing in these cases
also. The
miniwhite gene, which is also silenced by the PRE,
does not contain typical
clustered GAGA sites in its promoter region
but only a few scattered
sites in the transcribed region. The
expression of the
miniwhite gene is strongly dependent on
the site of insertion and on distant
enhancers within or outside of the
transposon construct. The silencing
of these enhancers might be in part
responsible for the effect
of the PRE on
miniwhite
expression. Alternatively, other proteins
binding to the
miniwhite promoter region might interact with PcG
complexes.
Other recruiting proteins.
The immunoprecipitation experiments
also detected binding that is not competed by GAGA oligonucleotides
with PRE fragments that do not contain consensus GAGA binding sites.
This implies that other recognition sequences and other DNA-binding
proteins are involved in these cases. The recent discovery that PHO, a Drosophila PcG protein homologue of the mammalian YY-1
factor, binds to DNA suggests that it might be one such recruiter of
PcG complexes (3). There are in fact a number of putative
PHO binding sites with the minimal consensus GCCAT in the PRE region:
one in AB, two in BP (a third site is destroyed by the BglI
cleavage), and three in the PF fragment. These bind PHO protein in
vitro and are important for PRE activity in vivo (11).
However, none are found in the HH or HA fragments; hence these
presumably depend on other recruiting proteins. The PF fragment, on the
other hand, though it contains three putative PHO sites, is conspicuous
for its inability to bind PcG complexes in our extracts, suggesting that PHO is either not present in the complex containing PC and PSC or
does not interact directly with it. The fact that the mammalian PHO
homologue YY-1 causes sharp bends in the DNA (27) raises the
possibility that PHO too might serve a primarily architectural role
without necessarily interacting directly with PcG complexes.
Although PF does not contain GAGA sites, it is almost as effective in
inducing PcG-dependent variegation of the
miniwhite gene as
the BP fragment and it can generate new PcG binding sites
at the site
of insertion on polytene chromosomes. Yet PF cannot
maintain repression
of the
Ubx-lacZ reporter gene in embryos.
One possible
explanation for these results is that PF is the target
for yet another
PcG recruiting mechanism that either functions
poorly under our in
vitro binding conditions or depends on proteins
that are not present in
the embryonic extracts. The fact that
the PF fragment can recruit
silencing complexes in larval cells
but cannot maintain repression in
the embryo would be consistent
with a requirement for proteins present
only at later developmental
stages. Another possible explanation is
that PF does interact
with certain PcG complexes which do not include
PC or PSC and
hence escaped our
detection.
The picture of the PRE that emerges from these experiments is that of a
mosaic of multiple interaction sites which may require
different
DNA-binding proteins to recruit PcG components. A similar
conclusion
was reached by Tillib et al. (
37), based on deletions
that
abolish the activity of the
bxd PRE and by Hodgson and Brock
(submitted), who used an in vitro binding approach similar to
ours.
GAGA sites are associated with some PREs but not others
(e.g., the
Mcp PRE). If the GAGA factor acts as a recruiting protein,
it is most likely only one of many possible recruiters. Different
recruiters might interact specifically with different PcG proteins,
accounting for the fact that the binding sites for different PcG
proteins on polytene chromosomes do not completely coincide.
Nevertheless,
the ability of PcG proteins to interact with one another
or to
enter into a chain of recruitment (
26) means that, in
most cases,
strong binding sites for one PcG protein will be able to
recruit
at least to some degree the other PcG proteins. The difference
between direct and indirect recruitment may be responsible for
the fact
that a strong chromosomal binding site for one PcG protein
is sometimes
a weak binding site for another PcG
protein.
 |
ACKNOWLEDGMENTS |
B.H. and C.T. contributed equally to this work.
We are grateful to Peter Becker and members of his laboratory for the
use of his fly cages and help in preparing the wild-type embryonic
extract. Thanks are due to Carl Wu and Peter Harte for repeated gifts
of antibody, to Gabriella Farkas for the Trl mutants, to Bob
Kingston for the LexA-PC gene and to Ivan Dellino for constructing the
BP* mutant. We thank Hugh Brock for valuable discussions and for
sharing results prior to publication.
