Previous Article | Next Article 
Molecular and Cellular Biology, May 2000, p. 3292-3307, Vol. 20, No. 9
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Regulation of the Pancreatic Islet-Specific Gene
BETA2 (neuroD) by Neurogenin 3
Hsiang-Po
Huang,
Min
Liu,
Heithem M.
El-Hodiri,
Khoi
Chu,
Milan
Jamrich, and
Ming-Jer
Tsai*
Department of Molecular and Cellular Biology,
Baylor College of Medicine, Houston, Texas 77030
Received 26 October 1999/Returned for modification 13 December
1999/Accepted 10 January 2000
 |
ABSTRACT |
The BETA2 (neuroD) gene is expressed in
endocrine cells during pancreas development and is essential for proper
islet morphogenesis. The objective of this study is to identify
potential upstream regulators of the BETA2 gene during
pancreas development. We demonstrated that the expression of neurogenin
3 (ngn3), an islet- and neuron-specific basic-helix-loop-helix
transcription factor, partially overlaps that of BETA2 during early
mouse development. More importantly, overexpression of ngn3 can induce
the ectopic expression of BETA2 in Xenopus embryos and
stimulate the endogenous RNA of BETA2 in endocrine cell lines.
Furthermore, overexpression of ngn3 could cause a dose-dependent
activation on the 1.0-kb BETA2 promoter in islet-derived
cell lines. Deletion and mutation analyses revealed that two proximal E
box sequences, E1 and E3, could bind to ngn3-E47 heterodimer and
mediate ngn3 activation. Based on these results, we hypothesize that
ngn3 is involved in activating the expression of BETA2 at an early
stage of islet cell differentiation through the E boxes in the
BETA2 promoter.
 |
INTRODUCTION |
The endocrine pancreas, which is
organized as the islets of Langerhans, contains at least four distinct
types of endocrine cells (
,
,
, and PP). The differentiation
and maturation of islet cells during development is a complex process
controlled by a unique network of gene regulation. Recently, it has
been demonstrated by gene targeting studies that several
tissue-specific transcription factors, such as BETA2 (neuroD) (24,
25), PDX-1 (1, 27), Islet-1 (2), Nkx2.2
(42), PAX-6 (41), and PAX-4 (40), are
involved in this process. These factors, alone or in concert, can
activate the expression of genes encoding hormones, such as glucagon
(9, 44), insulin (9, 25, 28), and somatostatin
(3, 31). BETA2 (neuroD), a basic helix-loop-helix (bHLH)
transcription factor, was isolated both as a transcriptional activator
of the insulin gene (25) and as a differentiation factor of
neurogenesis (17). BETA2 is selectively expressed in the
developing endocrine pancreas, the small intestine, and the nervous
system (17). It has been shown that BETA2 transactivates the
insulin (25) and glucagon genes (9) by binding to
the E box sequences localized in their promoters. Furthermore, the functional importance of BETA2 to pancreatic islet cell development has
been demonstrated by loss-of-function studies (24).
BETA2-deficient (BETA2
/
) mice die of severe diabetes
caused by a major reduction in the number of
cells and a lack of
proper islet formation. These results indicate that BETA2 plays an
important role in maintaining the differentiation of endocrine cells
and proper islet morphogenesis. Results obtained from BETA2-deficient
mice also imply that the upstream factors controlling BETA2 expression
are likely to be involved in the early events which determine endocrine
cell differentiation. So far, numbers of a novel family of genes, the
neurogenin genes (ngn) (19, 39), have been
reported to be good candidates for upstream regulators of the
BETA2 gene. During neuronal development, neurogenin family
members are expressed earlier than BETA2, and they are expressed in
either overlapping or adjacent domains (19). When
ectopically expressed in Xenopus embryos (19),
both mouse neurogenin 1 (ngn1) and Xenopus
neurogenin-related-1 are able to induce ectopic expression of
Xenopus neuroD, but not vice versa. More importantly, mice
lacking ngn1 (18) and ngn2 (12) develop distinct
defects in the cranial sensory ganglia and fail to express BETA2.
Therefore, it is likely that the BETA2 gene is the direct downstream target of some neurogenin family members in the
transcriptional cascade which controls neuronal development.
Interestingly, the expression of ngn3 (39) in the developing
pancreas also seems to precede and overlap with BETA2 expression, the
latter being detected exclusively in the endocrine pancreas
(24). Thus, we hypothesize that ngn3 plays a role in
activating the transcriptional expression of BETA2 and in determining
the cell fate of pancreatic endocrine cells. Very little is known about
the cis elements and trans activators regulating
the BETA2 promoter. In this study, we describe the cloning
of the 5' genomic sequence of the BETA2 gene and
determination of the transcription start site and exon-intron junctions. We found that the 1.7-kb promoter reporter has the highest
activity among a series of reporter constructs made from 5' deletions
of the 2.2-kb BETA2 promoter. We also demonstrate that the
2.2-kb promoter is capable of directing proper tissue-specific expression of the lacZ reporter gene in the pancreatic
islets and neuronal tissues. In addition, the first 1.0 kb of the
BETA2 promoter, which contains nine E box sequences, can
confer cell-type-specific activity in vitro. The notion that ngn3
participates in regulating BETA2 gene expression during
development is supported by our colocalization studies of ngn3 and
BETA2 in the developing pancreas, which indicate that ngn3 expression
partially overlaps that of BETA2. More importantly, we also provide
evidence that injection of ngn3 mRNA into Xenopus embryos
can cause ectopic expression of BETA2, and overexpression of ngn3 can
stimulate the endogenous RNA levels of BETA2 in endocrine cells lines.
Consistent with these data, transient transfection data indicate that
overexpression of ngn3 causes a dose-dependent activation of the
BETA2 promoter in islet-derived cell lines. While deletion
analysis suggests that the three E boxes (E1, E2, and E3) in the first
419-bp region could be important for ngn3-mediated activation, the
mutation analysis and gel shift results clearly indicate that the
ngn3-E47 heterodimer transactivates the 419-bp BETA2
promoter by binding to the two E boxes (E1 and E3) in this region
specifically. Collectively, our results suggest that ngn3 acts as an
upstream regulator of the BETA2 gene and could be involved in the initiation step that switches on the BETA2 gene at
early stage of islet cell differentiation.
 |
MATERIALS AND METHODS |
Isolation of the 5' end of the BETA2 cDNA.
A
gt11 cDNA library of
-TC cells (10) was constructed
previously (obtained from C. M. M. Stellrecht; M.-J. Tsai,
unpublished results). To clone the 5' end of the BETA2 cDNA
from this cDNA library, PCR was performed with an oligonucleotide (B2S
[5'-CCTGAGAACTGAGACACT-3']) that is complementary to the
encoding region of the BETA2 gene, combined with either of
the two oligonucleotides (
gt5 [5'-CCTGAGAACTGAGACACT-3'] and
gt3 [5'-GACACCAGACCAACTGGTAATG-3'] that are
specific for both ends of sequences flanking the EcoRI
cloning site. PCRs, using either B2S and
gt5 or B2S and
gt3, were
carried out at 95°C for 2 min, followed by 35 cycles of 95°C for 1 min, 55°C for 1 min, and 72°C for 1 min, followed by 5 min at
72°C. The amplified DNA was subjected to electrophoresis, gel
purified, and subcloned into pCR2.1 vector (Invitrogen) using a TA
cloning kit (Invitrogen).
RNase protection assay.
To generate the DNA template used in
the RNase protection assay, a SacII-HindIII
BETA2 genomic fragment, which spans 305 bp of the intron and
~300 bp upstream of the first exon, was subcloned into pBluescript II
KS(+) [pBSII-KS(+); (Stratagene]. The RNA probe was prepared by
transcription of SacII-linearized DNA template using T3
polymerase. Followed by electrophoresis and gel purification, ~105 cpm of probe was hybridized to 5 or 10 µg of total
RNA from
-TC cells, yeast, and mouse liver tissues. The
hybridization and RNase digestion procedures were performed with an
RNase protection assay kit as instructed by the manufacturer (Ambion).
Samples without RNase digestion were included as the control. To
generate the molecular marker for RNA, 0.5 µg of the Century marker
template (Ambion) was in vitro transcribed and labeled with
[32P]UTP.
RNA isolation and primer extension.
Total cellular RNA was
isolated from cultured
-TC cells and frozen 1-month-old mouse liver
using TRIZOL (Gibco BRL) according to the manufacturer's instructions.
The yeast RNA was purchased from the manufacturer (Gibco BRL). For the
probe used in the assay, a 29-mer oligonucleotide complementary to the
sequence located 15 bp upstream of the 3' end of the first exon of the
BETA2 gene was end labeled with T4 polynucleotide kinase.
Primer extension was performed by adding 5 × 105 cpm
of labeled probe to 20 or 100 µg of total cellular RNA in the
hybridization buffer (40 mM PIPES [pH 6.4], 1 mM EDTA, 0.4 M NaCl; 50 µl in volume). Hybridization at 42°C overnight was followed by
precipitation with 3 volumes of 1 M ammonium acetate and 4 volumes of
isopropanol and a 70% ethanol wash. The precipitated mixture was
dissolved in distilled water and subjected to extension using
Superscript reverse transcriptase (RT; Gibco BRL). The extension was
performed at 42°C for 2.5 h in 50 µl of buffer containing 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 1 mM
deoxynucleoside triphosphate, 10 mM dithiothreitol, and 10 U of RNasin
(Promega). After isopropanol precipitation, the products were subjected
to electrophoresis on a 10% polyacrylamide gel. A dideoxy sequencing reaction was performed with the BETA2 genomic DNA and the
same primer, and the reaction was loaded in adjacent lanes to determine the transcription start site.
DNA constructs.
A 14-kb NotI fragment containing
the entire BETA2 gene isolated from a 129/Sv mouse genomic
library was subcloned into pBSII-KS(+) and mapped as described
previously (24). From this construct, a 4.5-kb 5' flanking
sequence-containing BssHII fragment was subcloned into
pBSII-KS(+) and named pBSB2 (4.5 kb). The 2.2-kb
SacI-EcoRI fragment of pBSB2 (4.5 kb) was then
subcloned into a luciferase reporter vector pGL3-basic (Promega). A
series of 5' deletions were made in this plasmid, using the available
restriction enzyme XbaI (
1.7 kb), NheI (
1.0
kb), SacII (
0.3 kb), and MluI (
0.1 kb). The
resulting promoter reporters are B2 (1.7 kb), B2 (1.0 kb), B2 (0.3 kb),
and B2 (0.1 kb). To generate the successive deletions of eight E boxes
(E1 to E8) in the 1.0-kb promoter, PCRs were performed with nine
lower-strand primers, which correspond the flanking sequences located
3' from each E box, and an upper-strand primer which spans from
9 to
+11. The upper-strand primer sequence is
5'-CCCAAGCTTGAATTCCTCGTGTCCCGGTG-3'. The nine lower-strand primers (and sequences) are E1-8 (
938 to
956), E1-7 (
838 to
858), E1-6 (
820 to
841), E1-5 (
763 to
782), E1-4 (
707 to
726), E1-3 (
400 to
419), E1-2 (
322 to
342), E1 (
251 to
270), and E (
) (
212 to
231). The resulting nine deletion
constructs are B2E1-8 (
956 to +11), B2E1-7 (
860 to +11), B2E1-6
(
842 to +11), B2E1-5 (
782 to +11), B2E1-4 (
726 to +11), B2E1-3
(
419 to +11; =B2 (419 bp), B2E1-2 (
341 to +11), B2E1 (
296 to
+11), and B2E (
) (
231 to +11). In addition, in the text or figure legends B2 (1.0 kb) is equivalent to B2E1-9 and B2 (231 bp) is equivalent to B2E(
).
To generate successive mutations in the three most proximal E boxes, a
155-bp promoter fragment which contains the three E boxes (E1 to E3)
was amplified by PCR, digested, and subcloned into a pGL3-TATA vector.
