Previous Article | Next Article 
Molecular and Cellular Biology, January 2001, p. 298-309, Vol. 21, No. 1
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.1.298-309.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Position Effects Are Influenced by the Orientation
of a Transgene with Respect to Flanking Chromatin
Yong-Qing
Feng,1
Matthew C.
Lorincz,2
Steve
Fiering,3
John M.
Greally,4 and
Eric E.
Bouhassira1,*
Division of Hematology, Department of
Medicine, Albert Einstein College of Medicine, Bronx, New
York1; Fred Hutchinson Cancer
Research Center, Seattle, Washington2;
Microbiology Department, Dartmouth Medical School, Hanover,
New Hampshire3; and Department of
Genetics, Yale University School of Medicine, New Haven,
Connecticut4
Received 30 June 2000/Returned for modification 10 August
2000/Accepted 28 September 2000
 |
ABSTRACT |
We have inserted two expression cassettes at tagged reference
chromosomal sites by using recombinase-mediated cassette exchange in
mammalian cells. The three sites of integration displayed either stable
or silencing position effects that were dominant over the different
enhancers present in the cassettes. These position effects were
strongly dependent on the orientation of the construct within the
locus, with one orientation being permissive for expression and the
other being nonpermissive. Orientation-specific silencing, which was
observed at two of the three site tested, was associated with
hypermethylation but not with changes in chromatin structure, as judged
by DNase I hypersensitivity assays. Using CRE recombinase, we were able
to switch in vivo the orientation of the transgenes from the permissive
to the nonpermissive orientation and vice versa. Switching from the
permissive to the nonpermissive orientation led to silencing, but
switching from the nonpermissive to the permissive orientation did not
lead to reactivation of the transgene. Instead, transgene expression
occurred dynamically by transcriptional oscillations, with 10 to 20%
of the cells expressing at any given time. This result suggested that
the cassette had been imprinted (epigenetically tagged) while it was in
the nonpermissive orientation. Methylation analysis revealed that the
methylation state of the inverted cassettes resembled that of silenced
cassettes except that the enhancer had selectively lost some of its
methylation. Sorting of the expressing and nonexpressing cell
populations provided evidence that the transcriptional oscillations of
the epigenetically tagged cassette are associated with changes in the
methylation status of regulatory elements in the transgene. This
suggests that transgene methylation is more dynamic than was previously assumed.
 |
INTRODUCTION |
Stably integrated transgenes are
often poorly expressed because of position effects that are caused by
the influence of the site of chromosomal integration (4,
12). In cultured cells, two categories of position effects have
been recognized: stable and silencing (29, 39). Stable
position effects are characterized by pancellular expression of the
transgene (expression in every cell of a given tissue or cell
population) at levels that are dictated by the site of integration and
are different from the expression level of the endogenous gene or of
similar transgenes integrated at other sites. Silencing position
effects are characterized by progressive silencing of the transgene at
a rate characteristic of the site of integration. During the process of
silencing, expression occurs in only a fraction of the cell population
and can therefore be described as heterocellular. Silencing position
effects in cultured cells have some similarity to position effect
variegation (PEV) in Drosophila and mammals (14, 36,
42), which is characterized by clonally inherited silencing of
expression in a fraction of the cells of a given tissue. PEV thereby
results in heterocellular expression of the transgenes. PEV can be
temporally stable, or the proportion of expressing cells can decrease
with the age of the animal (32).
Attempts to overcome position effects have generally focused on
including strong native regulators such as locus control regions (LCRs)
(16) in the transgenic construct or on making the
transgene so large that it is likely to include all the sequences
required to establish its native epigenetic organization (28,
30). However, neither strategy is fully effective, highlighting
the fact that even following years of experimental analysis of
transgenes, the fundamental mechanisms of position effects remain
largely unknown (2). DNA elements called chromatin
insulators have been reported to decrease silencing and variegating
position effects in mammalian cells (7).
The major obstacle to understanding position effects has been the
technical inability to integrate reporter constructs into a defined
genomic locus. To overcome this problem, we have recently developed a
targeting approach that we call recombinase-mediated cassette exchange
(RMCE) (5, 11). RMCE uses site-specific recombinases to
integrate single-copy transgenes without selectable markers into
previously tagged sites in mammalian cells, allowing the sensitive and
accurate dissection of the elements within the transgene that influence
expression and epigenetic organization. In addition, since the RMCE
system used here causes the integration of the transgene in each of the
two possible orientations, we are able to test the effect of this
variable for the first time.
We have previously used RMCE in mouse erythroleukemia (MEL) cells to
study the LCR of the human
-globin gene locus, a group of five DNase
I-hypersensitive sites (HS) that controls the expression of all the
-like globin genes (6, 15). In these experiments, constructs consisting of a
-globin promoter linked to a
lacZ reporter and to various HSs of the LCR were targeted to
a randomly selected integration site, named RL1. We were able to show
that components of the
-globin LCR not only helped to overcome
position effects by increasing the proportion of expressing cells, a
previously described property of enhancers (12), but also
could increase the level of transcription in each expressing cell
(5). A striking observation was that with some of the
DNase I HSs of the LCR, expression was heterocellular, and that
apparently inactive cells could, with time, start to transcribe while,
conversely, active cells could become silent. We referred to these
temporally dynamic expression patterns as transcriptional oscillations
(10). The rate of transcriptional oscillation was
dependent on the strength of the enhancer included in the transgene.
We have now extended our previous analysis by comparing at three loci
the expression of two cassettes containing different cis-regulatory sequences driving an enhanced green
fluorescence protein (EGFP) reporter gene, integrated in both possible
orientations. We show that each integration site causes distinct EGFP
expression patterns that can be categorized as either stable or
silencing position effects, confirming the critical importance of the
site of integration on the level of transgene expression. Surprisingly, we found that the orientation of the cassette within each site is a
critical determinant of the type of position effect observed. We also
report that silencing of the construct in the nonpermissive orientation
can epigenetically imprint the transgene and that an escape from
repression, leading to transcriptional oscillations, is associated with
changes in methylation at specific sites within the regulatory elements
of the transgenes, suggesting that methylation can be a more dynamic
DNA modification than has previously been assumed.
 |
MATERIALS AND METHODS |
Plasmids.
Plasmid construction was performed by standard
methods. The sequences of all plasmids are available on request.
Plasmid pL1HYTK1L was described previously (11). Plasmid
L1CMVEGFP1L contains a NheI-NotI fragment from
pEGFP-N1 (Clontech, Palo Alto, Calif.) cloned between the L1 and 1L
LoxP511 sites of pL1HYTK1L. Plasmid L1234EGFP1L contains HS4
(HUMHBB positions 951 to 2199), HS3 (HUMHBB positions 4273 to 5122),
HS2 (HUMHBB positions 7764 to 9172), and the
-globin promoter
(positions
374 to +44 relative to cap site) linked to the EGFP coding
sequence (the AgeI-NotI fragment of pEGFP-N1).
Cell culture and transfections.
Cell culture and
transfections were performed as described previously (11).
Induction of differentiation with 2% dimethyl sulfoxide (DMSO) for 5 days resulted in 70 to 95% benzidine positivity depending on the clones.
Creation of the reference loci.
Loci RL4, RL5, and RL6 were
created by transfecting 10 µg of a BspHI fragment of
plasmid pL1HYTK1L containing L1 and 1L sites flanking the PGK-HYTK gene
plus about 500 bp of vector sequences on both sides (to protect the
lox sites from exonuclease digestion before integration).