This work was supported by a grant from the Swiss National Science
Foundation, by the Human Frontiers Science Program, and by a
contribution from the Georges and Antoine Claraz Donation.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Zoology, University of Geneva, 30 quai Ernest Ansermet, CH1211 Geneva, Switzerland. Phone: (41 22) 702 6786. Fax: (41 22) 702 6776. E-mail: pirrotta{at}zoo.unige.ch.
Present address: Laboratoire BIOMOVE, UMR 6547, Université de
Clermont Ferrand II, 63177 Aubiere Cedex, France.
 |
REFERENCES |
| 1.
|
Bhat, K. M.,
G. Farkas,
F. Karch,
H. Gyurkovics,
J. Gausz, and P. Schedl.
1996.
The GAGA factor is required in the early Drosophila embryo not only for transcriptional regulation but also for nuclear division.
Development
122:1113-1124[Abstract].
|
| 2.
|
Biggin, M. D., and R. Tjian.
1988.
Transcription factors that activate the Ultrabithorax promoter in developmentally staged extracts.
Cell
53:699-711[CrossRef][Medline].
|
| 3.
|
Brown, J. L.,
D. Mucci,
M. Whiteley,
M. Dirksen, and J. A. Kassis.
1998.
The Drosophila polycomb group gene pleiohomeotic encodes a sequence-specific DNA binding protein with homology to the multifunctional mammalian transcription factor YY1.
Mol. Cell
1:1057-1064[CrossRef][Medline].
|
| 4.
|
Bunker, C. A., and R. E. Kingston.
1994.
Transcriptional repression by Drosophila and mammalian Polycomb group proteins in transfected mammalian cells.
Mol. Cell. Biol.
14:1721-1732[Abstract/Free Full Text].
|
| 5.
|
Chan, C. S.,
L. Rastelli, and V. Pirrotta.
1994.
A Polycomb response element in the Ubx gene that determines an epigenetically inherited state of repression.
EMBO J.
13:2553-2564[Medline].
|
| 6.
|
Chang, Y.-L.,
B. O. King,
M. O'Connor,
A. Mazo, and D.-H. Huang.
1995.
Functional reconstruction of trans regulation of the Ultrabithorax promoter by the products of two antagonistic genes, trithorax and Polycomb.
Mol. Cell. Biol.
15:6601-6612[Abstract].
|
| 7.
|
Chinwalla, V.,
E. P. Jane, and P. J. Harte.
1995.
The Drosophila trithorax protein binds to specific chromosomal sites and is co-localized with Polycomb at many sites.
EMBO J.
14:2056-2065[Medline].
|
| 8.
|
Dorer, D. R., and S. Henikoff.
1994.
Expansions of transgene repeats cause heterochromatin formation and gene silencing in Drosophila.
Cell
77:993-1002[CrossRef][Medline].
|
| 9.
|
Farkas, G.,
J. Gausz,
M. Galloni,
G. Reuter,
H. Gyurkovics, and F. Karch.
1994.
The Trithorax-like gene encodes the Drosophila GAGA factor.
Nature
371:806-808[CrossRef][Medline].
|
| 10.
|
Fauvarque, M.-O., and J.-M. Dura.
1993.
polyhomeotic regulatory sequences induce developmental regulator-dependent variegation and targeted P-element insertions in Drosophila.
Genes Dev.
7:1508-1520[Abstract/Free Full Text].
|
| 11.
|
Fritsch, C.,
J. Brown,
J. Kassis, and J. Müller.
1999.
The DNA-binding Polycomb group protein Pleiohomeotic mediates silencing of a Drosophila homeotic gene.
Development
126:3905-3913[Abstract].
|
| 12.
|
Geyer, P. K., and V. G. Corces.
1987.
Separate regulatory elements are responsible for the complex pattern of tissue-specific and developmental transcription of the yellow locus in Drosophila melanogaster.
Genes Dev.
1:996-1004[Abstract/Free Full Text].
|
| 13.
|
Hagstrom, K.,
M. Müller, and P. Schedl.
1997.
A Polycomb and GAGA dependent silencer adjoins the Fab7 boundary in the Drosophila bithorax complex.
Genetics
146:1365-1380[Abstract].
|
| 14.
|
Hagstrom, K.,
M. Muller, and P. Schedl.
1996.
