Previous Article | Next Article 
Molecular and Cellular Biology, January 2001, p. 310-318, Vol. 21, No. 1
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.1.310-318.2001
Efficiency Alleles of the Pctr1 Modifier
Locus for Plasmacytoma Susceptibility
Shuling-L.
Zhang,1
Wendy
DuBois,1
Edward
S.
Ramsay,1
Valeri
Bliskovski,1
Herbert C.
Morse III,2
Leki
Taddesse-Heath,2
William C.
Vass,3
Ronald A.
DePinho,4 and
Beverly A.
Mock1,*
Laboratory of
Genetics1 and Laboratory of Cellular
Oncology,3 Division of Basic Sciences, National
Cancer Institute, and Laboratory of Immunopathology, National
Institute of Allergy and Infectious Diseases,2
National Institutes of Health, Bethesda, Maryland 20892, and
Department of Adult Oncology, Dana-Farber Cancer Institute, and
Departments of Genetics and Medicine, Harvard Medical School, Boston,
Massachusetts 021154
Received 10 August 2000/Accepted 27 September 2000
 |
ABSTRACT |
The susceptibility of BALB/c mice to pristane-induced plasmacytomas
is a complex genetic trait involving multiple loci, while DBA/2 and
C57BL/6 strains are genetically resistant to the plasmacytomagenic effects of pristane. In this model system for human B-cell neoplasia, one of the BALB/c susceptibility and modifier loci, Pctr1,
was mapped to a 5.7-centimorgan (cM) chromosomal region that included Cdkn2a, which encodes p16INK4a and
p19ARF, and the coding sequences for the BALB/c
p16INK4a and p19ARF alleles were found to be
polymorphic with respect to their resistant Pctr1
counterparts in DBA/2 and C57BL/6 mice (45). In the
present study, alleles of Pctr1, Cdkn2a, and
D4Mit15 from a resistant strain (BALB/cDAG) carrying DBA/2
chromatin were introgressively backcrossed to the susceptible BALB/c
strain. The resultant C.DAG-Pctr1 Cdkn2a D4Mit15 congenic
was more resistant to plasmacytomagenesis than BALB/c, thus narrowing
Pctr1 to a 1.5-cM interval. Concomitantly, resistant
C57BL/6 mice, from which both gene products of the Cdkn2a gene have been eliminated, developed pristane-induced plasma cell tumors over a shorter latency period than the traditionally susceptible BALB/cAn strain. Biological assays of the p16INK4a and
p19ARF alleles from BALB/c and DBA/2 indicated that the
BALB/c p16INK4a allele was less active than its DBA/2
counterpart in inducing growth arrest of mouse plasmacytoma cell lines
and preventing ras-induced transformation of NIH 3T3 cells,
while the two p19ARF alleles displayed similar potencies in
both assays. We propose that the BALB/c susceptibility/modifier locus,
Pctr1, is an "efficiency" allele of the
p16INK4a gene.
 |
INTRODUCTION |
Susceptibility to cancer in human
populations is a complex genetic trait. However, the field of cancer
susceptibility has been defined largely by studying familial human
cancers and targeted animal models that have sustained either gain- or
loss-of-function mutations in genes, resulting in phenotypes which
typically result in all-or-none responses. Therefore, the activation of
oncogenes and the loss of tumor suppressor genes have dominated the
field of cancer genetics as the effectors of tumor initiation,
promotion, and progression. In contrast to all-or-none alleles, certain
alleles of genes are partially functional, resulting in changes in the efficiencies of the proteins they encode. Due to their quantitative properties, natural alleles of genes that alter the efficiency of
protein function have remained largely elusive in experimental studies
of tumor susceptibility. However, putative "efficiency" alleles
that modify tumor susceptibility might actually occur more frequently
in people than all-or-none alleles and could make important
contributions to cancer pathogenesis.
The Pctr1 (22) and Mom1
(7) loci were among the first modifiers of tumor
susceptibility and resistance phenotypes identified by genome scans of
restriction fragment length polymorphism and simple sequence length
polymorphism markers, respectively. The Mom1 locus, occupied
by the Pla2g2a gene (6, 19), was identified as
a modifier of min (Apc), whose human ortholog is
a major determinant of colon cancer. Mom1 modifies
Apcmin mutant mice by modulating the tumor
microenvironment to control the number of adenomas that develop in
their intestines (6, 7, 19). Strains whose Mom1
locus contains a susceptibility allele have sustained a
loss-of-function frameshift mutation.
Susceptibility to plasmacytomas in mice is a complex genetic trait,
with at least five Pctr susceptibility-resistance loci determining whether mice develop hematopoietic tumors of the plasma cell lineage in response to induction with pristane, an oil which elicits a chronic inflammatory response (21, 22). The
modifier loci Pctr1, -2, and -3 are
linked to mouse chromosome 4 in noncontiguous portions of the
chromosome (21, 22, 28, 45). The cyclin-dependent kinase
inhibitor gene Cdkn2a, which encodes both
p16INK4a and p19ARF products, falls within the
Pctr1 region of chromosome 4, and BALB/cAn mice were found
to carry a rare allele of the Cdkn2a gene (45).
Until now, none of the Pctr loci have been molecularly identified, as there was no genetic evidence to directly implicate the
Cdkn2a locus or the relative roles of p16INK4a
and p19ARF in mouse plasmacytomagenesis.