After selection with 1.1 mg of hygromycin per ml for 12 days, clones
were isolated and single-copy integration events were identified by
Southern blotting after digestion with EcoRV, an enzyme that
does not cut into pL1HYTK1L. Twelve single-copy clones were then tested
for ganciclovir sensitivity. Three clones that were strongly sensitive
to ganciclovir (>99% cell death in 48 h in 10 µM ganciclovir)
were termed RL4, RL5, and RL6 and were used throughout this study. The
orientation of the integration was determined relative to chromosomal
EcoRV sites located close to the integration sites by
Southern blotting. The orientation of the cassettes was also determined
relative to the residual plasmid sequences at the three loci in
reference to AlwNI or NdeI sites. The letters A
and B were assigned according to the orientation relative to the
residual plasmid sequences.
Flow cytometry and cell sorting.
Flow cytometry and cell
sorting was performed on Beckton Dickinson instruments (FACSCAN,
FACS-STAR plus, and FACS SCALIBUR). EGFP was quantitated under
standardized conditions using untransfected cells and GFP or
fluorescein isothiocyanate (FITC)-labeled beads as standards. To ensure
that all measurements were performed during log phase, the cells were
fed for two consecutive days before being subjected to
fluorescence-activated cell sorter (FACS) analysis. Dead cells were
gated out on the basis on propidium iodide exclusion. Comparisons
between different clones were always performed on the same day. The
percentage of expressing cells was determined relative to a cutoff
value set at the level of autofluorescence of the 99.5th percentile of
untransfected control cells analyzed on the same day. The level of EGFP
was defined as the linearized mean fluorescence of 10,000 cells in the
FL1 (green) channel.
The FACS-gal procedure and the enrichment for transfected cells with
the CMV-LacZ plasmid was performed as described previously (5).
Mapping of HSs with DNase I.
HS analysis was performed as
described previously (10). Genomic DNA samples were
digested with PvuII and probed with the EGFP coding sequence.
Methylation analysis.
Southern blots were quantified with a
Molecular Dynamics PhosphorImager. All Southern blot analyses were
performed at least twice. The genomic DNA was digested with
PvuII (a methylation-insensitive enzyme that yields a 5.5-kb
fragment regardless of the site of integration) plus one
methylation-sensitive enzyme. Genomic samples exhibiting signs of
partial digestion (a band larger than 5.5 kb) were discarded.
Bisulfite conversion was conducted as described previously
(20). Nested PCR of converted genomic DNA was carried out
with primer pairs +bisHS2-1 (GTTATATTTTTGTGTGTTTTTATTAGTGAT)
and
bisHS2-1 (ATTTTCATACCTTCCTCTTCCATATCCTTA) in the
first round (30 cycles with an annealing temperature of 50°C) and
+bisHS2-2 (TATAGTTTAAGTATGAGTAGTTTTGGTTAG) and
bisHS2-2
(TACACATATATTAATAAAACCTAATTCTAC) in the second round (29 cycles with an annealing temperature of 50°C). The converted PCR
products were cloned using the TA cloning kit (Invitrogen, Carlsbad,
Calif.), and individuals clones were sequenced on an automatic sequencer.
FISH analysis.
Fluorescent in situ hybridization (FISH) was
performed as described previously (2) using the entire
plasmid pL1234EGFP1L as a probe. MEL cells were hypotonically swollen
in 75 mM KCl for 9 min, at which time 1/40 volume of fixative (fresh
methanol-acetic acid at 3:1) was added to the suspension, the tube was
inverted, and the cells were centrifuged gently for 7 min. The cells
were washed a further four times in fixative, and slides were prepared by pipetting 30 µl of cell suspension onto a slide and stored in
100% ethanol at
20°C. The major satellite probe was prepared by
amplifying mouse genomic DNA with PCR primers from the conserved part
of the repeat (43). The primers used were
5'-TAGAAATGTCCACTGTAGG-3' and
5'-CAGTTTTCTTGCCATATTC-3', with annealing at 39.8°C. This PCR product and the pL1234EGFP1L plasmid were separately nick translated to incorporate CY3.5 and biotin, respectively. By using standard hybridization conditions, the biotin signal was detected with
avidin-fluorescein isothiocyanate (FITC). Images were captured and
processed as previously described (2).
 |
RESULTS |
Creation of the tagged RL4, RL5, and RL6 loci.
The sites into
which the transgenes were targeted were created using pL1HYTK1L, a
plasmid that contains two inverted Lox sites (referred to as L1 and 1L)
flanking the hygromycin-thymidine kinase (HYTK) gene, a fusion gene
that can be selected for positively with hygromycin and against
negatively with ganciclovir (Fig. 1A).
Linearized pL1HYTK1L was transfected into MEL cells,
hygromycin-resistant clones were isolated, and Southern blotting was
performed to identify clones with single-copy integration (data not
shown). Three single-copy clones that proved particularly sensitive to
ganciclovir were designated RL4, RL5, and RL6 (for "random locus 4, 5, and 6). To determine the approximate chromosomal locations of RL4,
RL5, and RL6, three-color FISH was performed using the pL1HYTK1L
plasmid and mouse major satellite repeat DNA as probes. This revealed that all three integration sites were far from the potentially repressive environment of the centromere (Fig. 1B).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 1.
Site-specific integration at RL4, RL5, and RL6. (A)
RMCE. Reference loci are created by insertion of plasmid L1HYTK1L at
random integration sites in MEL cells. Expression cassettes are then
integrated using RMCE by cotransfection of a Cre expression plasmid and
a plasmid containing the expression cassette of interest. Cells that
undergo an exchange can be selected for resistance to ganciclovir.
Site-specific integration occurs in both possible orientations. (B)
Three reference loci (random loci RL4, RL5, and RL6) were created and
localized on the chromosomes by FISH. The chromosomes were stained with
DAPI (blue pseudocolor), and the centromere were visualized with a
CY3.5-labeled probe (red pseudocolor), and the reference loci were
visualized indirectly with FITC-labeled avidin (green pseudocolor).
None of the loci is near the centromere or telomere. (C) Cassette
234EGFP contains the coding sequence of the EGFP genes linked to a
human -globin promoter fragment and to HS2, HS3, and HS4 of the
human -globin LCR. Cassette CMVEGFP contains the same reporter
linked to the CMV IE promoter-enhancer. (D) Southern blots
demonstrating site-specific integration of cassette 234EGFP at RL4,
RL5, and RL6 in both orientations. Three subclones with integration in
each orientation at all three loci are shown (except RL5 orientation B,
for which only two subclones are shown). Orientation was determined
using chromosomal EcoRV sites for reference (see Materials
and Methods).
|
|
Recombinase-mediated cassette exchange.
Two plasmids
containing L1 and 1L Lox sites flanking the expression cassettes
234EGFP and CMVEGFP (Fig. 1C) were created. The first cassette,
234EGFP, contains HS2, HS3, and HS4 of the
-globin LCR 5' to the
-globin promoter driving the EGFP reporter gene. The second
cassette, CMVEGFP, contains the cytomegalovirus (CMV) immediate-early
(IE) promoter-enhancer driving the EGFP reporter (25, 35).
Cassettes 234EGFP and CMVEGFP were then integrated in both possible
orientations at the three reference loci RL4, RL5, and RL6 by a
cassette exchange mediated by recombination between the inverted Lox
sites (11) (Fig. 1D). At all three integration sites, the
frequency of exchange was very high: between 80 and 100% of the
ganciclovir-resistant clones had a transfected cassette integrated in
one of the two possible orientations.
Comparison of cassettes 234EGFP and CMVEGFP.
