Previous Article | Next Article 
Molecular and Cellular Biology, January 2001, p. 209-223, Vol. 21, No. 1
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.1.209-223.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Identification and Characterization of Human
Orthologues to Saccharomyces cerevisiae Upf2 Protein and
Upf3 Protein (Caenorhabditis elegans SMG-4)
Guillaume
Serin,1,2
Anand
Gersappe,1
Jennifer D.
Black,3
Rachel
Aronoff,4 and
Lynne E.
Maquat1,2,*
Department of Cancer
Genetics1 and Department of Experimental
Therapeutics,3 Roswell Park Cancer Institute,
Buffalo, New York 14263; Department of Biochemistry and
Biophysics, School of Medicine and Dentistry, University of
Rochester, Rochester, New York 146422; and
Max-Planck Institute for Medical Research, Molecular
Neuroscience, D-69120 Heidelberg, Germany4
Received 19 May 2000/Returned for modification 17 August
2000/Accepted 19 September 2000
 |
ABSTRACT |
Nonsense-mediated mRNA decay (NMD), also called mRNA surveillance,
is an important pathway used by all organisms that have been tested to
degrade mRNAs that prematurely terminate translation and, as a
consequence, eliminate the production of aberrant proteins that could
be potentially harmful. In mammalian cells, NMD appears to involve
splicing-dependent alterations to mRNA as well as ribosome-associated components of the translational apparatus. To date, human (h) Upf1
protein (p) (hUpf1p), a group 1 RNA helicase named after its
Saccharomyces cerevisiae orthologue that functions in both translation termination and NMD, has been the only factor shown to be
required for NMD in mammalian cells. Here, we describe human orthologues to S. cerevisiae Upf2p and S. cerevisiae Upf3p (Caenorhabditis elegans SMG-4) based
on limited amino acid similarities. The existence of these orthologues
provides evidence for a higher degree of evolutionary conservation of
NMD than previously appreciated. Interestingly, human orthologues to
S. cerevisiae Upf3p (C. elegans SMG-4) derive
from two genes, one of which is X-linked and both of which generate
multiple isoforms due to alternative pre-mRNA splicing. We demonstrate
using immunoprecipitations of epitope-tagged proteins transiently
produced in HeLa cells that hUpf2p interacts with hUpf1p, hUpf3p-X, and
hUpf3p, and we define the domains required for the interactions.
Furthermore, we find by using indirect immunofluorescence that hUpf1p
is detected only in the cytoplasm, hUpf2p is detected primarily in the
cytoplasm, and hUpf3p-X localizes primarily to nuclei. The finding that
hUpf3p-X is a shuttling protein provides additional indication that NMD
has both nuclear and cytoplasmic components.
 |
INTRODUCTION |
The biogenesis of functionally
mature mRNAs in mammalian cells is remarkably involved and inherently
subject to inefficiencies and inaccuracies that result in the
generation of abnormal translational reading frames. Mammalian mRNAs
are transcribed initially as precursors, most of which contain multiple
introns that must be removed by the process of pre-mRNA splicing. If
transcription initiates incorrectly or an intron either fails to be
removed or is removed using one or more abnormal splice sites, then
product mRNA has the potential to harbor a premature termination codon
(PTC) that could derive from an upstream reading frame, a retained
intron, or a shift in the reading frame.
In order to cope with the generation of PTCs and their potential to
result in deleterious proteins that function in new or dominant-negative ways, mammalian cells have evolved a pathway called
nonsense-mediated mRNA decay (NMD) or mRNA surveillance (reviewed in
references 20, 28, 30, 31, and
32). This pathway surveys all translated mRNAs,
whether they be normal or defective, in order to degrade those that
prematurely terminate translation more than 50 to 55 nucleotides (nt)
upstream of the final exon-exon junction (7, 8, 41, 43, 44, 48, 49)
a feature of most PTCs but not most normal termination
codons (34). These and other data indicate that NMD is
mechanistically linked to nuclear pre-mRNA splicing.
Depending on the particular mRNA and its conditions of expression, NMD
can take place in association with nuclei or after export to the
cytoplasm. One unresolved issue of NMD pertains to the precise cellular
site of nucleus-associated NMD that, like cytoplasmic NMD, requires a
process that is experimentally indistinguishable from cytoplasmic
translation. In theory, nucleus-associated NMD could take place either
during mRNA transport from the nucleus to the cytoplasm and depend on
cytoplasmic ribosomes or within the nucleoplasm and depend on nuclear
ribosomes (8, 28, 44, 48, 49). The link between splicing
and NMD exists for both nucleus-associated (7, 8, 44, 48,
49) and cytoplasmic (41) NMD. We have proposed that
the link involves proteins that are deposited by the process of
splicing at or near exon-exon junctions of product mRNA and remain
bound to mRNA long enough to interact with translational factors.
Recent studies using HeLa cell nuclear extracts and cross-linking in
vitro have identified several proteins, including the nuclear
matrix-associated splicing coactivator SRm160, that form a tight
complex at or near exon-exon junctions as a direct consequence of
splicing and remain associated with mRNA after its release from the
spliceosome (26). Thus, evidence now exists that pre-mRNA
splicing can influence mRNp structure. Another unresolved issue of NMD
pertains to how the translational apparatus interacts with
splicing-marked mRNA in a way that elicits NMD.
NMD typifies not only mammalian cells but all cells that have been
examined. trans-acting factors known to be required for NMD
are best understood for Saccharomyces cerevisiae and
Caenorhabditis elegans, which are readily amenable to
genetic analyses. Loss-of-function mutations affecting the S. cerevisiae Upf1 protein (p) (also known as Nam7p, Sal1p, Ifs2p, or
Mof4p), Upf2p (also known as Nmd2p, Isf1p, or Sua1p), Upf3p (also known
as Sua6p), or any one of SMG-1 through SMG-7 of C. elegans
eliminate NMD without general effects on the decay of mRNAs lacking
PTCs (4, 9, 17, 23, 24, 25, 35, 37). In yeast,
polysome-associated mRNAs are substrates for NMD (50).
Consistent with this, all three Upf proteins associate with ribosomes
(3, 4) and Upf1p binds release factors (RFs) 1 and 3 to
enhance translation termination and elicit NMD (11). Upf1p
also forms a complex with Dcp2p (also known as Nmd1p
[11]), a protein required for the mRNA decapping step of
NMD (13). In fact, all three Upf proteins appear to
function in translation termination and monitor translational fidelity
since they interact (18, 19, 46), deleting any single UPF
gene results in a nonsense suppression phenotype (9, 11,
25), and the mof4-1 allele of the UPF1 gene as well
as an upf3-
strain demonstrate increased programmed
1
frameshifting (10, 39). The C. elegans orthologue to S. cerevisiae Upf1p is the phosphoprotein
SMG-2 (35). SMG-4 appears to be the C. elegans
orthologue to S. cerevisiae Upf3p and derives from
alternatively spliced RNA (R. Aronoff, R. Baran, and J. Hodgkin,
unpublished data). SMG-3 appears to be the C. elegans
orthologue to S. cerevisiae Upf2p (S. Kuchma and P. Anderson, personal communication).
Until now, the only Upf-like or SMG-like factor identified for
mammalian cells has been human (h) Upf1p (hUpf1p) (1, 36). hUpf1p is required for NMD in mammalian cells, as evidenced by the
finding that a cysteine in place of an arginine at position 844 (R844C)
within the RNA helicase domain has a dominant-negative effect on the
pathway (42). Despite sequence and, by extrapolation, functional similarities among S. cerevisiae Upf1p, C. elegans SMG-2, and hUpf1p indicating that NMD evolved before most
eukaryotes (1, 25, 35, 36), there may be significant
differences among the three organisms in the factors that elicit NMD.
First, yeast Upf1p has never been reported to be phosphorylated, in
contrast to both SMG-2 (35) and hUpf1p (M. Pal, Y. Ishigaki, E. Nagy, and L. E. Maquat, unpublished data), although
data demonstrating that epitope-tagged Upf1p can migrate as a doublet
in acrylamide (4) suggest that it may be
posttranslationally modified. Second, expression of either yeast Upf1p
in SMG-2 mutant worms or hUpf1p in upf1 mutant
yeast fails to restore NMD (35, 36). Third, even a hybrid
hUpf1p flanked by the extreme N and C termini of yeast Upf1p, which is
capable of binding RFs 1 and 3 and functioning in nonsense suppression
in yeast, fails to function in NMD in yeast (11, 36).
Finally, four of the seven SMG factors are without known orthologues in
either yeast or humans.
Here, we identify and describe human orthologues to S. cerevisae Upf2p and S. cerevisae Upf3p (C. elegans SMG-4). Using comparative genomics and rapid amplification
of cDNA ends (RACE), the results of cDNA analyses indicate that there
is a single human orthologue to S. cerevisae Upf2p, which we
have called hUpf2p. In contrast, there are multiple human orthologues
to S. cerevisae Upf3p (C. elegans SMG-4) that
derive from two separate genes, one of which is X-linked and both of
which produce alternatively spliced RNAs. The full-length versions are
called hUpf3p-X and hUpf3p. Immunoprecipitations of epitope-tagged
proteins transiently produced in HeLa cells demonstrate that hUpf1p,
hUpf2p, hUpf3p-X, and hUpf3p copurify, providing evidence for a role in
NMD. Indirect immunofluorescence assays of protein localization in HeLa
cells reveal that hUpf1p is detected exclusively in the cytoplasm,
hUpf2p is detected primarily in the cytoplasm, and hUpf3p-X is mostly
nuclear. Results of protein shuttling in interspecies heterokaryons
indicate that hUpf3p-X shuttles rapidly between nuclei and the
cytoplasm. Apparent similarities and differences of these proteins in
S. cerevisiae, C. elegans, and humans are discussed.
 |
MATERIALS AND METHODS |
Isolation and sequence analysis of full-length cDNAs.
Two
expressed sequence tags (ESTs; accession no. AA 8120190 and AA 447286)
that appeared to encode different portions of a human orthologue to
S. cerevisiae Upf2p (17) and one EST (accession no. NA 442937) and genomic sequence (accession no. DJ 327A19) that
appeared to encode different human orthologues of S. cerevisiae Upf3p (C. elegans SMG-4) were identified by
using the BLAST algorithm (http://www.ncbi.nlm.nih.gov/BLAST/) and
dbest (nonredundant GenBank plus EMBL plus DDJB plus PDB EST) database.
Primers were generated from these sequences and used to amplify a
HeLa-cell Marathon cDNA library (Clontech) by using the Advantage cDNA
polymerase mix (Clontech) and RACE-PCR. In order to ensure that the
resulting cDNAs harbored an unmutagenized coding region, subsequent
studies were confined to those cDNAs that harbored a coding region
identical to (i) at least two out of three independently amplified
coding regions and (ii) available database sequences.
Epitope-tagged expression plasmids.
pCI-Neo-FLAG-hUPF1 WT,
which encodes wild-type (WT) hUpf1p, has been described
(35a).
To generate pCI-Neo-hUPF3-X WT, the entire coding region of hUPF3-X
cDNA together with 19 nt of 5' untranslated region (UTR) and the two
consecutive termination codons of the 3' UTR were PCR amplified as two
fragments that harbored an overlapping EcoRI site by using
the Advantage cDNA polymerase mix (Clontech) and HeLa-cell
Marathon-Ready cDNA (Clontech). Primers for the 5' fragment of cDNA
consisted of
5'CCCCGCTCGAGTTCAGCGGGGGACGTAGCCATGAAGGAAGAGAAGGAGCACAGGCC 3' (sense; underlined nucleotides constitute the
XhoI site) and 5'
CGCGGATCCTTATCAATCCTTTAATTTGTCCCTTTCTGG 3' (no. 4 antisense). Primers for the 3' fragment consisted of 5'
AGCTAAAGAAGATAGACAGAATTCCAG 3' (sense) and 5'
TTTTCCTTTTGCGGCCGCTTATCACTCCTCTCCTCCTTCTTTTCTATGGC 3'
(antisense; underlined nucleotides constitute the NotI
site). The 5' fragment was cleaved with XhoI and
EcoRI, the 3' fragment was cleaved with EcoRI and
NotI, and both were inserted simultaneously into the
XhoI and NotI sites of pCI-Neo DNA. All
PCR-generated clones were sequenced in their entirety. Regions
harboring one or more mutated nucleotides were replaced with regions
harboring the corresponding WT nucleotides by subcloning. Sequencing
was used to confirm that the final construct was WT.
To generate pCI-Neo-hUPF2 WT, the entire coding region of hUPF2 cDNA
together with 19 nt of 5' UTR and the 3' UTR termination
codon were
similarly inserted into pCI-Neo after PCR amplification
using primers
5' CCCCG
CTCGAGGCTGATTGTCCTGGGTCACATAATGCCAG 3'
(sense)
and 5' CAAATAACATAGTCTTTCACTTCTTGGTCC 3' (no.
9 antisense) to
generate the 5' fragment, primers 5'
CCCCGCTCGAGGCATGCACCCTGCTGGAGACATGTGGACCG
3' (sense) and 5'
GGGAAGATCTTA
GCGGCCGCTCATTACCTCAGATTCTCTTCATCGG
3'
(antisense) to generate the middle fragment, and primers 5'
GGCAGGTACAAGACTTGGAACGAG 3' (sense) and 5'
ACTAAAGGGAA
GCGGCCGCTCAACGTCTCCTCCCACCAGTC
3'
(antisense) to generate the 3'
fragment.
The resulting expression vectors were modified so as to produce
amino-terminal-tagged HA-hUpf3p-X and T7-hUpf2p. Sequences
encoding the
hemagglutinin (HA) epitope were inserted as an
XhoI-
and
EcoRI-cleaved PCR product that was synthesized using
primers
5'
CCCCCG
CTCGAGTTCAGCGGGGGACGTAGCCATGTACCCATACGACGTAAAAGACTACGCTAAGGAAGAGAAGGAGCACAGGCC
3' (HA sense) and no. 4 antisense. Sequences encoding the T7
epitope
were inserted as an
XhoI- and
EcoRV-cleaved PCR product that was
synthesized using primers
5'
CCCCGA
CTCGAGGCTGATTGTCCTGGGTCACATAATGGCTAGCATGACTGGTGGACAGCAAATGGGTCCAGCTGAGCGTAAAAAGCCAGC
3' (T7 sense) and no. 9
antisense.
pCI-Neo-hUPF3-X NES 3A, in which amino acids 54 to 58 were changed from
VVIRRL to AVARRA, and pCI-Neo-hUPF3-X YVF