The primers used were 5'-GGAGTCTCTAACTGGCGA-3' (lower
strand) and 5'-TGCTCCTTCCTCCCCGGCAT-3' (upper strand). The
three E boxes were then mutated using a Quick Change site-directed mutagenesis kit (Stratagene) with primers specific for each E box that
change CANNTG to TANNCT. The resulting mE1, mE2, and mE3 constructs
were then used as templates to generate m(E1+E2), m(E1+E3), m(E2+E3),
and m(E1+E2+E3) by using the same primers and mutagenesis method. The
mutated E box oligonucleotide sequences are
5'-CTGGACCGGGAAGACTATACTGCGCATGCCGGGGAG-3'
(mutE1);
5'-AGGCAGGTTACGCTGTTCCCGGCTCTTGGCTGGA-3' (mutE2);
5'-GTCTCTAACTGGCGATAGACTGGCCACTTTCTTCTG-3'
(mutE3). The mutated nucleotides in the E boxes are underlined.
To generate the E47 expression vector, the
HindIII-BstEII fragment of pSVE2-5 (14) was subcloned into
HindIII-EcoRV sites of pCR3.1 (Invitrogen). To generate the expression plasmid full-length E47 (FL-E47), the full-length cDNA of E47 (37) was amplified using PCR and
subcloned into EcoRI and XbaI sites of pCR3.1.
The expression plasmid for ngn3 was constructed by subcloning into
pCR3.1 the encoding region of ngn3, which was amplified from pSK-ngn3
(39) by PCR using the primers
5'-ACCCAAGCTTGCCACCATGGCGCCTCATCCCTTG-3' (lower strand) and
5'-CGGGATCCTCACAAGAAGTCTGAG AACAC-3' (upper strand). To add a FLAG peptide sequence (33) at the C terminus of ngn3, the encoding region of ngn3 was amplified by PCR with the ngn3-specific lower-strand primer mentioned above and an upper-strand primer tagged
with the 18 nucleotides encoding the FLAG peptide. The sequence of the
upper-strand primer is
5'-CGGGATCC TCAC T TG TCATCG TCATCC T TG TAG TCCAAGAAG TCTGAGAACACCAG-3'.
The PCR product was digested with
HindIII-BamHI and subcloned into the
corresponding sites of pCR3.1. The TATA-luciferase reporters driven by
three copies of each E box [(E1)×3-TATA, (E2)×3-TATA, and
(E3)×3-TATA] were constructed by inserting three copies of each E box
and the surrounding sequences into pGL3-TATA. The E boxes and
surrounding sequences used were as follows: E1 (
230 to
247), E2
(
266 to
283), and E3 (
337 to
354). All of the constructs
mentioned above were verified by sequencing analysis.
Cell culture and transfections.
The HIT-T15 M2.2.2
(36),
-TC (10), NIH 3T3, and HeLa cell lines
were grown in Dulbecco modified Eagle's medium supplemented with 10%
fetal bovine serum, 100 U of penicillin/ml, and 100 µg of
streptomycin/ml. The HIT and
-TC cells were seeded at 5 × 105 cells per well in Falcon six-well dishes. The HeLa
cells were seeded at 105 cells per well. The NIH 3T3 cells
were seeded at 2 × 105 cells per well. Transient
transfections were performed using FuGENE6 (Boehringer Mannheim)
according to the manufacturer's instructions. The amount of each
reporter plasmid used in transfection was 300 ng per well. For all
other transfections, the amounts of DNA used are noted in the figure
legends. Cells were harvested 24 to 36 h after transfections. Cell
extracts were assayed for luciferase activity using the Promega
luciferase system, and values (relative luciferase units [RLU]) were
corrected for protein concentration or Rous sarcoma virus
(RSV)-luciferase activity. Data are represented as means of triplicate
values obtained from representative experiments. All transfections were
repeated at least three times.
BETA2-lacZ transgenic constructs and generation of
transgenic mice.
The BETA2 promoter lacZ
transgene construct (BPIL-4) was generated by inserting the
VspI-XhoI fragment of BP-SBC-1 into the corresponding sites upstream of the lacZ gene in plasmid
lacZ-pA-SBC-2. BP-SBC-1 was constructed by inserting a
3.8-kb VspI-EcoRI BETA2 5' flanking sequence,
which includes the first exon and the intron in addition to a 2.2-kb
promoter fragment, into the corresponding sites of SBC-1 vector
(8). lacZ-pA-SBC-2 contains a 3-kb
XbaI-PstI fragment of the lacZ gene
(pPD46.21) (24) with a nuclear localization signal (obtained
from Eric Olson, University of Texas Southwestern Medical Center,
Dallas), fused upstream of a 0.7-kb human growth hormone poly(A)
sequence. All the constructs were confirmed by restriction enzyme
digestion and partial sequence analysis. The resultant transgene
construct was then released from plasmid BPIL-4 by VspI
digestion and purified from a low-melting-point gel after electrophoresis. The transgene DNA was microinjected into B6C3FI stud
male (Harlan) fertilized one-cell ICR embryos. After microinjection, the fertilized embryos were transferred into pseudo-pregnant ICR recipient mothers (Harlan) to carry the embryos to term. Different batches of DNA were used to generate three lines transgenic mice. Genotypic analysis was performed by Southern analysis of the genomic DNA isolated from mouse tails using a portion of the lacZ
gene as a probe.
X-Gal histochemistry and in situ hybridization.
For
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal)
histochemistry of BETA2-lacZ transgenic mice, the embryonic
day 11.5 (E11.5) transgenic embryos or the pancreata from 7-month-old adult transgenic mice were removed, fixed in 2% paraformaldehyde at
room temperature for 2 h, and subjected to whole mount X-Gal histochemistry as described elsewhere (6). After X-Gal
staining, the tissues were dehydrated, embedded in paraffin, and
sectioned at 10 µm. The sections were then counterstained with
nuclear fast red and subjected to microscopic analysis. For combined
X-Gal histochemistry and in situ hybridization, embryos of different developmental stages were obtained from the wild-type C57BL/6 female
mice mated to male BETA2+/
mice which were
generated previously (24). The embryos were then fixed in
4% paraformaldehyde at 4°C for 2 h and stained with X-Gal
solution at 25°C overnight. The BETA2+/
embryos, which were genotyped by PCR as described previously (24), were then postfixed in 4% paraformaldehyde at 4°C
overnight, embedded in paraffin, and sectioned at 6 µm. The sections
were then subjected to in situ hybridization with a
35S-labeled antisense RNA probe which is complementary to
the 3' untranslated region (UTR) and the encoding region of
ngn3. The procedures for probe preparation and in situ
hybridization were described elsewhere (45). After in situ
hybridization, the sections were processed for autoradiography using
NTB-2 Kodak emulsion and exposed to 4 to 7 days at 4°C. Analyses were
carried out using both light- and dark-field optics on a Zeiss microscope.
RT-PCR.
Pancreas total RNA, extracted with TRIZOL (Gibco
BRL), was from mouse embryos of different developmental stages (E13.5
to E17.5), postnatal day 2 (P2) mice, and 2-month-old adult mice. First-strand cDNA synthesis was performed with approximately 200 ng of
pancreas RNA using the Superscript preamplification system (Gibco BRL).
One-tenth of the first-strand cDNA was used for PCR amplification. For
BETA2 and the internal control L19 (29), the following
parameters were used: 94°C for 1 min, followed by 25 cycles of 94°C
for 1 min, 55°C for 1 min, and 72°C for 1 min. For ngn3, 30 cycles
were used with the parameters mentioned above. Following PCR, one-fifth
of the reaction products were loaded on a 2% gel and subjected to
electrophoresis. The primers used in PCR were
5'-GACAGAGTCTTGATGATCTC-3' (L19, upper strand),
5'-CTGAAGGTCAAAGGGAATGTG-3' (L19, lower strand),
5'-AAGCACAGTGGGTTCGTTTC-3' (BETA2, upper strand),
5'-CATCAATGGCAACTTCTCTTTC-3' (BETA2, lower strand),
5'-CTTCACAAGAAGTCTGAGAACACCAG-3' (ngn3, upper strand), and
5'-CTGCGCATAGCGGACCACAGCTTC-3' (ngn3, lower strand).
Electrophoretic mobility shift assay.
The E1 (
224 to
254), E2 (
260 to
289), and E3 (
331 to
360) double-stranded
oligonucleotides were end labeled with [
-32P]dCTP,
using the Klenow fragment, to a specific activity of ~108
cpm/µg. E47 and ngn3 proteins used in gel shift assay were
synthesized from plasmids pCR3.1-E47, pCR3.1-ngn3, and
pCR3.1-ngn3-FLAG, using the Promega TNT coupled
transcription-translation kit according to the manufacturer's
instructions. Parallel reactions with [35S]methionine or
unlabeled methionine were performed. Labeled proteins were analyzed by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on
a 10% gel to ensure proper synthesis. Binding reaction mixtures
included 10 mM Tris-HCl (pH 7.5), 50 mM NaCl, 1 mM EDTA, 1 mM
dithiothreitol, 5% glycerol, 200 ng of poly(dI-dC), ~3 × 104 cpm of each probe, and various amounts of in
vitro-translated proteins. Protein-DNA complexes were incubated at room
temperature for 20 min and then resolved by SDS-PAGE on a 5%
polyacrylamide gel. The mutated E box oligonucleotides used for
competition studies were
5'-GGACCGGGAAGACTATACTGCGCATGCCGGG-3'
(mutE1, upper strand), 5'-GGACCCGGCATGCGCAGTATAGTCTTCCCGG-3'
(mutE1, lower strand),
5'-GTCTAACTGGCGATAGACTGGCCACTTTCTT-3' (mutE3, upper strand), and
5'-GGGAAGAAAGTGGCCAGTCTATCGCCAGTTA-3' (mutE3, lower strand). The mutated nucleotides are underlined. For supershift assay, 1 µl of 1:10-diluted anti-E47 antibody (Santa Cruz Biotechnology) or 1 µl of 1:10 diluted anti-FLAG peptide antibody (Biological Research and Imaging Products) was added to the
mixture after the DNA probes were preincubated with proteins for 5 min.
The whole mixture was then incubated at room temperature for another 20 min. To obtain cellular extracts from COS-1 cells, COS-1 cells were
cotransfected with pCR3.1-E47 and pCR3.1-ngn3-FLAG by the DEAE-dextran
suspension method (7), and cellular extracts were collected
as described previously. For gel shift assay, 10 µg of cellular
extract was used for each reaction. The reaction buffer and conditions
used were similar to those described above except that the reaction was
carried out at 4°C and 1.2 µg of poly(dI-dC) was added in the
reaction buffer.
Xenopus embryo injection and in situ
hybridization.
Capped ngn3 RNA was prepared from PCR3.1-ngn3
linearized with AflIII, using a T7 mMessage mMachine kit
(Ambion) as recommended by the manufacturer. Xenopus
embryos, prepared as described previously (11), were
injected with ngnr3 RNA in the animal region of the two prospective
left blastomeres of the four-celled embryos. Embryos were cultured in
1× MBS (30) containing 3% Ficoll until 3 to 4 h after
fertilization and then transferred to 0.1× MBS containing 3% Ficoll.
After overnight incubation, embryos were transferred to 0.1× MBS for
subsequent culture. Embryos were collected at approximately stage 26 (26) and fixed for 1 to 2 h in MEMFA (13)
prepared using paraformaldehyde and then dehydrated in methanol. In
these experiments, green fluorescent protein (GFP) RNA was coinjected
as a lineage tracer or injected alone as a control for nonspecific
effects due to the microinjection procedure. Before fixation for in
situ hybridization, embryos were scored for GFP expression by
fluorescence microscopy (data not shown). Embryos not expressing GFP
were discarded. In another experiment, embryos were subjected to
whole-mount immunostaining using an antibody which could detect GFP
expression following in situ hybridization to verify that ectopic BETA2
expression was on the injected side of the embryos (data not shown).
In situ hybridization was performed with a digoxygenin-labeled
Xenopus BETA2 probe (see below) as described previously
(
13)
and modified by Turner and Weintraub (
43)
except that the color
reaction substrate solution contained 10-fold
less nitroblue tetrazolium,
as suggested by Ma et al. (
19).