For each locus,
the level of expression (defined as the mean green fluorescence of the
cell population) and the proportion of expressing cells (from which the
rate of silencing can be evaluated) of at least six subclones (three of
each orientation) were monitored regularly for several months by flow
cytometry (Fig. 2A
and B). As indicated by the small
error bars, the levels of expression of different subclones with
identical cassettes in the same orientation at the same chromosomal
site were remarkably similar, demonstrating that the use of RMCE
successfully eliminates the variables due to the site of integration.
By contrast, comparisons of the level of EGFP expression with the
cassettes in different orientations and at different loci revealed
striking position effects.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 2.
Expression at RL4, RL5, and RL6. (A) Representative
histograms obtained by flow cytometry of cells containing cassettes
234EGFP at RL4, RL5, and RL6 at various times postintegration. The
white histogram overlays were obtained from control untransfected
cells. The x axis shows the number of cells; the
y axis shows the mean green fluorescence on a relative
scale. Orientation-dependent stable and silencing position effects can
be observed (see the text). (B) Bar graphs summarizing the expression
levels (defined as the mean level of green fluorescence in 10,000 cells) of cassettes 234EGFP and CMVEGFP 5 to 6 weeks after integration
at loci RL4, RL5, and RL6. The white bars show expression in
orientation A, and the black bars show expression in orientation B. Each bar represents the average of two independent determinations of
the expression level of three clones, and error bars indicate standard
deviation. Silencing was not a factor in comparing expression levels
between the various cell lines, since at 5 weeks postintegration the
expression in all the samples tested was pancellular or absent
(silencing at RL4 in orientation A was already complete but was minimal
at RL6 in orientation A). (C) Cells with 234EGFP or CMVEGFP at RL4, RL5, and RL6 were incubated with
0.25 µM 5-azaC for 24 h (top panels) or with TSA for 48 h
(bottom panels). Each bar represents the average (and standard
deviation) of two independent experiments in which the expression level
of three subclones containing one of the cassettes in each orientation
was determined. The locus of integration and the orientation of the
cassette are indicated below the bars.
|
|
At RL4, 3 weeks after the transfection, expression of cassette 234EGFP
in orientation A was very low and heterocellular. At 1 month later, the
cassette was completely silent in all clones examined, demonstrating a
high rate of silencing at this locus in this orientation. Expression in
orientation B was much higher than in orientation A and was
pancellular. No signs of silencing were detected over a 6-month
monitoring period. At the same RL4 locus, expression of the CMVEGFP
cassette was similar to that of the 234EGFP cassette. In orientation A,
heterocellular, low-level expression was detected 3 weeks
postintegration. Rapid silencing was then observed. In orientation B,
expression occurred at a higher level and did not silence over time.
At RL5, expression of cassette 234EGFP inserted in orientations A and B
occurred at high levels and was pancellular. No silencing could be
detected over at least 6 months of culture. Nevertheless, the level of
expression in orientation B was about 1.5-fold higher than in
orientation A. The Student t test revealed that this
difference was statistically significant (P < 0.0001).
Expression of cassette CMVEGFP in orientations A and B was also
pancellular and occurred at high level, with expression in orientation
B being slightly higher than in orientation A. This difference did not
achieve statistical significance.
At RL6, pancellular expression of cassette 234EGFP was initially
observed at similar levels in both orientations, but expression in
orientation A slowly silenced over a 4-month period while expression in
orientation B remained stable. Expression of cassette CMVEGFP followed
the same pattern, with silencing of expression in orientation A being
observed after 3 to 5 months in culture in eight of nine clones.
Comparison of expression levels of the same cassette at the three loci
revealed 10-fold differences in the average GFP fluorescence for either
the 234EGFP or the CMVEGFP cassette, presumably a consequence of
different transcription rates. For both cassettes, expression was
weakest at RL6 and strongest at RL5. Furthermore, for both cassettes,
silencing occurred rapidly at RL4 and more slowly at RL6. This
illustrates the strong influence of the site of integration on both the
level of transgene expression and the rate of silencing and indicates
that the determinants of expression present at the sites of integration
influence both the CMV enhancer and the
-globin LCR fragments similarly.
MEL cells can be induced to mature into late-stage erythrocytes by a
variety of treatments, including exposure to DMSO (22). This differentiation generally strongly activates constructs with
-globin regulatory elements. Induction of differentiation with DMSO
led to a two- to threefold increase in the level of expression of
cassette 234EGFP in the cells that were expressing but did not
reactivate the silenced loci (data not shown).
TSA and 5-azaC stimulate expression at active loci.
To
investigate the role of cytosine methylation in the control of gene
expression in these cells, clones with cassettes 234EGFP or CMVEGFP in
each orientation at loci RL4, RL5, and RL6 were treated with
5-azacytidine (5-azaC), a demethylating agent (Fig. 2C)
(31). After incubation of the cells containing cassette 234EGFP with 5-azaC, the levels of expression increased 1.5- to 2-fold
in all the clones with pancellular expression. Importantly, silenced
loci could not be reactivated. With the CMVEGFP cassette, the results
were more striking, with a 5- to 10-fold-greater response than for the
234EGFP cassette and minimal effects on the silenced RL4 locus in
orientation A.
To determine if histone acetylation plays a role in transgene
regulation, the same panel of clones were treated with trichostatin A
(TSA), a histone deacetylase inhibitor (Fig. 2C) (44).
Incubation of the 234EGFP cells with 10 nM TSA for 48 h was
associated with a doubling of the level of expression at all loci in
which expression was already occurring but had little effect at the
silenced RL4 locus in the nonpermissive A orientation. Treatment of the
CMVEGFP cassette with TSA resulted in a stronger activation than did
treatment of the 234EGFP cassette. In both cases, this increase in
expression could either be due to a direct action of TSA on the
chromatin at the integration sites or be indirect. Treatment with a
combination of 10 nM TSA and 0.25 µM 5-azaC also failed to reactivate
the silenced RL4 and RL6 loci (data not shown).
Levels of expression correlate with levels of methylation.
To
test the relationship between levels of methylation and expression
patterns, we digested genomic DNA with methylation-sensitive restriction endonucleases (and their methylation-insensitive
isoschizomers when available) and performed Southern blot analyses
(Fig. 3A and B). At RL5, the locus with
the highest expression levels, cassette 234EGFP in both orientations
was almost completely unmethylated except for a small amount of
methylation in HS2, detected using AvaI. At RL4 and RL6 in
orientation B (the orientation in which expression is stable), the
results were similar to those for RL5, with an overall paucity of
methylation except at HS2 and the
-globin promoter, which were
partially methylated (Fig. 3A and B). Overall, the level of expression
correlated inversely with the degree of methylation of the
cis-regulatory sequences.

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 3.
Methylation and DNase I studies. (A) The first line
represents the functional map of the cassette (the hatched bar in the
EGFP coding sequence is the probe used for hybridization). The vertical
lines are restriction sites (A, AvaI; H, HpaII;
Pm, PmlI; Pv, PvuII; S, SnaBI). The
open circles represent unmethylated CpGs (sites at which digestion was
between 95 and 100% complete), the solid circles represent methylated
CpGs (sites at which digestion was between 0 and 5% complete), and the
shaded circles represent partially methylated CpG (sites at which
digestion was between 5 and 95% complete). Expressed cassettes were
largely unmethylated, while silenced cassettes were almost fully
methylated at all the testable CpG in HS2, the promoter, and the EGFP
coding sequence but unmethylated at HS4. The HpaII sites are
numbered for reference in the text and in Fig. 3, 4, and 5. (B)
Representative Southern blots. Genomic DNA was double digested with
PvuII plus one of the methylation-sensitive enzymes and
probed with the coding sequence of EGFP (Pv, PvuII, H,
HpaII; M, MspI; S, SnaBI; A,
AvaI). Number in parentheses refers to the restriction sites
numbered in panel A. (C) DNase I HS mapping. Nuclei were digested for
increasing times with DNase I, and genomic DNA was digested with
PvuII (Pv) and probed with the EGFP coding sequence (hatched
bar). The HSs are formed at least as well in the silenced constructs as
in the active constructs. In contrast, an HS that maps at the promoter
can be detected only in actively expressing cells.
|
|
In the silenced cell lines (RL4, orientation A, and RL6, orientation A,
after several months in culture), hypermethylation was found at all the
CpG dinucleotides tested in the EGFP coding sequences, the
-globin
promoter, and HS2. Methylation of the two CpG dinucleotides in HS3
could not be assessed due to the lack of suitable restriction
endonucleases, but an HpaII site introduced as part of the
cloning of HS2 and HS3 was partially methylated. Interestingly, HS4 was
not methylated. We concluded that at both RL4 and RL6, silencing was
associated with complete methylation of HS2, the promoter, and the
coding sequence.