DVD, in
which amino acids
117 to 119 were changed from YVF to DVD, were
generated using
overlap-extension PCR (
21). For NES 3A, pCI-Neo-hUPF3-X
WT
was amplified using overlapping primers 5'
AGCAAGG
CGGTA
GCTCGAAGA
GCACCTCCCACTTTGACCAAGGAGCAGCTTCAGG
3' (sense; in which mutagenic nucleotides are italicized) and
5'
GGGAGGT
GCTCTTCGA
GCTACC
GCCTTGCTCAGCGCTTCTTTCTTCTCCTTGTTGCG
3'
(antisense) and, as flanking primers, HA sense and no. 4 antisense.
The resulting PCR product was inserted into the
XhoI and
EcoRI
sites of pCI-Neo-hUPF3-X WT. For
YVF

DVD, pCI-Neo-hUPF3-X WT was
amplified using overlapping primers
5' GATGGT
GATGTA
GACCTTGACAATAAAGGTCAGG
3'
(sense) and 5'
GTCAAGG
TCTACAT
CACCATCAAAGCGATCCCTGAACAA 3'
(antisense)
and the HA sense and no. 4 antisense flanking
primers. pCI-Neo-hUPF3-X

(30-255) was generated from pCI-Neo-hUPF-X
WT by digestion with
PpuMI and
EcoRI, Klenow
filling the resulting 5' overhangs, and
circularization so as to create
an in-frame deletion. pCI-Neo-hUPF3-X

(257-483) was similarly
generated except
PpuMI was omitted so
that a nonsense codon
was created at the filled
EcoRI
site.
To generate pCI-Neo-hUPF3 and pCI-Neo-hUPF3

, the entire coding
region plus the termination codon of hUPF3 or hUPF3

cDNA
was PCR
amplified so as to contain 6 nt of 5' UTR that promote
optimal
translation initiation efficiency (reviewed in reference
22) and a herpes simplex virus (HSV) epitope tag
(Novagen) using
the Advantage cDNA polymerase mix and HeLa-cell
Marathon-Ready
cDNA. Primers consisted of 5'
CCCCG
CTCGAGGCCACCATGCAGCCTGAACTCGCTCCAGAGGATCCGGAAGATCTGTCGGCCCTAGAAGTGCAGTTCCACC
3' (sense) and 5'
TTTTCCTTTT
GCGGCCGCTCACTCTGCCTCTTCCCTCTTCTCAGGACC
3'
(antisense). The resulting PCR product was cleaved with
XhoI
and
NotI and inserted into the corresponding
sites of pCI-Neo.
pCI-Neo-hUPF2

(94-133) was generated by overlap-extension PCR using
overlapping primers 5'
TCAAAGAAAAAAGAAGAGGAAGAAGCTTGGGAACGAGACGACTTAAG
3' (sense) and
5' CTTAAATGATGTCGTTCCGAAGCTTCTTCCTCTTCTTTTTTCTTTGATTC
3'
(antisense). pCI-Neo-hUPF2

(526-722) was generated by
digestion
with
XbaI and
Bsu36I followed by Klenow
filling in the resulting
5' overhangs and circularization so as to
create an in-frame deletion.
pCI-Neo-hUpf2p

(711-928) was generated
by digestion with
AflIII
followed by circularization to
create an in-frame deletion. pCI-Neo-hUPF2

(709-1272) and
pCI-Neo-hUPF2

(787-1272) were derived by digestion
with,
respectively,
BstEII and
EcoRI or
AflIII and
EcoRI, Klenow
filling in the resulting
5' overhangs, and circularization to
create a nonsense codon. All
constructs were sequenced to ensure
their
composition.
HeLa-CCL2 cell transfections.
HeLa-CCL2 cells were
propagated in minimal essential medium (MEM) containing 10% fetal
bovine serum (FBS). One day prior to transfection, cells (~3 × 105 to 4 × 105 per 60-mm-diameter dish)
were cultured in antibiotic-free medium containing 10% FBS and, after
reaching 80 or 100% confluency, were transfected using Lipofectamine
PLUS Reagent or Lipofectamine 2000 (Life Technologies, Inc.),
respectively, by following the manufacturer's directions.
RNA purification, Northern blot analysis, and reverse
transcriptase (RT) PCR.
Total-cell RNA was isolated using Trizol
(Life Technologies, Inc.). Poly(A)+ RNA was generated for
Northern blot analysis (49) using the mRNA Isolation Kit
(Dynal, Inc.). Uniformly 32P-labeled probes were
synthesized from pCI-Neo-hUPF2, pCI-Neo-hUPF3-X, and pCI-Neo-hUPF3
using the Prime-a Gene kit (Promega) after cleavage with
XhoI and NotI, which cleave to either side of
each cDNA insert.
Total RNA Panels III and IV (2.5 µg; Clontech) or total HeLa-cell RNA
(2.5 µg) were reverse transcribed for 1 h at 37°C using
500 ng
of random hexamer (Promega) and Superscript II RT (200
U; Life
Technologies) by following the Life Technologies protocol.
The
resulting cDNA was amplified using one-tenth of the RT reaction
mixture, 0.2 mM concentrations of each deoxynucleotide, 5 µCi
of
[