To prepare the probe, a fragment
of the
Xenopus BETA2 cDNA
(from nucleotides 501 to 1251, [
17])
was isolated by
PCR from stage 17 cDNA, using the primers
CG
GAATTCCAGACCTGGTGTCCTTTGTAC
and
GC
TCTAGAAGTGTCGTATTGGAAGGAGGTG. The resulting
750-bp fragment
was digested with
EcoRI and
XbaI
(underlined in the primer sequences)
and ligated with similarly
digested pBSII KS. Digoxygenin-labeled
riboprobe was generated from
this plasmid linearized with
EcoRI
using T7 RNA polymerase
(Boehringer Mannheim Biochemicals) as
recommended by the
manufacturer.
Generation of stably transfected cell line and Northern
blotting.
The STC-1 (34) and
-TC cell lines were
grown in Dulbecco modified Eagle medium supplemented with 10% fetal
bovine serum and 1% penicillin-streptomycin (Life Sciences-Gibco BRL).
Ten-centimeter-diameter dishes of STC-1 and
-TC cells were
transfected by the FuGENE6 reagent (Boehringer Mannheim Biochemicals)
with either pCR3.1-ngn3 (containing the neomycin resistance gene) or
the control pCR3.1 vector without ngn3 insert. The cells were then
grown in medium for 2 days. Cells were then split into five
10-cm-diameter plates with medium containing 500 µg of Geneticin
(Life Sciences-Gibco BRL) per ml, which was determined earlier to be
the effective killing dose for both the STC-1 and
-TC cells. Cells
were grown in selection medium for 2 weeks, and colonies were pooled by
trypsin-EDTA digestion and expanded. For Northern blotting, total RNA
was prepared using RNeasy kit (Qiagen) as recommended by the
manufacturer. STC-1 total RNA (10 µg) or
-TC total RNA (5 µg)
was denatured, and subjected to electrophoresis in 2.2 M
formaldehyde-1% agarose gel in morpholinepropanesulfonic acid (MOPS)
buffer at 120 V for 6 h, and transferred to nylon membranes
(Hybond-NX; Amersham) overnight. RNA was cross-linked to the membranes
by UV irradiation. A 1.1-kb BssHII-SpeI fragment
of mouse BETA2 cDNA, a 700-bp
HindIII-BamHI fragment of pCR3.1-ngn3 that
contained the full-length mouse ngn3, and an RT-PCR-generated clone of
mouse L19 mRNA were used as the templates to synthesize
[
-32P]dCTP-labeled probes by random priming.
Prehybridization and hybridization were carried out in ExpressHyb
hybridization solution (Clontech) at 60°C overnight. Unhybridized
probes were removed by washing twice in 2× SSC (1× SSC is 0.15 M NaCl
plus 0.015 M sodium citrate)-0.5% SDS at 50°C for 20 min and twice
in 0.2× SSC-0.1% SDS at 55°C for 15 min. Filters were then
processed for autoradiography. Quantitative analysis of the
hybridization signals was performed by scanning the phosphor screen
(Molecular Dynamics) with a densitometer (Molecular Dynamics).
 |
RESULTS |
Analysis of the 5' flanking sequences of the mouse
BETA2 gene.
We isolated a 14-kb genomic fragment from
a mouse genomic library to characterize the promoter of the mouse
BETA2 gene. Preliminary sequence analyses indicated that the
fragment contained the BETA2 gene and a ~3.8-kb region
upstream of the first ATG. Recently, two members of
BETA2/neuroD family, the mouse NEX-1
(4) and neuroD2 (20) genes, were
cloned and analyzed. The results suggest that members of the
BETA2/neuroD gene family are composed of two exons; the
first exon contains the 5' UTR, and the second includes the coding
region and 3' UTR. Previously, an incomplete mouse BETA2
cDNA sequence was reported (17), which contains the coding region and a very short 5' UTR. To identify the full-length cDNA of
BETA2, we used PCR to amplify the 5' UTR of BETA2
from a cDNA library of the
-TC cell line that expresses endogenous
mouse BETA2 (25). The longest 5' UTR sequence that we cloned
was 79 bp in size. We then compared the partial 5' UTR sequence to the known genomic sequence and determined the size of the intron, which is
1.5 kb, and the exon-intron junctions (Fig.
1A). The intron is flanked by consensus
sequences for splice donors and acceptors, and the branch point is
located 60 nucleotides upstream of the coding sequences (Fig. 1A). An
RNase protection assay was performed to determine the exact
transcription start site, using a 32P-labeled antisense
cRNA probe that spans 305 nucleotides of the intron and 323 nucleotides
of the 5' upstream region (Fig. 1B). A major protected band of
approximately 85 bp, which is equivalent to the size of the first exon,
was observed when the probe was hybridized to
-TC cell total RNA
(Fig. 1B). In contrast, no protected band was observed when the same
amount of mouse liver and yeast RNAs was used. In addition to the major
protected band, we observed several minor and longer protected bands,
indicating the existence of additional minor transcription start sites
in this promoter.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Partial 5' flanking nucleotide sequence of the
BETA2 gene. The sequence includes the promoter sequence from
bp 2201 to 2052, the first exon and surrounding sequences (bp 451
to +150), and both 5'- and 3'-end sequences of the intron. The E box
consensus sequences are underlined and numbered (from the transcription
start site). The three most proximal E boxes (E1, E2, and E3) and
surrounding sequences are included because of their importance in
BETA2 promoter activity. The TATA box is double underlined.
The first exon sequence, starting from the transcription start site
(marked by an arrow) and terminating at the donor site for splicing, is
boxed and labeled. The putative branch point, which is an adenine (A),
is circled. The pyrimidine-rich region is labeled and underlined by a
dash line. The first 14 nucleotides (nt) of the second (encoding) exon
are also boxed to indicate the splicing acceptor site. Asterisks mark
the first ATG. (B) Determination of transcription start site by RNase
protection assay. The upper panel shows the result of RNase protection
assay performed with total RNA from -TC cells (10 µg in lane 2; 5 µg in lane 3), yeast (10 µg, lane 1), and mouse liver (10 µg,
lane 4). The middle panel is the RNA electrophoresis gel stained with
ethidium bromide. Clear 18S and 28S bands suggest that most RNAs from
-TC cells and liver were not degraded. The lower panel shows a
schematic representation of the BETA2 gene and the design of
the antisense probe used in the assay. The size of the protected band
equals that of the first exon. A major protected band, which is ~85
bp in size, is observed in the upper panel and labeled. (C)
Determination of transcription start site by primer extension assay
performed with total cellular RNA from yeast (lane 1, 100 µg) and
-TC cells (lane 3, 100 µg; lane 4, 20 µg). A 29-bp primer
complementary to the 3' end of the first exon was used in the assay.
Lane 2 does not contain any reaction. A dideoxy sequencing reaction
using the genomic BETA2 DNA and the same primer was
performed and loaded in parallel on the left side of the gel for better
estimation of the location of the transcription start site. An asterisk
marks the mapped transcription start site.
|
|
To further confirm the result, we performed a primer extension assay
using an oligonucleotide primer selected from the first
exon sequence.
The result indicated that the putative transcription
start site is
located at 97 bp upstream of the coding region (Fig.
1C). The RNase
protection assay result is consistent with the
primer extension result,
considering that the second exon contains
11 untranslated nucleotides
before the first ATG (Fig.
1A). In
addition, there is a typical TATA
box located 25 bp upstream of
the first exon (Fig.
1A). Therefore, we
conclude that the major
transcription start site of the
BETA2 gene is positioned at 97
bp upstream of the
translation start site, and the size of the
first exon is 86
bp.
The promoter activity of BETA2 in transient
transfection and in transgenic mice.
To determine if the 5'
flanking sequence that we isolated is sufficient for islet-specific
expression of BETA2, transgenic mice were generated using as a reporter
gene lacZ, fused downstream of a 3.8-kb 5' sequence of the
BETA2 gene, including the 2.2-kb BETA2 promoter,
the untranslated exon, and the intron. In all three lines of transgenic
mice examined by X-Gal histochemistry, the 2.2-kb 5' flanking region is
sufficient to direct appropriate tissue-specific expression of the
lacZ gene in the islets of Langerhans of adult mice (Fig.
2A). In addition, strong
-galactosidase (
-Gal) activity can be detected in the adult mouse
brain, including the cerebellum, the hippocampus, the pituitary gland,
the retina, and the cerebral cortex. Also, transgenic embryos carrying
the same transgene were analyzed at E11.5. Expression of LacZ was found
only in the pancreas and the nervous system, including the brain, the
neural retina, trigeminal ganglia, and dorsal root ganglia (Fig. 2B).
Since the expression patterns of the BETA2 promoter-lacZ in embryos and adult mice seem to be
indistinguishable from what we observed in BETA2+/
mice
and what others have reported, we conclude that the 2.2-kb 5' flanking
sequence contain most if not all cis elements important for
tissue-specific expression of BETA2. To identify promoter sequences
important for BETA2 transcription, we linked the 2.2-kb BETA2 fragment (
2191 to +11) to a luciferase reporter gene
and generated a series of 5' deletion constructs using available
restriction enzyme sites (Fig. 3A). These
constructs, together with another 3.8-kb construct that contains
additional sequences for the untranslated exon and the intron, were
transiently transfected into two cell lines expressing endogenous
BETA2. As shown in Fig. 3B and C, the 3.8-kb construct had activity
similar to that of the 2.2-kb construct alone in both HIT and
-TC
cells. In addition, we consistently observed a slight increase in
promoter activity when the fragment between
2.2 and
1.0 kb was
deleted (Fig. 3B and C), suggesting the existence of a negative
regulatory element(s) in this region. Further deletion from
1.0 to
0.1 kb resulted in a progressive decrease of reporter activities,
which indicated that the proximal 1.0-kb region contains cis
elements important for the BETA2 transcription (Fig. 3B and
C).

View larger version (75K):
[in this window]
[in a new window]
|
FIG. 2.
The 2.2-kb promoter sequence of the BETA2
gene can direct tissue-specific expression of LacZ in pancreatic islets
and neurons of transgenic mice. (A) In the adult transgenic mouse
pancreas, -Gal activity is restricted to well-formed islets of
Langerhans (thick arrows) and in small clusters of islet cells (thin
arrows). No -Gal activity is found in exocrine acini (AC), vessels
(V), and ducts (D). (B) Whole-mount X-Gal staining of an E11.5
transgenic embryo carrying the BETA2
promoter-lacZ transgene. High levels of -Gal activity
are seen in the dorsal root ganglia (DRG), trigeminal ganglia (TG),
neural retina (NR), forebrain (FB), midbrain (MB), and hindbrain (HB).
Scale bars equal 200 µm (A) and 40 µm (B).
|
|

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 3.
Activities of BETA2 promoter deletion
constructs in HIT and -TC cells. (A) Schematic diagram of the
BETA2 promoter deletion constructs subcloned in pGL3-basic.
At the top is the 3.8-kb construct which contains a 2.2-kb promoter
(thick line), the first exon (solid box), and the intron (thin line).
All other constructs are named according to the location (kilobase) of
the 5' end of each promoter fragment relative to the transcription
start site. The restriction enzymes used to make the deletions are
indicated on the bottom. (B and C) Comparison of activities of
different deletion constructs in HIT (B) and -TC (C) cells.
Luciferase (Luc) activities (expressed as RLU) were corrected by
protein concentrations and presented as means of triplicate values (± standard deviation of the mean). All transfection assays were performed
in triplicate and repeated at least three times. (D) Both the 1.7- and
1.0-kb BETA2 promoter fragments can confer
cell-type-specific activity. Transient transfections were performed
with HIT, HeLa, and NIH 3T3 cells. For comparison of luciferase
activities in different cell lines, an RSV promoter-driven luciferase
construct (RSV-Luc) was transfected to each cell line in parallel
wells. The activities of deletion constructs from a representative
experiment were presented as percentage of the RSV-Luc activities
(±standard deviation of the mean). Transfections were performed in
triplicate and repeated three times.
|
|
In addition, we tested the cell-type-specific activity of different
deletion constructs in both BETA2-expressing and -nonexpressing
cell
lines. Interestingly, both the 1.7- and 1.0-kb fragments
had
significantly higher activity in HIT cells than in BETA2-nonexpressing
cell lines such as HeLa and NIH 3T3 (Fig.
3D). However, further
deletion to

231 seemed to decrease the cell-type-specific activity
in
HIT cells compared to the activity in HeLa and NIH 3T3 cells
(Fig.
3D).
