Previous Article | Next Article 
Molecular and Cellular Biology, January 2001, p. 16-25, Vol. 21, No. 1
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.1.16-25.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
The Sko1p Repressor and Gcn4p Activator
Antagonistically Modulate Stress-Regulated Transcription in
Saccharomyces cerevisiae
Amparo
Pascual-Ahuir,
Ramón
Serrano, and
Markus
Proft*
Instituto de Biología Molecular y
Celular de Plantas, Universidad Politécnica de Valencia-CSIC,
46022 Valencia, Spain
Received 10 July 2000/Returned for modification 30 August
2000/Accepted 6 October 2000
 |
ABSTRACT |
In the transcriptional response of Saccharomyces
cerevisiae to stress, both activators and repressors are
implicated. Here we demonstrate that the ion homeostasis determinant,
HAL1, is regulated by two antagonistically operating bZIP
transcription factors, the Sko1p repressor and the Gcn4p activator. A
single CRE-like sequence (CREHAL1) at position
222 to
215 with the palindromic core sequence TTACGTAA
is essential for stress-induced expression of HAL1.
Down-regulation of HAL1 under normal growth conditions
requires specific binding of Sko1p to CREHAL1 and the corepressor gene SSN6. Release from this repression
depends on the function of the high-osmolarity glycerol pathway. The
Gcn4p transcriptional activator binds in vitro to the same
CREHAL1 and is necessary for up-regulated
HAL1 expression in vivo, indicating a dual control
mechanism by a repressor-activator pair occupying the same promoter
target sequence. gcn4 mutants display a strong sensitivity
to elevated K+ or Na+ concentrations in the
growth medium. In addition to reduced HAL1 expression, this
sensitivity is explained by the fact that amino acid uptake is
drastically impaired by high Na+ and K+
concentrations in wild-type yeast cells. The reduced amino acid biosynthesis of gcn4 mutants would result in amino acid
deprivation. Together with the induction of HAL1 by amino
acid starvation, these results suggest that salt stress and amino acid
availability are physiologically interconnected.
 |
INTRODUCTION |
The transcriptional response of
cells to stress conditions has two general requirements, a low
expression of defense genes during periods of favorable conditions and
a fast increase of their expression during adverse conditions. A low
abundance of stress gene transcripts can be achieved by repression of
transcription or by the absence or inactivation of positive factors.
The immediate up-regulation of defense genes upon stress, on the other
hand, will require the inactivation of repressors and/or the operation of gene activators. Repression and activation mechanisms have been
implicated in the hyperosmotic and salt stress response of yeast
(15, 43).
The yeast Saccharomyces cerevisiae responds to hyperosmotic
challenge by inducing more than 180 different genes (32,
37). Among the signal transduction pathways contributing to this
adaptive response, the high-osmolarity glycerol (HOG) pathway
(2) plays a dominant role. This osmosensing
mitogen-activated protein (MAP) kinase pathway very rapidly activates
the Hog1p MAP kinase by phosphorylation, leading to its nuclear import
and subsequently to stress gene induction (6, 22, 31, 35).
Additionally, the Ras-cyclic AMP (cAMP)-protein kinase A pathway, which
generally responds to stresses and availability of nutrients (for a
review, see reference 48), plays an important role
in osmotic adaptation (30).
Some mechanisms of transcriptional modulation by these signaling
cascades are beginning to be defined. Depending on the promoter architecture of the osmotic stress-regulated genes, various gene activators like Msn2p, Msn4p, Msn1p, and Hot1p (24, 36, 37, 41) or Crz1p/Hal8p (25, 26, 45) contribute to
various extents to the transcriptional induction.
Other stress defense genes, such as ENA1, show a negative
regulation. The Sko1p repressor has been found to participate in the
transcriptional response by binding a cAMP response element (CRE)-like
promoter sequence. Sko1p is controlled by the HOG pathway (33) and belongs to the bZIP family of transcription
factors that recognize their DNA target sequence via a conserved basic region (16) and dimerize by using the adjacent leucine
zipper domain (21). Apparently, S. cerevisiae
has a set of different transcriptional activators and repressors that
impose specific expression patterns on certain stress defense genes.
The Gcn4p transcriptional activator, another member of the yeast bZIP
family, was originally identified as up-regulating amino acid
biosynthetic genes upon amino acid starvation (reference 12 and references therein). Gcn4p dimers bind to
AP-1 sites located in the upstream control regions of a multitude of
amino acid biosynthetic genes (1, 16) and activate their transcription.
The HAL1 gene plays an important role in maintaining
cellular Na+/K+ ion homeostasis and confers
salt tolerance when overexpressed in yeast cells (9, 38).
HAL1 is induced by osmotic stress (9) via a
derepression mechanism involving the general corepressor Ssn6p/Tup1p
(23). Here we demonstrate that HAL1
transcriptional regulation depends on a single CRE promoter element
that confers repression under normal growth conditions by binding the
Sko1p bZIP repressor and is activated upon hyperosmotic challenge by Gcn4p. Our findings point to a general role of Gcn4p in hyperosmotic stress adaptation and identify HAL1 as a natural target for
the competitive operation of a bZIP repressor-activator pair.
 |
MATERIALS AND METHODS |
Strains and growth conditions.
All the strains of S. cerevisiae used in this work are listed in Table
1. Gene disruptions were made as
described previously (10) and confirmed by genomic PCR.
YPD contained 2% glucose, 2% peptone, and 1% yeast extract.
Synthetic medium (SD) contained 2% glucose, 0.7% yeast nitrogen base
(Difco) without amino acids, 50 mM MES
[2-(N-morpholino)ethanesulfonic acid] adjusted to pH 6 with Tris, and the amino acids and purine and pyrimidine bases required
by the strains. The growth of yeast strains under different osmotic and
salt stress conditions was assayed by spotting dilutions of saturated
cultures onto YPD plates with the indicated concentration of osmotic
agents or salts.
Plasmids.
The HAL1-lacZ fusion plasmid pRS-909
(URA3 2µm) was reported previously (9) and
contains 1,071 bp of the HAL1 promoter fused to
lacZ. The CREHAL1-lacZ plasmid pPY9
and the 2×CREHAL1-lacZ plasmid pPY17 reporter
fusions were constructed by inserting one or two double-stranded
oligonucleotides TCGACGGGAAAAATTACGTAAAGCATCG, respectively
(giving SalI-compatible ends, representing nucleotides
209
to
231 of the HAL1 promoter), into the
CYC1-lacZ fusion pMP206 (33) (URA3 2 µm), which contains 250 bp of the CYC1 upstream control
region without upstream activator sites fused to the lacZ gene. The point-mutated CRE*HAL1-lacZ reporter
(pPY10) was obtained in the same way by inserting
TCGACGGGAAAAATTATTTAAAGCATCG (the 2-base
exchange in the CRE-core sequence is underlined). All plasmids were
confirmed by sequencing. Site-directed mutagenesis of the
HAL1-lacZ fusion plasmid pRS-909 was performed as described previously (14). An internal primer pair was used to
change the TTACGTAA CRE sequence to TTATTTAA to
obtain the HAL1*-lacZ fusion plasmid pPY18, which was
confirmed by sequencing. The ENA1-lacZ fusion plasmid was
pFR70, a kind gift of Alonso Rodríguez-Navarro (7).