-
32P]dATP (3,000 Ci/mmol; Amersham), 20 pmol (0.4 µM) of each primer,
and 5 U of
Taq DNA polymerase (Life
Technologies). To amplify
hUPF3-X cDNA, the primers consisted of
5' AGCACACGACTACTTCGAGTTCTTCG
3' (sense) and 5'
CGCGGATCTTATCACAGTGTCTCTGGAGTAGATGTCATTTTCTC
3' (antisense). To
amplify hUPF3 cDNA, the primers consisted of
5'
CGCGGATCCTCATTACAGAGTCTCAGGGTTGGCACTGGTCTTCTC 3' (sense) and
5' TGCCAGAGCATACATCAACTTTAAAAACCAAGAGG 3' (antisense).
Primers
for the amplification of G3PDH (glyceraldehyde-3-phosphate
dehydrogenase)
cDNA were commercially available (Clontech).
For every PCR, each
cycle consisted of denaturation for 10 s
at 95°C, annealing for
1 min at 60°C, and extension for 1 min at
72°C for a total of
23 cycles. One-tenth of each PCR mixture was
electrophoresed in
a 10% polyacrylamide gel, and RT-PCR products were
quantitated
by PhosphorImaging (Molecular
Dynamics).
Protein purification, immunoprecipitations, and Western blot
analyses.
HeLa cells (one 60-mm-diameter dish) that had been mock
transfected or transiently transfected with one or more epitope-tagged expression plasmids were rinsed with ice-cold phosphate-buffered saline
(pH 7.4) and subsequently incubated in 600 µl of lysis buffer
(16) (150 mM NaCl, 50 mM Tris-HCl [pH 7.4], and 0.4% NP-40 [Boehringer]) for 30 min at 4°C. The efficiency of tagged protein production was analyzed by Western blotting using either 1 µg
of anti-FLAG (
-FLAG) antibody (M5; Sigma)/ml; 1 µg of
-T7 antibody (Novagen)/ml, 0.5 µg of
-HA antibody (high-affinity rat
antibody; Boehringer)/ml, or 1 µg of
-HSV antibody (Novagen)/ml. Immunoprecipitations were performed at 4°C using 200 µl of lysate and 10 µg of
-T7 antibody (Novagen), 10 µg of
-HA antibody, 10 µg of
-HSV antibody, or 20 µg of purified
-hUpf1p antibody (35a). After 3 h, 30 µl of protein A-Sepharose
(Boehringer; for
-T7 or
-HSV antibodies) or protein G-Sepharose
(Boehringer; for
-FLAG and
-HA antibodies) that had been washed
with lysis buffer were added for 2 h. Immunoprecipitates were then
collected by centrifugation, pellets were washed twice with 1 ml of
lysis buffer without NP-40 to eliminate unbound proteins, and bound proteins were analyzed by Western blotting using antibody to the appropriate epitope tag.
Immunofluorescence microscopy.
HeLa cells were grown in
MEM-
supplemented with 10% FBS, and 5 × 105 to
7 × 105 cells were transiently transfected with 1 to
2 µg or 10 µg of pCI-Neo-FLAG-hUPF1, pCI-Neo-T7-hUPF2, or
pCI-Neo-HA-hUpf3-X using either Lipofectamine PLUS Reagent or
Lipofectamine 2000. After either 24 or 40 h, the cells were seeded
on a 60-mm-diameter dish holding three coverslips and were fixed
(5). Epitope-tagged proteins were localized by indirect
immunofluorescence using
-FLAG,
-T7, or
-HA antibody and
rhodamine-conjugated secondary antibody (Sigma) raised against either
mouse (for
-FLAG or
-T7 antibody) or rat (for
-HA antibody).
For heterokaryon analyses, HeLa cells were transfected and seeded on
coverslips as described above. After 24 h, the medium was
replaced, and the cells were incubated 4 h later in the presence
of 1 × 106 to 2 × 106 mouse NIH 3T3
cells and 50 µg of cycloheximide/ml. After 3 h, the
concentration of cycloheximide was increased to 100 µg/ml. After 30 min, the cells were fused (37) using polyethylene glycol 1500 (Roche Molecular Biochemicals), washed extensively with
phosphate-buffered saline, and incubated for an additional 1 to 2 h in the presence of 100 µg of cycloheximide/ml. Epitope-tagged
proteins were localized as described above. Cells were simultaneously
stained with 5 µg of Hoechst 33258 (Sigma)/ml in order to distinguish
mouse and human nuclei.
Nucleotide sequence accession numbers.
GenBank accession
numbers for nucleotide sequences are as follows: for hUPF2 cDNA,
AF318574; hUPF3 cDNA, AF318575; and hUPF3X cDNA, AF318576.
 |
RESULTS |
Evidence for human orthologues to S. cerevisiae Upf2p
and S. cerevisiae Upf3p (C. elegans
SMG-4).
Two ESTs (accession no. AA 8120190 and AA 447286) that
appeared to encode portions of hUpf2p were obtained by comparing the coding potential in all frames and both directions of cDNA sequences in
the dbest database to S. cerevisiae Upf2p (17,
18) by using the BLAST algorithm. Primers designed from each
EST, RACE-PCR product, and HeLa-cell Marathon-Ready cDNA (Clontech)
were then used to obtain sequences from hUPF2 5' and 3' UTRs and the
complete coding region. The derived cDNA harbored a total of 75 nt of
5' UTR, 3,816 nt of coding region, and 1,810 nt of 3' UTR up to the site of polyadenylation (Fig. 1; data not
shown). Consistent with the derived sum of 5,701 nt, the analysis of
HeLa-cell poly(A)+ RNA by Northern blotting using cDNA
sequences from the coding region indicated that hUPF2 mRNA is ~5.4 kb
(Fig. 2A).


View larger version (162K):
[in this window]
[in a new window]
|
FIG. 1.
Characterization of hUPF2 (A), hUPF3-X (B1), and hUPF3
(C) cDNAs. Nucleotide and deduced amino acid sequences of hUPF2,
hUPF3-X, and hUPF3 cDNAs are numbered at the right. (B1) Vertical lines
in the hUPF3-X nucleotide sequence correspond to exon-exon junctions
deduced from the X-chromosome sequence of PAC clone DJ 327A19.
Underlined sequences correspond to an exon absent in the
fibroblast-derived EST AA071043, suggesting that it is alternatively
spliced. (B2) Exon-intron organization of the hUPF3-X gene. Introns are
represented at one-tenth the scale of the exons. The black box
corresponds to the exon absent from EST AA071043. (C) Underlined
sequences in the hUPF3 nucleotide sequence correspond to the
alternatively spliced exon evident from the analysis of HeLa cell RNA
(see Results).
|
|

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 2.
Analysis of hUPF2, hUPF3-X, and hUPF3 transcripts. (A)
Poly(A)+ RNA from 75 µg of total HeLa-cell RNA was
subject to Northern blotting and probed with coding region sequences
from hUPF2, hUPF3-X, or hUPF3 cDNAs. hUPF2 mRNA migrates at ~5.4 kb,
hUPF3-X mRNA migrates at ~2.4 kb, and hUPF3 mRNAs migrate at ~2.1
and ~2.4 kb. (B) cDNA was generated using total RNA (2.5 µg) from
either the specified human tissue (Clontech) or HeLa cells. hUPF3-X,
hUPF3, and, as a control, G3PDH cDNA were PCR amplified. In order to
assay for exon skipping, hUPF3-X cDNA was amplified from exon 3 to exon 5, and hUPF3 cDNA was
amplified from sequences corresponding to hUPF3-X exon 3 to sequences
corresponding to hUPF3-X exon 5. Partial arrows specify the positions
of PCR primer annealing. The right-most four lanes contain twofold
(hUPF3-X) or threefold (hUPF3 and G3PDH) serial dilutions of HeLa-cell
RNA in order to demonstrate a linear relationship between the amounts
of input cDNA and RT-PCR products. Results are representative of two
independently performed experiments.
|
|
hUPF2 cDNA encodes a 1,272-amino-acid protein having a predicted
molecular mass of 148 kDa and a PI of 5.5. Relative to Upf2p
from
S. cerevisiae and
Saccharomyces pombe, the latter
of which
was deduced from a single intron-less genomic sequence
(accession
no.
Z98974) available in the nr (nonredundant GenBank plus
EMBL plus DDJB plus PDB without EST) database, hUpf2p is, respectively,
22 and 21% identical and 39 and 35% similar (Fig.
3). hUpf2p harbors
two distinctly large
regions that are missing from
S. cerevisiae Upf2p. One
consists of 135 amino acids at the extreme N terminus,
a part of which
(amino acids 94 to 133; Fig.
3) contains sequences
similar to those of
one of the two domains in
S. cerevisiae Upf2p
required for
binding to Upf1p (
18,
19; see below). These
N-terminal
amino acids are also notable for their multiple acidic and
basic
repeats, which, the PROSITE algorithm revealed, contain numerous
regions similar to nuclear localization sequences (NLS). The second
region of hUpf2p that is missing from the
S. cerevisiae
orthologue
consists of amino acids 502 to 567 and is localized in the
middle
of the protein. hUpf2p amino acids 164 to 179 are the most
conserved
among the three species, and the corresponding sequences in
S. cerevisiae Upf2p have been proposed to constitute part of
an NLS
(
17). Also notable is the absence of approximately
30 amino
acids from the C terminus of hUpf2p that correspond to
approximately
half of the acidic repeat of
S. cerevisiae
Upf2p. No functional
property or role has been ascribed to acidic
repeats, which are
shared with numerous nucleolar proteins, including
nucleolin (
14).
Another potentially important
feature of hUpf2p is the FIGEL motif
(amino acids 659 to 663) and
surrounding amino acids extending
from positions 657 to 713, which are
32 and 30% identical and
55 and 53% similar to amino acids contained
in the domain necessary
for the binding of human eIF4A to eIF4GI,
eIF4GII, and related
factors, respectively (
27). Recently,
the corresponding region
in
S. cerevisiae Upf2p(Nmd2p),
eIF4G, and cap binding protein
80 (CBP80) has been named NIC, and the
NIC domain of Upf2p has
been proposed to have a regulatory role by
interacting with the
translation initiation complex similarly to eIF4G
(
2).

View larger version (113K):
[in this window]
[in a new window]
|
FIG. 3.
Comparison of Upf2 proteins from H. sapiens, S. pombe, and S. cerevisiae. Amino
acid sequences are numbered at the right. White-letter amino acids in
black or grey boxes correspond to S. pombe and S. cerevisiae amino acids that are, respectively, identical or
similar to those of H. sapiens. Black-letter amino acids in
grey boxes correspond only to those that are identical or similar
between S. cerevisiae and S. pombe (rather than
to those that are identical or similar to those of H. sapiens). Amino acids underlined with a thin or a thick line
represent S. cerevisiae sequences known to interact with
S. cerevisiae Upf3p or Upf1p, respectively (18,
19). Notably, hUpf2p sequences that constitute the two putative
hUpf1p binding sites derive from the N terminus (broken-line box; amino
acids 94 to 133) and the C terminus (thick underline; amino acids 1085 to 1124 and 1167 to 1194). hUpf2p sequences that constitute the
putative hUpf3p binding site are specified by the thin line, which
signifies the major binding determinant, and the broken line, which
signifies sequences that contribute to binding. Amino acids underlined
with a double line correspond to the putative NLS in S. cerevisiae (17).
|
|
Using similar methodologies and the nr database, an
X-chromosome-derived genomic sequence (accession no. DJ 327A19) that
potentially
encodes portions of the human orthologue to
S. cerevisiae Upf3p
(
C. elegans SMG-4)
(
25; R. Aronoff, R. Baran, and J. Hodgkin,
unpublished data) was obtained. Considering that another hUPF3
gene
also exists (see below), the X-linked DNA was designated
hUPF3-X.
Primers designed from the genomic hUPF3-X sequence, RACE-PCR
product,
and HeLa-cell Marathon-Ready cDNA were used to obtain
a more complete
hUPF3-X cDNA sequence, including 20 nt of 5' UTR,
all 1,449 nt of the
coding region, and 850 nt of 3' UTR up to
the site of polyadenylation.
The cDNA encodes a 483-amino-acid
protein having a predicted molecular
mass of 58 kDa and a PI of
9.5. Consistent with the derived sum of
2,319 nt, hUPF3-X mRNA
is ~2.4 kb (Fig.
2). The hUPF3-X gene consists
of 11 exons spanning
18.9 kbp (Fig.
1). The existence of an hUPF3-X EST
(accession
no. AA 071043) from fibroblasts lacking exon 8 suggests that
hUPF3-X
pre-mRNA could be alternatively spliced to generate two
distinct
mRNAs: one containing exon 8 and the other lacking exon 8 and
encoding a protein that lacks amino acids 270 to 282. In fact,
the
analysis of RT-PCR products that extend from hUPF3-X exon
7 to exon 9 indicate that exon 8 is alternatively spliced in HeLa-cell
RNA so as to
generate approximately equal amounts of exon 8-containing
and exon
8-lacking RNA (data not shown). As would be expected,
the difference of
39 nt was not detectable by Northern blot analysis
(Fig.
2A).
Another EST (accession no. NA 442937) appeared to derive from a gene
different from the hUpf3p-X gene. RACE-PCR product and
HeLa-cell
Marathon-Ready cDNA were used to obtain two hUPF3 cDNAs
that harbored
2,296 and 2,197 nt upstream of the site of polyadenylation.
The sole
difference between the two cDNAs was the presence or
absence of 99 bp,
indicating that the cDNAs derived from alternatively
spliced versions
of a common pre-mRNA. Notably, amino acids 117
to 149 encoded by these
99 bp are similar to all of those encoded
by exon 4 of the hUPF3-X
gene. The isoform containing these 33
amino acids was designated
hUpf3p, and the isoform lacking these
33 amino acids was designated
hUpf3p