This result suggested the existence of a cell-type-specific
element(s)
between

1.0 kb and

230 bp in the
BETA2 promoter.
The spatial expression of ngn3 partially overlaps that of BETA2
during early islet cell differentiation.
Sommer et al.
(39) have demonstrated that ngn3 expression seems to precede
that of BETA2 in the mouse endocrine pancreas. In that study, a
comparison of in situ hybridization on adjacent sections of the
pancreas indicates that ngn3-expressing cells are localized closely to
the area where BETA2 is detected. Thus, it is likely that ngn3, like
ngn1 and ngn2 in the nervous system (12, 18), is an upstream
activator of BETA2 in the developing pancreas. However, the study did
not address the question of whether ngn3 and BETA2 are indeed expressed
in the same cells during development. To address this question, we
performed colocalization studies on the embryonic tissues from the
previously generated BETA2+/
mouse
(24), in which the lacZ gene replaces one copy of
the BETA2 gene, so that the expression of BETA2 could be
followed by X-Gal staining. BETA2+/
embryos of different
stages were first subjected to standard whole-mount X-Gal staining. The
embryonic sections were then hybridized with either the antisense (Fig.
4A, B, and D) or sense control (Fig.
4C) probes for ngn3. As shown in Fig. 4A, at E9.0, when the first pancreatic tissue starts to arise from the foregut, ngn3 mRNA
can be easily detected in the foregut region where a small number of
BETA2-positive cells (Fig. 4A) can also be seen. Interestingly, at this
stage, about 40% of BETA2-positive cells coexpressed the ngn3
transcript (Fig. 4A, E, and G). At later stages such as E14.5 (Fig. 4B
and G) and E16.5 (Fig. 4G and data not shown), ngn3 expression still
partially colocalized with BETA2. Interestingly, most of those cells
coexpressing BETA2 and ngn3 were weakly positive for
-Gal activity
and existed either as a single isolated cell or as small clusters (Fig.
4B and F), suggesting that these cells were at the earlier
differentiation stage, when the BETA2 gene was just switched on. In
contrast, most strongly X-Gal-positive cells were grouped in larger
clusters and expressed little ngn3 (Fig. 4B). Moreover, the percentage
of BETA2-positive cells which coexpress ngn3 decreased gradually from
E9.0 to E16.5 (Fig. 4G), suggesting that as more endocrine cells
aggregate and differentiate at later developmental stages, they
coexpress less BETA2 and ngn3. Taken together, the observation that
ngn3 expression partially overlaps that of BETA2 suggests that ngn3 is
a pro-endocrine cell-specific gene and is likely involved in switching
on BETA2 expression at the early stage of islet cell differentiation.
The expression of ngn3 in the pancreas seems to persist until the newborn stage and disappears in adults, since ngn3 RNA could still be
detected using RT-PCR in the pancreas of postnatal day 2 mice but not
in the adult mice (Fig. 4H). In addition, we also observed intermediate
regions coexpressing ngn3 and BETA2 in the hypothalamus and the
spinal cord at E10.5 (Fig. 4D). Again, this suggested that ngn3 could
be an upstream trans activator of the BETA2 gene in these regions. Based on these observations, we propose that at the
early stage of islet cell differentiation, there exists a transitional
cell population that coexpresses BETA2 and ngn3. The function of ngn3
in these cells can be potentially involved in switching on the initial
expression of BETA2. Once BETA2 expression is initiated in these cells,
BETA2 itself, or other transcription factors, may replace ngn3 and
maintain the expression of BETA2.


View larger version (14029K):
[in this window]
[in a new window]
|
FIG. 4.
Partial colocalization of ngn3 and BETA2 in the
developing pancreas and the brain. (A) Sagittal section through the
foregut area of an E9.0 BETA2+/ embryo. BETA2 expression
(blue, X-Gal staining) and ngn3 expression (black silver grains, in
situ hybridization) are partially colocalized (bracket). The region
marked by a bracket is magnified in the inset, showing a cell
coexpressing BETA2 and ngn3. (B) Sagittal section of the
BETA2+/ pancreas at E14.5. Colocalization of BETA2 (blue)
and ngn3 (black grains) is seen in some cells (arrows) that have weaker
-Gal activity and in smaller clusters (fewer than five cells). The
larger clusters (more than five) of BETA2-positive cells (*) are
strongly X-Gal positive and express little ngn3. (C) The in situ
hybridization of E14.5 pancreas using the sense probe for ngn3. (D)
Sagittal section of the hypothalamus region of an E10.5 embryo. The
region coexpressing BETA2 (blue) and ngn3 (white silver grains) is
shown (bracket). Scale bars equal 10 µm. (E) Distribution of ngn3
signal (average number of silver grains per cell ± standard
deviation) in BETA2-positive cells and other cells in the foregut
region at E9.0. The number in each column represents the average of 50 cells from four embryos. The ngn3 (+) cell is arbitrarily defined as a
cell with more than 10 silver grains. (F) Distribution of ngn3 signal
(average number of silver grains per cell ±standard deviation) in
BETA2-positive cells and other cells in the pancreas at E14.5. The
number of each column represents the average of 200 cells from three
embryos. The BETA2-positive [BETA2(+)] cell clusters were classified
as small when fewer than five cells were found; otherwise, they were
classified as large. (G) The percentage of BETA2-positive cells which
express ngn3 decreases in later development. The data (average ± standard deviation) were obtained by counting 50 BETA2-positive cells
from four E9.0 embryos and 300 cells from three E14.5 or E16.5 embryos.
(H) Expression of ngn3 and BETA2 in the pancreas during development.
Total RNA was extracted from the pancreas from different stages of
mouse embryos. After DNase I treatment, RT-PCR was performed with
approximately same amount of RNA and primer pairs specific to ngn3,
BETA2, and the housekeeping gene L19. As a control, the same amount of
RNA was subjected to PCR directly without RT treatment. After
electrophoresis, the gels (except L19) were transferred to nylon
membranes and subjected to Southern blotting using ngn3- or
BETA2-specific probes complementary to the central region of the
specific fragments amplified.
|
|
Induction of ectopic BETA2 expression by ngn3 mRNA in
Xenopus embryos.
The observation that the ngn3
expression pattern partially overlap that of BETA2 prompted us to
clarify whether ectopic ngn3 expression can induce BETA2 expression
during embryonic development. Xenopus embryos at the
four-cell stage were injected with either ngn3 mRNA or control GFP mRNA
and allowed to develop until approximately stage 26. Whole-mount in
situ hybridization of BETA2 was performed to examine the expression
pattern of BETA2. In addition to GFP-injected embryos (Fig.
5A and C), the uninjected sides of
ngn3-injected embryos were included as the control (Fig. 5D). On the
ngn3-injected side of embryos, ectopic BETA2 expression was found in
the superficial layer of the trunk (Fig. 5B; 68% of embryos examined;
28 embryos from three independent experiments). The ectopic expression
of BETA2 was not seen on the uninjected side of the same embryos or in
the GFP-injected embryos (0% of embryos examined; 30 embryos from
three independent experiments). Moreover, ngn3 injection also caused
abnormal expansion of BETA2-expressing area in the head region (Fig.
5B), which obscured the normal expression of BETA2 in the eyes and
trigeminal ganglia seen in the uninjected embryos (Fig. 5A, C, and D).
These data suggest that ngn3 is able to induce the expression of BETA2
mRNA in vivo.

View larger version (136K):
[in this window]
[in a new window]
|
FIG. 5.
Injection of ngn3 can induce ectopic expression of BETA2
in Xenopus embryos. (A) The injected sides of GFP-injected
embryos, which were included as the control. Normal expression of BETA2
is seen in the eyes (E), trigeminal ganglia (TG), and dorsal root
ganglia (DRG). (C) Uninjected side of the same GFP-injected embryos.
(B) The injected sides of ngn3-injected embryos. In the lower embryo,
the two areas that express ectopic BETA2 are marked by black (left) and
white (right) dashed lines and are magnified in two insets at the left
and right corners, respectively. In the upper embryo, the region
expressing an ectopic or abnormal amount of BETA2 is also marked
(bracket). In addition, in both embryos the expression of BETA2 in the
head region is expanded and obscures the normal expression of BETA2 in
the eyes and trigeminal ganglia. (D) The uninjected side of
ngn3-injected embryos. Original magnification, ×3.125.
|
|
ngn3 up-regulates BETA2 gene transcription in endocrine cells.
To determine whether overexpression of ngn3 can alter the level of
endogenous BETA2 transcript, we established cell lines overexpressing
ngn3 by stably transfecting STC-1 (34) and
-TC cells with
the expression vector containing ngn3 cDNA (Fig. 6A, lane 2 and 4). As
a control, cell lines stably transfected with control expression vector
without the ngn3 insert (Fig. 6A, lane 1 and 3) were also established.
Northern blotting was performed with total RNA from cells, and the same
blots were hybridized with probes for BETA2, ngn3, and L19
(29), which is an RNA control to indicate equal loading in
the filters. As shown in Fig. 6A, overexpression of ngn3 in both STC-1 and
-TC cells can lead to a
two- to threefold increase (Fig. 6B) of BETA2 RNA signal compared to
control cells. Thus, the results suggest that ngn3 up-regulates the
level of BETA2 gene expression.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 6.
Stimulation of BETA2 transcription by overexpression of
ngn3 in endocrine cells. (A) Both STC-1 and -TC cells were stably
transfected with either pCR3.1-ngn3 (lanes 2 and 4) or control pCR3.1
empty vector (lanes 1 and 3). After selection with G418, the surviving
colonies were pooled and expanded in medium containing G418. Northern
blotting was performed with total RNAs from transfected cells. Ten and
5 µg of total RNAs were used for STC-1 and -TC cells,
respectively. The same blots were hybridized with probes for BETA2,
ngn3, and control L19 separately. (B) Fold increase of the BETA2 RNA
signal in ngn3-overexpressing cells. The levels of BETA2 RNA signals
shown in the graph were normalized against those of L19, which was used
as a loading control. Quantitative analyses of Northern blot signals
were performed by scanning the phosphor screen using a densitometer.
|
|
ngn3 up-regulates BETA2 promoter activity in
islet-derived and non-islet cell lines.
Since overexpression of
ngn3 can induce ectopic expression of BETA2 both in Xenopus
embryo injection and in endocrine cell lines, we next examined whether
the BETA2 promoter contains potential binding sites for bHLH
factors. A preliminary analysis of the 2.2-kb 5' flanking region
revealed the existence of 17 putative E boxes, 9 of them located in the
proximal 1.0-kb sequence (see Fig. 8A). In addition, a computer-based
analysis indicated that two of nine E boxes in the 1-kb promoter have
the flanking sequences homologous to the known MyoD binding sites
(21). To determine whether ngn3 is capable of stimulating
the BETA2 promoter, ngn3 was transiently overexpressed in
two BETA2-expressing cell lines, HIT and
-TC, with the
BETA2 promoter reporter constructs. As shown in Fig.
7A, in both cell lines ngn3 clearly
exerted a dose-dependent activation effect on the 1.0-kb promoter
reporter. We also cotransfected these cells with the same amount of
both cytomegalovirus (CMV)-ngn3 and CMV-E47; however, CMV-E47 did not
further increase the activation ability of ngn3 in these cells (data
not shown), possibly because HIT and
-TC cells already had an
abundant amount of E47 (23) and other ubiquitous bHLH
factors, such as HEB/BETA1 (32, 37, 47). In contrast, in
HeLa cells, coexpression of CMV-E47 further increased the ability of
ngn3 to activate the BETA2 promoter (Fig. 7B). Since the
initial construct of E47 contained a truncated form of E47 that lacked
~200 bp at the N terminus, we also included a CMV expression vector
containing the full-length cDNA for E47 (Fig. 7B, FL-E47). When
transfected alone, it had a slightly higher activation effect (2.2-fold
versus 1.7-fold) on the BETA2 promoter than E47. However,
when cotransfected with CMV-ngn3, both FL-E47 and E47 had similar
activation effects on the BETA2 promoter (Fig. 7B).

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 7.
The BETA2 promoter can be activated by ngn3.
(A) Dose-dependent activation of the BETA2 promoter by ngn3
in HIT and -TC cells. In both HIT and -TC cells, 300 ng of the
1.0-kb BETA2 promoter reporter was cotransfected with
increased amounts (50 to 800 ng) of CMV-ngn3 expression vector.