DNase I hypersensitivity studies.
To determine whether the
differences in expression levels and rate of silencing between loci
were associated with different chromatin structures, we performed DNase
I hypersensitivity mapping on clones with cassette 234EGFP at loci RL4,
RL5, and RL6. These experiments revealed that strong DNase I HSs that
map to HS2 and HS3 formed at all three loci and in both orientations,
including after silencing of expression at RL4 and RL6 (Fig. 3C).
Silencing at loci RL4 and RL6 is therefore not due to the failure of HS formation. By contrast, the presence of an HS that maps to the
-globin promoter correlated with expression, showing that silencing in these cells correlates with the failure of transcriptional initiation.
Stable epigenetic imprinting of nonexpressing cassettes.
To
gain further insight into the cause of silencing and of the orientation
dependence of expression, we inverted in vivo the 234EGFP cassette
integrated at RL4, the locus with the most pronounced effect of
orientation. This was possible because the transgene remains flanked by
L1 Lox sites in opposite orientations following RMCE, allowing
inversion of the transgene if Cre recombinase is reexpressed in the
cell (1). Cells containing 234EGFP inserted at RL4 in the
permissive orientation (orientation B) were transiently transfected
with a Cre expression plasmid and were examined as pools 4 weeks later.
FACS analysis revealed that about 10% of the cells had lost expression
of EGFP (Fig. 4A).
To verify that in vivo inversion of
the cassette had indeed taken place after reexpression of Cre, cells
that had lost EGFP expression following transfection were purified by
flow cytometry, individual clones were isolated, and Southern blot
analyses were performed. This revealed that all 20 silenced clones
tested had undergone an in vivo inversion (Fig. 4B). A total of 35 clones that were still expressing EGFP after the transient transfection
of Cre were also tested by Southern blot analyses. None of these clones
had undergone an in vivo cassette inversion. Therefore, a perfect
correlation was found between in vivo inversion and the loss of
transgene expression.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 4.
In vivo inversion of the cassette does not fully
reactivate the silenced cassette. (A) In vivo inversion of cassette
234EGFP at RL4 by transient transfection of a Cre expression plasmid.
The four histograms on the left show flow cytometry analyses of pools
of cells before and 4 weeks after transient transfection with a Cre
expression plasmid. The appearance of the GFP-negative cell
subpopulation after transient Cre expression in cells containing
234EGFP in orientation B (the permissive orientation) suggests that
B-to-A inversions lead to silencing of the cassette. The absence of a
GFP-positive cell subpopulation after transient CRE expression in cells
with a cassette in orientation A suggests that A-to-B inversions do not
fully reactivate the cassette. The four dot plots on the right show
flow cytometry analyses of individual clones of cells having
undergone B-to-A or A-to-B inversions as determined by Southern blot
analyses (see Fig. 5B). Analysis of individual clones with a B-to-A
inversion confirms that active cassettes are silenced by inversion.
Analysis of individual clones with an A-to-B inversion reveals that
silenced cassettes are not fully reactivated by inversion; instead, a
low level of heterocellular expression is observed. (B) Southern blots
demonstrating the A-to-B and B-to-A inversions. (C) Summary of the in
vivo inversion experiments. Inversion from the permissive orientation
(orientation B) to the nonpermissive orientation (orientation A) leads
to transcriptional silencing. Inversion from the nonpermissive
orientation to the permissive orientation leads to a heterocellular
pattern expression instead of complete reactivation, indicating that
the cassette was epigenetically tagged while it was silenced. (D)
Southern blots illustrating the methylation analysis of the RL4
cassettes. After in vivo inversion, the cassette remains mostly
methylated (compare with Fig. 3B, RL4 orientation B results). However,
HS2 is subject to specific demethylation compared with the RL4
orientation A transgene. (E) Summary of methylation analysis after in
vivo inversion of cassette 234EGFP at RL4. The vertical lines are
restriction sites (H, HpaII-MspI; A,
AvaI; P, PmlI; S, SnaBI). The open
circles represent unmethylated CpGs, and the solid circles represent
methylated CpGs; the shaded areas represent partially methylated CpGs.
Epigenetic tagging of the A-to-B inverted cassette is associated with
retention of methylation of the promoter and the EGFP coding sequence
and with selective partial demethylation of the HS2 region.
|
|
To determine if inversion from the nonpermissive to the permissive
orientation would reactivate expression, cells with cassette 234EGFP in
orientation A were transiently transfected with the Cre expression
plasmid and examined by FACS analysis 2 to 4 weeks later. No
reactivation of EGFP could be detected (Fig. 4A). To determine if in
vivo inversions were occurring, individual clones were generated and
Southern blot analyses were performed, identifying one clone that had
undergone an inversion (Fig. 4B). Expression analysis revealed that
although this clone was now in the permissive orientation, it had not
acquired the phenotype of cells that had integrated the transgene in
the permissive orientation in the first place. Instead, expression was
heterocellular, with only 10 to 20% of the cells expressing EGFP at
levels in excess of those found in a negative control (Fig. 4A). To
generate more clones with an inversion from the nonpermissive to the
permissive orientation, cells with cassette 234EGFP in orientation A
were cotransfected with a Cre expression plasmid and a CMV-LacZ
expression plasmid. At 48 h following transfection, successfully
transfected cells were isolated by flow cytometry after staining for
LacZ expression by the FACS-gal procedure (27). Two clones
with an inversion were recovered (Fig. 4B). These clones had expression patterns similar to that of the previously isolated A-to-B inversion clone, with only a minority of expressing cells. We conclude that inversion from the nonpermissive to the permissive orientation does not
fully reactivate the transgene, indicating that an epigenetic modification is present on cassette 234EGFP in the nonpermissive orientation which is not lost upon inversion (Fig. 4C). Epigenetic tagging is known to occur in the germ line at many loci and is referred
to as genomic imprinting (26). Since the experimentally induced phenomenon that we report here in cell culture is a
superficially similar process of epigenetic tagging, we termed it
inversion-mediated imprinting.
Inversion-mediated imprinting of cassette 234EGFP is associated
with persistence of methylation in the EGFP coding sequence and the
-globin promoter and with partial demethylation of HS2.
To test
the methylation status of the cassettes after in vivo inversion, we
performed experiments similar to that described above (Fig. 4D and E).
After inversion from the permissive to the nonpermissive orientation,
the methylation pattern observed was indistinguishable from that of
clones directly recovered in the nonpermissive orientation (Fig. 3),
suggesting that in the nonpermissive chromatin context, cassettes are
efficiently de novo methylated and that no irreversible epigenetic tags
were attached to the cassette while it was in the permissive orientation.