Northern blot analysis.
Total RNA was isolated
(3) from YPD-grown yeast cells that were either untreated
or subjected to the indicated salt stress conditions. Approximately 30 µg of RNA per lane was separated in formaldehyde gels and blotted
onto nylon membranes (Hybond-N; Amersham). Radioactively labeled probes
were hybridized in PSE buffer (300 mM sodium phosphate [pH 7.2], 7%
sodium dodecyl sulfate, 1 mM EDTA). The probes used were a 0.8-kb PCR
fragment of almost the entire HAL1 gene amplified from
pRS903 (9), a 3.3-kb PCR fragment spanning the whole
ENA1 gene amplified from plasmid ML80 (a kind gift of Martin
Leube), and PCR fragments representing nucleotides 77 to 706 of
TBP1 and 1 to 1035 of ATR1 amplified from
chromosomal yeast DNA. Signal quantification was carried out using a
Fujifilm BAS-1500 phosphorimager.
Expression and purification of epitope-tagged proteins.
Almost the entire GCN4 open reading frame (lacking the
sequence encoding first five N-terminal amino acids) was cloned by EcoRI-PstI into the pET-28b His tag vector
(Novagen). His-tagged Gcn4 protein was produced in Escherichia
coli BL21, bound to His-bind resin (Novagen), and eluted with 300 mM imidazole-containing buffer. Construction of GST-SKO1 and
purification of glutathione S-transferase (GST)-tagged Sko1p
were described previously (33).
Gel retardation.
The GST-Sko1 fusion protein was tested for
CREHAL1 interaction as described previously
(33). Binding conditions for His-tagged Gcn4 protein and
general conditions of electrophoresis were as described previously
(23). Yeast protein extracts were prepared as in reference
(23). Oligonucleotides representing CREHAL1 and the point-mutated
CRE*HAL1 (the same as that used to construct the
corresponding CREHAL1-lacZ plasmids) were
labeled by filling the SalI protruding ends with Klenow polymerase.
-Galactosidase assay.
Transformed yeast strains were
grown until saturation in SD medium without uracil and then diluted
into YPD. Exponentially growing cells were then directly measured or
subjected to salt stress by adding 0.4 M NaCl (final concentration) for
20 min or transferred to minimal medium for 1 h.
-Galactosidase
activity was determined as described previously (9). All
results presented in this work are mean values for at least three
independent clones measured in duplicate.
Leucine uptake assay.
Exponentially grown cells for
transport studies (either untreated or treated for 2 h with 1 M
NaCl or 200 mM LiCl) were diluted at 10 mg/ml in 50 mM succinate-Tris
buffer (pH 5.5) (either without or with 1 M NaCl or 200 mM LiCl). After
20 min, leucine uptake assays were started by adding
L-[U-14C]leucine (American Radiolabelled
Chemicals, St. Louis, Mo.) to a final concentration of 10 µM
(specific radioactivity, 20 Ci/mol). Measurements were performed as
described elsewhere (49).
 |
RESULTS |
Sko1p is a repressor of HAL1 expression.
The
regulation of HAL1 gene expression has been previously
reported to depend on a repression mechanism occurring on an upstream promoter region, URSHAL1 (
231 to
156)
(23). A database search (MatInspector 34) revealed a
CRE-like sequence at position
222 to
215. To date, only one
transcription factor from S. cerevisiae, Sko1p, has been
described that represses transcription from CRE (28, 33,
50). Therefore, we investigated the role of Sko1p in the
transcriptional control of HAL1. As shown in Fig.
1A, sko1 mutants show
derepressed HAL1 mRNA levels under nonstress conditions as
compared to the wild-type strain, showing that Sko1p is the repressor
acting on the HAL1 promoter. While HAL1
transcription in wild-type cells is induced during osmotic stress (0.4 M NaCl), we observed a constant high level of HAL1 mRNA in
sko1 mutant cells. A very similar result was obtained using
a HAL1-promoter-lacZ fusion (Fig. 1B).
Additionally, we tested a hog1 mutant for repression and
derepression of HAL1-lacZ since genetic data place Sko1p
downstream of Hog1p (33). Accordingly, upon brief
hyperosmotic shock, we did not observe any derepression of
HAL1 (Fig. 1B). The use of a sko1 hog1 double
mutant, which showed very similar high HAL1-lacZ expression
to sko1 single mutants, indicated that the Hog1 MAP kinase
acts through Sko1p on HAL1 expression (Fig. 1B).

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 1.
HAL1 expression is repressed by Sko1p. (A)
Northern analysis of total RNA from the wild type (w.t.) (W303-1A) and
sko1 mutant (MAP19). Cells were subjected to hyperosmotic
stress (0.4 M NaCl) for the indicated times. The TBP1 gene
was used as loading control. The relative HAL1 mRNA level
corrected for the TBP1 control is given below the gels. (B)
Repression-derepression of HAL1-lacZ depends on Sko1p and
Hog1p. HAL1 expression was monitored using a
HAL1-lacZ reporter (pRS-909) transformed in wild-type
(W303-1A) and sko1 (MAP19), hog1 (MAP32), and
hog1 sko1 (MAP33) mutant strains. Transformants were grown
in YPD ( NaCl) or treated for 30 min with 0.4 M NaCl (+NaCl).
|
|
CREHAL1 mediates osmotic stress-dependent
repression by binding Sko1p.
We next asked whether
CREHAL1 is sufficient to mediate the observed
stress-regulation. We therefore inserted CREHAL1 (
231 to
209) into a CYC1-lacZ-based test system. A
single insertion of the 23-base CRE was sufficient to mediate
repression under normal conditions and derepression under hyperosmotic
stress conditions (Fig. 2). A tandem
insertion of CREHAL1 led to a more pronounced
repression of the fusion gene (Fig. 2). A 2-bp exchange in the
CREHAL1 core sequence completely abolished its function, and sko1 mutants failed to repress the fusion gene
through CREHAL1. The same behavior was observed
for ssn6 mutants, confirming the previously reported
dependence of HAL1 on the Ssn6p-Tup1p corepressor complex
(23). The dependence on the HOG pathway was shown by
measuring CRE-driven lacZ expression in a
hog1 mutant strain that was highly repressed under both
nonstress and stress conditions (Fig. 2).