Activation effects of different amounts of CMV-ngn3 on the promoter are
shown as fold activation (±standard deviation of the mean). The
transfections were performed in triplicate and repeated three times.
(B) Cotransfection of E47 and ngn3 together had a higher activation
effect on the BETA2 promoter in non-islet cells. HeLa cells
were cotransfected with 300 ng of the 1.0-kb BETA2 promoter
reporter and 600 ng of E47 (or FL-E47) and/or ngn3 expression vectors.
The luciferase activities (expressed as RLU) were corrected by protein
concentrations and presented as the average of triplicate values
(±standard deviation of the mean). The transfection were repeated
three times.
|
|
Characterization of ngn3 binding sites in the BETA2
promoter.
As shown in Fig. 8A,
there are 17 E boxes in the 2.2-kb
BETA2 promoter. To further define those E boxes important
for ngn3-mediated activation of the BETA2 promoter, we
assayed the effect of ngn3 on a series of reporter constructs bearing
different deletions of the BETA2 promoter. Among the five
constructs tested, we consistently found that the 1.0-kb promoter
reporter [B2 (1.0 kb)] had the highest level of activation by ngn3 in
both HIT and
-TC cells (Fig. 8B and 6C). Moreover, the 419-bp
promoter reporter [B2 (419 bp)], which contains the three most
proximal E boxes, could still be stimulated by ngn3 to a reasonable
level. However, a further deletion of this promoter to eliminate the
three proximal E boxes [B2 (231 bp)] resulted in the loss of
ngn3-mediated activation (Fig. 8B and 6C). Interestingly, by alignment
of the human and mouse BETA2 promoter sequences, we found
that only four of the nine E boxes in the 1.0-kb fragment, including
the three most proximal ones and another located at bp
754 and
749,
are conserved between the human and mouse sequences. To further support
the assumption that the proximal three E boxes are important, we
generated 10 promoter reporter constructs with stepwise deletions of
one E box each time from the 5' end of the 1.0-kb promoter.
Transfection assay of these constructs indicated that, in general,
deletion of each E box from the distal end caused either no effect or a slight reduction of ngn3-mediated activation (Fig. 8D). However, deletion of the three proximal E boxes from the 419-bp construct [Fig.
8D, 2E1-3) abolished most of the effect of ngn3 and E47 [Fig. 8D,
2E(
)]. To confirm the importance of the three most proximal E boxes
(E1 to E3), we subcloned a 155-bp promoter sequence containing these
three E boxes in either a wild-type (CANNTG) or a mutated (TANNCT) form
(Fig. 9A and B) into a TATA-luciferase reporter. Wild-type and mutated constructs were cotransfected into HeLa
cells with expression vectors for ngn3 and E47. The results indicated
that mutation of either E1 or E3 caused an ~50% decrease of
ngn3-mediated fold activation compared to the wild type. However,
mutation of E2 did not decrease but rather slightly increased of
ngn3-E47-mediated activation. In addition, the reporter constructs
bearing mutations of E1 and E3 or all three mutations decreased
ngn3-E47-mediated activation to the level close to that of the control
vector (TATA). Further, we did not observe any synergistic effect
between E1 and E3.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 8.
The proximal three E boxes are important for
ngn3-mediated activation of the BETA2 promoter. (A to C)
Effects of E box deletions on ngn3-mediated activation of the
BETA2 promoter in HIT and -TC cells. (A) Schematic
diagram of locations of 17 E boxes in the 2.2-kb BETA2
promoter. (B) Deletion analyses in HIT cells cotransfected with 300 ng
of deletion constructs and 600 ng of CMV-ngn3. (C) Deletion analyses in
-TC cells cotransfected with 300 ng of deletion constructs and 200 ng of CMV-ngn3. The size of each promoter fragment is given in
parentheses. The effects are shown as fold activation of each reporter
construct by ngn3 (±standard deviation of the mean). Transfections
were performed in triplicate and repeated three times. (D) Effects of a
progressive deletion of E boxes ngn3-E47-mediated activation of the
1.0-kb BETA2 promoter. HeLa cells were cotransfected with
300 ng of each deletion construct and an equal amount (600 ng) of the
expression vectors for ngn3 and E47. The numbers following B2E
represent the E boxes included in each construct. The B2E( ) construct
has no E box. The effects are shown as fold activation of each reporter
construct by ngn3-E47 (±standard deviation of the mean). Transfections
were performed in triplicate and repeated three times.
|
|


View larger version (2618K):
[in this window]
[in a new window]
|
FIG. 9.
E1 and E3 E boxes are important for ngn3-E47-mediated
activation of the BETA2 promoter. (A) Mutational analyses of
the three proximal E boxes in the BETA2 promoter in the
presence of ngn3 and E47. All constructs (except the control) derived
from a TATA-luciferase reporter driven by a 155-bp BETA2
promoter fragment containing three E boxes in either a wild type
(WT-3E; open box) or mutated (hatched box) form. (B) Illustration of
mutated E box sequences, in each of which the sequence CANNTG was
replaced by TANNCT. Each construct was cotransfected into HeLa cells
with both ngn3 and E47 expression vectors. The activation of each
construct by ngn3-E47 is represented as fold activation (±standard
deviation of the mean). (C) Synergistic activation of individual E box
reporters by ngn3 and E47. Three copies of each E box (E1, E2, and E3)
were cloned into pGL3-TATA vector. The resultant reporters (300 ng)
were then cotransfected into HeLa cells with ngn3 and/or E47 expression
vectors (100 ng). The transfections were repeated three times. Top four
rows, E1 results; middle four rows, E3 results; bottom four rows, E2
results.
|
|
To determine whether an individual E box can, indeed, mediate the
activating effect of ngn3-E47, we cloned three copies of
each E box
into a TATA box-containing luciferase reporter (pGL3-TATA).
The
reporters and the expression vectors for ngn3 and E47 were
then
cotransfected into HeLa cells. The activities of all E box
reporters
(Fig.
9C) were only slightly increased by overexpression
of E47 alone.
Overexpression of ngn3 alone resulted in significant
increases on both
the E1 [(E1)×3-TATA]- and E3 [(E3)×3-TATA]-driven
reporter
activities (Fig.
9C, ngn3 compared to reporters). In
addition,
coexpression of E47 and ngn3 exerted synergistic activation
on both the
E1- and E3-driven reporters (Fig.
9C, E47+ngn3 compared
to ngn3 and E47
alone). In sharp contrast, the reporter activity
of E2 was not affected
by either ngn3 or ngn3-E47. Thus, both
E1 and E3 E boxes can act as the
target of ngn3-E47. In agreement
with previous results (Fig.
9A and B),
these data suggest that
E1 and E3, but not E2, can mediate the
activation effect of ngn3-E47.
ngn3-E47 heterodimer can bind to E1 and E3 but not E2 in the
BETA2 promoter.
For the next series of experiments, we
addressed the question of whether ngn3 can bind specifically to the
three proximal E boxes in vitro. The cDNAs of ngn3 and E47 were
transcribed and translated in vitro, and the proteins, individually or
in combination, were incubated with 32P-labeled E1, E2, and
E3 oligonucleotides individually. While incubation of E47 alone with
either E1 or E3 gave rise to a single binding complex (Fig.
10A, lanes 2 and 8; Fig. 10B, lane 2),
incubation of ngn3 alone generated no visible complex (Fig. 10B, lane
3). Coincubation of ngn3 and E47 with either E1 or E3 generated two complexes: a major, faster-migrating ngn3-E47 heterodimer and a minor,
slower-migrating E47 homodimer (Fig. 10). The identities of these
complexes were confirmed by supershift assay (Fig. 10A) with anti-E47
antibody and an antibody against a FLAG peptide sequence
(33) that was tagged at the C terminus of ngn3. As expected,
in the supershift assay using the E1 or E3 oligonucleotide as a probe,
anti-E47 antibody could supershift not only the E47 homodimer (Fig.
10A, lanes 3 and 9) but also the major complexes formed by ngn3 and E47
(Fig. 10A, lanes 5 and 11). In contrast, the presence of anti-FLAG
antibody seemed to prevent the formation of the major fast-migrating
complexes and enhanced the formation of slower-migrating complexes
(Fig. 10A, lanes 6 and 12), suggesting that the faster-migrating
complexes indeed contain both ngn3 and E47.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 10.
ngn3-E47 heterodimer can specifically bind to E1 and
E3. (A) The E47 and FLAG-tagged ngn3 proteins were synthesized in vitro
in rabbit reticulocyte lysate. Two specific protein-DNA complexes were
observed when E47 and/or ngn3 were incubated with E1 or E3 probe: the
faster-migrating one (arrow labeled ngn3/E47) and the slower-migrating
one (arrow labeled E47). Supershift assay was performed with 1 µl of
1:10-diluted anti-E47 antibody and 1 µl of 1:10 diluted anti-FLAG
peptide, respectively. Both antibodies were added after completion of
binding reactions. The positions of supershifted complexes (lanes 3, 5, 9, and 11) are indicated (arrowhead). Also notice that the E47
homodimer-DNA complexes were enhanced (lanes 6 and 12) in the presence
of anti-FLAG antibody. Nonimmune rabbit serum was not found to have
supershift activity and is not shown. (B) ngn3-E47 heterodimer bound
specifically to E1. The binding reaction was performed as described for
panel A. The homodimer- and heterodimer-DNA complexes are labeled as in
panel A. Binding specificity was determined by competition with 10- and
50-fold molar excess of unlabeled double-stranded E1, E2, E3, and
mutated E1 (mut E1) oligonucleotides.
|
|
To test the specificity of the bindings between E boxes and ngn3-E47
heterodimer, we performed a competition assay using unlabeled
E1, E2,
E3, mutated E1 (Fig.
10B), and mutated E3 oligonucleotides
(data not
shown). The results indicated that the complexes formed
by ngn3-E47
with either E1 or E3 could be competed by the addition
of unlabeled E1
or E3 oligonucleotides in a dose-dependent manner.
In contrast,
unlabeled E2, mutated E1, or mutated E3 (data not
shown)
oligonucleotide, in which three nucleotides were changed
in the core E
box (CANNTG to TANNCT), was unable to compete with
the binding of the
ngn3-E47 heterodimer to E1 (Fig.
10B) or E3
(data not shown). The
inability of E2 to compete for the binding
of ngn3-E47 to E1 (Fig.
10B,
lanes 9 and 10) or E3 (data not shown)
suggested that the ngn3-E47
heterodimer was not able to bind to
E2 efficiently. This result may
explain why E2 was not important
in mediating the ngn3 regulation of
the
BETA2 promoter as shown
in the transfection experiments
(Fig.
9). In a similar gel shift
assay using the extract from COS-1
cells transfected with expression
vectors for E47 and FLAG-tagged ngn3,
we found similar bands formed
by E47-ngn3 and E boxes, which could be
supershifted by anti-FLAG
tag antibody (data not shown). Taken
together, the data suggest
that ngn3-E47 activates the
BETA2
promoter by binding specifically
to both E1 and E3 but not to
E2.
 |
DISCUSSION |
Recent studies on cell fate determination during vertebrate
neuronal development have led to the identification of several tissue-specific bHLH factors, including members of the neurogenin family (19, 39) and the BETA2 (neuroD) family (17, 24, 25). The early expression of ngns in undifferentiated and
dividing neuronal progenitors makes them better candidates than BETA2
(neuroD) members as neuronal determination factors (19).
This notion is further supported by the findings that in ngn1- and
ngn2-deficient mice (12, 18), the expression of BETA2 is
abolished in neuronal cells, possibly because the BETA2
promoter cannot be switched on in the absence of potential
transcription activators like ngns. Interestingly, the molecular basis
of endocrine pancreas development is in many respects similar to that
of neuronal development (38), and both ngn3 and BETA2 are
expressed in the developing pancreas and neurons (39).
Therefore, by extension, the same cascade relationship may likely hold
true for ngn3 and BETA2 in the endocrine pancreas.
