Previous Article | Next Article ![]()
Molecular and Cellular Biology, January 2001, p. 298-309, Vol. 21, No. 1
Division of Hematology, Department of
Medicine, Albert Einstein College of Medicine, Bronx, New
York1; Fred Hutchinson Cancer
Research Center, Seattle, Washington2;
Microbiology Department, Dartmouth Medical School, Hanover,
New Hampshire3; and Department of
Genetics, Yale University School of Medicine, New Haven,
Connecticut4
Received 30 June 2000/Returned for modification 10 August
2000/Accepted 28 September 2000
We have inserted two expression cassettes at tagged reference
chromosomal sites by using recombinase-mediated cassette exchange in
mammalian cells. The three sites of integration displayed either stable
or silencing position effects that were dominant over the different
enhancers present in the cassettes. These position effects were
strongly dependent on the orientation of the construct within the
locus, with one orientation being permissive for expression and the
other being nonpermissive. Orientation-specific silencing, which was
observed at two of the three site tested, was associated with
hypermethylation but not with changes in chromatin structure, as judged
by DNase I hypersensitivity assays. Using CRE recombinase, we were able
to switch in vivo the orientation of the transgenes from the permissive
to the nonpermissive orientation and vice versa. Switching from the
permissive to the nonpermissive orientation led to silencing, but
switching from the nonpermissive to the permissive orientation did not
lead to reactivation of the transgene. Instead, transgene expression
occurred dynamically by transcriptional oscillations, with 10 to 20%
of the cells expressing at any given time. This result suggested that
the cassette had been imprinted (epigenetically tagged) while it was in
the nonpermissive orientation. Methylation analysis revealed that the
methylation state of the inverted cassettes resembled that of silenced
cassettes except that the enhancer had selectively lost some of its
methylation. Sorting of the expressing and nonexpressing cell
populations provided evidence that the transcriptional oscillations of
the epigenetically tagged cassette are associated with changes in the
methylation status of regulatory elements in the transgene. This
suggests that transgene methylation is more dynamic than was previously assumed.
Stably integrated transgenes are
often poorly expressed because of position effects that are caused by
the influence of the site of chromosomal integration (4,
12). In cultured cells, two categories of position effects have
been recognized: stable and silencing (29, 39). Stable
position effects are characterized by pancellular expression of the
transgene (expression in every cell of a given tissue or cell
population) at levels that are dictated by the site of integration and
are different from the expression level of the endogenous gene or of
similar transgenes integrated at other sites. Silencing position
effects are characterized by progressive silencing of the transgene at
a rate characteristic of the site of integration. During the process of
silencing, expression occurs in only a fraction of the cell population
and can therefore be described as heterocellular. Silencing position
effects in cultured cells have some similarity to position effect
variegation (PEV) in Drosophila and mammals (14, 36,
42), which is characterized by clonally inherited silencing of
expression in a fraction of the cells of a given tissue. PEV thereby
results in heterocellular expression of the transgenes. PEV can be
temporally stable, or the proportion of expressing cells can decrease
with the age of the animal (32).
Attempts to overcome position effects have generally focused on
including strong native regulators such as locus control regions (LCRs)
(16) in the transgenic construct or on making the
transgene so large that it is likely to include all the sequences
required to establish its native epigenetic organization (28,
30). However, neither strategy is fully effective, highlighting
the fact that even following years of experimental analysis of
transgenes, the fundamental mechanisms of position effects remain
largely unknown (2). DNA elements called chromatin
insulators have been reported to decrease silencing and variegating
position effects in mammalian cells (7).
The major obstacle to understanding position effects has been the
technical inability to integrate reporter constructs into a defined
genomic locus. To overcome this problem, we have recently developed a
targeting approach that we call recombinase-mediated cassette exchange
(RMCE) (5, 11). RMCE uses site-specific recombinases to
integrate single-copy transgenes without selectable markers into
previously tagged sites in mammalian cells, allowing the sensitive and
accurate dissection of the elements within the transgene that influence
expression and epigenetic organization. In addition, since the RMCE
system used here causes the integration of the transgene in each of the
two possible orientations, we are able to test the effect of this
variable for the first time.