It was of particular interest to test the methylation pattern of the
imprinted cassette (A-to-B inverted clones) because these clones
allowed us to analyze whether the failure to reactivate expression in
the majority of cells was due to the methylation of the construct.
Restriction enzyme methylation assays indicated that the
hypermethylation of the EGFP coding sequence and the
-globin
promoter was unaltered by the in vivo inversion, suggesting that
maintenance of the silent state in the otherwise permissive orientation
may be due to the conservation of the preexisting methylation patterns.
However, the degree of methylation of HS2 in the cassette imprinted by
inversion was markedly reduced compared with that in the silenced,
noninverted clones (Fig. 4D), suggesting that the small amount of
expression in the imprinted cells might be due to this partial
demethylation. This prompted us to study these cells in greater detail.
Escape from inactivation is associated with transcriptional
oscillations and methylation changes at HS2.
To determine whether
the inversion-mediated imprinting was stable or whether it would be
eliminated by serial passages in culture, we monitored these cells over
a 70-week period. The percentage of expressing cells in the imprinted
population was analyzed by measuring the proportion of cells with
fluorescence greater than a threshold defined as the 99.5th percentile
of the background fluorescence of untransfected control cells analyzed
simultaneously. This revealed that the inversion-mediated imprinting
was stable, since the proportion of expressing cells in RL4 A-to-B
inversion clones remained between 10 and 20% throughout that time in
culture (Fig. 5A). These expression
characteristics giving rise to the heterocellular pattern of expression
of this cell population were strikingly similar to the transcriptional
oscillations that we had previously observed at locus RL1
(10).

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 5.
Transcriptional oscillation of the 234EGFP cassette
imprinted by inversion is associated with selective methylation changes
at HS2. (A) In the left panel, cells with the imprinted cassette at RL4
were grown in culture for 71 weeks and the percentage of GFP-positive
cells was tested periodically. The epigenetic tag was stable over this
period since the GFP-positive fraction of cells remains between 10 and
20%. In the four middle panels, GFP-positive and GFP-negative cells
were purified by flow cytometry (x axis, forward side
scatter; y axis, green fluorescence). In the two right
panels, bar graphs are shown summarizing the percent GFP-positive cells
as a function of time when the GFP-positive and GFP-negative cell
fractions were returned to culture and monitored daily for GFP
expression. Both populations rapidly returned to the parental
phenotype, demonstrating that expression in these cells occurs by
transcriptional oscillations. (B) Methylation analyses of the two
sorted fractions with methylation-sensitive restriction nucleases: H,
HpaII; S, SnaBI; Pv, PvuII. Both the
SnaBI site in HS2 and the HpaII site 3 (see Fig.
3) are methylated twice as much in the GFP-negative cells as in the
GFP-positive cells. HpaII sites 2 and 3 (see Fig. 3) are
comethylated in 45% of the GFP-negative cells but in only 30% of the
GFP-positive cells. (C) Summary of bisulfite sequencing analysis of the
plus strand of the core of HS2. Each line represents the methylation
status of the five CpG dinucleotides of an allele (a single molecule)
of HS2. The open circles represent unmethylated CpGs, and the solid
circles represent methylated CpGs. The GFP-negative cells are generally
less methylated than the GFP-positive cells. The three CpGs near the
core of HS2 are less methylated than the two CpGs on the 3' side. Each
CpG dinucleotide therefore appears to have a specific probability of
methylation.
|
|
To test whether transcriptional oscillations were occurring, 16 individual subclones of each of these inverted clones were generated
and analyzed by flow cytometry. All the subclones displayed heterocellular expression patterns similar to those of the parental clones (data not shown), supporting the possibility that expression in
these cells is oscillating (10). To generate definitive
data, GFP-positive and GFP-negative cells from one of the inverted
clones were sorted and placed back in culture for 1 week and expression of EGFP was monitored by FACS daily (Fig. 5A). Within 48 h of the
start of culture, about 10% of the cells from the GFP-negative fraction had become positive for GFP expression. Similarly, within 7 days of the start of culture, 82% of the cells from the GFP-positive fraction had lost expression and were fluorescing below the 99.5th percentile of the control cells. Expression had therefore been silenced
in the majority of the expressing cells, and expression had been
activated in the corresponding minority of the nonexpressing cells.
Both populations had reverted to heterocellular expression patterns
similar to the parent population. Together, these data demonstrate that
the heterocellular expression patterns of the cassette imprinted by
inversion are caused by transcriptional oscillations.
To assess the role of methylation and acetylation in determining
transcriptional oscillation of the cassette imprinted by inversion, we
treated the inverted clones with 5-azaC or with TSA for 2 to 8 days.
These treatments increased the proportion of expressing cells by up to
fourfold (from about 10-20 to 40% of the cells) but did not lead to
complete reactivation of expression (data not shown). The response to
these drugs was therefore similar to what we previously reported for
RL1 (10), suggesting that the oscillations at RL1 and RL4
are caused by similar molecular mechanisms.
Methylation analysis with methylation-sensitive restriction nucleases
was performed at three time points during the 70-week growth period of
the imprinted cells (Fig. 4D and data not shown). The results of all
three analyses concurred, showing that HS2 was partly methylated in
these cells and demonstrating that the partial methylation was not
merely a transient phenomenon due to the strand breakage and religation
of the DNA sequence that occurred during the inversion but was a
temporally stable characteristic of these oscillating cells. Again,
this suggests that oscillations at RL1 and at RL4 are caused by similar
molecular mechanisms, since we had previously observed that the
transgenes that oscillate at RL1 are partially methylated in their
regulatory regions (E.E.B., unpublished data).
We then performed methylation analysis on sorted GFP-positive and
GFP-negative cells. Because of the long half-life of EGFP in these
cells (>24 h), we could only enrich rather than purify for cells with
the state of transcription of interest at the transgene locus. Despite
this caveat, the methylation analysis was informative.
Sorted GFP-positive and GFP-negative cells from the population of cells
with the imprinted 234EGFP cassette at RL4 were analyzed using
methylation-sensitive enzymes. Quantitative analysis of the restriction
patterns observed with these enzymes revealed that the coding sequence
of the EGFP reporter and the promoter were completely methylated in
both expressing and nonexpressing cells (Fig. 5B). By contrast, three
CpG sites located within HS2 and between HS2 and HS3 were partially
methylated in both populations of cells but were about 50% less
methylated in the GFP-positive than in the GFP-negative cells.
Incomplete digestion could be ruled out because complete digestion by
HpaII (site 1) could be detected on the same blots (Fig. 5B)
and because a repeat of these experiments with genomic DNA extracted
from cells sorted on a different day and with fresh enzymes yielded the
same results.
To extend these results, the methylation status of five CpG
dinucleotides within a 500-bp fragment spanning the core of HS2 was
determined by bisulfite sequencing (8), a method that
allows the determination of the methylation status of all the CpG
nucleotides within the segment tested. The sequencing of 10 clones
(each representing the positive strand of one "allele" of HS2 that
was originally present in a single cell) from each population revealed
that 32% of the CpGs in the HS2 fragment from the GFP-positive cells
were methylated whereas 56% of the CpGs in the HS2 fragment from the GFP-negative cells were methylated (Fig. 5C). Hypomethylation in
GFP-expressing cells was detectable at each of the five CpGs, but the
three CpGs located closer to the core of HS2 were on average distinctly
less methylated than the two downstream CpGs closer to the
hypermethylated promoter and EGFP coding sequences. Therefore, two
independent methods clearly indicate that the GFP-positive cells were
hypomethylated with respect to the GFP-negative fraction. Since
expression in these cells is oscillating, the simplest interpretation of these results is that methylation of the inverted cassette also oscillates.
 |
DISCUSSION |
We have tagged three genomic sites with pairs of inverted L1 Lox
sites and inserted two expression cassettes at each of these reference
loci by using RMCE. Pancellular variation in expression levels from the
same cassette integrated at different loci (stable position effects)
was observed in the presence of two unrelated enhancers (HS2, HS3, and
HS4 of the
-globin LCR and the CMV IE). Strikingly, the levels of
expression of both cassettes were affected in the same manner by the
locus of integration, with the RL5 locus allowing the strongest
expression and RL6 allowing the weakest. These results demonstrate the
presence at most integration sites of unknown determinants of
transcription rate that are dominant over two completely distinct
enhancers that both promote high levels of transcription in erythroid
cells. Silencing of expression was observed at two of the three loci
tested and occurred regardless of the enhancers present, again
demonstrating the presence at these integration sites of determinants
of transcriptional competence that are dominant over the LCR and the
CMV IE.