In this study, we describe the cloning and characterization of the
mouse BETA2 promoter. Our work indicates that the 2.2-kb promoter fragment is sufficient to direct proper expression of the
transgene in the mouse pancreas and neuronal tissues. During the
preparation of this paper, Xu and Murphy (46) reported the isolation of the mouse BETA2 (neuroD) gene. The
transcription start site that we found is 2 bp upstream of the one
defined using 5' RACE PCR alone by Xu and Murphy (46), and
the untranslated exon (exon 1) that we identified is 86 bp in length,
not 82 bp. In addition to the in vitro transfection assay, we have
shown that in transgenic mice, the 3.8-kb BETA2 5'
flanking sequence, which includes the 2.2-kb promoter, the first exon,
and the intron, is able to direct proper islet-specific expression of
the
-Gal gene. Interestingly, in collaboration with P.-L. Herrera,
we obtained preliminary data also indicating that the 2.2-kb promoter
with a heterologous intron sequence was able to direct proper
islet-specific expression of the reporter gene in the transgenic mice.
Therefore, the untranslated exon (exon 1) and the intron do not seem to
be required for tissue-specific expression of BETA2 in the islets of Langerhans.
In this paper, we have demonstrated that the BETA2 gene has
a tissue- or cell-type-specific promoter. The sequence important for
the cell type specificity probably resides between bp
231 and kb
1.0, where nine E boxes exist. It is likely that these E boxes may
contribute to the cell-type-specific activity observed. Indeed, for
both 1.0-kb and 419-bp reporter constructs, overexpression of ngn3 and
E47 in HeLa cells seemed to compensate for the low activity of the
BETA2 promoter in these cells (data not shown). However,
deletion of the three proximal E boxes (E1 to E3) abolished the
activation effect in HeLa cells (data not shown), suggesting that these
three E boxes may also contribute to the cell-type-specific activities.
The gel shift analyses demonstrated that ngn3 alone cannot form a
visible protein-DNA complex with E boxes (Fig. 10). This is consistent
with previous studies (16, 22) showing that tissue-specific
or class B bHLH factors cannot form stable homodimers binding to E
boxes. However, when heterodimerized with E47, ngn3 could bind to E1
and E3 but not E2. Sequence comparison indicated that the E2 sequence
is indeed more homologous to the consensus binding site of Myc
(5). Further experiments are under way to determine whether
any bHLH-leucine zipper or class C bHLH factor (15) can bind
to E2. The interactions between ngn3-E47 and E1 or E3 were
significantly weakened when only three nucleotides in the core E boxes
were changed. This is in agreement with our mutational analyses showing
that the activation effect of ngn3-E47 was decreased when these E boxes
were mutated in the same way (Fig. 9). It is also noteworthy that both
E1 and E3 contain an E box sequence, CANATG, that is slightly different
from the identified BETA2-responsive E box sequence (CANCTG) in the
insulin and secretin promoters (23, 25). The significance of
this subtle difference is not known. Taken together, these results
indicate that the ngn3-E47 heterodimer could discriminate against the
slight variances in the E box sequences. Therefore, the interactions
that we observed between ngn3-E47 and E1 or E3 are specific and
involved in activation of the BETA2 promoter. We should
emphasize, however, that other E boxes localized in the distal promoter
may be also bound by ngn3-E47 and contribute to maximal activation of
the BETA2 promoter. Whether these two E boxes (E1 and E3)
that we describe here are essential for BETA2 expression during
development requires further experimentation. In addition, it will be
interesting to determine whether other transcription factors, such as
BETA2 itself, can also bind to these two E boxes and regulate the
expression of BETA2.
In the supershift experiments, we do not know exactly whether the
anti-FLAG antibody simply prevented the formation of the ngn3-E47
complex on E boxes or formed the supershift complexes migrating at a
position indistinguishable from that of the slower-migrating complexes
containing E47 homodimer (Fig. 10A). For the former possibility, it is
likely that the antibody caused a conformational change of ngn3 and
hence interfered with or physically prevented the interaction between
ngn3 and E47. Nevertheless, both possibilities suggest that the
faster-migrating complex contained both ngn3 and E47.
The role of ngn3 as one of the physiologically relevant upstream
regulators of the BETA2 gene is strongly suggested by two biological
studies. First, injection of ngn3 mRNA into Xenopus embryos
caused the ectopic expression of BETA2 in the trunk of embryos (Fig.
5). Second, overexpression of ngn3 in stably transfected endocrine cell
lines up-regulated the endogenous levels of BETA2 RNA (Fig. 6).
Furthermore, the observation that the expression domains of ngn3
partially overlaps those of BETA2 in both the developing pancreas
(especially at earlier stages) and neuronal tissues (Fig. 4A, B, and D)
further supports the conclusion that BETA2 gene expression
can be regulated by ngn3. While our results clearly indicate that ngn3
is an upstream regulator of BETA2 gene expression, they do
not distinguish whether the effect of ngn3 is a direct one or is
mediated by other ngn3 downstream bHLH factors that in turn bind to the
E boxes and activate BETA2 transcription. However, the
ability of ngn3-E47 heterodimer to directly bind to the
BETA2 promoter and transactivate it supports the notion that
the activation of BETA2 by ngn3 is a direct effect.
Although we were able to activate BETA2 gene expression in
-TC and STC cells by overexpression of ngn3, we were not able to do
so in several other cell lines such as ARIP and Panc1. This result is
consistent with data presented in Fig. 5 showing that injection of ngn3
mRNA into Xenopus embryos can ectopically induce BETA2 gene expression in several but not all areas receiving
ngn3 mRNA. Thus, ngn3 is not able to stimulate BETA2 gene
expression in all cell types. Other factors may also participate in
BETA2 gene expression. For example, many factors such as
coactivators (i.e., CBP/p300), ngn3 modification (i.e., phosphorylation
and dephosphorylation), and other transcription factors may be needed to synergize with ngn3 to induce BETA2 gene expression. If
these factors or modification systems are required and not expressed in
some cells, we expect that ngn3 will not be able to stimulate BETA2 gene expression in all cells. Indeed, all of these
factors have been shown to play a role in modifying the transcriptional activity of other bHLH transcription factors.
Interestingly, at later stages of islet cell differentiation, BETA2
and ngn3 were frequently found to be expressed in separate cell
populations, suggesting that ngn3 was no longer required for the
expression of BETA2. Therefore, other transcription factors are
necessary to maintain the expression of BETA2 in differentiated endocrine cells. Recently, a novel neuron-specific bHLH factor, NeuroM
(35), was cloned from the chicken retina. It is possible that the putative intermediate bHLH factors, such as NeuroM or NeuroM-like molecules, play a role in maintaining the expression of
BETA2 after the expression of ngn3 is switched off. However, it has not
been shown that NeuroM or NeuroM-like molecules are expressed in the
developing pancreas or that they can regulate the BETA2
promoter. Alternatively, after being turned on by ngn3 at an early
stage, BETA2 may play an autoregulatory role in maintaining its own
expression in the developing pancreas. This is more likely, since we
have preliminary data indicating that BETA2 could also activate the E1-
and E3-driven reporter constructs (data not shown). Intriguingly, the
expression of ngn3 (Fig. 4H) could still be detected in the pancreas
during later development at E17.5 and P2, suggesting that
ngn3-expressing cells may represent a stem cell population in the
endocrine pancreas and may be involved in renewal of islet cells.
In conclusion, ngn3 is likely to be one of the transcription factors
involved in regulation of the BETA2 promoter during early islet cell differentiation. Future isolation of other transcriptional factors involved in this context and generation of gene-disrupted animals, including ngn3-deficient mice, will help to elucidate the
transcriptional cascade of islet-specific transcription factors and its
physiological significance during endocrine pancreas development.
 |
ACKNOWLEDGMENTS |
We are grateful to David J. Anderson for the gift of plasmid
pSK-ngn3. We thank Francesco J. DeMayo's laboratory for
microinjections. We are grateful to Roland Stein for providing the
plasmid containing full-length E47 cDNA, Francisco J. Naya for
providing the BETA2 genomic DNA clone, Christine M. M. Stellrecht for the
-TC cell cDNA library, Fabrice Petit for
providing the pGL3-TATA plasmid and valuable help with gel shift
assays, and Fred A. Pereira and Cheng Zhou for technical advice on in
situ hybridization. We are grateful to Sophia Y. Tsai, Eric
Nemoz-Gaillard, and Carlos Pipaon for useful discussions. We thank
Debra Bramblett and members in Tsai laboratory for critical reading of
the manuscript.
This work was supported by a postdoctoral fellowship (M.L.) and grants
(M.-J.T.) from the National Institutes of Health.
 |
ADDENDUM IN PROOF |
Following submission of this paper, G. Gradwohl et al. (Proc.
Natl. Acad. Sci. USA 97:1607-1611, 2000) reported that expression of BETA2 is lost and all four islet cell types are lacking
in ngn3-deficient mice.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular and Cellular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030. Phone: (713) 798-6253. Fax: (713) 798-8227. E-mail: mtsai{at}bcm.tmc.edu.
 |
REFERENCES |
| 1.
|
Ahlgren, U.,
J. Jonsson, and H. Edlund.
1996.
The morphogenesis of the pancreatic mesenchyme is uncoupled from that of the pancreatic epithelium in IPF1/PDX1-deficient mice.
Development
122:1409-1416[Abstract].
|
| 2.
|
Ahlgren, U.,
S. L. Pfaff,
T. M. Jessell,
T. Edlund, and H. Edlund.
1997.
Independent requirement for ISL1 in formation of pancreatic mesenchyme and islet cells.
Nature
385:257-260[CrossRef][Medline].
|
| 3.
|
Andersen, F. G.,
J. Jensen,
R. S. Heller,
H. V. Petersen,
L. I. Larsson,
O. D. Madsen, and P. Serup.
1999.
Pax6 and Pdx1 form a functional complex on the rat somatostatin gene upstream enhancer.
FEBS Lett.
445:315-320[CrossRef][Medline].
|
| 4.
|
Bartholoma, A., and K. A. Nave.
1994.
NEX-1: a novel brain-specific helix-loop-helix protein with autoregulation and sustained expression in mature cortical neurons.
Mech. Dev.
48:217-228[CrossRef][Medline].
|
| 5.
|
Blackwell, T. K.,
L. Kretzner,
E. M. Blackwood,
R. N. Eisenman, and H. Weintraub.
1990.
Sequence-specific DNA binding by the c-Myc protein.
Science
250:1149-1151[Abstract/Free Full Text].
|
| 6.
|
Bonnerot, C., and J. F. Nicolas.
1993.
Application of LacZ gene fusions to postimplantation development.
Methods Enzymol.
225:451-469[Medline].
|
| 7.
|
Busch, K.,
B. Martin,
A. Baniahmad,
R. Renkawitz, and M. Muller.
1997.
At least three subdomains of v-erbA are involved in its silencing function.
Mol. Endocrinol.
11:379-389[Abstract/Free Full Text].
|
| 8.
|
Dirks, W.,
M. Wirth, and H. Hauser.
1993.
Dicistronic transcription units for gene expression in mammalian cells.
Gene
128:247-249[CrossRef][Medline].
|
| 9.
|
Dumonteil, E.,
B. Laser,
I. Constant, and J. Philippe.
1998.
Differential regulation of the glucagon and insulin I gene promoters by the basic helix-loop-helix transcription factors E47 and BETA2.
J. Biol. Chem.
273:19945-19954[Abstract/Free Full Text].
|
| 10.
|
Efrat, S.,
S. Linde,
H. Kofod,
D. Spector,
M. Delannoy,
S. Grant,
D. Hanahan, and S. Baekkeskov.
1988.
Beta-cell lines derived from transgenic mice expressing a hybrid insulin gene-oncogene.
Proc. Natl. Acad. Sci. USA
85:9037-9041[Abstract/Free Full Text].
|
| 11.
|
El-Hodiri, H. M., and M. Perry.
1995.
Interaction of the CCAAT displacement protein with shared regulatory elements required for transcription of paired histone genes.
Mol. Cell. Biol.
15:3587-3596[Abstract].
|
| 12.
|
Fode, C.,
G. Gradwohl,
X. Morin,
A. Dierich,
M. LeMeur,
C. Goridis, and F. Guillemot.
1998.
The bHLH protein NEUROGENIN 2 is a determination factor for epibranchial placode-derived sensory neurons.
Neuron
20:483-494[CrossRef][Medline].
|
| 13.
|
Harland, R. M.