We have previously used RMCE in mouse erythroleukemia (MEL) cells to
study the LCR of the human We have now extended our previous analysis by comparing at three loci
the expression of two cassettes containing different cis-regulatory sequences driving an enhanced green
fluorescence protein (EGFP) reporter gene, integrated in both possible
orientations. We show that each integration site causes distinct EGFP
expression patterns that can be categorized as either stable or
silencing position effects, confirming the critical importance of the
site of integration on the level of transgene expression. Surprisingly, we found that the orientation of the cassette within each site is a
critical determinant of the type of position effect observed. We also
report that silencing of the construct in the nonpermissive orientation
can epigenetically imprint the transgene and that an escape from
repression, leading to transcriptional oscillations, is associated with
changes in methylation at specific sites within the regulatory elements
of the transgenes, suggesting that methylation can be a more dynamic
DNA modification than has previously been assumed.
Plasmids.
Plasmid construction was performed by standard
methods. The sequences of all plasmids are available on request.
Plasmid pL1HYTK1L was described previously (11). Plasmid
L1CMVEGFP1L contains a NheI-NotI fragment from
pEGFP-N1 (Clontech, Palo Alto, Calif.) cloned between the L1 and 1L
LoxP511 sites of pL1HYTK1L. Plasmid L1234EGFP1L contains HS4
(HUMHBB positions 951 to 2199), HS3 (HUMHBB positions 4273 to 5122),
HS2 (HUMHBB positions 7764 to 9172), and the Cell culture and transfections.
Cell culture and
transfections were performed as described previously (11).
Induction of differentiation with 2% dimethyl sulfoxide (DMSO) for 5 days resulted in 70 to 95% benzidine positivity depending on the clones.
Creation of the reference loci.
Loci RL4, RL5, and RL6 were
created by transfecting 10 µg of a BspHI fragment of
plasmid pL1HYTK1L containing L1 and 1L sites flanking the PGK-HYTK gene
plus about 500 bp of vector sequences on both sides (to protect the
lox sites from exonuclease digestion before integration).
After selection with 1.1 mg of hygromycin per ml for 12 days, clones
were isolated and single-copy integration events were identified by
Southern blotting after digestion with EcoRV, an enzyme that
does not cut into pL1HYTK1L. Twelve single-copy clones were then tested
for ganciclovir sensitivity. Three clones that were strongly sensitive
to ganciclovir (>99% cell death in 48 h in 10 µM ganciclovir)
were termed RL4, RL5, and RL6 and were used throughout this study. The
orientation of the integration was determined relative to chromosomal
EcoRV sites located close to the integration sites by
Southern blotting. The orientation of the cassettes was also determined
relative to the residual plasmid sequences at the three loci in
reference to AlwNI or NdeI sites. The letters A
and B were assigned according to the orientation relative to the
residual plasmid sequences.
Flow cytometry and cell sorting.
Flow cytometry and cell
sorting was performed on Beckton Dickinson instruments (FACSCAN,
FACS-STAR plus, and FACS SCALIBUR). EGFP was quantitated under
standardized conditions using untransfected cells and GFP or
fluorescein isothiocyanate (FITC)-labeled beads as standards. To ensure
that all measurements were performed during log phase, the cells were
fed for two consecutive days before being subjected to
fluorescence-activated cell sorter (FACS) analysis. Dead cells were
gated out on the basis on propidium iodide exclusion. Comparisons
between different clones were always performed on the same day. The
percentage of expressing cells was determined relative to a cutoff
value set at the level of autofluorescence of the 99.5th percentile of
untransfected control cells analyzed on the same day. The level of EGFP
was defined as the linearized mean fluorescence of 10,000 cells in the
FL1 (green) channel.
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.1.298-309.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Position Effects Are Influenced by the Orientation
of a Transgene with Respect to Flanking Chromatin
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-globin gene locus, a group of five DNase
I-hypersensitive sites (HS) that controls the expression of all the
-like globin genes (6, 15). In these experiments, constructs consisting of a
-globin promoter linked to a
lacZ reporter and to various HSs of the LCR were targeted to
a randomly selected integration site, named RL1. We were able to show
that components of the
-globin LCR not only helped to overcome
position effects by increasing the proportion of expressing cells, a
previously described property of enhancers (12), but also
could increase the level of transcription in each expressing cell
(5). A striking observation was that with some of the
DNase I HSs of the LCR, expression was heterocellular, and that
apparently inactive cells could, with time, start to transcribe while,
conversely, active cells could become silent. We referred to these
temporally dynamic expression patterns as transcriptional oscillations
(10). The rate of transcriptional oscillation was
dependent on the strength of the enhancer included in the transgene.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-globin promoter
(positions
374 to +44 relative to cap site) linked to the EGFP coding
sequence (the AgeI-NotI fragment of pEGFP-N1).
Mapping of HSs with DNase I. HS analysis was performed as described previously (10). Genomic DNA samples were digested with PvuII and probed with the EGFP coding sequence.