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 2.
CREHAL1 confers repression
dependent on Sko1p and Ssn6p. A CREHAL1-lacZ
reporter was assayed in wild-type (w.t.) (W303-1A) and sko1
(MAP19), hog1 (MAP32), and ssn6 (MAP6) mutant
strains. Growth conditions were the same as in the experiment in Fig.
1B. CRE* refers to the insertion of a point-mutated
CREHAL1, and 2×CRE indicates the tandem
insertion of two CREHAL1 sites. The degree of
expression is given as relative -galactosidase values compared to
the constitutive empty CYC1-lacZ vector, which has a value
of about 1,000 nmol min 1 mg 1 in all the
strains used. Absolute values are accurate to ±10%.
|
|
Using recombinant GST-Sko1p fusion protein, we tested its binding to
CRE
HAL1 (Fig.
3B).
Gel retardation assays demonstrated
a specific GST-Sko1p-CRE complex
that was not observed when the
point-mutated and inactive CRE* probe
was used. Furthermore, using
total-protein extracts from wild-type
yeast cells, a protein-CRE
complex was found that was not detected in
extracts from
sko1 mutant cells (Fig.
3A). Taken together,
our results demonstrate
that repression of
HAL1 occurs
through the Sko1p bZIP repressor
bound to its
CRE
HAL1 recognition site.

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 3.
Sko1p and Gcn4p bind specifically to
CREHAL1. (A) Gel retardation assay using
whole-cell extracts from YPD-grown wild-type (W303-1A) or
sko1 (MAP19) mutant cells. Wild-type
CREHAL1 or the point-mutated
CRE*HAL1 sequence were used as a probe. (B) Gel
retardation assay using bacterially expressed and purified Sko1-GST
protein. Both lanes contain 600 ng of fusion protein incubated with the
wild-type CREHAL1 probe or the point-mutated
CRE*HAL1 probe. (C) Gel retardation assay using
bacterially expressed and purified His-tagged Gcn4 protein. Increasing
amounts of fusion protein (200, 400, 600, and 800 ng) were incubated
with wild-type CREHAL1 probe or the
point-mutated CRE*HAL1 probe. (D) Competition of
Sko1p and Gcn4p for CREHAL1 binding. Bacterially
expressed and purified GST-Sko1 and His-tag-Gcn4 proteins were used in
a gel retardation assay. Numbers indicate nanograms of fusion protein
in the binding reaction using wild-type CREHAL1
probe.
|
|
Gcn4p is an activator of HAL1 expression.
To prove
the importance of the CREHAL1 site for
stress-dependent regulation, we constructed a point-mutated
HAL1-lacZ reporter (designated HAL1*-lacZ) by
changing the TTACGTAA core sequence to TTATTTAA.
HAL1*-lacZ showed low
-galactosidase activities independently of osmotic stress conditions (Fig.
4). Therefore, we concluded that
CREHAL1 did not behave like a pure repressor
element but displayed gene activation properties upon osmotic stress.
Since mutation of CREHAL1 completely abolished
the responsiveness to stress, HAL1 cannot be regulated simply by the loss of Sko1p-mediated repression, implying the operation
of an activator under hyperosmotic stress conditions. Moreover, given
the requirement of an intact CRE site within the HAL1
promoter, this activator should recognize the same
CREHAL1 site. Previously it has been shown that
a single CRE sequence can repress and activate transcription in
artificial promoter fusions (42). The bZIP activator Gcn4p
flexibly recognizes both the so-called AP-1 site (consensus,
TGACTCA) and the CRE site (consensus, TGACGTCA)
(42). Therefore, we investigated the possible role
of Gcn4p as an antagonist to Sko1p at the HAL1 promoter. By
using the recombinant His-tagged Gcn4 protein, we examined whether
Gcn4p (like Sko1p) can bind in vitro to the
CREHAL1 element. As shown in Fig. 3C, we
detected a specific binding of Gcn4p to CREHAL1
that was absent when a point-mutated CRE* probe was used.
Moreover, the binding of Gcn4p and Sko1p to the
CREHAL1 sequence occurs in a competitive manner, as shown in Fig. 3D.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 4.
CREHAL1 function is crucial for
salt stress induction. Wild-type yeast cells (W303-1A) were transformed
with HAL1-lacZ (pRS909, wild-type sequence) or
HAL1*-lacZ (pPY18, HAL1 promoter point mutated in
the CREHAL1 core). -Galactosidase activity
was determined under the growth conditions described in the legend to
Fig. 1B.
|
|
Analysis of
HAL1 mRNA levels revealed that
gcn4
mutants failed to induce
HAL1 transcription upon NaCl shock
(Fig.
5A). Moreover,
the
gcn4
sko1 double mutant showed the same defect, indicating
that
derepressed
HAL1 levels in the absence of Sko1p are due to
Gcn4p-mediated activation. The slightly elevated
HAL1
transcription
in a
gcn4 sko1 double mutant might indicate
the existence of a
minor Gcn4p-independent activation of
HAL1. The dependence on
Gcn4p was also shown by using a
HAL1-lacZ reporter, as illustrated
in Fig.
5C. In turn,
constitutive overexpression of
GCN4 increased
HAL1 transcript levels significantly (data not shown).

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 5.
Gcn4p is involved in salt stress-induced gene
expression. (A) Effect of gcn4 and sko1 on
HAL1 mRNA levels. A Northern blot analysis of total RNA from
wild-type (w.t.) (W303-1A), gcn4 (APA73), and
sko1gcn4 (APA75) cells grown in YPD without salt or treated
for 20 min with 0.4 M NaCl was performed. Relative HAL1 mRNA
levels corrected for the TBP1 loading control are given
below. (B) Effect of gcn4 on ATR1 and
ENA1 expression. A Northern blot analysis of total RNA from
wild-type (w.t.) (W303-1A) and gcn4 (APA73) cells grown as
indicated in panel A was performed. (C) Effect of gcn4 and
sko1 mutations on HAL1-lacZ reporter expression.
HAL1-lacZ expression was assayed in wild-type (w.t.)
(W303-1A), gcn4 (APA73), sko1 (MAP19), and
sko1gcn4 (APA75) strains in the absence (YPD) or presence
(YPD + NaCl) of 0.4 M NaCl or after a shift to minimal medium for
1 h. (D) ENA1-lacZ expression was assayed in wild-type
(w.t.) (W303-1A) and gcn4 (APA73) strains in the absence or
presence of 0.4 M NaCl.
|
|
We also tested the very recently reported CRE-binding activators Aca1p
and Aca2p (
8) for their effect on
HAL1
expression.
However, we did not find a diminished transcriptional
activation
when comparing
aca1 aca2 double mutants with the
wild type by
Northern blot analysis or by the
HAL1-lacZ
reporter assay (data
not
shown).