1991.
In situ hybridization: an improved whole-mount method for Xenopus embryos.
Methods Cell Biol.
36:685-695[Medline].
|
| 14.
|
Henthorn, P.,
M. Kiledjian, and T. Kadesch.
1990.
Two distinct transcription factors that bind the immunoglobulin enhancer microE5/kappa 2 motif.
Science
247:467-470[Abstract/Free Full Text].
|
| 15.
|
Landschulz, W. H.,
P. F. Johnson, and S. L. McKnight.
1988.
The leucine zipper: a hypothetical structure common to a new class of DNA binding proteins.
Science
240:1759-1764[Abstract/Free Full Text].
|
| 16.
|
Lassar, A. B.,
R. L. Davis,
W. E. Wright,
T. Kadesch,
C. Murre,
A. Voronova,
D. Baltimore, and H. Weintraub.
1991.
Functional activity of myogenic HLH proteins requires hetero-oligomerization with E12/E47-like proteins in vivo.
Cell
66:305-315[CrossRef][Medline].
|
| 17.
|
Lee, J. E.,
S. M. Hollenberg,
L. Snider,
D. L. Turner,
N. Lipnick, and H. Weintraub.
1995.
Conversion of Xenopus ectoderm into neurons by NeuroD, a basic helix-loop-helix protein.
Science
268:836-844[Abstract/Free Full Text].
|
| 18.
|
Ma, Q.,
Z. Chen,
I. del Barco Barrantes,
J. L. de la Pompa, and D. J. Anderson.
1998.
Neurogenin1 is essential for the determination of neuronal precursors for proximal cranial sensory ganglia.
Neuron
20:469-482[CrossRef][Medline].
|
| 19.
|
Ma, Q.,
C. Kintner, and D. J. Anderson.
1996.
Identification of neurogenin, a vertebrate neuronal determination gene.
Cell
87:43-52[CrossRef][Medline].
|
| 20.
|
McCormick, M. B.,
R. M. Tamimi,
L. Snider,
A. Asakura,
D. Bergstrom, and S. J. Tapscott.
1996.
NeuroD2 and neuroD3: distinct expression patterns and transcriptional activation potentials within the neuroD gene family.
Mol. Cell. Biol.
16:5792-5800[Abstract].
|
| 21.
|
Murre, C.,
P. S. McCaw, and D. Baltimore.
1989.
A new DNA binding and dimerization motif in immunoglobulin enhancer binding, daughterless, MyoD, and myc proteins.
Cell
56:777-783[CrossRef][Medline].
|
| 22.
|
Murre, C.,
A. Voronova, and D. Baltimore.
1991.
B-cell- and myocyte-specific E2-box-binding factors contain E12/E47-like subunits.
Mol. Cell. Biol.
11:1156-1160[Abstract/Free Full Text].
|
| 23.
|
Mutoh, H.,
B. P. Fung,
F. J. Naya,
M. J. Tsai,
J. Nishitani, and A. B. Leiter.
1997.
The basic helix-loop-helix transcription factor BETA2/NeuroD is expressed in mammalian enteroendocrine cells and activates secretin gene expression.
Proc. Natl. Acad. Sci. USA
94:3560-3564[Abstract/Free Full Text].
|
| 24.
|
Naya, F. J.,
H. P. Huang,
Y. Qiu,
H. Mutoh,
F. J. DeMayo,
A. B. Leiter, and M. J. Tsai.
1997.
Diabetes, defective pancreatic morphogenesis, and abnormal enteroendocrine differentiation in BETA2/neuroD-deficient mice.
Genes Dev.
11:2323-2334[Abstract/Free Full Text].
|
| 25.
|
Naya, F. J.,
C. M. Stellrecht, and M. J. Tsai.
1995.
Tissue-specific regulation of the insulin gene by a novel basic helix-loop-helix transcription factor.
Genes Dev.
9:1009-1019[Abstract/Free Full Text].
|
| 26.
|
Nieuwkoop, P. D., and J. Faber.
1967.
Normal table of Xenopus laevis (Daudin), 2nd ed.
Elsevier/North Holland Publishing Co., Amsterdam, The Netherlands.
|
| 27.
|
Offield, M. F.,
T. L. Jetton,
P. A. Labosky,
M. Ray,
R. W. Stein,
M. A. Magnuson,
B. L. Hogan, and C. V. Wright.
1996.
PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum.
Development
122:983-995[Abstract].
|
| 28.
|
Ohlsson, H.,
K. Karlsson, and T. Edlund.
1993.
IPF1, a homeodomain-containing transactivator of the insulin gene.
EMBO J.
12:4251-4259[Medline].
|
| 29.
|
Orly, J.,
Z. Rei,
N. M. Greenberg, and J. S. Richards.
1994.
Tyrosine kinase inhibitor AG18 arrests follicle-stimulating hormone-induced granulosa cell differentiation: use of reverse transcriptase-polymerase chain reaction assay for multiple messenger ribonucleic acids.
Endocrinology
134:2336-2346[Abstract/Free Full Text].
|
| 30.
|
Peng, H. B.
1991.
Xenopus laevis: practical uses in cell and molecular biology. Solutions and protocols.
Methods Cell Biol.
36:657-662[Medline].
|
| 31.
|
Peshavaria, M.,
E. Henderson,
A. Sharma,
C. V. Wright, and R. Stein.
1997.
Functional characterization of the transactivation properties of the PDX-1 homeodomain protein.
Mol. Cell. Biol.
17:3987-3996[Abstract].
|
| 32.
|
Peyton, M.,
L. G. Moss, and M. J. Tsai.
1994.
Two distinct class A helix-loop-helix transcription factors, E2A and BETA1, form separate DNA binding complexes on the insulin gene E box.
J. Biol. Chem.
269:25936-25941[Abstract/Free Full Text].
|
| 33.
|
Prickett, K. S.,
D. C. Amberg, and T. P. Hopp.
1989.
A calcium-dependent antibody for identification and purification of recombinant proteins.
BioTechniques
7:580-589[Medline].
|
| 34.
|
Rindi, G.,
S. G. Grant,
Y. Yiangou,
M. A. Ghatei,
S. R. Bloom,
V. L. Bautch,
E. Solcia, and J. M. Polak.
1990.
Development of neuroendocrine tumors in the gastrointestinal tract of transgenic mice. Heterogeneity of hormone expression.
Am. J. Pathol.
136:1349-1363[Abstract].
|
| 35.
|
Roztocil, T.,
L. Matter-Sadzinski,
C. Alliod,
M. Ballivet, and J. M. Matter.
1997.
NeuroM, a neural helix-loop-helix transcription factor, defines a new transition stage in neurogenesis.
Development
124:3263-3272[Abstract].
|
| 36.
|
Santerre, R. F.,
R. A. Cook,
R. M. Crisel,
J. D. Sharp,
R. J. Schmidt,
D. C. Williams, and C. P. Wilson.
1981.
Insulin synthesis in a clonal cell line of simian virus 40-transformed hamster pancreatic beta cells.
Proc. Natl. Acad. Sci. USA
78:4339-4343[Abstract/Free Full Text].
|
| 37.
|
Sharma, A.,
E. Henderson,
L. Gamer,
Y. Zhuang, and R. Stein.
1997.
Analysis of the role of E2A-encoded proteins in insulin gene transcription.
Mol. Endocrinol.
11:1608-1617[Abstract/Free Full Text].
|
| 38.
|
Slack, J. M.
1995.
Developmental biology of the pancreas.
Development
121:1569-1580[Abstract].
|
| 39.
|
Sommer, L.,
Q. Ma, and D. J. Anderson.
1996.
Neurogenins, a novel family of atonal-related bHLH transcription factors, are putative mammalian neuronal determination genes that reveal progenitor cell heterogeneity in the developing CNS and PNS.
Mol. Cell. Neurosci.
8:221-241[CrossRef][Medline].
|
| 40.
|
Sosa-Pineda, B.,
K. Chowdhury,
M. Torres,
G. Oliver, and P. Gruss.
1997.
The Pax4 gene is essential for differentiation of insulin-producing beta cells in the mammalian pancreas.
Nature
386:399-402[CrossRef][Medline].
|
| 41.
|
St-Onge, L.,
B. Sosa-Pineda,
K. Chowdhury,
A. Mansouri, and P. Gruss.
1997.
Pax6 is required for differentiation of glucagon-producing alpha-cells in mouse pancreas.
Nature
387:406-409[CrossRef][Medline].
|
| 42.
|
Sussel, L.,
J. Kalamaras,
D. J. Hartigan-O'Connor,
J. J. Meneses,
R. A. Pedersen,
J. L. Rubenstein, and M. S. German.
1998.
Mice lacking the homeodomain transcription factor Nkx2.2 have diabetes due to arrested differentiation of pancreatic beta cells.
Development
125:2213-2221[Abstract].
|
| 43.
|
Turner, D. L., and H. Weintraub.
1994.
Expression of achaete-scute homolog 3 in Xenopus embryos converts ectodermal cells to a neural fate.
Genes Dev.
8:1434-1447[Abstract/Free Full Text].
|
| 44.
|
Wang, M., and D. J. Drucker.
1995.
The LIM domain homeobox gene isl-1 is a positive regulator of islet cell-specific proglucagon gene transcription.
J. Biol. Chem.
270:12646-12652[Abstract/Free Full Text].
|
| 45.
|
Wilkinson, D. G., and M. A. Nieto.
1993.
Detection of messenger RNA by in situ hybridization to tissue sections and whole mounts.
Methods Enzymol.
225:361-373[Medline].
|
| 46.
|
Xu, W., and L. J. Murphy.
1998.
Isolation and characterization of the mouse beta 2/neuroD gene promoter.
Biochem. Biophys. Res. Commun.
247:814-818[CrossRef][Medline].
|
| 47.
|
Zhuang, Y.,
P. Cheng, and H. Weintraub.
1996.
B-lymphocyte development is regulated by the combined dosage of three basic helix-loop-helix genes, E2A, E2-2, and HEB.
Mol. Cell. Biol.
16:2898-2905[Abstract].
|
Molecular and Cellular Biology, May 2000, p. 3292-3307, Vol. 20, No. 9
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lan, M. S., Breslin, M. B.
(2009). Structure, expression, and biological function of INSM1 transcription factor in neuroendocrine differentiation. FASEB J.
23: 2024-2033
[Abstract]
[Full Text]
-
Zhang, T., Liu, W.-D., Saunee, N. A., Breslin, M. B., Lan, M. S.
(2009). Zinc Finger Transcription Factor INSM1 Interrupts Cyclin D1 and CDK4 Binding and Induces Cell Cycle Arrest. J. Biol. Chem.
284: 5574-5581
[Abstract]
[Full Text]
-
Haumaitre, C., Lenoir, O., Scharfmann, R.
(2008). Histone Deacetylase Inhibitors Modify Pancreatic Cell Fate Determination and Amplify Endocrine Progenitors. Mol. Cell. Biol.
28: 6373-6383
[Abstract]
[Full Text]
-
Oliver-Krasinski, J. M., Stoffers, D. A.
(2008). On the origin of the {beta} cell. Genes Dev.
22: 1998-2021
[Abstract]
[Full Text]
-
Wang, H.-W., Muguira, M., Liu, W.-D., Zhang, T., Chen, C., Aucoin, R., Breslin, M. B, Lan, M. S
(2008). Identification of an INSM1-binding site in the insulin promoter: negative regulation of the insulin gene transcription. J Endocrinol
198: 29-39
[Abstract]
[Full Text]
-
Holmberg, J., Hansson, E., Malewicz, M., Sandberg, M., Perlmann, T., Lendahl, U., Muhr, J.
(2008). SoxB1 transcription factors and Notch signaling use distinct mechanisms to regulate proneural gene function and neural progenitor differentiation. Development
135: 1843-1851
[Abstract]
[Full Text]
-
Mattar, P., Langevin, L. M., Markham, K., Klenin, N., Shivji, S., Zinyk, D., Schuurmans, C.
(2008). Basic Helix-Loop-Helix Transcription Factors Cooperate To Specify a Cortical Projection Neuron Identity. Mol. Cell. Biol.
28: 1456-1469
[Abstract]
[Full Text]
-
White, P., Lee May, C., Lamounier, R. N., Brestelli, J. E., Kaestner, K. H.