Methylation analysis. Southern blots were quantified with a Molecular Dynamics PhosphorImager. All Southern blot analyses were performed at least twice. The genomic DNA was digested with PvuII (a methylation-insensitive enzyme that yields a 5.5-kb fragment regardless of the site of integration) plus one methylation-sensitive enzyme. Genomic samples exhibiting signs of partial digestion (a band larger than 5.5 kb) were discarded.
Bisulfite conversion was conducted as described previously (20). Nested PCR of converted genomic DNA was carried out with primer pairs +bisHS2-1 (GTTATATTTTTGTGTGTTTTTATTAGTGAT) and
bisHS2-1 (ATTTTCATACCTTCCTCTTCCATATCCTTA) in the
first round (30 cycles with an annealing temperature of 50°C) and
+bisHS2-2 (TATAGTTTAAGTATGAGTAGTTTTGGTTAG) and
bisHS2-2
(TACACATATATTAATAAAACCTAATTCTAC) in the second round (29 cycles with an annealing temperature of 50°C). The converted PCR
products were cloned using the TA cloning kit (Invitrogen, Carlsbad,
Calif.), and individuals clones were sequenced on an automatic sequencer.
FISH analysis.
Fluorescent in situ hybridization (FISH) was
performed as described previously (2) using the entire
plasmid pL1234EGFP1L as a probe. MEL cells were hypotonically swollen
in 75 mM KCl for 9 min, at which time 1/40 volume of fixative (fresh
methanol-acetic acid at 3:1) was added to the suspension, the tube was
inverted, and the cells were centrifuged gently for 7 min. The cells
were washed a further four times in fixative, and slides were prepared by pipetting 30 µl of cell suspension onto a slide and stored in
100% ethanol at
20°C. The major satellite probe was prepared by
amplifying mouse genomic DNA with PCR primers from the conserved part
of the repeat (43). The primers used were
5'-TAGAAATGTCCACTGTAGG-3' and
5'-CAGTTTTCTTGCCATATTC-3', with annealing at 39.8°C. This PCR product and the pL1234EGFP1L plasmid were separately nick translated to incorporate CY3.5 and biotin, respectively. By using standard hybridization conditions, the biotin signal was detected with
avidin-fluorescein isothiocyanate (FITC). Images were captured and
processed as previously described (2).
| |
RESULTS |
|---|
|
|
|---|
Creation of the tagged RL4, RL5, and RL6 loci.
The sites into
which the transgenes were targeted were created using pL1HYTK1L, a
plasmid that contains two inverted Lox sites (referred to as L1 and 1L)
flanking the hygromycin-thymidine kinase (HYTK) gene, a fusion gene
that can be selected for positively with hygromycin and against
negatively with ganciclovir (Fig. 1A).
Linearized pL1HYTK1L was transfected into MEL cells,
hygromycin-resistant clones were isolated, and Southern blotting was
performed to identify clones with single-copy integration (data not
shown). Three single-copy clones that proved particularly sensitive to
ganciclovir were designated RL4, RL5, and RL6 (for "random locus 4, 5, and 6). To determine the approximate chromosomal locations of RL4,
RL5, and RL6, three-color FISH was performed using the pL1HYTK1L
plasmid and mouse major satellite repeat DNA as probes. This revealed that all three integration sites were far from the potentially repressive environment of the centromere (Fig. 1B).
|
Recombinase-mediated cassette exchange.
Two plasmids
containing L1 and 1L Lox sites flanking the expression cassettes
234EGFP and CMVEGFP (Fig. 1C) were created. The first cassette,
234EGFP, contains HS2, HS3, and HS4 of the
-globin LCR 5' to the
-globin promoter driving the EGFP reporter gene. The second
cassette, CMVEGFP, contains the cytomegalovirus (CMV) immediate-early
(IE) promoter-enhancer driving the EGFP reporter (25, 35).
Comparison of cassettes 234EGFP and CMVEGFP.
For each locus,
the level of expression (defined as the mean green fluorescence of the
cell population) and the proportion of expressing cells (from which the
rate of silencing can be evaluated) of at least six subclones (three of
each orientation) were monitored regularly for several months by flow
cytometry (Fig. 2A
and B). As indicated by the small
error bars, the levels of expression of different subclones with
identical cassettes in the same orientation at the same chromosomal
site were remarkably similar, demonstrating that the use of RMCE
successfully eliminates the variables due to the site of integration.