. Consistent with the existence
of hUPF3 transcript
alternative splicing, the analysis of HeLa-cell
poly(A)
+
RNA by Northern blotting using sequences from the coding region
of the
2,296-bp cDNA revealed ~2.1- and ~2.4-kb RNA sequences
(Fig.
2A).
Since the difference in size between the two RNAs is
larger than the
alternatively spliced exon, the difference may
reflect additional
differences in, e.g., the transcription start
site or poly(A) tail
length. Currently, there is no evidence for
additional alternative
splicing of hUPF3 transcripts. Proof for
alternative splicing of the
99-nt exon of hUPF3 RNA that resembles
exon 4 of hUPF3-X transcripts
was obtained by analyzing HeLa cell
RNA by using RT-PCR (Fig.
2B;
sequencing data not shown). In fact,
data obtained using RT-PCR
indicate that this exon is alternatively
spliced in every human tissue
examined, albeit with different
efficiencies, depending on the tissue
(Fig.
2B). As would be predicted
from the Northern blot analysis of
hUPF3-X RNA (Fig.
2A), and
consistent with the sequence analysis of
hUPF3-X cDNA, the skipping
of hUPF3-X exon 4 was barely detected in
HeLa cells (Fig.
2B).
Likewise, hUPF3-X exon 4 skipping was either
barely detected or
undetected in each of the human tissues that was
examined (Fig.
2B). The failure to detect hUPF3 sequences similar to
the alternatively
spliced exon 8 of hUPF3-X by either cDNA sequencing
or searching
available EST databases (Fig.
4) exemplifies an additional difference
in the alternative splicing of hUPF3 and hUPF3-X transcripts.

View larger version (84K):
[in this window]
[in a new window]
|
FIG. 4.
Comparison of Upf3-X and hUpf3 proteins from H. sapiens, C. elegans, S. pombe, and S. cerevisiae. (A) Amino acid alignment of hUpf3p-X and hUpf3p
according to the coding potential of hUPF3-X gene exons. Amino acid
sequences are numbered at the left. White-letter amino acids in black
or grey boxes correspond to amino acids that are, respectively,
identical or similar between hUpf3p-X and hUpf3p. STOP, end of the
coding region. Italicized amino acids specify alternatively spliced
exons. (B) Amino acid alignment is provided only for regions that show
significant similarity. White-letter amino acids in black or grey boxes
correspond to amino acids that are, respectively, identical and similar
to those of H. sapiens, and black-letter amino acids in grey
boxes correspond only to amino acids that are identical or similar
among the three other species. Amino acids underlined with a thin line
represent S. cerevisiae sequences shown be required for the
interaction with S. cerevisiae Ufp2p (18). The
region between arrowheads specifies the S. cerevisiae NES
that spans amino acids 88 to 97 (40). (C) Regions
corresponding to putative NES, NLS, or acidic-basic domains are
specified with black, grey, or lined boxes, respectively. The S. cerevisiae Upf2p interacting domain is underlined, and the
broken-line box sets off the region shown in panel B.
|
|
hUPF3 cDNA encodes a 452-amino-acid protein having an estimated
molecular mass of 52 kDa and a PI of 8.9, while hUPF3

cDNA
encodes a
420-amino-acid protein having an estimated molecular
mass of 49 kDa and
a PI of 8.6. Identity and similarity between
hUpf3p and hUpf3p-X are 42 and 60%, respectively. N-terminal amino
acids 38 to 236 are the most
conserved and manifest 86% similarity.
C-terminal amino acids 202 to
453 are considerably more divergent
even though some sequences, e.g.,
those that could comprise one
of several NLS, appear to be conserved.
Remarkably, the C termini
of both proteins are rich in acidic amino
acids (25% for both)
and basic amino acids (27% for hUpf3p and 31%
for hUpf3-X).
A search of the nr database uncovered the UPF3 gene of
S. pombe (YD33), which consists of three exons and two intervening
introns (data not shown). It was not possible to align the entire
amino
acid sequence of hUpf3p-X and hUpf3p to the sequence of
Upf3p(SMG-4) of
C. elegans,
S. pombe, or
S. cerevisiae
due to
the considerable degree of divergence at the C termini. However,
conserved domains, some of which have been shown to be functional
for
S. cerevisiae Upf3p, do exist in hUpf3p-X and hUpf3p (Fig.
4) and include a nuclear export signal (NES; 40) in addition to
sequences required for an interaction with Upf2p (
19).
Using
the PROSITE algorithm, other motifs common to hUpf3p-X, hUpf3p,
and putative orthologues in other species were found to consist
of one
or more putative NLS in all but the
S. pombe orthologue
(Fig.
4). Also, an acidic-basic region was shared by the N termini
of
hUpf2p, hUpf3p, and
C. elegans SMG-4 but not
S. cerevisiae Upf3p (Fig.
4). As was found for hUpf2p, however,
a comparison
of hUpf3p-X or hUpf3 and its orthologues in other
species reveals
that the relative positions of comparable domains
can
vary.
By using the two-hybrid analysis to assay
genetically for interactions between full-length and deletion-bearing
S. cerevisiae proteins, amino acids 1 to 181 of Upf1p and
947 to 1061 of Upf2p
have been shown to be required for the Upf1p-Upf2p
interaction
(
17,
18,
19,
45), and amino acids 564 to 933 of Upf2p
and 78 to 278 of Upf3p have been shown to be required for the
Upf2p-Upf3p interaction (
19). Notably, because two-hybrid
analysis
is performed in the presence of
S. cerevisiae
proteins, either
interaction may be direct or involve bridging by one
or more cellular
proteins. Sequence comparisons of yeast and human
orthologues
indicate that all Upf protein interactions could be
conserved
in mammalian
cells.
Mutations located towards the C-terminal region of hUpf2p and
towards the N-terminal region of hUpf3p-X inhibit the hUpf2p-hUpf3p-X
interaction.
In order to explore the possibility that the human
orthologues interact, WT hUpf2p and WT hUpf3p-X were transiently
coproduced in HeLa cells from cDNA expression vectors as T7- and
HA-tagged proteins, respectively (Fig. 5A and
B). Western blot analysis of total
protein demonstrated that each protein was expressed (Fig. 5D, lane 1).
The findings that T7-hUpf2p was immunoprecipitated with
-HA antibody
and HA-hUpf3p-X was immunoprecipitated with
-T7 antibody (Fig. 5D,
lane 1) indicated that the two proteins interact either directly or
indirectly. In order to define sequences within each protein required
for the interaction, proteins harboring a deletion were produced and
assayed. Results for T7-hUpf2p demonstrated that amino acids 526 to 722 or 1095 to 1272 could be deleted without consequence to the interaction
with HA-hUpf3p-X, whereas deletion of amino acids 711 to 928 eliminated the interaction (Fig. 5D, lanes 6 to 8, 11, and 12).
These results are consistent with predictions made based on the degree
of conservation between yeast and human proteins, considering that
hUpf2p amino acids 761 to 1072 correspond to the domain of
S. cerevisiae Upf2p that interacts with S. cerevisiae hUpf3p (Fig. 3). Results for HA-hUpf3p-X demonstrated
that mutation of either the putative NES (NES 3A; amino acids 53 to 58)
or amino acids 117-119 (YVF
DVD) or deletion of amino acids 30 to 255 eliminated the interaction with T7-hUpf2p, whereas deletion of
amino acids 257 to 483 was of no consequence to the interaction (Fig.
5D, lanes 2 to 5).