Orientation dependence of expression.
Surprisingly, expression
of the two cassettes was dependent on their orientations within the
reference locus. At two of the three loci (RL4 and RL6), expression was
temporally stable in one orientation but gradually silenced in the
other. At the third locus (RL5), expression was temporally stable in
both orientations but was nevertheless higher in one of the two
orientations. The nature of the sequences in the flanking chromatin
responsible for the orientation dependence is unknown. Such sequences
are probably not large blocks of heterochromatin from which chromatin condensation spreads over large distances, as has been proposed for PEV
in Drosophila (9), since inversion would not
significantly change the distance between the regulatory sequences
within the transgene and distant heterochromatic blocks that are
believed to induce silencing at distances greater than 1 Mb
(41). The simplest explanation is that the unknown
determinants of transgene expression are sequences located within a few
hundred bases of the sites of integration, combining with the
regulatory sequences of the expression cassette to cause either stable
or silencing position effects. Orientation-dependent position effect
variegation has been previously reported for the brown
transgene in Drosophila by Sabl and Henikoff
(33). These authors proposed that the orientation of the
transgene affected somatic pairing with repetitive elements that led to
inactivation. Although the transgenes inserted at RL1 are present at a
single copy in the cell, a similar phenomenon could conceivably be
occurring in MEL cells. The direction of DNA replication or
unidirectional transcription into the transgene from endogenous
promoters (24) could also be the source of the polarity of
the position effect that we observed.
Silencing in MEL cells is associated with methylation but not with
changes in DNase I HS formation.
The observation that methylation
at RL4 and RL6 correlates strongly with the level of GFP expression and
with silencing is in accordance with previous reports on silencing of
globin constructs and retroviruses in cell culture and in transgenic
mice (13, 19-21, 29). However, the formation of strong
DNase I HSs even after silencing has not been reported before, and
contrasts with previous reports by us and others that position effect
variegation on globin transgenes in mice is associated with loss of
DNase I sensitivity at the LCR (2, 13). This difference
suggests that silencing in MEL cells occurs by a mechanism that differs from silencing of globin transgenes that go through the mouse germ
line. Interestingly, HS4 was not methylated, even in completely silenced cells, suggesting that HS4 might be more resistant to methylation than HS2 is. Whether this has any functional consequences is not clear.
Inversion-mediated imprinting.
In vivo inversion toward the
permissive orientation of a silenced cassette did not lead to complete
reactivation of the cassette but instead led to a temporally stable
heterocellular pattern of expression caused by transcriptional
oscillations associated with dynamic activation and inactivation of the
transgenes. Two independent methylation assays, Southern blot and
bisulfite sequencing analyses, revealed that the GFP-positive and
GFP-negative cells have different levels of methylation of HS2 but not
of the promoter or the GFP coding sequence. Since GFP expression is
dynamic in these cells, it probably follows that the methylation of HS2
is itself dynamic. To our knowledge, dynamic methylation of an enhancer has not been previously documented but several reports have
demonstrated selective demethylation of viral enhancers in transgenes
and of regulatory sequences (18). It has been proposed
that demethylation of regulatory elements is associated with binding of
protein factors such as Sp1 in CpG islands or NF-
B in B cells
(3, 34). Studies with Xenopus and mammalian
cells suggest that factor-mediated selective demethylation is
replication dependent (17, 23). Changes in the methylation
of HS2 in the oscillating cells might therefore be mediated by
temporally unstable binding of factors capable of inducing
demethylation at HS2.
Although the causes of the instability of both expression and
methylation of the imprinted cells are not known, our results suggest
that inversion-mediated imprinting is probably related to the
methylation of the promoter and EGFP coding sequence. We previously
reported that expression of a nonimprinted transgene at a different
integration site (RL1) could oscillate at different rates depending on
the enhancer present. Transgenes therefore oscillate when they are
partly methylated because of inversion-mediated imprinting or when the
enhancer is too weak for a given integration site. We propose a model
in which competition between de novo methylation and demethylation is a
critical determinant of transgene expression. In this model, stable
position effects are due to variable and reversible levels of de novo
methylation associated with various integration sites. Silencing
position effects, on the other hand, are due to stochastic variations
in the recruitment of either the demethylation or the de novo
methylation activity, causing an individual cell to reach a threshold
of methyl-CpG density that cannot be reversed, leading in turn to
permanent silencing of the gene. In this model, the known abilities of
enhancers to prevent silencing (38), to set expression
levels (5), and to determine the rate of transcriptional
oscillation (10) would be related, at least in part, to
the capacity of these regulatory elements to bind protein factors that
promote demethylation.
The overall role of methylation in vertebrates is still debated
(37), but it is clear that methylation is involved in
X-inactivation, genomic imprinting, silencing of parasitic DNA, and
maybe silencing of tissue-specific genes. Whether the imprinting of the
cassette that we artificially created by inversion and the resulting
transcriptional oscillations that we observed mimic physiological
processes, such as those that might occur when regulatory regions are
demethylated as part of normal development, after a chromosomal
rearrangement, or after activation of an oncogene, will have to be
tested experimentally. Such a "somatic" imprinting could represent
an additional means of keeping a gene repressed even if its regulatory
sequences are demethylated, for instance by ectopic activation of a
transcription factor or by the insertion of a retrovirus. The
oscillations that appear to result from such imprinting could
potentially explain the erratic behavior of many tumor cells as well as
the extreme plasticity of stem cells in response to different
environments (40).
 |
ACKNOWLEDGMENTS |
Y.Q.F. and E.E.B. are supported by NIH grants HL55435,
HL38655, and DK56845; M.L. is supported by NIH grant GM19767; and
J.M.G. is supported by grants DK02467 and DK56786.
We thank Judith Dunai, Yale University, for technical assistance with
the FISH assay.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Division of
Hematology, Department of Medicine, Albert Einstein College of
Medicine, 1300 Morris Park Ave., Bronx, NY 10461. Phone: (718) 430 2188. Fax: (718) 824 3153. E-mail:
Bouhassi{at}aecom.yu.edu.
 |
REFERENCES |
| 1.
|
Abremski, K.,
B. Frommer, and R. H. Hoess.
1986.
Linking-number changes in the DNA substrate during Cre-mediated loxP site-specific recombination.
J. Mol. Biol.
192:17-26[CrossRef][Medline].
|
| 2.
|
Alami, R.,
J. M. Greally,
K. Tanimoto,
S. Hwang,
Y. Q. Feng,
J. D. Engel,
S. Fiering, and E. E. Bouhassira.
2000.
Beta-globin YAC transgenes exhibit uniform expression levels but position effect variegation in mice.
Hum. Mol. Genet.