By contrast, comparisons of the level of EGFP expression with the
cassettes in different orientations and at different loci revealed
striking position effects.
|
-globin LCR fragments similarly.
MEL cells can be induced to mature into late-stage erythrocytes by a
variety of treatments, including exposure to DMSO (22). This differentiation generally strongly activates constructs with
-globin regulatory elements. Induction of differentiation with DMSO
led to a two- to threefold increase in the level of expression of
cassette 234EGFP in the cells that were expressing but did not
reactivate the silenced loci (data not shown).
TSA and 5-azaC stimulate expression at active loci. To investigate the role of cytosine methylation in the control of gene expression in these cells, clones with cassettes 234EGFP or CMVEGFP in each orientation at loci RL4, RL5, and RL6 were treated with 5-azacytidine (5-azaC), a demethylating agent (Fig. 2C) (31). After incubation of the cells containing cassette 234EGFP with 5-azaC, the levels of expression increased 1.5- to 2-fold in all the clones with pancellular expression. Importantly, silenced loci could not be reactivated. With the CMVEGFP cassette, the results were more striking, with a 5- to 10-fold-greater response than for the 234EGFP cassette and minimal effects on the silenced RL4 locus in orientation A.
To determine if histone acetylation plays a role in transgene regulation, the same panel of clones were treated with trichostatin A (TSA), a histone deacetylase inhibitor (Fig. 2C) (44). Incubation of the 234EGFP cells with 10 nM TSA for 48 h was associated with a doubling of the level of expression at all loci in which expression was already occurring but had little effect at the silenced RL4 locus in the nonpermissive A orientation. Treatment of the CMVEGFP cassette with TSA resulted in a stronger activation than did treatment of the 234EGFP cassette. In both cases, this increase in expression could either be due to a direct action of TSA on the chromatin at the integration sites or be indirect. Treatment with a combination of 10 nM TSA and 0.25 µM 5-azaC also failed to reactivate the silenced RL4 and RL6 loci (data not shown).Levels of expression correlate with levels of methylation.
To
test the relationship between levels of methylation and expression
patterns, we digested genomic DNA with methylation-sensitive restriction endonucleases (and their methylation-insensitive
isoschizomers when available) and performed Southern blot analyses
(Fig. 3A and B). At RL5, the locus with
the highest expression levels, cassette 234EGFP in both orientations
was almost completely unmethylated except for a small amount of
methylation in HS2, detected using AvaI. At RL4 and RL6 in
orientation B (the orientation in which expression is stable), the
results were similar to those for RL5, with an overall paucity of
methylation except at HS2 and the
-globin promoter, which were
partially methylated (Fig. 3A and B). Overall, the level of expression
correlated inversely with the degree of methylation of the
cis-regulatory sequences.
|
-globin
promoter, and HS2. Methylation of the two CpG dinucleotides in HS3
could not be assessed due to the lack of suitable restriction
endonucleases, but an HpaII site introduced as part of the
cloning of HS2 and HS3 was partially methylated. Interestingly, HS4 was
not methylated. We concluded that at both RL4 and RL6, silencing was
associated with complete methylation of HS2, the promoter, and the
coding sequence.
DNase I hypersensitivity studies.
To determine whether the
differences in expression levels and rate of silencing between loci
were associated with different chromatin structures, we performed DNase
I hypersensitivity mapping on clones with cassette 234EGFP at loci RL4,
RL5, and RL6. These experiments revealed that strong DNase I HSs that
map to HS2 and HS3 formed at all three loci and in both orientations,
including after silencing of expression at RL4 and RL6 (Fig. 3C).
Silencing at loci RL4 and RL6 is therefore not due to the failure of HS formation. By contrast, the presence of an HS that maps to the
-globin promoter correlated with expression, showing that silencing in these cells correlates with the failure of transcriptional initiation.
Stable epigenetic imprinting of nonexpressing cassettes.
To
gain further insight into the cause of silencing and of the orientation
dependence of expression, we inverted in vivo the 234EGFP cassette
integrated at RL4, the locus with the most pronounced effect of
orientation. This was possible because the transgene remains flanked by
L1 Lox sites in opposite orientations following RMCE, allowing
inversion of the transgene if Cre recombinase is reexpressed in the
cell (1). Cells containing 234EGFP inserted at RL4 in the
permissive orientation (orientation B) were transiently transfected
with a Cre expression plasmid and were examined as pools 4 weeks later.
FACS analysis revealed that about 10% of the cells had lost expression
of EGFP (Fig. 4A).