Sko1p participates in regulating the transcription of the
ENA1 gene from a CRE site that does not display a
palindromic structure
(TGACGTTT) (
33) and
therefore possibly does not fulfill the
optimal binding requirements of
Gcn4p (
42). Accordingly,
ENA1 transcript levels
(Fig.
5B), as well as
ENA1-lacZ expression (Fig.
5D), were
unaffected by mutation of
GCN4. These results also
demonstrate
that the loss of
HAL1 transcriptional induction
in
gcn4 mutants
does not result from a general sensitivity
of
gcn4 cells to salt
stress (see also the following
section).
We next tested whether the conditions that activate Gcn4p also increase
HAL1 expression. We therefore examined
HAL1-lacZ
expression
before and after the switch from rich medium to minimal
medium
containing only the amino acids needed to satisfy the
auxotrophies
(Fig.
5C). By the use of a
GCN4-lacZ fusion, we
confirmed that

-galactosidase production was stimulated by this
treatment. Under
these conditions,
HAL1 was also induced
(Fig.
5C). Moreover, it
was similarly dependent on Gcn4p and Sko1p, as
was found for salt
induction. Gcn4p has been previously shown to
activate the transcription
of
ATR1 (encoding a multidrug
resistance transporter) in response
to amino acid starvation in
cooperation with Yap1p (
4,
17)
from an AP-1-binding site,
TTAGTAA, suggesting a general role
of Gcn4p in stress
resistance. Therefore we also examined
ATR1 expression
levels under salt stress conditions. As shown in Fig.
5B, the
ATR1 transcript, like
HAL1, was induced
severalfold by
NaCl and this induction was absent in a
gcn4 mutant.
gcn4 mutants are sensitive to salt and osmotic
stress.
Our results indicate that the Gcn4p activator plays an
important role in the osmotic induction of putative defense genes like HAL1 and ATR1. Therefore we tested the resistance
of gcn4 mutant cells to osmotic and salt stress. We found
that the lack of GCN4 function decreased the tolerance of
yeast cells to salt (NaCl and KCl) and osmotic (sorbitol) stresses
(Fig. 6). However, stress caused by the
highly toxic Li+ ions did not result in a greater
inhibition than in wild-type cells, but, as described previously
(33), it was improved by deletion of SKO1. It
is clear, however, that the salt and osmotic sensitivities of
gcn4 mutants cannot be explained by reduced HAL1 expression because the observed phenotype is much stronger than in the
case of hal1 mutants, which do not exhibit increased
sensitivity to either sorbitol or KCl (9). Therefore,
GCN4 function must be important for the expression of
additional genes, which become rate limiting for growth under osmotic
stress and especially under salt stress. These unknown genes may also
be regulated by Sko1p, because deletion of this repressor improves the
salt and sorbitol tolerance of gcn4 mutants (Fig. 6).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 6.
gcn4 mutants are sensitive to high
Na+ and K+ concentrations. The growth of mutant
strains sko1 (MAP19), gcn4 (APA73), and
sko1gcn4 (APA75) under salt stress or in high-osmolarity
media is compared with that of wild-type (w.t.) (W303-1A) cells.
|
|
Amino acid uptake is inhibited by Na+.
Given that
Gcn4p is the major transcriptional activator of a multitude of
structural genes involved in amino acid biosynthesis (12),
we examined the physiological connection between salt stress conditions
and intracellular amino acid abundance. One reason for the sensitivity
of gcn4 mutants could be that high Na+ or
K+ concentrations impair amino acid uptake and therefore
reduce intracellular amino acid pools to a critical level. Therefore we
quantified leucine uptake in the absence or presence of salt stress.
Figure 7 shows the results of a typical
leucine uptake assay comparing cells grown in YPD or treated with 1 M
NaCl or 0.2 M LiCl. Both treatments result in a similar growth
inhibition of wild-type cells. In these assays, the uptake rate was
inhibited by more than 90% by Na+ (and K+
[data not shown]), while Li+ treatment did not
significantly affect the transport rate. Identical results were
obtained using salt-adapted cells (>20 h of NaCl treatment [data not
shown]), showing that the observed inhibition is independent of
intracellular adaptation processes. We also measured inhibition of
leucine uptake over a range of Na+ and K+
concentrations and found that as little as 0.4 M NaCl or KCl inhibited
the uptake efficiency significantly (about 40%), in agreement with the
observed growth inhibition of gcn4 mutants by these ion
concentrations (data not shown).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 7.
Leucine uptake is inhibited by NaCl. Yeast wild-type
cells (W303-1A) grown in YPD, YPD plus 1 M NaCl, or YPD plus 200 mM
LiCl were assayed for uptake of 10 µM leucine.
|
|
 |
DISCUSSION |
Here we present evidence for an interplay between the
transcriptional activator and repressor bound at a natural promoter CRE
site as a mechanism of hyperosmotic stress response in yeast cells (a
schematic overview is given in Fig. 8).
The experimental data supporting this model are as follows: (i) the
single HAL1 CRE-like sequence TTACGTAA is
essential for osmotic stress-induced expression of HAL1 and
confers osmotic stress regulation to a heterologous test promoter; (ii)
Sko1p repressor binds specifically to CREHAL1 in
vitro and is necessary for repression of HAL1 transcription
in vivo; and (iii) Gcn4p activator binds specifically to
CREHAL1 in vitro and is necessary for activation
of HAL1 transcription in vivo.
Our findings and the originally reported in vitro binding studies
(28, 50) indicate that the target sequence for Sko1p can
be depicted as T(G/T)ACGT(C/A)A. Suckow and Hollenberg
(47) also identified a CRE sequence matching the
CREHAL1 core as a possible in vivo target of
Sko1p by using a systematic approach based on the use of artificial
CYC1-lacZ reporters. Sko1p plays a dominant role in the
regulation of HAL1 since a sko1 mutant strain
shows highly elevated HAL1 mRNA levels that are no longer increased during salt stress (Fig. 1). Therefore, up-regulation of
HAL1 and ENA1 (and probably other Sko1p target
genes) contributes to the salt resistance phenotype of sko1
mutant cells (33).
However, high HAL1 expression in the absence of Sko1p is not
simply due to the lack of repression but is also due to the operation of an activator. Here we demonstrate that the Gcn4p activator is
essential for the stress-induced expression of HAL1 since
neither gcn4 nor gcn4 sko1 mutants could increase
HAL1 transcription over the basal level upon salt stress
(Fig. 5A and C). In turn, overexpression of GCN4 increases
HAL1 transcript levels (data not shown). Furthermore, we
demonstrate here that Gcn4p (like Sko1p) binds specifically to
the CREHAL1 site in vitro (Fig. 3C and D),
indicating that Gcn4p activates HAL1 expression from
CREHAL1 while Sko1p represses HAL1
from the same site.