(2008). Defining Pancreatic Endocrine Precursors and Their Descendants. Diabetes
57: 654-668
[Abstract]
[Full Text]
-
Serafimidis, I., Rakatzi, I., Episkopou, V., Gouti, M., Gavalas, A.
(2008). Novel Effectors of Directed and Ngn3-Mediated Differentiation of Mouse Embryonic Stem Cells into Endocrine Pancreas Progenitors. Stem Cells
26: 3-16
[Abstract]
[Full Text]
-
Fratticci, A, Grieco, F A, Spilioti, C, Giangaspero, F, Ventura, L, Esposito, V, Piccirilli, M, Santoro, A, Gulino, A, Cantore, G, Alesse, E, Jaffrain-Rea, M L
(2007). Differential expression of neurogenins and NeuroD1 in human pituitary tumours. J Endocrinol
194: 475-484
[Abstract]
[Full Text]
-
Guillemain, G., Filhoulaud, G., Da Silva-Xavier, G., Rutter, G. A., Scharfmann, R.
(2007). Glucose Is Necessary for Embryonic Pancreatic Endocrine Cell Differentiation. J. Biol. Chem.
282: 15228-15237
[Abstract]
[Full Text]
-
Ackermann, A. M, Gannon, M.
(2007). Molecular regulation of pancreatic {beta}-cell mass development, maintenance, and expansion. J Mol Endocrinol
38: 193-206
[Abstract]
[Full Text]
-
Cerf, M. E
(2006). Transcription factors regulating {beta}-cell function.. Eur J Endocrinol
155: 671-679
[Abstract]
[Full Text]
-
Treff, N. R., Vincent, R. K., Budde, M. L., Browning, V. L., Magliocca, J. F., Kapur, V., Odorico, J. S.
(2006). Differentiation of Embryonic Stem Cells Conditionally Expressing Neurogenin 3. Stem Cells
24: 2529-2537
[Abstract]
[Full Text]
-
Mortazavi, A., Thompson, E. C. L., Garcia, S. T., Myers, R. M., Wold, B.
(2006). Comparative genomics modeling of the NRSF/REST repressor network: From single conserved sites to genome-wide repertoire. Genome Res
16: 1208-1221
[Abstract]
[Full Text]
-
Wang, J., Cortina, G., Wu, S. V., Tran, R., Cho, J.-H., Tsai, M.-J., Bailey, T. J., Jamrich, M., Ament, M. E., Treem, W. R., Hill, I. D., Vargas, J. H., Gershman, G., Farmer, D. G., Reyen, L., Martin, M. G.
(2006). Mutant neurogenin-3 in congenital malabsorptive diarrhea.. NEJM
355: 270-280
[Abstract]
[Full Text]
-
Taylor-Fishwick, D. A, Shi, W., Pittenger, G. L, Vinik, A. I
(2006). PDX-1 can repress stimulus-induced activation of the INGAP promoter.. J Endocrinol
188: 611-621
[Abstract]
[Full Text]
-
Volinic, J. L., Lee, J. H., Eto, K., Kaur, V., Thomas, M. K.
(2006). Overexpression of the Coactivator Bridge-1 Results in Insulin Deficiency and Diabetes. Mol. Endocrinol.
20: 167-182
[Abstract]
[Full Text]
-
Wilson, M. E., Yang, K. Y., Kalousova, A., Lau, J., Kosaka, Y., Lynn, F. C., Wang, J., Mrejen, C., Episkopou, V., Clevers, H. C., German, M. S.
(2005). The HMG Box Transcription Factor Sox4 Contributes to the Development of the Endocrine Pancreas. Diabetes
54: 3402-3409
[Abstract]
[Full Text]
-
Jung, C.-G., Kim, H.-J., Kawaguchi, M., Khanna, K. K., Hida, H., Asai, K., Nishino, H., Miura, Y.
(2005). Homeotic factor ATBF1 induces the cell cycle arrest associated with neuronal differentiation. Development
132: 5137-5145
[Abstract]
[Full Text]
-
Dominguez-Bendala, J., Klein, D., Ribeiro, M., Ricordi, C., Inverardi, L., Pastori, R., Edlund, H.
(2005). TAT-Mediated Neurogenin 3 Protein Transduction Stimulates Pancreatic Endocrine Differentiation In Vitro. Diabetes
54: 720-726
[Abstract]
[Full Text]
-
Habener, J. F., Kemp, D. M., Thomas, M. K.
(2005). Minireview: Transcriptional Regulation in Pancreatic Development. Endocrinology
146: 1025-1034
[Abstract]
[Full Text]
-
Lay, J. M., Bane, G., Brunkan, C. S., Davis, J., Lopez-Diaz, L., Samuelson, L. C.
(2005). Enteroendocrine cell expression of a cholecystokinin gene construct in transgenic mice and cultured cells. Am. J. Physiol. Gastrointest. Liver Physiol.
288: G354-G361
[Abstract]
[Full Text]
-
Seo, S., Richardson, G. A., Kroll, K. L.
(2005). The SWI/SNF chromatin remodeling protein Brg1 is required for vertebrate neurogenesis and mediates transactivation of Ngn and NeuroD. Development
132: 105-115
[Abstract]
[Full Text]
-
Gasa, R., Mrejen, C., Leachman, N., Otten, M., Barnes, M., Wang, J., Chakrabarti, S., Mirmira, R., German, M.
(2004). Proendocrine genes coordinate the pancreatic islet differentiation program in vitro. Proc. Natl. Acad. Sci. USA
101: 13245-13250
[Abstract]
[Full Text]
-
Schonhoff, S. E., Giel-Moloney, M., Leiter, A. B.
(2004). Minireview: Development and Differentiation of Gut Endocrine Cells. Endocrinology
145: 2639-2644
[Abstract]
[Full Text]
-
Quan, X.-J., Denayer, T., Yan, J., Jafar-Nejad, H., Philippi, A., Lichtarge, O., Vleminckx, K., Hassan, B. A.
(2004). Evolution of neural precursor selection: functional divergence of proneural proteins. Development
131: 1679-1689
[Abstract]
[Full Text]
-
Lamolet, B., Poulin, G., Chu, K., Guillemot, F., Tsai, M.-J., Drouin, J.
(2004). Tpit-Independent Function of NeuroD1(BETA2) in Pituitary Corticotroph Differentiation. Mol. Endocrinol.
18: 995-1003
[Abstract]
[Full Text]
-
Smith, S. B., Watada, H., German, M. S.
(2004). Neurogenin3 Activates the Islet Differentiation Program while Repressing Its Own Expression. Mol. Endocrinol.
18: 142-149
[Abstract]
[Full Text]
-
Breslin, M. B., Zhu, M., Lan, M. S.
(2003). NeuroD1/E47 Regulates the E-box Element of a Novel Zinc Finger Transcription Factor, IA-1, in Developing Nervous System. J. Biol. Chem.
278: 38991-38997
[Abstract]
[Full Text]
-
Vojtek, A. B., Taylor, J., DeRuiter, S. L., Yu, J.-Y., Figueroa, C., Kwok, R. P. S., Turner, D. L.
(2003). Akt Regulates Basic Helix-Loop-Helix Transcription Factor-Coactivator Complex Formation and Activity during Neuronal Differentiation. Mol. Cell. Biol.
23: 4417-4427
[Abstract]
[Full Text]
-
Suzuki, A., Nakauchi, H., Taniguchi, H.
(2003). Glucagon-like peptide 1 (1-37) converts intestinal epithelial cells into insulin-producing cells. Proc. Natl. Acad. Sci. USA
100: 5034-5039
[Abstract]
[Full Text]
-
Samaras, S. E., Zhao, L., Means, A., Henderson, E., Matsuoka, T.-a., Stein, R.
(2003). The Islet beta Cell-enriched RIPE3b1/Maf Transcription Factor Regulates pdx-1 Expression. J. Biol. Chem.
278: 12263-12270
[Abstract]
[Full Text]
-
Moates, J. M., Nanda, S., Cissell, M. A., Tsai, M.-J., Stein, R.
(2003). BETA2 Activates Transcription From the Upstream Glucokinase Gene Promoter in Islet {beta}-Cells and Gut Endocrine Cells. Diabetes
52: 403-408
[Abstract]
[Full Text]
-
Vernon, A. E., Devine, C., Philpott, A.
(2003). The cdk inhibitor p27Xic1 is required for differentiation of primary neurones in Xenopus. Development
130: 85-92
[Abstract]
[Full Text]
-
Hu, Y., Ippolito, J. E., Garabedian, E. M., Humphrey, P. A., Gordon, J. I.
(2002). Molecular Characterization of a Metastatic Neuroendocrine Cell Cancer Arising in the Prostates of Transgenic Mice. J. Biol. Chem.
277: 44462-44474
[Abstract]
[Full Text]
-
Heremans, Y., Van De Casteele, M., in't Veld, P., Gradwohl, G., Serup, P., Madsen, O., Pipeleers, D., Heimberg, H.
(2002). Recapitulation of embryonic neuroendocrine differentiation in adult human pancreatic duct cells expressing neurogenin 3. JCB
159: 303-312
[Abstract]
[Full Text]
-
Lee, C. S., Perreault, N., Brestelli, J. E., Kaestner, K. H.
(2002). Neurogenin 3 is essential for the proper specification of gastric enteroendocrine cells and the maintenance of gastric epithelial cell identity. Genes Dev.
16: 1488-1497
[Abstract]
[Full Text]
-
Kim, J.-W., Seghers, V., Cho, J.-H., Kang, Y., Kim, S., Ryu, Y., Baek, K., Aguilar-Bryan, L., Lee, Y.-D., Bryan, J., Suh-Kim, H.
(2002). Transactivation of the Mouse Sulfonylurea Receptor I Gene by BETA2/NeuroD. Mol. Endocrinol.
16: 1097-1107
[Abstract]
[Full Text]
-
Parras, C. M., Schuurmans, C., Scardigli, R., Kim, J., Anderson, D. J., Guillemot, F.
(2002). Divergent functions of the proneural genes Mash1 and Ngn2 in the specification of neuronal subtype identity. Genes Dev.
16: 324-338
[Abstract]
[Full Text]
-
Abderrahmani, A., Steinmann, M., Plaisance, V., Niederhauser, G., Haefliger, J.-A., Mooser, V., Bonny, C., Nicod, P., Waeber, G.
(2001). The Transcriptional Repressor REST Determines the Cell-Specific Expression of the Human MAPK8IP1 Gene Encoding IB1 (JIP-1). Mol. Cell. Biol.
21: 7256-7267
[Abstract]
[Full Text]
-
Nakamura, T., Kishi, A., Nishio, Y., Maegawa, H., Egawa, K., Wong, N. C. W., Kojima, H., Fujimiya, M., Arai, R., Kashiwagi, A., Kikkawa, R.
(2001). Insulin Production in a Neuroectodermal Tumor that Expresses Islet Factor-1, But Not Pancreatic-Duodenal Homeobox 1. J. Clin. Endocrinol. Metab.
86: 1795-1800
[Abstract]
[Full Text]
-
Deutsch, G, Jung, J, Zheng, M, Lora, J, Zaret, K.
(2001). A bipotential precursor population for pancreas and liver within the embryonic endoderm. Development
128: 871-881
[Abstract]
-
Liu, M., Pereira, F. A., Price, S. D., Chu, M.-j., Shope, C., Himes, D., Eatock, R. A., Brownell, W. E., Lysakowski, A., Tsai, M.-J.
(2000). Essential role of BETA2/NeuroD1 in development of the vestibular and auditory systems. Genes Dev.
14: 2839-2854
[Abstract]
[Full Text]
-
Schwitzgebel, V., Scheel, D., Conners, J., Kalamaras, J, Lee, J., Anderson, D., Sussel, L, Johnson, J., German, M.
(2000). Expression of neurogenin3 reveals an islet cell precursor population in the pancreas. Development
127: 3533-3542
[Abstract]
-
Smith, S. B., Watada, H., Scheel, D. W., Mrejen, C., German, M. S.
(2000). Autoregulation and Maturity Onset Diabetes of the Young Transcription Factors Control the Human PAX4 Promoter. J. Biol. Chem.
275: 36910-36919
[Abstract]
[Full Text]