To verify that in vivo inversion of
the cassette had indeed taken place after reexpression of Cre, cells
that had lost EGFP expression following transfection were purified by
flow cytometry, individual clones were isolated, and Southern blot
analyses were performed. This revealed that all 20 silenced clones
tested had undergone an in vivo inversion (Fig. 4B). A total of 35 clones that were still expressing EGFP after the transient transfection
of Cre were also tested by Southern blot analyses. None of these clones
had undergone an in vivo cassette inversion. Therefore, a perfect
correlation was found between in vivo inversion and the loss of
transgene expression.
|
Inversion-mediated imprinting of cassette 234EGFP is associated
with persistence of methylation in the EGFP coding sequence and the
-globin promoter and with partial demethylation of HS2.
To test
the methylation status of the cassettes after in vivo inversion, we
performed experiments similar to that described above (Fig. 4D and E).
After inversion from the permissive to the nonpermissive orientation,
the methylation pattern observed was indistinguishable from that of
clones directly recovered in the nonpermissive orientation (Fig. 3),
suggesting that in the nonpermissive chromatin context, cassettes are
efficiently de novo methylated and that no irreversible epigenetic tags
were attached to the cassette while it was in the permissive orientation.
-globin
promoter was unaltered by the in vivo inversion, suggesting that
maintenance of the silent state in the otherwise permissive orientation
may be due to the conservation of the preexisting methylation patterns.
However, the degree of methylation of HS2 in the cassette imprinted by
inversion was markedly reduced compared with that in the silenced,
noninverted clones (Fig. 4D), suggesting that the small amount of
expression in the imprinted cells might be due to this partial
demethylation. This prompted us to study these cells in greater detail.
Escape from inactivation is associated with transcriptional
oscillations and methylation changes at HS2.
To determine whether
the inversion-mediated imprinting was stable or whether it would be
eliminated by serial passages in culture, we monitored these cells over
a 70-week period. The percentage of expressing cells in the imprinted
population was analyzed by measuring the proportion of cells with
fluorescence greater than a threshold defined as the 99.5th percentile
of the background fluorescence of untransfected control cells analyzed
simultaneously. This revealed that the inversion-mediated imprinting
was stable, since the proportion of expressing cells in RL4 A-to-B
inversion clones remained between 10 and 20% throughout that time in
culture (Fig. 5A). These expression
characteristics giving rise to the heterocellular pattern of expression
of this cell population were strikingly similar to the transcriptional
oscillations that we had previously observed at locus RL1
(10).
|
| |
DISCUSSION |
|---|
|
|
|---|
We have tagged three genomic sites with pairs of inverted L1 Lox
sites and inserted two expression cassettes at each of these reference
loci by using RMCE. Pancellular variation in expression levels from the
same cassette integrated at different loci (stable position effects)
was observed in the presence of two unrelated enhancers (HS2, HS3, and
HS4 of the
-globin LCR and the CMV IE). Strikingly, the levels of
expression of both cassettes were affected in the same manner by the
locus of integration, with the RL5 locus allowing the strongest
expression and RL6 allowing the weakest. These results demonstrate the
presence at most integration sites of unknown determinants of
transcription rate that are dominant over two completely distinct
enhancers that both promote high levels of transcription in erythroid
cells. Silencing of expression was observed at two of the three loci
tested and occurred regardless of the enhancers present, again
demonstrating the presence at these integration sites of determinants
of transcriptional competence that are dominant over the LCR and the
CMV IE.
Orientation dependence of expression. Surprisingly, expression of the two cassettes was dependent on their orientations within the reference locus. At two of the three loci (RL4 and RL6), expression was temporally stable in one orientation but gradually silenced in the other. At the third locus (RL5), expression was temporally stable in both orientations but was nevertheless higher in one of the two orientations. The nature of the sequences in the flanking chromatin responsible for the orientation dependence is unknown. Such sequences are probably not large blocks of heterochromatin from which chromatin condensation spreads over large distances, as has been proposed for PEV in Drosophila (9), since inversion would not significantly change the distance between the regulatory sequences within the transgene and distant heterochromatic blocks that are believed to induce silencing at distances greater than 1 Mb (41). The simplest explanation is that the unknown determinants of transgene expression are sequences located within a few hundred bases of the sites of integration, combining with the regulatory sequences of the expression cassette to cause either stable or silencing position effects. Orientation-dependent position effect variegation has been previously reported for the brown transgene in Drosophila by Sabl and Henikoff (33). These authors proposed that the orientation of the transgene affected somatic pairing with repetitive elements that led to inactivation. Although the transgenes inserted at RL1 are present at a single copy in the cell, a similar phenomenon could conceivably be occurring in MEL cells. The direction of DNA replication or unidirectional transcription into the transgene from endogenous promoters (24) could also be the source of the polarity of the position effect that we observed.