Fab-7 functions as a chromatin domain boundary to ensure proper segment specification by the Drosophila bithorax complex.
Genes Dev.
10:3202-3215[Abstract/Free Full Text].
|
| 15.
|
Harlow, E., and D. Lane.
1988.
Antibodies. A laboratory manual, p. 522-523.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 16.
|
Karch, F.,
M. Galloni,
L. Sipos,
J. Gausz,
H. Gyurkovics, and P. Schedl.
1994.
Mcp and Fab-7: molecular analysis of putative boundaries of cis-regulatory domains in the bithorax complex of Drosophila melanogaster.
Nucleic Acids Res.
22:3138-3146[Abstract/Free Full Text].
|
| 17.
|
Kassis, J. A.
1994.
Unusual properties of regulatory DNA from the Drosophila engrailed gene: three "pairing-sensitive" sites within a 1.6 kb region.
Genetics
136:1025-1038[Abstract].
|
| 18.
|
Katsani, K.,
M. Hajibagheri, and C. Verrijzer.
1999.
Co-operative DNA binding by GAGA transcription factor requires the conserved BTB/POZ domain and reorganizes promoter topology.
EMBO J.
18:698-708[CrossRef][Medline].
|
| 19.
|
Laney, J. D., and M. D. Biggin.
1992.
zeste, a nonessential gene, potently activates Ultrabithorax transcription in the Drosophila embryo.
Genes Dev.
6:1531-1541[Abstract/Free Full Text].
|
| 20.
|
Lawrence, P. A., and P. Johnston.
1989.
Analysis of function of the pair-rule genes hairy, even-skipped and fushi tarazu in mosaic Drosophila embryos.
Development
107:847-854[Abstract/Free Full Text].
|
| 21.
|
Lee, H.-S.,
K. W. Kraus,
M. F. Wolfner, and J. T. Lis.
1992.
DNA sequence requirements for generating paused polymerase at the start of hsp70.
Genes Dev.
6:284-295[Abstract/Free Full Text].
|
| 22.
|
Liaw, G.-J.,
K. M. Rudolph,
J.-D. Huang,
T. Dubnicoff,
A. J. Courey, and J. A. Lengyel.
1995.
The torso response element binds GAGA and NTF-1/Elf-1, and regulates tailless by relief of repression.
Genes Dev.
9:3163-3173[Abstract/Free Full Text].
|
| 23.
|
Lindsley, D. L., and G. G. Zimm.
1992.
The genome of Drosophila melanogaster.
Academic Press, San Diego, Calif.
|
| 24.
|
Martin, C. H.,
C. A. Mayeda,
C. A. Davis,
C. L. Ericsson,
J. D. Knafels,
D. R. Mathog,
S. E. Celniker,
E. B. Lewis, and M. J. Palazzolo.
1995.
Complete sequence of the bithorax complex of Drosophila.
Proc. Natl. Acad. Sci. USA
92:8398-8402[Abstract/Free Full Text].
|
| 25.
|
Mihaly, J.,
I. Hogga,
J. Gausz,
H. Gyurkovics, and F. Karch.
1997.
In situ dissection of the Fab-7 region of the bithorax complex into a chromatin domain boundary and a Polycomb-response element.
Development
124:1809-1820[Abstract].
|
| 26.
|
Müller, J.
1995.
Transcriptional silencing by the Polycomb protein in Drosophila embryos.
EMBO J.
14:1209-1220[Medline].
|
| 27.
|
Natesan, S., and M. Z. Gilman.
1993.
DNA bending and orientation-dependent function of YY1 in the c-fos promoter.
Genes Dev.
7:2497-2509[Abstract/Free Full Text].
|
| 28.
|
Orlando, V.,
E. P. Jane,
V. Chinwalla,
P. J. Harte, and R. Paro.
1998.
Binding of Trithorax and Polycomb proteins to the bithorax complex: dynamic changes during early Drosophila embryogenesis.
EMBO J.
17:5141-5150[CrossRef][Medline].
|
| 29.
|
Pirrotta, V.
1988.
Vectors for P-mediated transformation in Drosophila, p. 437-445.