Gcn4p, which up-regulates the transcription of at least 40 genes under
amino acid starvation conditions (for a review, see reference
12), is the best-characterized bZIP factor of yeast. Although initial evidence restricted Gcn4p binding specificity to AP-1
sites (1, 11), it has been found that Gcn4p can bind flexibly to AP-1 and CRE sites (42, 46). Therefore, our
results are in perfect agreement with those of in vitro binding assays that qualify CRE sequences as targets for Gcn4p. However, when tested
in artificial promoter hybrids, CRE sites failed to activate transcription significantly in a Gcn4p-dependent manner (8, 47). One reason for this discrepancy could be that the in vivo reporters used previously did not fulfill the steric requirements of
correct Gcn4p binding. This hypothesis is reinforced by X-ray structural data obtained with Gcn4-bZIP peptides bound to either AP-1
or CRE sequences (5, 19), which revealed that binding of
Gcn4p to CRE (but not to AP-1) involves a bending of the target DNA. It
was therefore concluded that the flexibility of natural CRE sites might
be an important determinant for Gcn4p accessibility (19,
47). Here we show that removal of CRE from its HAL1
promoter context inactivates HAL1 induction, as disruption
of GCN4 does. It is very likely that
CREHAL1 is a functional Gcn4p-binding site in
vivo and therefore meets its bending requirements. Also, it is possible
that activation of HAL1 by Gcn4p requires an additional protein(s) that binds to other promoter sequences outside
CREHAL1. From these results, it is clear that
the relevance of a given CRE site for one or another bZIP factor can be
estimated only when the natural promoter environment is experimentally maintained.
HAL1 is the first natural target gene of the antagonistic
Sko1p-Gcn4p pair. The identification of more CRE sites that function in
stress-regulated promoters should reveal more examples of a mechanism
that implies the occupancy of CRE by a negative bZIP factor preventing
transcription, its stress-induced inactivation, and the operation of a
bZIP activator(s) (Fig. 8). This model was originally derived from the
overlapping sequence specificities of Sko1p, Gcn4p, and other bZIP
activators, as well as from the regulation of artificial
CRE-lacZ reporters (50). With HAL1, we have not found evidence for the participation of additional bZIP
transcription factors, at least not under the conditions tested.
However, CRE sites can be regulated very differently depending on their
surrounding promoter sequences (42), and therefore the
relative importance of each bZIP factor might be different in each
specific promoter.
Differential gene regulation by competitive occupancy of either an
activator or a repressor of one or two neighboring promoter elements
has been reported in yeast for some genes. For example, Mig1p repressor
and Mal63p activator compete for binding at two adjacent sites in the
MAL62 promoter (52). Also, expression of some
genes during sporulation depends on the competitive interplay of Sum1p
repressor and Ndt80p activator at middle sporulation elements
(54). Moreover, Mig1p-binding sites also bind activators, and the elimination of Mig1p sites in the SUC2 promoter led
to its inactivation, pointing to the existence of currently
unidentified transcriptional activators competing with Mig1p on glucose
starvation (53).
A functional HOG pathway is absolutely required for the immediate
derepression of HAL1, as well as
CREHAL1-lacZ, upon a sudden increase in
osmolarity (Fig. 1B and 2). Very recently we showed that Sko1p
repressor activity is indeed regulated by direct phosphorylations of
the Hog1 MAP kinase (M. Proft, A. Pascual-Ahuir, E. de Nadal, J. Ariño, R. Serrano, and F. Posas, unpublished data). Additionally,
Gcn4p could be a target of HOG-mediated activation. However, this is
unlikely to play an important role, since in the absence of Sko1p under
normal conditions that do not activate HOG, HAL1 and
CREHAL1-lacZ are largely derepressed.
Therefore we can speculate that osmotic induction of HAL1
implies mainly the inactivation of the Sko1p repressor by Hog1 that is
specifically activated under such conditions. Gcn4p then accounts for
high HAL1 transcription. Under amino acid starvation
conditions, the HOG pathway will not be activated, but Gcn4p levels
will increase by the well-known translational activation mechanism
(13) and thereby will activate HAL1 expression,
probably by competing with Sko1p.
In mammalian cells, various external stimuli lead to the
phosphorylation of the bZIP CRE-binding protein (CREB), which
subsequently triggers changes in gene expression. CREB is one of the
best-characterized stimulus-induced transcription factors, and several
kinases (like protein kinase A, Ca2+-calmodulin-dependent
kinases, MAPKAP kinase 2, which acts downstream of the mammalian Hog1
homolog p38, and RSK1-3) modulate CREB activity by direct
phosphorylation (for a recent review, see reference 44). Interestingly, an important regulatory
mechanism has been established in the mammalian system that implies
that competition between the CREB activator and the induced cAMP early
repressor is necessary for the correct timing of the transcriptional
response to cAMP (for reviews, see references 20 and
40). However, in this case the bZIP repressor ICER
is expressed from an alternative intronic promoter (27).
Gcn4p is the dominant transcriptional activator in the general amino
acid control of S. cerevisiae. A multitude of genes encoding enzymes of distinct amino acid synthesis pathways are induced in a
Gcn4p-dependent manner upon amino acid starvation (for a review, see
reference 12). Here we report a role of Gcn4p in the
salt stress induction of HAL1 and ATR1 (Fig. 5).
Both genes are induced by amino acid starvation and salt stress
(4, 17; also see above), pointing to a common
transcriptional response elicited by both stresses, and this may also
be true for other stress-regulated genes. However, the ATR1
case is different from the regulation we report here for
HAL1. ATR1 is up-regulated by the two activators
Gcn4p and Yap1p, which have a common AP-1 site in the ATR1
promoter (4), while HAL1 differential
expression is achieved by competitive binding of Sko1p repressor and
Gcn4p activator at a CRE site. Gcn4p function seems to be crucial for the adaptation and survival under severe salt stress (1 M NaCl and KCl)
(Fig. 6). This phenotype is the opposite of that reported for the loss
of Sko1p function, which leads to hyperresistance to high
Na+ and Li+ concentrations (33),
again reflecting the antagonistic roles of both transcription factors
in salt stress adaptation.