Silencing in MEL cells is associated with methylation but not with changes in DNase I HS formation. The observation that methylation at RL4 and RL6 correlates strongly with the level of GFP expression and with silencing is in accordance with previous reports on silencing of globin constructs and retroviruses in cell culture and in transgenic mice (13, 19-21, 29). However, the formation of strong DNase I HSs even after silencing has not been reported before, and contrasts with previous reports by us and others that position effect variegation on globin transgenes in mice is associated with loss of DNase I sensitivity at the LCR (2, 13). This difference suggests that silencing in MEL cells occurs by a mechanism that differs from silencing of globin transgenes that go through the mouse germ line. Interestingly, HS4 was not methylated, even in completely silenced cells, suggesting that HS4 might be more resistant to methylation than HS2 is. Whether this has any functional consequences is not clear.
Inversion-mediated imprinting.
In vivo inversion toward the
permissive orientation of a silenced cassette did not lead to complete
reactivation of the cassette but instead led to a temporally stable
heterocellular pattern of expression caused by transcriptional
oscillations associated with dynamic activation and inactivation of the
transgenes. Two independent methylation assays, Southern blot and
bisulfite sequencing analyses, revealed that the GFP-positive and
GFP-negative cells have different levels of methylation of HS2 but not
of the promoter or the GFP coding sequence. Since GFP expression is
dynamic in these cells, it probably follows that the methylation of HS2
is itself dynamic. To our knowledge, dynamic methylation of an enhancer has not been previously documented but several reports have
demonstrated selective demethylation of viral enhancers in transgenes
and of regulatory sequences (18). It has been proposed
that demethylation of regulatory elements is associated with binding of
protein factors such as Sp1 in CpG islands or NF-
B in B cells
(3, 34). Studies with Xenopus and mammalian
cells suggest that factor-mediated selective demethylation is
replication dependent (17, 23). Changes in the methylation
of HS2 in the oscillating cells might therefore be mediated by
temporally unstable binding of factors capable of inducing
demethylation at HS2.
| |
ACKNOWLEDGMENTS |
|---|
Y.Q.F. and E.E.B. are supported by NIH grants HL55435, HL38655, and DK56845; M.L. is supported by NIH grant GM19767; and J.M.G. is supported by grants DK02467 and DK56786.
We thank Judith Dunai, Yale University, for technical assistance with the FISH assay.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Division of Hematology, Department of Medicine, Albert Einstein College of Medicine, 1300 Morris Park Ave., Bronx, NY 10461. Phone: (718) 430 2188. Fax: (718) 824 3153. E-mail: Bouhassi{at}aecom.yu.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Abremski, K., B. Frommer, and R. H. Hoess. 1986. Linking-number changes in the DNA substrate during Cre-mediated loxP site-specific recombination. J. Mol. Biol. 192:17-26[CrossRef][Medline]. |
| 2. |
Alami, R.,
J. M. Greally,
K. Tanimoto,
S. Hwang,
Y. Q. Feng,
J. D. Engel,
S. Fiering, and E. E. Bouhassira.
2000.
Beta-globin YAC transgenes exhibit uniform expression levels but position effect variegation in mice.
Hum. Mol. Genet.
9:631-636 |
| 3. | Bergman, Y., and R. Mostoslavsky. 1998. DNA demethylation: turning genes on. Biol. Chem. 379:401-407[Medline]. |
| 4. | Bestor, T. H. 2000. Gene silencing as a threat to the success of gene therapy. J. Clin. Investig. 105:409-411[Medline]. |
| 5. |
Bouhassira, E. E.,
K. Westerman, and P. Leboulch.
1997.
Transcriptional behavior of LCR enhancer elements integrated at the same chromosomal locus by recombinase-mediated cassette exchange.
Blood
90:3332-3344 |
| 6. |
Bulger, M., and M. Groudine.
1999.
Looping versus linking: toward a model for long-distance gene activation.
Genes Dev.
13:2465-2477 |
| 7. | Chung, J. H., M. Whiteley, and G. Felsenfeld. 1993. A 5' element of the chicken beta-globin domain serves as an insulator in human erythroid cells and protects against position effects in Drosophila. Cell 74:505-514[CrossRef][Medline]. |
| 8. |
Clark, S. J.,
J. Harrison,
C. L. Paul, and M. Frommer.
1994.