In
R. L. Rodriquez, and D. T. Denhardt (ed.), Vectors. A survey of molecular cloning vectors and their uses. Butterworths, Boston, Mass.
|
| 30.
|
Pirrotta, V.,
C. S. Chan,
D. McCabe, and S. Qian.
1995.
Distinct parasegmental and imaginal enhancers and the establishment of the expression pattern of the Ubx gene.
Genetics
141:1439-1450[Abstract].
|
| 31.
|
Poux, S.,
C. Kostic, and V. Pirrotta.
1996.
Hunchback-independent silencing of late Ubx enhancers by a Polycomb group response element.
EMBO J.
15:4713-4722[Medline].
|
| 32.
|
Qian, S.,
M. Capovilla, and V. Pirrotta.
1991.
The bx region enhancer, a distant cis-control element of the Drosophila Ubx gene and its regulation by hunchback and other segmentation genes.
EMBO J.
10:1415-1425[Medline].
|
| 33.
|
Shao, Z.,
F. Raible,
R. Mollaaghababa,
J. Guyon,
C. Wu,
W. Bender, and R. Kingston.
1999.
Stabilization of chromatin structure by PRC1, a Polycomb complex.
Cell
98:37-46[CrossRef][Medline].
|
| 34.
|
Sigrist, C. J. A., and V. Pirrotta.
1997.
Chromatin insulator elements block the silencing of a target gene by the Drosophila Polycomb response element (PRE) but allow trans interactions between PREs on different chromosomes.
Genetics
147:209-221[Abstract].
|
| 35.
|
Strutt, H., and R. Paro.
1997.
The Polycomb group protein complex of Drosophila melanogaster has different compositions at different target genes.
Mol. Cell. Biol.
17:6773-6783[Abstract].
|
| 36.
|
Strutt, H.,
G. Cavalli, and R. Paro.
1997.
Co-localization of Polycomb protein and GAGA factor on regulatory elements responsible for the maintenance of homeotic gene expression.
EMBO J.
16:3621-3632[CrossRef][Medline].
|
| 37.
|
Tillib, S.,
S. Petruk,
Y. Sedkov,
A. Kuzin,
M. Fujioka,
T. Goto, and A. Mazo.
1999.
Trithorax- and Polycomb-group response elements within an Ultrabithorax transcription maintenance unit consist of closely situated but separable sequences.
Mol. Cell. Biol.
19:5189-5202[Abstract/Free Full Text].
|
| 38.
|
Zhou, J.,
S. Barolo,
P. Szymanski, and M. Levine.
1996.
The Fab-7 element of the bithorax complex attenuates enhancer-promoter interactions in the Drosophila embryo.
Genes Dev.
10:3195-3201[Abstract/Free Full Text].
|
Molecular and Cellular Biology, May 2000, p. 3187-3197, Vol. 20, No. 9
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Fujioka, M., Yusibova, G. L., Zhou, J., Jaynes, J. B.
(2008). The DNA-binding Polycomb-group protein Pleiohomeotic maintains both active and repressed transcriptional states through a single site. Development
135: 4131-4139
[Abstract]
[Full Text]
-
Petruk, S., Smith, S. T., Sedkov, Y., Mazo, A.
(2008). Association of trxG and PcG proteins with the bxd maintenance element depends on transcriptional activity. Development
135: 2383-2390
[Abstract]
[Full Text]
-
Lee, C., Li, X., Hechmer, A., Eisen, M., Biggin, M. D., Venters, B. J., Jiang, C., Li, J., Pugh, B. F., Gilmour, D. S.
(2008). NELF and GAGA Factor Are Linked to Promoter-Proximal Pausing at Many Genes in Drosophila. Mol. Cell. Biol.
28: 3290-3300
[Abstract]
[Full Text]
-
DeVido, S. K., Kwon, D., Brown, J. L., Kassis, J. A.
(2008). The role of Polycomb-group response elements in regulation of engrailed transcription in Drosophila. Development
135: 669-676
[Abstract]
[Full Text]
-
Sipos, L., Kozma, G., Molnar, E., Bender, W.
(2007). In situ dissection of a Polycomb response element in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA
104: 12416-12421
[Abstract]
[Full Text]
-
Kahn, T. G., Schwartz, Y. B., Dellino, G. I., Pirrotta, V.