Having found that a key regulator of general amino acid control also
plays a regulatory role in the expression of genes that are important
during salt challenge, we asked whether salt stress is interconnected
with amino acid starvation. We hypothesized that growth in the presence
of elevated salt concentrations could provoke a starvation situation
for some or all amino acids. Experimentally we provide strong evidence
for this hypothesis, at least at the level of NaCl-dependent inhibition
of amino acid uptake (Fig. 7). Our results are in agreement with those
obtained previously with S. cerevisiae and Candida
membranefaciens, where NaCl inhibited the uptake of several amino
acids (18, 29). Therefore, one important consequence of
salinity stress is the general inhibition of amino acid import. Active
uptake of amino acids depends on the electrochemical proton gradient
generated by the plasma membrane H+-ATPase
(49). High concentrations of Na+ and
K+ would depolarize the yeast plasma membrane through
uptake by the low-affinity monovalent cation system of yeast
(39). This, in turn, would cause an internal amino acid
depletion, which we have actually measured (A. Pascual-Ahuir, J. Calvete, and R. Serrano, unpublished data). This situation is normally
counteracted by activation of GCN4 transcription and
translation and the subsequent up-regulation of amino acid biosynthetic genes.
 |
ACKNOWLEDGMENTS |
We thank Lynne Yenush for critically reading the manuscript.
A.P.-A. is the recipient of a predoctoral grant from the Spanish
government. M.P. is supported by the European TMR program RYPLOS
(ERB-FMRX-CT96-0007).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Instituto de
Biología Molecular y Celular de Plantas, Universidad
Politécnica de Valencia-CSIC, Camino de Vera s/n, 46022 Valencia,
Spain. Phone: 34-96-3877860. Fax: 34-96-3877859. E-mail:
mproft{at}ibmcp.upv.es.
 |
REFERENCES |
| 1.
|
Arndt, K., and G. R. Fink.
1986.
GCN4 protein, a positive transcription factor in yeast, binds general control promoters at all 5' TGACTC 3' sequences.
Proc. Natl. Acad. Sci. USA
83:8516-8520[Abstract/Free Full Text].
|
| 2.
|
Brewster, J. L.,
T. de Valoir,
N. D. Dwyer,
E. Winter, and M. Gustin.
1993.
An osmosensing signal transduction pathway in yeast.
Science
259:1760-1763[Abstract/Free Full Text].
|
| 3.
|
Carlson, M., and D. Botstein.
1982.
Two differentially regulated mRNAs with different 5'-ends encode secreted and intracellular forms of yeast invertase.
Cell
28:145-154[CrossRef][Medline].
|
| 4.
|
Coleman, A. T.,
E. Tseng, and W. S. Moye-Rowley.
1997.
Saccharomyces cerevisiae basic region-leucine zipper protein regulatory networks converge at the ATR1 structural gene.
J. Biol. Chem.
272:23224-23230[Abstract/Free Full Text].
|
| 5.
|
Ellenberger, T. E.,
C. J. Brandl,
K. Struhl, and S. C. Harrison.
1992.
The GCN4 basic region leucine zipper binds DNA as a dimer of uninterrupted -helices: crystal structure of the protein-DNA complex.
Cell
71:1223-1237[CrossRef][Medline].
|
| 6.
|
Ferrigno, P.,
F. Posas,
D. Koepp,
H. Saito, and P. A. Silver.
1998.
Regulated nucleo/cytoplasmic exchange of HOG1 MAPK requires the importin b homologs NMD5 and XPO1.
EMBO J.
17:5606-5614[CrossRef][Medline].
|
| 7.
|
Garciadeblas, B.,
F. Rubio,
F. J. Quintero,
M. A. Bañuelos,
R. Haro, and A. Rodríguez-Navarro.
1993.
Differential expression of two genes encoding isoforms of the ATPase involved in sodium efflux in Saccharomyces cerevisiae.
Mol. Gen. Genet.
236:363-368[CrossRef][Medline].
|
| 8.
|
Garcia-Gimeno, A. M., and K. Struhl.
2000.
Aca1 and Aca2, ATF/CREB activators in Saccharomyces cerevisiae, are important for carbon source utilization but not the response to stress.
Mol. Cell. Biol.
20:4340-4349[Abstract/Free Full Text].
|
| 9.
|
Gaxiola, R.,
I. F. deLarrinoa,
J. M. Villalba, and R. Serrano.
1992.
A novel and conserved salt-induced protein is an important determinant of salt tolerance in yeast.
EMBO J.
11:3157-3164[Medline].
|
| 10.
|
Güldener, U.,
S. Heck,
T. Fiedler,
J. Beinhauer, and J. H. Hegemann.
1996.
A new efficient gene disruption cassette for repeated use in budding yeast.
Nucleic Acids Res.
24:2519-2524[Abstract/Free Full Text].
|
| 11.
|
Hill, D. E.,
I. A. Hope,
J. P. Macke, and K. Struhl.
1986.
Saturation mutagenesis of the yeast his3 regulatory site: requirements for transcriptional induction and for binding by GCN4 activator protein.
Science
234:451-457[Abstract/Free Full Text].
|
| 12.
|
Hinnebusch, A.
1992.
General and pathway-specific regulatory mechanisms controlling the synthesis of amino acid biosynthetic enzymes in S. cerevisiae, p. 319-415.
In
E. W. Jones, J. R. Pringle, and J. R. Broach (ed.), The molecular and cellular biology of the yeast Saccharomyces. Gene expression, vol. II. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 13.
|
Hinnebusch, A.
1997.
Translational regulation of GCN4.
J. Biol. Chem.
272:21661-21664[Free Full Text].
|
| 14.
|
Ho, S. N.,
H. D. Hunt,
R. M. Horton,
J. K. Pullen, and L. R. Pease.
1989.
Site-directed mutagenesis by overlap extension using the polymerase chain reaction.
Gene
77:51-59[CrossRef][Medline].
|
| 15.
|
Hohmann, S.
1997.
Shaping up: the response of yeast to osmotic stress, p. 101-134.
In
S. Hohmann, and W. H. Mager (ed.), Yeast stress responses. R. G. Landes Co., Austin, Tex.
|
| 16.
|
Hope, I. A., and K. Struhl.
1986.
Functional dissection of a eukaryotic transcriptional activator protein, GCN4 of yeast.
Cell
46:885-894[CrossRef][Medline].
|
| 17.
|
Kanazawa, S.,
M. Driscoll, and K. Struhl.
1988.
ATR1, a Saccharomyces cerevisiae gene encoding a transmembrane protein required for aminotriazole resistance.
Mol. Cell. Biol.
8:664-673[Abstract/Free Full Text].
|
| 18.
|
Khaware, R. K.,
D. Jethwaney, and R. Prasad.
1996.
Role of PM-ATPase, amino acid transport and free amino acid pool in the salt stress of Candida membranefaciens.
Biochem. Mol. Biol. Int.
39:421-429[Medline].
|
| 19.
|
König, P., and T. J. Richmond.
1993.
The X-ray structure of GCN4-bZIP bound to ATF/CREB site DNA shows the complex depends on DNA flexibility.
J. Mol. Biol.
233:139-154[CrossRef][Medline].
|
| 20.
|
Lalli, E., and P. Sassone-Corsi.
1994.