High sensitivity mapping of methylated cytosines.
Nucleic Acids Res.
22:2990-2997 |
| 9. | Dobie, K., M. Mehtali, M. McClenaghan, and R. Lathe. 1997. Variegated gene expression in mice. Trends Genet. 13:127-130[CrossRef][Medline]. |
| 10. |
Feng, Y. Q.,
R. Alami, and E. E. Bouhassira.
1999.
Enhancer-dependent transcription oscillations in mouse erythroleukemia cells.
Mol. Cell. Biol.
19:4907-4917 |
| 11. | Feng, Y. Q., J. Seibler, R. Alami, A. Eisen, S. N. Fiering, and E. E. Bouhassira. 1999. Site-specific chromosomal integration in mammalian cells: highly efficient CRE recombinase-mediated cassette exchange. J. Mol. Biol. 292:779-785[CrossRef][Medline]. |
| 12. | Fiering, S., E. Whitelaw, and D. I. Martin. 2000. To be or not to be active: the stochastic nature of enhancer action. Bioessays 22:381-387[CrossRef][Medline]. |
| 13. |
Garrick, D.,
H. Sutherland,
G. Robertson, and E. Whitelaw.
1996.
Variegated expression of a globin transgene correlates with chromatin accessibility but not methylation status.
Nucleic Acids Res.
24:4902-4909 |
| 14. |
Graubert, T. A.,
B. A. Hug,
R. Wesselschmidt,
C. L. Hsieh,
T. M. Ryan,
T. M. Townes, and T. J. Ley.
1998.
Stochastic, stage-specific mechanisms account for the variegation of a human globin transgene.
Nucleic Acids Res.
26:2849-2858 |
| 15. | Grosveld, F. 1999. Activation by locus control regions? Curr. Opin. Genet. Dev. 9:152-157[CrossRef][Medline]. |
| 16. | Grosveld, F., G. B. van Assendelft, D. R. Greaves, and G. Kollias. 1987. Position-independent, high-level expression of the human beta-globin gene in transgenic mice. Cell 51:975-985[CrossRef][Medline]. |
| 17. |
Hsieh, C. L.
1999.
Evidence that protein binding specifies sites of DNA demethylation.
Mol. Cell. Biol.
19:46-56 |
| 18. | Hsieh, C. L. 2000. Dynamics of DNA methylation pattern. Curr. Opin. Genet. Dev. 10:224-228[CrossRef][Medline]. |
| 19. | Jahner, D., H. Stuhlmann, C. L. Stewart, K. Harbers, J. Lohler, I. Simon, and R. Jaenisch. 1982. De novo methylation and expression of retroviral genomes during mouse embryogenesis. Nature 298:623-628[CrossRef][Medline]. |
| 20. |
Lorincz, M. C.,
D. Schubeler,
S. C. Goeke,
M. Walters,
M. Groudine, and D. I. Martin.
2000.
Dynamic analysis of proviral induction and de novo methylation: implications for a histone deacetylase-independent, methylation density-dependent mechanism of transcriptional repression.
Mol. Cell. Biol.
20:842-850 |
| 21. |
Luo, H. Y.,
X. L. Liang,
C. Frye,
M. Wonio,
G. V. Hankins,
D. K. Chui, and B. P. Alter.
1999.
Embryonic hemoglobins are expressed in definitive cells.
Blood
94:359-361 |
| 22. | Marks, P. A., and R. A. Rifkind. 1978. Erythroleukemic differentiation. Annu. Rev. Biochem. 47:419-448[CrossRef][Medline]. |
| 23. | Matsuo, K., J. Silke, O. Georgiev, P. Marti, N. Giovannini, and D. Rungger. 1998. An embryonic demethylation mechanism involving binding of transcription factors to replicating DNA. EMBO J. 17:1446-1453[CrossRef][Medline]. |
| 24. | Moser, T., K. Harbers, and K. Kratochwil. 1996. Tissue- and stage-specific activation of an endogenous provirus after transcription through its integration site in the opposite orientation. Mol. Cell. Biol. 16:384-389[Abstract]. |
| 25. | Nelson, J. A., J. W. J. Gnann, and P. Ghazal. 1990. Regulation and tissue-specific expression of human cytomegalovirus. Curr. Top. Microbiol. Immunol. 154:75-100[Medline]. |
| 26. | Nicholls, R. D., S. Saitoh, and B. Horsthemke. 1998. Imprinting in Prader-Willi and Angelman syndromes. Trends Genet. 14:194-200[CrossRef][Medline]. |
| 27. |
Nolan, G. P.,
S. Fiering,
J. F. Nicolas, and L. A. Herzenberg.
1988.