(2006). Polycomb Complexes and the Propagation of the Methylation Mark at the Drosophila Ubx Gene. J. Biol. Chem.
281: 29064-29075
[Abstract]
[Full Text]
-
Mihaly, J., Barges, S., Sipos, L., Maeda, R., Cleard, F., Hogga, I., Bender, W., Gyurkovics, H., Karch, F.
(2006). Dissecting the regulatory landscape of the Abd-B gene of the bithorax complex. Development
133: 2983-2993
[Abstract]
[Full Text]
-
Wang, J., Lee, C.-H. J., Lin, S., Lee, T.
(2006). Steroid hormone-dependent transformation of polyhomeotic mutant neurons in the Drosophila brain. Development
133: 1231-1240
[Abstract]
[Full Text]
-
Blastyak, A., Mishra, R. K., Karch, F., Gyurkovics, H.
(2006). Efficient and Specific Targeting of Polycomb Group Proteins Requires Cooperative Interaction between Grainyhead and Pleiohomeotic. Mol. Cell. Biol.
26: 1434-1444
[Abstract]
[Full Text]
-
Martinez, A.-M., Colomb, S., Dejardin, J., Bantignies, F., Cavalli, G.
(2006). Polycomb group-dependent Cyclin A repression in Drosophila.. Genes Dev.
20: 501-513
[Abstract]
[Full Text]
-
Brown, J. L., Grau, D. J., DeVido, S. K., Kassis, J. A.
(2005). An Sp1/KLF binding site is important for the activity of a Polycomb group response element from the Drosophila engrailed gene. Nucleic Acids Res
33: 5181-5189
[Abstract]
[Full Text]
-
Canudas, S., Perez, S., Fanti, L., Pimpinelli, S., Singh, N., Hanes, S. D., Azorin, F., Espinas, M. L.
(2005). dSAP18 and dHDAC1 contribute to the functional regulation of the Drosophila Fab-7 element. Nucleic Acids Res
33: 4857-4864
[Abstract]
[Full Text]
-
Lee, D. Y., Teyssier, C., Strahl, B. D., Stallcup, M. R.
(2005). Role of Protein Methylation in Regulation of Transcription. Endocr. Rev.
26: 147-170
[Abstract]
[Full Text]
-
Schwartz, Y. B., Kahn, T. G., Pirrotta, V.
(2005). Characteristic Low Density and Shear Sensitivity of Cross-Linked Chromatin Containing Polycomb Complexes. Mol. Cell. Biol.
25: 432-439
[Abstract]
[Full Text]
-
Schweinsberg, S., Hagstrom, K., Gohl, D., Schedl, P., Kumar, R. P., Mishra, R., Karch, F.
(2004). The Enhancer-Blocking Activity of the Fab-7 Boundary From the Drosophila Bithorax Complex Requires GAGA-Factor-Binding Sites. Genetics
168: 1371-1384
[Abstract]
[Full Text]
-
Tchurikov, N. A., Kretova, O. V., Chernov, B. K., Golova, Y. B., Zhimulev, I. F., Zykov, I. A.
(2004). SuUR Protein Binds to the Boundary Regions Separating Forum Domains in Drosophila melanogaster. J. Biol. Chem.
279: 11705-11710
[Abstract]
[Full Text]
-
SCHWARTZ, Y.B., KAHN, T.G., DELLINO, G.I., PIRROTTA, V.
(2004). Polycomb Silencing Mechanisms in Drosophila. Cold Spring Harb Symp Quant Biol
69: 301-308
[Abstract]
-
ZHANG, Y., CAO, R., WANG, L., JONES, R.S.
(2004). Mechanism of Polycomb Group Gene Silencing. Cold Spring Harb Symp Quant Biol
69: 309-318
[Abstract]
-
Mulholland, N. M., King, I. F.G., Kingston, R. E.
(2003). Regulation of Polycomb group complexes by the sequence-specific DNA binding proteins Zeste and GAGA. Genes Dev.
17: 2741-2746
[Abstract]
[Full Text]
-
Mahmoudi, T., Zuijderduijn, L. M. P., Mohd-Sarip, A., Verrijzer, C. P.