View larger version (46K):
[in this window]
[in a new window]
|
FIG. 5.
Characterization of the interaction between hUpf2p
and hUpf3p-X or hUpf3p. (A) Diagram of WT and mutated T7-hUpf2p.
Striped, black, and grey boxes specify, respectively, the T7 epitope
tag, putative hUpf3p binding site, and putative hUpf1p binding sites.
, amino acid deletion. (B) Diagram of WT and mutated HA-hUpf3p-X.
NES, putative NES, the counterpart of which has function in S. cerevisiae Upf2p (40). Striped, black, and grey boxes
specify, respectively, the HA epitope tag, putative NES, and putative
hUpf2p binding site. (C) Diagram of WT HSV-hUpf3p and WT HSV-hUpf3p .
Striped, black, and grey boxes specify, respectively, the HSV epitope
tag, putative NES, and putative hUpf2p binding site. (D) Total proteins
(10 µl of lysate) from 104 HeLa cells that had been
transiently transfected with the specified T7-hUPF2 and HA-hUPF3-X
expression vectors were subjected to Western blot analysis using -T7
or -HA antibody either before or after immunoprecipitation (IP) with
-T7 or -HA antibody as specified. (E and F) Total proteins (10 µl of lysate) from 104 HeLa cells that had been
transiently transfected with the specified T7-hUPF2 and HSV-hUPF3 or
HSV-hUPF3 expression vectors were subjected to Western blot analysis
using -T7 or -HSV antibody either before or after
immunoprecipitation with -T7 antibody as specified. Results typify
three independently performed experiments that, taken as a whole, rule
out the possibility that the absence of an interaction is attributable
to a low expression level of any particular epitope-tagged protein.
|
|
Mutations located towards the C-terminal region of hUpf2p also
inhibit the interaction with hUpf3p and hUpf3p
.
In order to
determine if hUpf2p also interacts with hUpf3p or hUpf3p
, an isoform
hUpf3p generated by alternative splicing, T7-tagged WT hUpf2p, and
HSV-tagged hUpf3p or hUpf3
were transiently coproduced in HeLa cells
(Fig. 5E and F). A priori, while an interaction between hUpf2p and
hUpf3p was predicted, an interaction between hUpf2p and hUpf3p
was
not predicted given that the 33 codons removed by alternative splicing
encode part of the putative Upf2p interaction domain (Fig. 5C). The
results of immunoprecipitations with
-T7 antibody followed by
Western blotting with
-HSV antibody demonstrated that T7-hUpf2p
interacted with both HSV-hUpf3p and HSV-hUpf3p
(Fig. 5E and F, lanes
1). The finding that T7-hUpf2p interacted with HSV-hUpf3p
indicates
that hUpf3p amino acids 117 to 149 are not required for the
interaction. This finding is compatible with the data indicating that
deletion of amino acids 151 to 204 of S. cerevisiae Upf3p
eliminates the interaction with Upf2p (19) provided that
elimination does not depend on the deletion of amino acids 175 to 205, which correspond to hUpf2p amino acids 117 to 147 (Fig. 4). Deletion of
hUpf2p amino acids 711 to 928, 788 to 1272, 710 to 1272, or 711 to 928 together with 1095 to 1272, which were shown to preclude the
interaction with hUpf3p-X (Fig. 5D, lanes 7, 9, 10, and 12), also
precluded an interaction with hUpf3p and hUpf3p
(Fig. 5E and F,
lanes 3, 5, 6, and 8). However, deletion of hUpf2p amino acids 526 to
722 or amino acids 1095 to 1272 did not preclude the interaction with hUpf3p and hUpf3p
(compare Fig. 5D, lanes 6, 8, and 11, and Fig. 5E
and F, lanes 2, 4, and 7), in agreement with results obtained for the
interaction with hUpf3p-X.
Evidence that hUpf1p interacts with hUpf2p.
Considering that
the interaction between Upf2p and Upf3p is conserved between S. cerevisiae and Homo sapiens, it is reasonable to think
that the same would be true of the interaction between Upf2p and Upf1p.
First, the interaction between Upf2p and Upf1p in S. cerevisiae is required for NMD, as analyses of deletion and point
mutations within one or the other of the two proteins have demonstrated
(17, 18, 19, 45). Second, the bipartite nature of the
Upf1p binding site of S. cerevisiae Upf2p, consisting of
amino acids 947 to 985 and 1034 to 1061, appears to be conserved in
hUpf2p as C-terminal amino acids 1085 to 1124 and 1167 to 1194 (Fig.
2). Interestingly, an additional conservation of only the first part of
the bipartite site is present in N-terminal hUpf2p amino acids 94 to
133, which is rich in acidic and basic amino acids (Fig. 2). Relative
to the corresponding S. cerevisiae Upf2p sequences that bind
Upf1p, the N-terminal hUpf2 sequence is 46% similar, while the
C-terminal hUpf2p sequences are 28% similar for the first part and
46% similar for the second part.
In order to test for an interaction between hUpf1p and hUpf2p,
FLAG-tagged WT hUpf1p and T7-tagged WT hUpf2p were transiently
coproduced in HeLa cells. Previous studies have demonstrated that
FLAG-hUpf1p is functional in NMD, binds RNA, and associates with
ribosomes, as does its yeast counterpart (
35a,
40).

-hUpf1p
antibody immunoprecipitated T7-hUpf2p only in cells
that had been
transfected with both FLAG-hUpf1p and T7-hUpf2p
expression vectors
(Fig.
6B, lane 1; data not
shown). Therefore, hUpf1p and hUpf2p
interact, consistent with a role for hUpf2p in NMD. Since

-hUpf1p
antibody reacts with both FLAG-hUpf1p and endogenous HeLa-cell
hUpf1p, the failure to detect the interaction between hUpf1p and
hUpf2p in cells lacking FLAG-hUpf1p (data not shown) probably
indicates that the level of endogenous HeLa-cell hUpf1p is too
low to
allow a detectable interaction with T7-hUpf2p under the
conditions employed. We resorted to using

-hUpf1p antibody
since,
for reasons that may reflect epitope accessibility,

-FLAG
antibody
failed to immunoprecipitate T7-hUpf2p (data not shown).
Similarly,

-T7 antibody failed to immunoprecipitate FLAG-hUpf1p
(data not
shown). Deletion of T7-hUpf2p amino acids 94 to 133 resulted
in
a reproducibly slight weakening of the interaction with FLAG-hUpf1p
(Fig.
6B, lane 4; data not shown), deletion of T7-hUpf2p amino
acids
1095 to 1272 resulted in a reproducibly significant weakening
of the
interaction with FLAG-hUpf1p (Fig.
6, lane 5; data not
shown), and deletion of amino acids 94 to 133 together with 1095
to 1272 precluded the interaction with FLAG-hUpf1p (Fig.
6B, lane
6).
These findings corroborate the importance of T7-hUpf2p amino
acids 94 to 133 for hUpf1p binding but indicate that these amino
acids are less
important for binding than amino acids 1095 to
1272. Deletion of
T7-hUpf2p amino acids 711 to 928, a region important
for hUpf3p-X,
hUpf3p, and hUpf3p

binding (Fig.
5D, lane 7; Fig.
5E and F, lanes
3), was of no consequence to the interaction with
FLAG-hUpf1p (Fig.
6B,
lane 2). This result indicates that the
interaction between hUpf2p and
hUpf1p is independent of the interaction
between hUpf2p and hUpf3p.
Similarly, deletion of T7-hUpf2p amino
acids 526 to 722 was
inconsequential to the interaction with hUpf1p
(Fig.
6B, lane 3).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 6.
hUpf1p and hUpf2p coimmunoprecipitate. (A) Diagrams of
epitope-tagged proteins (here, open inset boxes indicate hUpf1p binding
sites), as well as FLAG-hUpf1p. (B) Total proteins (10 µl of lysate)
from 104 HeLa cells that had been transiently transfected
with the specified combination of FLAG-hUpf1p and either WT or mutated
T7-hUpf2p expression vectors were subjected to Western blot analysis
using -FLAG or -T7 antibody. Immunoprecipitations (IP) with
-hUpf1p antibody were analyzed by Western blotting using -T7
antibody.
|
|
hUpf1p is detected exclusively in the cytoplasm, hUpf2p is detected
primarily in the cytoplasm, and hUpf3p-X is detected primarily in
nuclei.
Insight into protein function often derives from
information on where in the cell the protein resides. To determine the
intracellular location of hUpf1p, hUpf2p, and hUpf3p-X, HeLa
cells were transiently transfected with expression plasmids that
produce FLAG-hUpf1p, T7-hUpf2p, HA-hUpf3p-X, or, as a control,
T7-hnRNP A1. The location of each transiently produced protein was then
determined by indirect immunofluorescence using antibody against
the appropriate epitope tag. None of the antibodies reacted with
mock-transfected cells except for antibody to the T7 epitope tag,
which reacted slightly with nuclei (Fig.
7A, C, and E). T7-hnRNP A1 was detected
exclusively in nuclei (data not shown) as described previously
(37). FLAG-hUpf1p was detected exclusively in the
cytoplasm (Fig. 7B). Endogenous hUpf1p was also found to be cytoplasmic
by Western analysis using an
-hUpf1p antibody that reacts
specifically with hUpf1p (data not shown). Localization of hUpf1p to
the cytoplasm is consistent with its presence in postnuclear
extracts of human Raji and U937 cells (1), its
purification with polysomes and ribosomal subunits (35a),
as well as indirect immunofluorescence studies of human Raji and U937
cells that employed peptide antibodies (1).
Furthermore, S. cerevisiae Upf1p localizes to the cytoplasm
but not the nucleus (3, 4). T7-hUpf2p was detected
primarily in cytoplasm (Fig. 7D). The background of nuclear reactivity
evident in mock-transfected cells (Fig. 7C) precluded our determining
if a smaller fraction of T7-hUpf2p localizes to nuclei. While the
intracellular distribution of S. cerevisiae Upf2p has
never been reported, Upf2p is known to associate with polyribosomes
(4). Moreover, the finding that targeting a
dominant-negative Upf2p variant to nuclei alleviated the inhibition
of NMD suggests that function in NMD is cytoplasmic (17). Notably, cytoplasmic FLAG-hUpf1p and T7-hUpf2p
occasionally appeared concentrated in the vicinity of the nuclear
envelope (e.g., Fig. 7B and D). HA-hUpf3p-X localized
predominantly to nuclei (Fig. 7F). This result was unexpected
given that Upf3p in S. cerevisiae localizes primarily to
the cytoplasm even though it is exported from nuclei to the cytoplasm
by a NES (40).