9:631-636[Abstract/Free Full Text].
|
| 3.
|
Bergman, Y., and R. Mostoslavsky.
1998.
DNA demethylation: turning genes on.
Biol. Chem.
379:401-407[Medline].
|
| 4.
|
Bestor, T. H.
2000.
Gene silencing as a threat to the success of gene therapy.
J. Clin. Investig.
105:409-411[Medline].
|
| 5.
|
Bouhassira, E. E.,
K. Westerman, and P. Leboulch.
1997.
Transcriptional behavior of LCR enhancer elements integrated at the same chromosomal locus by recombinase-mediated cassette exchange.
Blood
90:3332-3344[Abstract/Free Full Text].
|
| 6.
|
Bulger, M., and M. Groudine.
1999.
Looping versus linking: toward a model for long-distance gene activation.
Genes Dev.
13:2465-2477[Free Full Text].
|
| 7.
|
Chung, J. H.,
M. Whiteley, and G. Felsenfeld.
1993.
A 5' element of the chicken beta-globin domain serves as an insulator in human erythroid cells and protects against position effects in Drosophila.
Cell
74:505-514[CrossRef][Medline].
|
| 8.
|
Clark, S. J.,
J. Harrison,
C. L. Paul, and M. Frommer.
1994.
High sensitivity mapping of methylated cytosines.
Nucleic Acids Res.
22:2990-2997[Abstract/Free Full Text].
|
| 9.
|
Dobie, K.,
M. Mehtali,
M. McClenaghan, and R. Lathe.
1997.
Variegated gene expression in mice.
Trends Genet.
13:127-130[CrossRef][Medline].
|
| 10.
|
Feng, Y. Q.,
R. Alami, and E. E. Bouhassira.
1999.
Enhancer-dependent transcription oscillations in mouse erythroleukemia cells.
Mol. Cell. Biol.
19:4907-4917[Abstract/Free Full Text].
|
| 11.
|
Feng, Y. Q.,
J. Seibler,
R. Alami,
A. Eisen,
S. N. Fiering, and E. E. Bouhassira.
1999.
Site-specific chromosomal integration in mammalian cells: highly efficient CRE recombinase-mediated cassette exchange.
J. Mol. Biol.
292:779-785[CrossRef][Medline].
|
| 12.
|
Fiering, S.,
E. Whitelaw, and D. I. Martin.
2000.
To be or not to be active: the stochastic nature of enhancer action.
Bioessays
22:381-387[CrossRef][Medline].
|
| 13.
|
Garrick, D.,
H. Sutherland,
G. Robertson, and E. Whitelaw.
1996.
Variegated expression of a globin transgene correlates with chromatin accessibility but not methylation status.
Nucleic Acids Res.
24:4902-4909[Abstract/Free Full Text].
|
| 14.
|
Graubert, T. A.,
B. A. Hug,
R. Wesselschmidt,
C. L. Hsieh,
T. M. Ryan,
T. M. Townes, and T. J. Ley.
1998.
Stochastic, stage-specific mechanisms account for the variegation of a human globin transgene.
Nucleic Acids Res.
26:2849-2858[Abstract/Free Full Text].
|
| 15.
|
Grosveld, F.
1999.
Activation by locus control regions?
Curr. Opin. Genet. Dev.
9:152-157[CrossRef][Medline].
|
| 16.
|
Grosveld, F.,
G. B. van Assendelft,
D. R. Greaves, and G. Kollias.
1987.
Position-independent, high-level expression of the human beta-globin gene in transgenic mice.
Cell
51:975-985[CrossRef][Medline].
|
| 17.
|
Hsieh, C. L.
1999.
Evidence that protein binding specifies sites of DNA demethylation.
Mol. Cell. Biol.
19:46-56[Abstract/Free Full Text].
|
| 18.
|
Hsieh, C. L.
2000.
Dynamics of DNA methylation pattern.
Curr. Opin. Genet. Dev.
10:224-228[CrossRef][Medline].
|
| 19.
|
Jahner, D.,
H. Stuhlmann,
C. L. Stewart,
K. Harbers,
J. Lohler,
I. Simon, and R. Jaenisch.
1982.
De novo methylation and expression of retroviral genomes during mouse embryogenesis.
Nature
298:623-628[CrossRef][Medline].
|
| 20.
|
Lorincz, M. C.,
D. Schubeler,
S. C. Goeke,
M. Walters,
M. Groudine, and D. I. Martin.
2000.
Dynamic analysis of proviral induction and de novo methylation: implications for a histone deacetylase-independent, methylation density-dependent mechanism of transcriptional repression.
Mol. Cell. Biol.
20:842-850[Abstract/Free Full Text].
|
| 21.
|
Luo, H. Y.,
X. L. Liang,
C. Frye,
M. Wonio,
G. V. Hankins,
D. K. Chui, and B. P. Alter.
1999.
Embryonic hemoglobins are expressed in definitive cells.
Blood
94:359-361[Abstract/Free Full Text].
|
| 22.
|
Marks, P. A., and R. A. Rifkind.
1978.
Erythroleukemic differentiation.
Annu. Rev. Biochem.
47:419-448[CrossRef][Medline].
|
| 23.
|
Matsuo, K.,
J. Silke,
O. Georgiev,
P. Marti,
N. Giovannini, and D. Rungger.
1998.
An embryonic demethylation mechanism involving binding of transcription factors to replicating DNA.
EMBO J.
17:1446-1453[CrossRef][Medline].
|
| 24.
|
Moser, T.,
K. Harbers, and K. Kratochwil.
1996.
Tissue- and stage-specific activation of an endogenous provirus after transcription through its integration site in the opposite orientation.
Mol. Cell. Biol.
16:384-389[Abstract].
|
| 25.
|
Nelson, J. A.,
J. W. J. Gnann, and P. Ghazal.
1990.
Regulation and tissue-specific expression of human cytomegalovirus.
Curr. Top. Microbiol. Immunol.
154:75-100[Medline].
|
| 26.
|
Nicholls, R. D.,
S. Saitoh, and B. Horsthemke.
1998.
Imprinting in Prader-Willi and Angelman syndromes.
Trends Genet.
14:194-200[CrossRef][Medline].
|
| 27.
|
Nolan, G. P.,
S. Fiering,
J. F. Nicolas, and L. A. Herzenberg.
1988.
Fluorescence-activated cell analysis and sorting of viable mammalian cells based on beta-D-galactosidase activity after transduction of Escherichia coli lacZ.
Proc. Natl. Acad. Sci. USA
85:2603-2607[Abstract/Free Full Text].
|
| 28.
|
Peterson, K. R.,
C. H. Clegg,
C. Huxley,
B. M. Josephson,
H. S. Haugen, and T. Furukawa.
1993.
Transgenic mice containing a 248-kb yeast artificial chromosome carrying the human beta-globin locus display proper developmental control of human globin genes.
Proc. Natl. Acad. Sci. USA
90:7593-7597[Abstract/Free Full Text].
|
| 29.
|
Pikaart, M. J.,
F. Recillas-Targa, and G. Felsenfeld.
1998.
Loss of transcriptional activity of a transgene is accompanied by DNA methylation and histone deacetylation and is prevented by insulators.
Genes Dev.
12:2852-2862[Abstract/Free Full Text].
|
| 30.
|
Porcu, S.,
M. Kitamura,
E. Witkowska,
Z. Zhang,
A. Mutero,
C. Lin,
J. Chang, and K. M. L. Gaensler.
1997.
The human beta globin locus introduced by YAC transfer exhibits a specific and reproducible pattern of developmental regulation in transgenic mice.
Blood
90:4602-4609[Abstract/Free Full Text].
|
| 31.
|
Razin, A., and H. Cedar.