(2003). GAGA facilitates binding of Pleiohomeotic to a chromatinized Polycomb response element. Nucleic Acids Res
31: 4147-4156
[Abstract]
[Full Text]
-
Salvaing, J., Lopez, A., Boivin, A., Deutsch, J. S., Peronnet, F.
(2003). The Drosophila Corto protein interacts with Polycomb-group proteins and the GAGA factor. Nucleic Acids Res
31: 2873-2882
[Abstract]
[Full Text]
-
Kelley, R. L., Kuroda, M. I.
(2003). The Drosophila roX1 RNA Gene Can Overcome Silent Chromatin by Recruiting the Male-Specific Lethal Dosage Compensation Complex. Genetics
164: 565-574
[Abstract]
[Full Text]
-
Poux, S., Horard, B., Sigrist, C. J. A., Pirrotta, V.
(2003). The Drosophila Trithorax protein is a coactivator required to prevent re-establishment of Polycomb silencing. Development
129: 2483-2493
[Abstract]
[Full Text]
-
Hur, M.-W., Laney, J. D., Jeon, S.-H., Ali, J., Biggin, M. D.
(2003). Zeste maintains repression of Ubx transgenes: support for a new model of Polycomb repression. Development
129: 1339-1343
[Abstract]
[Full Text]
-
Brown, J. L., Fritsch, C., Mueller, J., Kassis, J. A.
(2003). The Drosophila pho-like gene encodes a YY1-related DNA binding protein that is redundant with pleiohomeotic in homeotic gene silencing. Development
130: 285-294
[Abstract]
[Full Text]
-
Faucheux, M., Roignant, J.-Y., Netter, S., Charollais, J., Antoniewski, C., Theodore, L.
(2003). batman Interacts with Polycomb and trithorax Group Genes and Encodes a BTB/POZ Protein That Is Included in a Complex Containing GAGA Factor. Mol. Cell. Biol.
23: 1181-1195
[Abstract]
[Full Text]
-
Drewell, R. A., Bae, E., Burr, J., Lewis, E. B.
(2002). Transcription defines the embryonic domains of cis-regulatory activity at the Drosophila bithorax complex. Proc. Natl. Acad. Sci. USA
99: 16853-16858
[Abstract]
[Full Text]
-
Mohd-Sarip, A., Venturini, F., Chalkley, G. E., Verrijzer, C. P.
(2002). Pleiohomeotic Can Link Polycomb to DNA and Mediate Transcriptional Repression. Mol. Cell. Biol.
22: 7473-7483
[Abstract]
[Full Text]
-
Fourel, G., Miyake, T., Defossez, P.-A., Li, R., Gilson, E.
(2002). General Regulatory Factors (GRFs) as Genome Partitioners. J. Biol. Chem.
277: 41736-41743
[Abstract]
[Full Text]
-
Kosoy, A., Pagans, S., Espinas, M. L., Azorin, F., Bernues, J.
(2002). GAGA Factor Down-regulates Its Own Promoter. J. Biol. Chem.
277: 42280-42288
[Abstract]
[Full Text]
-
Maurange, C., Paro, R.
(2002). A cellular memory module conveys epigenetic inheritance of hedgehog expression during Drosophila wing imaginal disc development. Genes Dev.
16: 2672-2683
[Abstract]
[Full Text]
-
Schwendemann, A., Lehmann, M.
(2002). Pipsqueak and GAGA factor act in concert as partners at homeotic and many other loci. Proc. Natl. Acad. Sci. USA
99: 12883-12888
[Abstract]
[Full Text]
-
Sheldon, C. C., Conn, A. B., Dennis, E. S., Peacock, W. J.
(2002). Different Regulatory Regions Are Required for the Vernalization-Induced Repression of FLOWERING LOCUS C and for the Epigenetic Maintenance of Repression. Plant Cell
14: 2527-2537
[Abstract]
[Full Text]
-
Leibovitch, B. A., Lu, Q., Benjamin, L. R., Liu, Y., Gilmour, D. S., Elgin, S. C. R.
(2002). GAGA Factor and the TFIID Complex Collaborate in Generating an Open Chromatin Structure at the Drosophila melanogaster hsp26 Promoter. Mol. Cell. Biol.