View larger version (93K):
[in this window]
[in a new window]
|
FIG. 7.
hUpf1p and hUpf2p are primarily cytoplasmic, while
hUpf3p-X is primarily nuclear. HeLa cells were mock transfected (left)
or transiently transfected with FLAG-hUpf1p, T7-hUpf2p, or HA-hUpf3p-X
expression vectors (right) and fixed. The subcellular location of each
protein was determined by indirect immunofluorescence using antibody
against each epitope tag (FLAG [A and B], T7 [C and D], and HA [E
and F]) and an appropriate rhodamine-conjugated secondary antibody.
|
|
To confirm the observations that hUpf3p-X is
primarily nuclear and able to function in association with cytoplasmic
hUpf1p
and hUpf2p, HeLa cells were transiently transfected with the
HA-hUpf3p-X
expression vector or, as a control, the T7-hnRNP
A1 expression
vector, and the cells subsequently fused to mouse NIH 3T3
cells
to form heterokaryons (
33). Before and during
fusion, the cells
were treated with cycloheximide to prevent
additional protein
synthesis. At 2 h postfusion, the cells
were fixed and HA-hUpf3p-X
or T7-hnRNP A1 was localized using
antibody against the appropriate
epitope tag. Human and mouse
nuclei were distinguished using the
dye Hoechst 33458, which stains
intranuclear bodies only in mouse
nuclei (Fig.
8A and
B). T7-hnRNP A1 produced in HeLa
cells prior
to heterokaryon formation was detected within mouse nuclei
of
the heterokaryons and, thus, shuttles as has been reported
previously
(Fig.
8C;
37). Significantly,
HA-hUpf3p-X was also found to
shuttle (Fig.
8D).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 8.
hUpf3p-X shuttles between nuclei and cytoplasm. HeLa
cells were transfected with either the T7-hnRNP A1 (A and C) or
HA-hUpf3p-X (B and D) expression vector. At 24 h posttransfection,
cells were incubated with cycloheximide, subsequently fused with mouse
NIH 3T3 cells using polyethylene glycol to form heterokaryons,
incubated further with cycloheximide, and fixed. Expressed proteins
were localized by indirect immunofluorescence (bottom). Cells were
simultaneously incubated with Hoechst 33258 for differential staining
of human and mouse nuclei (top).
|
|
 |
DISCUSSION |
Until this report, mammalian orthologues to the three S. cerevisiae Upf and seven C. elegans SMG factors known
to be required for NMD consisted solely of hUpf1p (1, 36,
42), which is orthologous to S. cerevisiae Upf1p
(23) and C. elegans SMG-2 (35).
Therefore, our finding of human orthologues to S. cerevisiae Upf2p and S. cerevisiae Upf3p (C. elegans SMG-4)
provides evidence for a higher degree of conservation of the NMD
pathways in yeast, worms, and mammals than was previously appreciated.
Nevertheless, differences between humans and lower eukaryotes became
apparent with the discovery of four human isoforms related to the
single isoform of S. cerevisiae Upf3p and the two isoforms
of C. elegans SMG-4: (i) hUpf3p-X, which derives from an
X-linked gene, (ii) a version of hUpf3p-X that is a product of exon
skipping, (iii) hUpf3p, which derives from a second gene, and (iv) a
version of hUpf3p, called hUpf3p
, that is a product of exon skipping
(Fig. 1 to 4). Notably, C. elegans SMG-4 also derives from
alternatively spliced RNA, but the two resulting isoforms have
different C termini (R. Aronoff, R. Baran, and J. Hodgkin, unpublished
data) in contrast to the isoforms generated by alternative splicing of
hUPF3-X or hUPF3 transcripts. Isoforms of hUpf3p-X, which derive from a
gene containing 10 exons, differ by the presence or absence of exon 8 (Fig. 1; data not shown). While the exonic organization of the hUPF3
gene remains to be determined, hUpf3p
is the result of skipping the
hUPF3 equivalent of hUPF3-X exon 4 (Fig. 1, 2, and 4). Results of
database analyses and RT-PCR (Fig. 2) indicate that there is no hUPF3
mRNA equivalent to the exon-skipped hUPF3-X mRNA, just as there is no
hUPF3-X mRNA equivalent to the exon-skipped hUPF3 mRNA. Differences in
exon skipping together with differences in amino acid sequence are
likely to confer differences in function.
In S. cerevisiae, Upf1p, Upf2p, and Upf3p form a complex
(4, 19, 45, 46). Results of immunoprecipitations using
extracts from HeLa cells that transiently produced different
combinations of epitope-tagged hUpf proteins indicate that hUpf1p
interacts with hUpf2p and hUpf2p interacts with hUpf1p, hUpf3p-X,
hUpf3p, and hUpf3p
(Fig. 5 and 6). In general, hUpf2p amino acids
required for the interaction with hUpf1p and hUpf3p-X and hUpf3p-X and hUpf3p amino acids required for the interaction with hUpf2p correspond to those predicted from the corresponding interaction in S. cerevisiae. However, two observations are particularly worthy of
comment. First, results generated from the analysis of hUpf3p
indicate that amino acids 117 to 149 of hUpf3p are not required for the interaction with hUpf2p (Fig. 5F). Therefore, our results narrow the
interaction site relative to what would be predicted from comparable
studies of S. cerevisiae Upf3p (19). Second, of
the two hUpf2p sites that interact with hUpf1p, amino acids 94 to 133, which comprise the N-terminal site, lack the bipartite nature that
characterizes both amino acids 1085 to 1194, which comprise the
C-terminal site, as well as the corresponding site in S. cerevisiae (Fig. 2). More specifically, the Upf1p-Upf2p
interaction in S. cerevisiae requires Upf2p amino acids 947 to 985 and 1034 to 1061 (19). hUpf2p amino acids 94 to
133, which strikingly resemble only the first portion of the bipartite
domain in Upf2p, contribute less significantly to the interaction with
hUpf2p than amino acids 1085 to 1124 and 1167 to 1194, which
respectively resemble the first and second portions of the bipartite
domain in Upf2p (Fig. 6B).
Genetic and biochemical analyses of C. elegans SMG-2, SMG-3,
and SMG-4, which are orthologous to S. cerevisiae Upf1p,
Upf2p, and Upf3p, respectively (35; S. Kuchma and P. Anderson, personal communication), offer considerable insight into
function considering that smg-3 and smg-4 mutants
are defective in SMG-2 phosphorylation (35). Extrapolating
from these findings, hUpf2p and each of or some combination of
hUpf3p-X, hUpf3p, or hUpf3p
would be expected to affect the
phosphorylation of hUpf1p. Additional evidence for this possibility
derives from the finding that hUpf1p is a phosphoprotein that is
subject to serum-induced phosphorylation by a
phosphotidylinositol-3-kinase-related kinase (35a).
Insight into protein function can often be obtained be information on
intracellular localization. hUpf1p and hUpf2p produced in HeLa cells as
epitope-tagged proteins from transiently introduced expression vectors
were detected primarily if not exclusively in the cytoplasm,
occasionally concentrated near the nuclear envelope (Fig. 7). A
cytoplasmic location is consistent with their putative roles in
translation termination and NMD as well as with the ribosomal association of HeLa-cell hUpf1p (35a) and S. cerevisiae Upf1p, Upf2p, and Upf3p (4). In contrast,
Upf3p-X produced under similar conditions was found primarily in nuclei
(Fig. 7F). hUpf3p-X was also found to shuttle rapidly between nuclei
and cytoplasm (Fig. 8D), making it possible to complex with cytoplasmic
hUpf1p and hUpf2p as results from immunoprecipitations would predict.
Considering that hUpf3p-X, hUpf3p, and hUpf3p
each harbor sequences
corresponding to the NES known to be functional in S. cerevisiae (40) in addition to multiple putative NLS,
hUpf3 and hUpf3
may also shuttle between nuclei and cytoplasm.
S. cerevisiae Upf3p also shuttles between nuclei and
cytoplasm but localizes primarily to the cytoplasm (40).
Notably, the cytoplasmic distribution that typifies Upf3p in S. cerevisiae when expressed from a centromeric plasmid was found to
extend to nuclei when Upf3p was expressed at an eightfold higher level
from a 2µ plasmid (40), indicating that our observed nuclear location of hUpf3p-X could theoretically reflect expression at
abnormal intracellular levels. Countering this idea, hUpf3p-X was
undetectable in the cytoplasm. Furthermore, the cellular location of
hUpf1p is cytoplasmic regardless of whether the protein derives from a
transiently introduced plasmid or the HeLa-cell genome (Fig. 7; data
not shown).
Issues that remain to be resolved include the precise role of each hUpf
protein in translation termination and NMD. It will be of interest to
determine if functional differences exist between the four
alternatively spliced products of the hUPF3-X and hUPF3 genes. It will
also be important to determine if similarity between the
FIGEL-containing domain of hUpf2p and the eIF4A and eIF4AIII binding
site of the eIF4G family of translation initiation factors indicates
that there is a physical connection between translation termination and
mRNA degradation at the 5' end, which appears to be the first
nucleolytic step of NMD (29). However, attempts to
coimmunoprecipitate T7-hUpf2p and HA-eIF4A or HA-eIF4AIII have failed
to detect an interaction (data not shown). Recent studies of S. cerevisiae have demonstrated that Upf1p interacts with Hrp1p, which has been proposed to mark transcripts at so-called downstream sequence elements (15) much as splicing-dependent proteins
have been proposed to mark the exon-exon junctions of mammalian mRNAs (7, 8, 26, 41, 43, 44, 48, 49). Therefore, another issue
to be resolved is the relationship between those hUpf proteins that
shuttle between nuclei and cytoplasm and the splicing-dependent mark,
at least some component(s) of which must also shuttle, considering its
role in not only nucleus-associated NMD but cytoplasmic NMD (41). It will also be of great interest to resolve if
mammalian cells have orthologues to C. elegans SMG-1, SMG-5,
SMG-6, and SMG-7, the first of which appears to be a
phosphotidylinositol-3-kinase-related kinase required for SMG-2