1991.
DNA methylation and gene expression.
Microbiol. Rev.
55:451-458[Abstract/Free Full Text].
|
| 32.
|
Robertson, G.,
D. Garrick,
M. Wilson,
D. I. K. Martin, and E. Whitelaw.
1996.
Age-dependent silencing of globin transgenes in the mouse.
Nucleic Acids Res.
24:1465-1471[Abstract/Free Full Text].
|
| 33.
|
Sabl, J. F., and S. Henikoff.
1996.
Copy number and orientation determine the susceptibility of a gene to silencing by nearby heterochromatin in Drosophila.
Genetics
142:447-458[Abstract].
|
| 34.
|
Siegfried, Z.,
S. Eden,
M. Mendelsohn,
X. Feng,
B. Z. Tsuberi, and H. Cedar.
1999.
DNA methylation represses transcription in vivo.
Nat. Genet.
22:203-206[CrossRef][Medline].
|
| 35.
|
Stamminger, T., and B. Fleckenstein.
1990.
Immediate-early transcription regulation of human cytomegalovirus.
Curr. Top. Microbiol. Immunol.
154:3-19[Medline].
|
| 36.
|
Wakimoto, B. T.
1998.
Beyond the nucleosome: epigenetic aspects of position-effect variegation in Drosophila.
Cell
93:321-324[CrossRef][Medline].
|
| 37.
|
Walsh, C. P., and T. H. Bestor.
1999.
Cytosine methylation and mammalian development.
Genes Dev.
13:26-34[Abstract/Free Full Text].
|
| 38.
|
Walters, M. C.,
S. Fiering,
J. Eidemiller,
W. Magis,
M. Groudine, and D. I. K. Martin.
1995.
Enhancers increase the probability but not the level of gene expression.
Proc. Natl. Acad. Sci. USA
92:7125-7129[Abstract/Free Full Text].
|
| 39.
|
Walters, M. C.,
W. Magis,
S. Fiering,
J. Eidemiller,
D. Scalzo,
M. Groudine, and D. I. K. Martin.
1996.
Transcriptional enhancers act in cis to suppress position-effect variegation.
Genes Dev.
10:185-195[Abstract/Free Full Text].
|
| 40.
|
Watt, F. M., and B. L. Hogan.
2000.
Out of Eden: stem cells and their niches.
Science
287:1427-1430[Abstract/Free Full Text].
|
| 41.
|
Weiler, K. S., and B. T. Wakimoto.
1995.
Heterochromatin and gene expression in Drosophila.
Annu. Rev. Genet.
29:577-605[CrossRef][Medline].
|
| 42.
|
Widlund, H. R.,
H. Cao,
S. Simonsson,
E. Magnusson,
T. Simonsson,
P. E. Nielsen,
J. D. Kahn,
D. M. Crothers, and M. Kubista.
1997.
Identification and characterization of genomic nucleosome-positioning sequences.
J. Mol. Biol.
267:807-817[CrossRef][Medline].
|
| 43.
|
Wong, A. K., and J. B. Rattner.
1988.
Sequence organization and cytological localization of the minor satellite of mouse.
Nucleic Acids Res.
16:11645-11661[Abstract/Free Full Text].
|
| 44.
|
Yoshida, M.,
S. Horinouchi, and T. Beppu.
1995.
Trichostatin A and trapoxin: novel chemical probes for the role of histone acetylation in chromatin structure and function.
Bioessays
17:423-430[CrossRef][Medline].
|
Molecular and Cellular Biology, January 2001, p. 298-309, Vol. 21, No. 1
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.1.298-309.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Katz, R. A., Jack-Scott, E., Narezkina, A., Palagin, I., Boimel, P., Kulkosky, J., Nicolas, E., Greger, J. G., Skalka, A. M.
(2007). High-Frequency Epigenetic Repression and Silencing of Retroviruses Can Be Antagonized by Histone Deacetylase Inhibitors and Transcriptional Activators, but Uniform Reactivation in Cell Clones Is Restricted by Additional Mechanisms. J. Virol.
81: 2592-2604
[Abstract]
[Full Text]
-
Ebersole, T., Okamoto, Y., Noskov, V. N., Kouprina, N., Kim, J.-H., Leem, S.-H., Barrett, J. C., Masumoto, H., Larionov, V.
(2005). Rapid generation of long synthetic tandem repeats and its application for analysis in human artificial chromosome formation. Nucleic Acids Res
33: e130-e130
[Abstract]
[Full Text]
-
Feng, Y.-Q., Warin, R., Li, T., Olivier, E., Besse, A., Lobell, A., Fu, H., Lin, C. M., Aladjem, M. I., Bouhassira, E. E.
(2005). The Human {beta}-Globin Locus Control Region Can Silence as Well as Activate Gene Expression. Mol. Cell. Biol.
25: 3864-3874
[Abstract]
[Full Text]
-
Escher, G., Hoang, A., Georges, S., Tchoua, U., El-Osta, A., Krozowski, Z., Sviridov, D.
(2005). Demethylation using the epigenetic modifier, 5-azacytidine, increases the efficiency of transient transfection of macrophages. J. Lipid Res.
46: 356-365
[Abstract]
[Full Text]
-
Ghosh, M., Liu, G., Randall, G., Bevington, J., Leffak, M.
(2004). Transcription Factor Binding and Induced Transcription Alter Chromosomal c-myc Replicator Activity. Mol. Cell. Biol.
24: 10193-10207
[Abstract]
[Full Text]
-
Yusa, K., Takeda, J., Horie, K.
(2004). Enhancement of Sleeping Beauty Transposition by CpG Methylation: Possible Role of Heterochromatin Formation. Mol. Cell. Biol.
24: 4004-4018
[Abstract]
[Full Text]
-
Vadolas, J., Wardan, H., Orford, M., Williamson, R., Ioannou, P. A.
(2004). Cellular genomic reporter assays for screening and evaluation of inducers of fetal hemoglobin. Hum Mol Genet
13: 223-233
[Abstract]
[Full Text]
-
Chen, Z., Manley, J. L.
(2003). In Vivo Functional Analysis of the Histone 3-like TAF9 and a TAF9-related Factor, TAF9L. J. Biol. Chem.
278: 35172-35183
[Abstract]
[Full Text]
-
Lorincz, M. C., Schubeler, D., Hutchinson, S. R., Dickerson, D. R., Groudine, M.
(2002). DNA Methylation Density Influences the Stability of an Epigenetic Imprint and Dnmt3a/b-Independent De Novo Methylation. Mol. Cell. Biol.
22: 7572-7580
[Abstract]
[Full Text]
-
Eszterhas, S. K., Bouhassira, E. E., Martin, D. I. K., Fiering, S.
(2002). Transcriptional Interference by Independently Regulated Genes Occurs in Any Relative Arrangement of the Genes and Is Influenced by Chromosomal Integration Position. Mol. Cell. Biol.
22: 469-479
[Abstract]
[Full Text]
-
Lorincz, M. C., Schubeler, D., Groudine, M.
(2001). Methylation-Mediated Proviral Silencing Is Associated with MeCP2 Recruitment and Localized Histone H3 Deacetylation. Mol. Cell. Biol.
21: 7913-7922
[Abstract]
[Full Text]
-
Molete, J. M., Petrykowska, H., Bouhassira, E. E., Feng, Y.-Q., Miller, W., Hardison, R. C.
(2001). Sequences Flanking Hypersensitive Sites of the {beta}-Globin Locus Control Region Are Required for Synergistic Enhancement. Mol. Cell. Biol.
21: 2969-2980
[Abstract]
[Full Text]