Signal transduction and gene regulation: the nuclear response to cAMP.
J. Biol. Chem.
269:17359-17362[Free Full Text].
|
| 21.
|
Landschulz, W. H.,
P. F. Johnson, and S. L. McKnight.
1988.
The leucine zipper: a hypothetical structure common to a new class of DNA binding proteins.
Science
240:1759-1764[Abstract/Free Full Text].
|
| 22.
|
Maeda, T.,
S. M. Wurgler-Murphy, and H. Saito.
1994.
A two-component system that regulates an osmosensing MAP kinase cascade in yeast.
Nature
369:242-245[CrossRef][Medline].
|
| 23.
|
Márquez, J. A.,
A. Pascual-Ahuir,
M. Proft, and R. Serrano.
1998.
The Ssn6-Tup1 repressor complex of Saccharomyces cerevisiae is involved in the osmotic induction of HOG-dependent and -independent genes.
EMBO J.
17:2543-2553[CrossRef][Medline].
|
| 24.
|
Martínez-Pastor, M. T.,
G. Marchler,
C. Schüller,
A. Marchler-Bauer,
H. Ruis, and F. Estruch.
1996.
The Saccharomyces cerevisiae zinc finger proteins Msn2p and Msn4p are required for transcriptional induction through the stress-response element (STRE).
EMBO J.
15:2227-2235[Medline].
|
| 25.
|
Matheos, D. P.,
T. J. Kingsbury,
U. S. Ahsan, and K. W. Cunningham.
1997.
Tcn1p/Crz1p, a calcineurin-dependent transcription factor that differentially regulates gene expression in Saccharomyces cerevisiae.
Genes Dev.
11:3445-3458[Abstract/Free Full Text].
|
| 26.
|
Mendizabal, I.,
G. Rios,
J. M. Mulet,
R. Serrano, and I. F. deLarrinoa.
1998.
Yeast putative transcription factors involved in salt tolerance.
FEBS Lett.
425:323-328[CrossRef][Medline].
|
| 27.
|
Molina, C. A.,
N. S. Foulkes,
E. Lalli, and P. Sassone-Corsi.
1993.
Inducibility and negative autoregulation of CREM: an alternative promoter directs the expression of ICER, an early response repressor.
Cell
75:875-886[CrossRef][Medline].
|
| 28.
|
Nehlin, J. O.,
M. Carlberg, and H. Ronne.
1992.
Yeast SKO1 gene encodes a bZIP protein that binds to the CRE motif and acts as a repressor of transcription.
Nucleic Acids Res.
20:5271-5278[Abstract/Free Full Text].
|
| 29.
|
Norbeck, J., and A. Blomberg.
1998.
Amino acid uptake is strongly affected during exponential growth of Saccharomyces cerevisiae in 0.7 M NaCl medium.
FEMS Microbiol. Lett.
158:121-126[CrossRef][Medline].
|
| 30.
|
Norbeck, J., and A. Blomberg.
2000.
The level of cAMP-dependent protein kinase A activity strongly affects osmotolerance and osmo-instigated gene expression changes in S. cerevisiae.
Yeast
16:121-137[CrossRef][Medline].
|
| 31.
|
Posas, F.,
S. M. Wurgler-Murphy,
T. Maeda,
E. A. Witten,
T. C. Thai, and H. Saito.
1996.
Yeast HOG1 MAP kinase cascade is regulated by a multistep phosphorelay mechanism in the SLN1-YPD1-SSK1 "Two-component" osmosensor.
Cell
86:865-875[CrossRef][Medline].
|
| 32.
|
Posas, F.,
J. R. Chambers,
J. A. Heyman,
J. P. Hoeffler,
E. de Nadal, and J. Ariño.
2000.
The transcriptional response of yeast to saline stress.
J. Biol. Chem.
275:17249-17255[Abstract/Free Full Text].
|
| 33.
|
Proft, M., and R. Serrano.
1999.
Repressors and upstream repressing sequences of the stress-regulated ENA1 gene in S. cerevisiae: bZIP protein Sko1p confers HOG-dependent osmotic regulation.
Mol. Cell. Biol.
19:537-546[Abstract/Free Full Text].
|
| 34.
|
Quandt, K.,
K. Frech,
H. Karas,
E. Wingender, and T. Werner.
1995.
MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data.
Nucleic Acids Res.
23:4878-4884[Abstract/Free Full Text].
|
| 35.
|
Reiser, V.,
H. Ruis, and G. Ammerer.
1999.
Kinase activity-dependent nuclear export opposes stress-induced nuclear accumulation and retention of Hog1 mitogen-activated protein kinase in the budding yeast S. cerevisiae.
Mol. Biol. Cell
10:1147-1161[Abstract/Free Full Text].
|
| 36.
|
Rep, M.,
V. Reiser,
U. Gartner,
J. M. Thevelein,
S. Hohmann,
G. Ammerer, and H. Ruis.
1999.
Osmotic stress-induced gene expression in S. cerevisiae requires Msn1p and the novel nuclear factor Hot1p.
Mol. Cell. Biol.
19:5474-5485[Abstract/Free Full Text].
|
| 37.
|
Rep, M.,
M. Krantz,
J. M. Thevelein, and S. Hohmann.
2000.
The transcriptional response of S. cerevisiae to osmotic shock: Hot1p and Msn2p/Msn4p are required for the induction of subsets of HOG-dependent genes.
J. Biol. Chem.
275:8290-8300[Abstract/Free Full Text].
|
| 38.
|
Rios, G.,
A. Ferrando, and R. Serrano.
1997.
Mechanisms of salt tolerance conferred by overexpression of the HAL1 gene in Saccharomyces cerevisiae.
Yeast
13:515-528[CrossRef][Medline].
|
| 39.
|
Roberts, S. K.,
M. Fischer,
G. K. Dixon, and D. Sanders.
1999.
Divalent cation block of inward currents and low-affinity K+ uptake in Saccharomyces cerevisiae.
J. Bacteriol.
181:291-297[Abstract/Free Full Text].
|
| 40.
|
Sassone-Corsi, P.
1998.
Coupling gene expression to cAMP signalling: role for CREB and CREM.
Int. J. Biochem. Cell Biol.
30:27-38[CrossRef][Medline].
|
| 41.
|
Schmitt, A. P., and K. McEntee.
1996.
Msn2p, a zinc finger DNA-binding protein, is the transcriptional activator of the multistress response in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
93:5777-5782[Abstract/Free Full Text].
|
| 42.
|
Sellers, J. W.,
A. C. Vincent, and K. Struhl.
1990.
Mutations that define the optimal half-site for binding yeast GCN4 activator protein and identify an ATF/CREB-like repressor that recognizes similar DNA sites.
Mol. Cell. Biol.