Fluorescence-activated cell analysis and sorting of viable mammalian cells based on beta-D-galactosidase activity after transduction of Escherichia coli lacZ.
Proc. Natl. Acad. Sci. USA
85:2603-2607 |
| 28. |
Peterson, K. R.,
C. H. Clegg,
C. Huxley,
B. M. Josephson,
H. S. Haugen, and T. Furukawa.
1993.
Transgenic mice containing a 248-kb yeast artificial chromosome carrying the human beta-globin locus display proper developmental control of human globin genes.
Proc. Natl. Acad. Sci. USA
90:7593-7597 |
| 29. |
Pikaart, M. J.,
F. Recillas-Targa, and G. Felsenfeld.
1998.
Loss of transcriptional activity of a transgene is accompanied by DNA methylation and histone deacetylation and is prevented by insulators.
Genes Dev.
12:2852-2862 |
| 30. |
Porcu, S.,
M. Kitamura,
E. Witkowska,
Z. Zhang,
A. Mutero,
C. Lin,
J. Chang, and K. M. L. Gaensler.
1997.
The human beta globin locus introduced by YAC transfer exhibits a specific and reproducible pattern of developmental regulation in transgenic mice.
Blood
90:4602-4609 |
| 31. |
Razin, A., and H. Cedar.
1991.
DNA methylation and gene expression.
Microbiol. Rev.
55:451-458 |
| 32. |
Robertson, G.,
D. Garrick,
M. Wilson,
D. I. K. Martin, and E. Whitelaw.
1996.
Age-dependent silencing of globin transgenes in the mouse.
Nucleic Acids Res.
24:1465-1471 |
| 33. | Sabl, J. F., and S. Henikoff. 1996. Copy number and orientation determine the susceptibility of a gene to silencing by nearby heterochromatin in Drosophila. Genetics 142:447-458[Abstract]. |
| 34. | Siegfried, Z., S. Eden, M. Mendelsohn, X. Feng, B. Z. Tsuberi, and H. Cedar. 1999. DNA methylation represses transcription in vivo. Nat. Genet. 22:203-206[CrossRef][Medline]. |
| 35. | Stamminger, T., and B. Fleckenstein. 1990. Immediate-early transcription regulation of human cytomegalovirus. Curr. Top. Microbiol. Immunol. 154:3-19[Medline]. |
| 36. | Wakimoto, B. T. 1998. Beyond the nucleosome: epigenetic aspects of position-effect variegation in Drosophila. Cell 93:321-324[CrossRef][Medline]. |
| 37. |
Walsh, C. P., and T. H. Bestor.
1999.
Cytosine methylation and mammalian development.
Genes Dev.
13:26-34 |
| 38. |
Walters, M. C.,
S. Fiering,
J. Eidemiller,
W. Magis,
M. Groudine, and D. I. K. Martin.
1995.
Enhancers increase the probability but not the level of gene expression.
Proc. Natl. Acad. Sci. USA
92:7125-7129 |
| 39. |
Walters, M. C.,
W. Magis,
S. Fiering,
J. Eidemiller,
D. Scalzo,
M. Groudine, and D. I. K. Martin.
1996.
Transcriptional enhancers act in cis to suppress position-effect variegation.
Genes Dev.
10:185-195 |
| 40. |
Watt, F. M., and B. L. Hogan.
2000.
Out of Eden: stem cells and their niches.
Science
287:1427-1430 |
| 41. | Weiler, K. S., and B. T. Wakimoto. 1995. Heterochromatin and gene expression in Drosophila. Annu. Rev. Genet. 29:577-605[CrossRef][Medline]. |
| 42. | Widlund, H. R., H. Cao, S. Simonsson, E. Magnusson, T. Simonsson, P. E. Nielsen, J. D. Kahn, D. M. Crothers, and M. Kubista. 1997. Identification and characterization of genomic nucleosome-positioning sequences. J. Mol. Biol. 267:807-817[CrossRef][Medline]. |
| 43. |
Wong, A. K., and J. B. Rattner.
1988.
Sequence organization and cytological localization of the minor satellite of mouse.
Nucleic Acids Res.
16:11645-11661 |
| 44. | Yoshida, M., S. Horinouchi, and T. Beppu. 1995. Trichostatin A and trapoxin: novel chemical probes for the role of histone acetylation in chromatin structure and function. Bioessays 17:423-430[CrossRef][Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»