phosphorylation and the rest of which are required for SMG-2
dephosphorylation (35).
 |
ACKNOWLEDGMENTS |
We thank Xiaolei Sun and Mahadeb Pal for reagents, Xiaojie Li,
Saikat Pal, and Deborah Ogden for technical assistance, Javier Cáceres for helpful advice regarding the heterokaryon assays, Javier Cáceres and Adrian Krainer for the T7-hnRNP A1 expression vector, and Nahum Sonenberg for helpful conversations.
This work was supported by Public Health Service Research grants DK
33933 and GM 59614 (L.E.M.), a fellowship from the Association pour la
Recherche sur le Cancer (G.S.), and NCI core grant CA 16056 for support
of the Roswell Park Cell Analysis Facility (J.B.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry and Biophysics, School of Medicine and Dentistry,
University of Rochester, Rochester, NY 14642. Phone: (716) 273-5640. Fax: (716) 271-2683. E-mail:
lynne_maquat{at}urmc.rochester.edu.
 |
REFERENCES |
| 1.
|
Applequist, S. E.,
M. Selg,
C. Raman, and H. M. Jäck.
1997.
Cloning and characterization of HUPF1, a human homolog of the Saccharomyces cerevisiae nonsense mRNA-reducing UPF1 protein.
Nucleic Acids Res.
25:814-821[Abstract/Free Full Text].
|
| 2.
|
Aravind, L., and E. V. Koonin.
2000.
Eukaryote-specific domains in translation initiation factors: implications for translational regulation and evolution of the translational system.
Genome Res.
10:1172-1184[Abstract/Free Full Text].
|
| 3.
|
Atkin, A. L.,
N. Altamura,
P. Leeds, and M. R. Culbertson.
1995.
The majority of yeast UPF1 co-localizes with polyribosomes in the cytoplasm.
Mol. Biol. Cell
6:611-625[Abstract].
|
| 4.
|
Atkin, A. L.,
L. R. Schenkman,
M. Eastham,
J. N. Dahlseid,
M. J. Lelivelt, and M. R. Culbertson.
1997.
Relationship between yeast polyribosomes and Upf proteins required for nonsense mRNA decay.
J. Biol. Chem.
272:22163-22172[Abstract/Free Full Text].
|
| 5.
|
Cáceres, J. F.,
G. R. Screaton, and A. R. Krainer.
1998.
A specific subset of SR proteins shuttles continuously between the nucleus and the cytoplasm.
Genes Dev.
12:55-66[Abstract/Free Full Text].
|
| 6.
|
Cali, B. M.,
S. L. Kuchma,
J. Latham, and P. Anderson.
1999.
smg-7 is required for mRNA surveillance in Caenorhabditis elegans.
Genetics
151:605-616[Abstract/Free Full Text].
|
| 7.
|
Carter, M. S.,
S. Li, and M. F. Wilkinson.
1996.
A splicing-dependent regulatory mechanism that detects translation signals.
EMBO J.
15:5965-5975[Medline].
|
| 8.
|
Cheng, J.,
P. Belgrader,
X. Zhou, and L. E. Maquat.
1994.
Introns are cis effectors of the nonsense-codon-mediated reduction in nuclear mRNA abundance.
Mol. Cell. Biol.
14:6317-6325[Abstract/Free Full Text].
|
| 9.
|
Cui, Y.,
K. W. Hagan,
S. Zhang, and S. W. Peltz.
1995.
Identification and characterization of genes that are required for the accelerated degradation of mRNAs containing a premature translational termination codon.
Genes Dev.
9:423-436[Abstract/Free Full Text].
|
| 10.
|
Cui, Y.,
J. D. Dinman, and S. W. Peltz.
1996.
Mof4-1 is an allele of the UPF1/IFS2 gene which affects both mRNA turnover and 1 ribosomal frameshifting efficiency.
EMBO J.
15:5726-5736[Medline].
|
| 11.
|
Czaplinski, K.,
M. J. Ruiz-Echevarria,
S. V. Paushkin,
X. Han,
Y. Weng,
H. A. Perlick,
H. C. Dietz,
M. D. Ter Avanesyan, and S. W. Peltz.
1998.
The surveillance complex interacts with the translation release factors to enhance termination and degrade aberrant mRNAs.
Genes Dev.
12:1665-1677[Abstract/Free Full Text].
|
| 12.
|
Czaplinski, K.,
Y. Weng,
K. W. Hagan, and S. W. Peltz.
1995.
Purification and characterization of the Upf1 protein: a factor involved in translation and mRNA degradation.
RNA
1:610-623[Abstract].
|
| 13.
|
Dunckley, T., and R. Parker.
1999.
The DCP2 protein is required for mRNA decapping in Saccharomyces cerevisiae and contains a functional MutT motif.
EMBO J.
18:5411-5422[CrossRef][Medline].
|
| 14.
|
Ginisty, H.,
H. Sicard,
B. Roger, and P. Bouvet.
1999.
Structure and functions of nucleolin.
J. Cell Sci.
112:761-772[Abstract].
|
| 15.
|
González, C. I.,
M. J. Ruiz-Echevarría,
S. Vasudevan,
M. F. Henry, and S. W. Peltz.
2000.
The yeast hnRNP-like protein Hrp1/Nab4 marks a transcript for nonsense-mediated mRNA decay.
Mol. Cell
5:489-499[CrossRef][Medline].
|
| 16.
|
Harlow, E., and D. Lane.
1999.
Using antibodies: a laboratory manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 17.
|
He, F., and A. Jacobson.
1995.
Identification of a novel component of the nonsense-mediated mRNA decay pathway by use of an interacting protein screen.
Genes Dev.
9:437-454[Abstract/Free Full Text].
|
| 18.
|
He, F.,
A. H. Brown, and A. Jacobson.
1996.
Interaction between Nmd2p and Upf1p is required for activity but not for dominant-negative inhibition of the nonsense-mediated mRNA decay pathway in yeast.
RNA
2:153-170[Abstract].
|
| 19.
|
He, F.,
A. H. Brown, and A. Jacobson.
1997.
Upf1p, Nmd2p, and Upf3p are interacting components of the yeast nonsense-mediated mRNA decay pathway.
Mol. Cell. Biol.
17:1580-1594[Abstract].
|
| 20.
|
Hentze, M. W., and A. E. Kulozik.
1999.
A perfect message: RNA surveillance and nonsense-mediated decay.
Cell
96:307-310[CrossRef][Medline].
|
| 21.
|
Ho, S. N.,
H. D. Hunt,
R. M. Horton,
J. K. Pullen, and L. R. Pease.
1989.
Site-directed mutagenesis by overlap extension using the polymerase chain reaction.
Gene
77:51-59[CrossRef][Medline].
|
| 22.
|
Kozak, M.
1999.
Initiation of translation in prokaryotes and eukaryotes.
Gene
234:187-208[CrossRef][Medline].
|
| 23.
|
Lee, B. S., and M. R. Culbertson.
1995.
Identification of an additional gene required for eukaryotic nonsense mRNA turnover.
Proc. Natl. Acad. Sci. USA
92:10354-10358[Abstract/Free Full Text].
|
| 24.
|
Leeds, P.,
S. W. Peltz,
A. Jacobson, and M. R. Culbertson.
1991.
The product of the yeast UPF1 gene is required for rapid turnover of mRNAs containing a premature translational termination codon.
Genes Dev.
5:2303-2314[Abstract/Free Full Text].
|
| 25.
|
Leeds, P.,
J. M. Wood,
B. S. Lee, and M. R. Culbertson.
1992.
Gene products that promote mRNA turnover in Saccharomyces cerevisiae.
Mol. Cell. Biol.
12:2165-2177[Abstract/Free Full Text].
|
| 26.
|
Le Hir, H.,
M. J. Moore, and L. E. Maquat.
2000.
Pre-mRNA splicing alters mRNP composition: evidence for a stable association of proteins at exon-exon junctions.
Genes Dev.
14:1098-1108[Abstract/Free Full Text].
|
| 27.
|
Li, Q.,
H. Imataka,
S. Morino,
G. W. Rogers, Jr.,
N. J. Richter-Cook,
W. C. Merrick, and N. Sonenberg.
1999.
Eukaryotic translation initiation factor 4AIII(eIF4AIII) is functionally distinct from eIF4I and eIF4AII.
Mol. Cell. Biol.
19:7336-7346[Abstract/Free Full Text].
|
| 28.
|
Li, S., and M. R. Wilkinson.
1998.
Nonsense surveillance in lymphocytes?
Immunity
8:135-141[CrossRef][Medline].
|
| 29.
|
Lim, S.-K., and L. E. Maquat.
1992.
Human -globin mRNAs that harbor a nonsense codon are degraded in murine erythroid tissues to intermediates that have a 5' cap-like structure.
EMBO J.
11:3271-3278[Medline].
|
| 30.
|
Maquat, L. E.
1995.
When cells stop making sense: effects of nonsense codons on RNA metabolism in vertebrate cells.
RNA
1:453-465[Abstract].
|
| 31.
|
Maquat, L. E.
1996.
Defects in RNA splicing and the consequence of shortened translational reading frames.
Am. J. Hum. Genet.
59:279-286[Medline].
|
| 32.
|
Maquat, L. E.
2000.
Nonsense-mediated RNA decay in mammalian cells: a splicing-dependent means to down-regulate the levels of mRNAs that prematurely terminate translation, p. 849-868.
In
N. Sonenberg, J. W. B. Hershey, and M. B. Mathews (ed.), Translational control of gene expression. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 33.
|
Michael, W. M.,
P. S. Eder, and G. Dreyfuss.
1997.
The K nuclear shuttling domain: a novel signal for nuclear import and nuclear export in the hnRNP K protein.
EMBO J.
16:3587-3598[CrossRef][Medline].
|
| 34.
|
Nagy, E., and L. E. Maquat.
1998.
A rule for termination-codon position within intron-containing genes: when nonsense affects RNA abundance.
Trends Biochem. Sci.
23:198-199[CrossRef][Medline].
|
| 35.
|
Page, M. F.,
B. Carr,
K. R. Anders,
A. Grimson, and P. Anderson.
1999.
SMG-2 is a phosphorylated protein required for mRNA surveillance in Caenorhabditis elegans and related to Upf1p of yeast.
Mol. Cell. Biol.
19:5943-5951[Abstract/Free Full Text].
|
| 35a.
| Pal, M., Y. Ishigaki, E. Nagy, and L. E. Maquat.
Evidence that phosphorylation of human Upf1 protein varies with
intracellular location and is mediated by a wortmannin-sensitive and
rapamycin-sensitive PI 3-kinase-related kinase signaling pathway. RNA,
in press.
|
| 36.
|
Perlick, H. A.,
S. M. Medghalchi,
F. A. Spencer,
R. J. Kendzior, Jr., and H. C. Dietz.
1996.
Mammalian orthologues of a yeast regulator of nonsense transcript stability.
Proc. Natl. Acad. Sci. USA
93:10928-10932[Abstract/Free Full Text].
|
| 37.
|
Piñol-Roma, S., and G. Dreyfuss.
1992.
Shuttling of pre-mRNA binding proteins between nucleus and cytoplasm.
Nature
355:730-732[CrossRef][Medline].
|
| 38.
|
Pulak, R., and P. Anderson.
1993.
mRNA surveillance by the Caenorhabditis elegans smg genes.
Genes Dev.
7:1885-1897[Abstract/Free Full Text].
|
| 39.
|
Ruiz-Echevarria, M. J.,
J. M. Yasenchak,
X. Han,
J. D. Dinman, and S. W. Peltz.
1998.
The Upf3 protein is a component of the surveillance complex that monitors both translation and mRNA turnover and affects viral propagation.
Proc. Natl. Acad. Sci. USA
95:8721-8726[Abstract/Free Full Text].
|
| 40.
|
Shirley, R. L.,
M. J. Lelivelt,
L. R. Schenkman,
J. N. Dahlseid, and M. R. Culbertson.
1998.
A factor required for nonsense-mediated mRNA decay in yeast is exported from the nucleus to the cytoplasm by a nuclear export signal sequence.
J. Cell Sci.
111:3129-3143[Abstract].
|
| 41.
|
Sun, X.,
P. M. Moriarty, and L. E. Maquat.
2000.
Nonsense-mediated decay of glutathione peroxidase 1 mRNA in the cytoplasm is dependent on intron position and not restricted to newly synthesized mRNA.