10:5077-5086[Abstract/Free Full Text].
|
| 43.
| Serrano, R. Halotolerance genes in yeast.
In A. Läuchli and U. Lüttge (ed.), Salinity,
environment, plants, molecules, in press. Kluwer Academic Publishers,
Dordrecht, The Netherlands.
|
| 44.
|
Shaywitz, A. J., and M. E. Greenberg.
1999.
CREB: a stimulus-induced transcription factor activated by a diverse array of extracellular signals.
Annu. Rev. Biochem.
68:821-861[CrossRef][Medline].
|
| 45.
|
Stathopoulos, A. M., and M. S. Cyert.
1997.
Calcineurin acts through the CRZ1/TCN1-encoded transcription factor to regulate gene expression in yeast.
Genes Dev.
11:3432-3444[Abstract/Free Full Text].
|
| 46.
|
Suckow, M.,
B. von Wilcken-Bergmann, and B. Müller-Hill.
1993.
Identification of three residues in the basic region of the bZIP proteins GCN4, C/EBP and TAF-1 that are involved in specific DNA binding.
EMBO J.
12:1193-1200[Medline].
|
| 47.
|
Suckow, M., and C. P. Hollenberg.
1998.
The activation specificities of wild-type and mutant Gcn4p in vivo can be different from the DNA binding specificities of the corresponding bZIP peptides in vitro.
J. Mol. Biol.
276:887-902[CrossRef][Medline].
|
| 48.
|
Thevelein, J. M.
1994.
Signal transduction in yeast.
Yeast
10:1753-1790[CrossRef][Medline].
|
| 49.
|
Vallejo, C. G., and R. Serrano.
1989.
Physiology of mutants with reduced expression of plasma membrane H+-ATPase.
Yeast
5:307-319[CrossRef][Medline].
|
| 50.
|
Vincent, A. C., and K. Struhl.
1992.
ACR1, a yeast ATF/CREB repressor.
Mol. Cell. Biol.
12:5394-5405[Abstract/Free Full Text].
|
| 51.
|
Wallis, J. W.,
G. Chrebet,
G. Brodsky,
M. Rolfe, and R. Rothstein.
1989.
A hyper-recombination mutation in S. cerevisiae identifies a novel eukaryotic topoisomerase.
Cell
58:409-419[CrossRef][Medline].
|
| 52.
|
Wang, J.,
O. Sirenko, and R. Needleman.
1997.
Genomic footprinting of Mig1p in the MAL62 promoter.
J. Biol. Chem.
272:4613-4622[Abstract/Free Full Text].
|
| 53.
|
Wu, J., and R. J. Trumbly.
1998.
Multiple regulatory proteins mediate repression and activation by interaction with the yeast Mig1 binding site.
Yeast
14:985-1000[CrossRef][Medline].
|
| 54.
|
Xie, J.,
M. Pierce,
V. Gailus-Durner,
M. Wagner,
E. Winter, and A. K. Vershon.
1999.
Sum1 and Hst1 repress middle sporulation-specific gene expression during mitosis in Saccharomyces cerevisiae.
EMBO J.
18:6448-6454[CrossRef][Medline].
|
Molecular and Cellular Biology, January 2001, p. 16-25, Vol. 21, No. 1
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.1.16-25.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Pastor, M. M., Proft, M., Pascual-Ahuir, A.
(2009). Mitochondrial Function Is an Inducible Determinant of Osmotic Stress Adaptation in Yeast. J. Biol. Chem.
284: 30307-30317
[Abstract]
[Full Text]
-
Ruiz, A., Arino, J.
(2007). Function and Regulation of the Saccharomyces cerevisiae ENA Sodium ATPase System. Eukaryot Cell
6: 2175-2183
[Full Text]
-
Todeschini, A.-L., Condon, C., Benard, L.
(2006). Sodium-induced GCN4 Expression Controls the Accumulation of the 5' to 3' RNA Degradation Inhibitor, 3'-Phosphoadenosine 5'-Phosphate. J. Biol. Chem.
281: 3276-3282
[Abstract]
[Full Text]
-
Missall, T. A., Moran, J. M., Corbett, J. A., Lodge, J. K.
(2005). Distinct Stress Responses of Two Functional Laccases in Cryptococcus neoformans Are Revealed in the Absence of the Thiol-Specific Antioxidant Tsa1. Eukaryot Cell
4: 202-208
[Abstract]
[Full Text]
-
Narasimhan, J., Staschke, K. A., Wek, R. C.
(2004). Dimerization Is Required for Activation of eIF2 Kinase Gcn2 in Response to Diverse Environmental Stress Conditions. J. Biol. Chem.
279: 22820-22832
[Abstract]
[Full Text]
-
Rodriguez-Hernandez, C. J., Sanchez-Perez, I., Gil-Mascarell, R., Rodriguez-Afonso, A., Torres, A., Perona, R., Murguia, J. R.
(2003). The Immunosuppressant FK506 Uncovers a Positive Regulatory Cross-talk between the Hog1p and Gcn2p Pathways. J. Biol. Chem.
278: 33887-33895
[Abstract]
[Full Text]
-
Greenall, A., Hadcroft, A. P., Malakasi, P., Jones, N., Morgan, B. A., Hoffman, C. S., Whitehall, S. K.
(2002). Role of Fission Yeast Tup1-like Repressors and Prr1 Transcription Factor in Response to Salt Stress. Mol. Biol. Cell
13: 2977-2989
[Abstract]
[Full Text]
-
Hohmann, S.
(2002). Osmotic Stress Signaling and Osmoadaptation in Yeasts. Microbiol. Mol. Biol. Rev.
66: 300-372
[Abstract]
[Full Text]
-
Morillon, A., Benard, L., Springer, M., Lesage, P.
(2002). Differential Effects of Chromatin and Gcn4 on the 50-Fold Range of Expression among Individual Yeast Ty1 Retrotransposons. Mol. Cell. Biol.
22: 2078-2088
[Abstract]
[Full Text]
-
Hinnebusch, A. G., Natarajan, K.
(2002). Gcn4p, a Master Regulator of Gene Expression, Is Controlled at Multiple Levels by Diverse Signals of Starvation and Stress. Eukaryot Cell
1: 22-32
[Full Text]
-
Goossens, A., Dever, T. E., Pascual-Ahuir, A., Serrano, R.
(2001). The Protein Kinase Gcn2p Mediates Sodium Toxicity in Yeast. J. Biol. Chem.
276: 30753-30760
[Abstract]
[Full Text]
-
Pascual-Ahuir, A., Posas, F., Serrano, R., Proft, M.
(2001). Multiple Levels of Control Regulate the Yeast cAMP-response Element-binding Protein Repressor Sko1p in Response to Stress. J. Biol. Chem.
276: 37373-37378
[Abstract]
[Full Text]