22: 6148-6157
[Abstract]
[Full Text]
-
Huang, D.-H., Chang, Y.-L., Yang, C.-C., Pan, I-C., King, B.
(2002). pipsqueak Encodes a Factor Essential for Sequence-Specific Targeting of a Polycomb Group Protein Complex. Mol. Cell. Biol.
22: 6261-6271
[Abstract]
[Full Text]
-
Sewalt, R. G. A. B., Lachner, M., Vargas, M., Hamer, K. M., den Blaauwen, J. L., Hendrix, T., Melcher, M., Schweizer, D., Jenuwein, T., Otte, A. P.
(2002). Selective Interactions between Vertebrate Polycomb Homologs and the SUV39H1 Histone Lysine Methyltransferase Suggest that Histone H3-K9 Methylation Contributes to Chromosomal Targeting of Polycomb Group Proteins. Mol. Cell. Biol.
22: 5539-5553
[Abstract]
[Full Text]
-
Americo, J., Whiteley, M., Brown, J. L., Fujioka, M., Jaynes, J. B., Kassis, J. A.
(2002). A Complex Array of DNA-Binding Proteins Required for Pairing-Sensitive Silencing by a Polycomb Group Response Element From the Drosophila engrailed Gene. Genetics
160: 1561-1571
[Abstract]
[Full Text]
-
Bender, W., Fitzgerald, D. P.
(2002). Transcription activates repressed domains in the Drosophila bithorax complex. Development
129: 4923-4930
[Abstract]
[Full Text]
-
Greenberg, A. J., Schedl, P.
(2001). GAGA Factor Isoforms Have Distinct but Overlapping Functions In Vivo. Mol. Cell. Biol.
21: 8565-8574
[Abstract]
[Full Text]
-
Xu, L., Paulsen, J., Yoo, Y., Goodwin, E. B., Strome, S.
(2001). Caenorhabditis elegans MES-3 Is a Target of GLD-1 and Functions Epigenetically in Germline Development. Genetics
159: 1007-1017
[Abstract]
[Full Text]
-
Fitzgerald, D. P., Bender, W.
(2001). Polycomb Group Repression Reduces DNA Accessibility. Mol. Cell. Biol.
21: 6585-6597
[Abstract]
[Full Text]
-
Poux, S., Melfi, R., Pirrotta, V.
(2001). Establishment of Polycomb silencing requires a transient interaction between PC and ESC. Genes Dev.
15: 2509-2514
[Abstract]
[Full Text]
-
Hodgson, J. W., Argiropoulos, B., Brock, H. W.
(2001). Site-Specific Recognition of a 70-Base-Pair Element Containing d(GA)n Repeats Mediates bithoraxoid Polycomb Group Response Element-Dependent Silencing. Mol. Cell. Biol.
21: 4528-4543
[Abstract]
[Full Text]
-
Busturia, A., Lloyd, A., Bejarano, F., Zavortink, M., Xin, H., Sakonju, S.
(2001). The MCP silencer of the Drosophila Abd-B gene requires both Pleiohomeotic and GAGA factor for the maintenance of repression. Development
128: 2163-2173
[Abstract]
[Full Text]
-
Roseman, R. R., Morgan, K., Mallin, D. R., Roberson, R., Parnell, T. J., Bornemann, D. J., Simon, J. A., Geyer, P. K.
(2001). Long-Range Repression by Multiple Polycomb Group (PcG) Proteins Targeted by Fusion to a Defined DNA-Binding Domain in Drosophila. Genetics
158: 291-307
[Abstract]
[Full Text]
-
Mishra, R. K., Mihaly, J., Barges, S., Spierer, A., Karch, F., Hagstrom, K., Schweinsberg, S. E., Schedl, P.
(2001). The iab-7 Polycomb Response Element Maps to a Nucleosome-Free Region of Chromatin and Requires Both GAGA and Pleiohomeotic for Silencing Activity. Mol. Cell. Biol.
21: 1311-1318
[Abstract]
[Full Text]
-
Poux, S, McCabe, D, Pirrotta, V
(2001). Recruitment of components of Polycomb Group chromatin complexes in Drosophila. Development
128: 75-85
[Abstract]