EMBO J.
19:4734-4744[CrossRef][Medline].
|
| 42.
|
Sun, X.,
H. A. Perlick,
H. C. Dietz, and L. E. Maquat.
1998.
A mutated human homologue to yeast Upf1 protein has a dominant-negative effect on the decay of nonsense-containing mRNAs in mammalian cells.
Proc. Natl. Acad. Sci. USA
95:10009-10014[Abstract/Free Full Text].
|
| 43.
|
Sun, X., and L. E. Maquat.
2000.
mRNA surveillance in mammalian cells: the relationship between introns and translation termination.
RNA
6:1-8[CrossRef][Medline].
|
| 44.
|
Thermann, R.,
G. Neu-Yilik,
A. Deters,
U. Frede,
K. Wehr,
C. Hagemeier,
M. W. Hentze, and A. E. Kulozik.
1998.
Binary specification of nonsense codons by splicing and cytoplasmic translation.
EMBO J.
17:3484-3494[CrossRef][Medline].
|
| 45.
|
Weng, Y.,
K. Czaplinski, and S. W. Peltz.
1996.
Genetic and biochemical characterization of the mutations in the ATPase and helicase regions of Upf1 protein.
Mol. Cell. Biol.
16:5477-5490[Abstract].
|
| 46.
|
Weng, Y.,
K. Czaplinski, and S. W. Peltz.
1996.
Identification and characterization of mutations in the UPF1 gene that affect nonsense suppression and the formation of the Upf protein complex but not mRNA turnover.
Mol. Cell. Biol.
16:5491-5506[Abstract].
|
| 47.
|
Weng, Y.,
K. Czaplinski, and S. W. Peltz.
1998.
ATP is a cofactor of the Upf1 protein that modulates its translation termination and RNA binding activities.
RNA
4:205-214[Abstract].
|
| 48.
|
Zhang, J.,
X. Sun,
Y. Qian,
J. P. LaDuca, and L. E. Maquat.
1998.
At least one intron is required for the nonsense-mediated decay of triosephosphate isomerase mRNA: a possible link between nuclear splicing and cytoplasmic translation.
Mol. Cell. Biol.
18:5272-5283[Abstract/Free Full Text].
|
| 49.
|
Zhang, J.,
X. Sun,
Y. Qian, and L. E. Maquat.
1998.
Intron function in the nonsense-mediated decay of -globin mRNA: indications that pre-mRNA splicing in the nucleus can influence mRNA translation in the cytoplasm.
RNA
4:801-815[Abstract].
|
| 50.
|
Zhang, S.,
E. M. Welch,
K. Hogan,
A. H. Brown,
S. W. Peltz, and A. Jacobson.
1997.
Polysome-associated mRNAs are substrates for the nonsense-mediated mRNA decay pathway in Saccharomyces cerevisiae.
RNA
3:234-244[Abstract].
|
Molecular and Cellular Biology, January 2001, p. 209-223, Vol. 21, No. 1
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.1.209-223.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Stalder, L., Muhlemann, O.
(2009). Processing bodies are not required for mammalian nonsense-mediated mRNA decay. RNA
15: 1265-1273
[Abstract]
[Full Text]
-
Gong, C., Kim, Y. K., Woeller, C. F., Tang, Y., Maquat, L. E.
(2009). SMD and NMD are competitive pathways that contribute to myogenesis: effects on PAX3 and myogenin mRNAs. Genes Dev.
23: 54-66
[Abstract]
[Full Text]
-
Zheng, W., Finkel, J. S., Landers, S. M., Long, R. M., Culbertson, M. R.
(2008). Nonsense-Mediated Decay of ash1 Nonsense Transcripts in Saccharomyces cerevisiae. Genetics
180: 1391-1405
[Abstract]
[Full Text]
-
Takahashi, S., Araki, Y., Ohya, Y., Sakuno, T., Hoshino, S.-I., Kontani, K., Nishina, H., Katada, T.
(2008). Upf1 potentially serves as a RING-related E3 ubiquitin ligase via its association with Upf3 in yeast. RNA
14: 1950-1958
[Abstract]
[Full Text]
-
Saltzman, A. L., Kim, Y. K., Pan, Q., Fagnani, M. M., Maquat, L. E., Blencowe, B. J.
(2008). Regulation of Multiple Core Spliceosomal Proteins by Alternative Splicing-Coupled Nonsense-Mediated mRNA Decay. Mol. Cell. Biol.
28: 4320-4330
[Abstract]
[Full Text]
-
Durand, S., Cougot, N., Mahuteau-Betzer, F., Nguyen, C.-H., Grierson, D. S., Bertrand, E., Tazi, J., Lejeune, F.
(2007). Inhibition of nonsense-mediated mRNA decay (NMD) by a new chemical molecule reveals the dynamic of NMD factors in P-bodies. JCB
178: 1145-1160
[Abstract]
[Full Text]
-
Culbertson, M. R.
(2007). Navigating Without a Road Map. Genetics
177: 1-7
[Full Text]
-
Johns, L., Grimson, A., Kuchma, S. L., Newman, C. L., Anderson, P.
(2007). Caenorhabditis elegans SMG-2 Selectively Marks mRNAs Containing Premature Translation Termination Codons. Mol. Cell. Biol.
27: 5630-5638
[Abstract]
[Full Text]
-
Isken, O., Maquat, L. E.
(2007). Quality control of eukaryotic mRNA: safeguarding cells from abnormal mRNA function. Genes Dev.
21: 1833-3856
[Abstract]
[Full Text]
-
Kunz, J. B., Neu-Yilik, G., Hentze, M. W., Kulozik, A. E., Gehring, N. H.
(2006). Functions of hUpf3a and hUpf3b in nonsense-mediated mRNA decay and translation. RNA
12: 1015-1022
[Abstract]
[Full Text]
-
Wang, W., Cajigas, I. J., Peltz, S. W., Wilkinson, M. F., Gonzalez, C. I.
(2006). Role for Upf2p Phosphorylation in Saccharomyces cerevisiae Nonsense-Mediated mRNA Decay.. Mol. Cell. Biol.
26: 3390-3400
[Abstract]
[Full Text]
-
Wittmann, J., Hol, E. M., Jack, H.-M.
(2006). hUPF2 Silencing Identifies Physiologic Substrates of Mammalian Nonsense-Mediated mRNA Decay. Mol. Cell. Biol.
26: 1272-1287
[Abstract]
[Full Text]
-
Behm-Ansmant, I., Izaurralde, E.
(2006). Quality control of gene expression: a stepwise assembly pathway for the surveillance complex that triggers nonsense-mediated mRNA decay.. Genes Dev.
20: 391-398
[Full Text]
-
Kashima, I., Yamashita, A., Izumi, N., Kataoka, N., Morishita, R., Hoshino, S., Ohno, M., Dreyfuss, G., Ohno, S.
(2006). Binding of a novel SMG-1-Upf1-eRF1-eRF3 complex (SURF) to the exon junction complex triggers Upf1 phosphorylation and nonsense-mediated mRNA decay. Genes Dev.
20: 355-367
[Abstract]
[Full Text]
-
Maquat, L. E.
(2005). Nonsense-mediated mRNA decay in mammals. J. Cell Sci.
118: 1773-1776
[Full Text]
-
Paillusson, A., Hirschi, N., Vallan, C., Azzalin, C. M., Muhlemann, O.
(2005). A GFP-based reporter system to monitor nonsense-mediated mRNA decay. Nucleic Acids Res
33: e54-e54
[Abstract]
[Full Text]
-
Grimson, A., O'Connor, S., Newman, C. L., Anderson, P.
(2004). SMG-1 Is a Phosphatidylinositol Kinase-Related Protein Kinase Required for Nonsense-Mediated mRNA Decay in Caenorhabditis elegans. Mol. Cell. Biol.
24: 7483-7490
[Abstract]
[Full Text]
-
Inacio, A., Silva, A. L., Pinto, J., Ji, X., Morgado, A., Almeida, F., Faustino, P., Lavinha, J., Liebhaber, S. A., Romao, L.
(2004). Nonsense Mutations in Close Proximity to the Initiation Codon Fail to Trigger Full Nonsense-mediated mRNA Decay. J. Biol. Chem.
279: 32170-32180
[Abstract]
[Full Text]
-
Lehner, B., Sanderson, C. M.
(2004). A Protein Interaction Framework for Human mRNA Degradation. Genome Res
14: 1315-1323
[Abstract]
[Full Text]
-
Iborra, F. J., Escargueil, A. E., Kwek, K. Y., Akoulitchev, A., Cook, P. R.
(2004). Molecular cross-talk between the transcription, translation, and nonsense-mediated decay machineries. J. Cell Sci.
117: 899-906
[Abstract]
[Full Text]
-
Kataoka, N., Dreyfuss, G.
(2004). A Simple Whole Cell Lysate System for in Vitro Splicing Reveals a Stepwise Assembly of the Exon-Exon Junction Complex. J. Biol. Chem.
279: 7009-7013
[Abstract]
[Full Text]
-
Kebaara, B., Nazarenus, T., Taylor, R., Forch, A., Atkin, A. L.
(2003). The Upf-dependent decay of wild-type PPR1 mRNA depends on its 5'-UTR and first 92 ORF nucleotides. Nucleic Acids Res
31: 3157-3165
[Abstract]
[Full Text]
-
CHIU, S.-Y., SERIN, G., OHARA, O., MAQUAT, L. E.
(2003). Characterization of human Smg5/7a: A protein with similarities to Caenorhabditis elegans SMG5 and SMG7 that functions in the dephosphorylation of Upf1. RNA
9: 77-87
[Abstract]
[Full Text]
-
Lykke-Andersen, J.
(2002). Identification of a Human Decapping Complex Associated with hUpf Proteins in Nonsense-Mediated Decay. Mol. Cell. Biol.
22: 8114-8121
[Abstract]
[Full Text]
-
Shirley, R. L., Ford, A. S., Richards, M. R., Albertini, M., Culbertson, M. R.
(2002). Nuclear Import of Upf3p Is Mediated by Importin-{alpha}/-{beta} and Export to the Cytoplasm Is Required for a Functional Nonsense-Mediated mRNA Decay Pathway in Yeast. Genetics
161: 1465-1482
[Abstract]
[Full Text]
-
Carastro, L. M., Tan, C.-K., Selg, M., Jack, H.-M., So, A. G., Downey, K. M.
(2002). Identification of delta helicase as the bovine homolog of HUPF1: demonstration of an interaction with the third subunit of DNA polymerase delta. Nucleic Acids Res
30: 2232-2243
[Abstract]
[Full Text]
-
Ochotorena, I. L., Hirata, D., Kominami, K.-i., Potashkin, J., Sahin, F., Wentz-Hunter, K., Gould, K. L., Sato, K., Yoshida, Y., Vardy, L., Toda, T.
(2002). Conserved Wat1/Pop3 WD-repeat protein of fission yeast secures genome stability through microtubule integrity and may be involved in mRNA maturation. J. Cell Sci.
114: 2911-2920
[Abstract]
[Full Text]
-
Wagner, E., Lykke-Andersen, J.
(2002). mRNA surveillance: the perfect persist. J. Cell Sci.
115: 3033-3038
[Abstract]
[Full Text]
-
Wilusz, C. J., Wang, W., Peltz, S. W.
(2001). Curbing the nonsense: the activation and regulation of mRNA surveillance. Genes Dev.
15: 2781-2785
[Full Text]
-
Kim, V. N., Kataoka, N., Dreyfuss, G.
(2001). Role of the Nonsense-Mediated Decay Factor hUpf3 in the Splicing-Dependent Exon-Exon Junction Complex. Science
293: 1832-1836
[Abstract]
[Full Text]
-
Yamashita, A., Ohnishi, T., Kashima, I., Taya, Y., Ohno, S.
(2001). Human SMG-1, a novel phosphatidylinositol 3-kinase-related protein kinase, associates with components of the mRNA surveillance complex and is involved in the regulation of nonsense-mediated mRNA decay. Genes Dev.
15: 2215-2228
[Abstract]
[Full Text]
-
MAQUAT, L.E., SERIN, G.
(2001). Nonsense-mediated mRNA Decay: Insights into Mechanism from the Cellular Abundance of Human Upf1, Upf2, Upf3, and Upf3X Proteins. Cold Spring Harb Symp Quant Biol
66: 313-320
[Abstract]
-
GONZALEZ, C.I., WANG, W., PELTZ, S.W.
(2001). Nonsense-mediated mRNA Decay in Saccharomyces cerevisiae: A Quality Control Mechanism That Degrades Transcripts Harboring Premature Termination Codons. Cold Spring Harb Symp Quant Biol
66: 321-328
[Abstract]