In this report we provide in vivo evidence from congenic and knockout
studies that the Cdkn2a locus can modify susceptibility to
pristane-induced plasmacytomagenesis. Moreover, cell culture-based complementation studies support the conclusion that
p16INK4a is functionally impaired in BALB/cAn plasma cells
and can be specifically corrected by the DBA/2 allele. In contrast, the
biological potencies of BALB/c and DBA/2 p19ARF were found
to be identical. Correspondingly, p16INK4a, but not
p19ARF, from BALB/c mice was less effective than DBA/2
p16INK4a at suppressing ras transformation in
NIH 3T3 cells.
 |
MATERIALS AND METHODS |
Mice.
BALB/cDAG mice were obtained from Hillyard Festenstein
(Laboratory Animal Center, Carshalton, England). They were originally created by immunizing BALB/c mice with cells bearing LY6 alloantigens from DBA/2 mice. When these mice were brought into our conventional colony, we performed a modest genome scan and identified DBA markers as
passenger segments on chromosomes 3 (D3Mit21), 4 (Mtv13), 11 (D11Mit2), 15 (Ly6), and
17 (Qa). BALB/cDAG mice were found to be resistant to
plasmacytomagenesis. C.DAG-Mtv13 mice were created from the
BALB/cDAG mice by introgressively backcrossing DBA/2 Mtv13
and D4Lgm1 alleles onto a BALB/c background. DBA/2 alleles on chromosomes 2, 11, 15, and 17 were actively selected against, and
the subsequent C.DAG-Mtv13 mouse carried BALB/c alleles on these chromosomes. This strain was found to carry approximately 6 centimorgans (cM) of genetic material from DBA/2 mice. When BALB/c mice
were found to carry a rare allele of Cdkn2a, we made the
C.DAG-Cdkn2a D4Mit15 N20F5 mouse by selecting for DBA/2
alleles of Cdkn2a and D4Mit15 and BALB/c alleles
of Mtv13. This mouse was found to carry approximately 1.5 cM
of DBA chromatin surrounding the Cdkn2a and
D4Mit15 loci.
The INK4a knockout mice, with portions of exons 2 and 3 replaced by a neo cassette, were bred at Albert Einstein
College of Medicine to N3F3 (36). They were transferred to
a conventional mouse facility at the National Institutes of Health,
where they were backcrossed onto the C57BL/6N background for an
additional generation. Mice heterozygous for the knockout were
intercrossed, and homozygous mice (N4F4) were tested for susceptibility
and resistance to plasmacytomagenesis following two 0.5-ml injections of pristane. The N4F4 mice were examined for allelic variation at three
microsatellite markers per chromosome, with special emphasis on markers
linked to the Pctr1 to -4 and Pctm
modifier loci. For each interval examined, 129 mice carried the same
allele as resistant C57BL/6 and DBA/2 mice. Specifically, 129 mice were
identical to C57BL/6 mice at the Cdkn2a locus.
Mice were examined for plasma cell tumors by examination of
Wright- Giemsa-stained slides of peritoneal ascites fluid
cytospins. Autopsies of congenic strains were performed as the mice
developed tumors over the course of 360 days, and autopsies of knockout mice were performed at day 120 postpristane due to the significant morbidity observed in the mice. Tissues were embedded in paraffin, sectioned, and stained with hematoxylin and eosin (American HistoLabs Labs, Gaithersburg, Md.).
Construction of expression plasmids.
DBA/2N (wild-type)
p16INK4a and p19ARF cDNAs were cloned into
pBluescript KS. The BALB/c-derived variants A134C (H18P), G232A (V51I), and A134C+G232A of p16INK4a and BALB/c p19ARF
variant G257A (R72H) were constructed by PCR-directed mutagenesis with
Pfu polymerase (Stratagene) (13). The following
primers generated the A134C variant: (forward)
TGTGCCTGACGTGCGGGCACT and (reverse)
AGTGCCCGCACGTCAGGCACA. Primers (forward)
GGCAACGTTCACATAGCAGCTCTTC and (reverse)
GAAGAGCTGCTATGTGAACGTTGCC generated the G232A and G257A
variants of p16INK4a and p19ARF, respectively.
The wild-type and variant sequences of p16INK4a and
p19ARF were cloned into the pcDNA3.1 vector (Invitrogen).
All p16INK4a and p19ARF plasmids were confirmed
by direct sequencing of isolated plasmids (fmol DNA Sequencing System; Promega).
Cell culture and transfection.
MOPC460 and TEPC1165 cells
were cultured in RPMI 1640-2 mM L-glutamine-10% fetal
calf serum-50 µM
-mercaptoethanol with 3.6 ng of interleukin 6 (IL-6)/ml (40 U/ml) at 37°C in 5% CO2 to a maximum
density of 5 × 105/ml. All plasmids used in
transfection experiments were purified twice in cesium
chloride-ethidium bromide gradients (34). The cells were
pelleted and resuspended to a concentration of 107/0.25 ml;
they were electroporated at room temperature with a Cell-Porator (Life
Technologies, Inc., Gaithersburg, Md.) at 180 V and 1,600 µF at the
low-resistance setting (3). The cells were diluted in 10 ml of medium and incubated for 48 h before fluorescence-activated
cell sorter analysis. NIH 3T3 cells were grown in Dulbecco's modified
Eagle's medium supplemented with 10% fetal calf serum and 1%
penicillin and streptomycin at 37°C in 5% CO2. The cells
were split into 100- by 15-mm tissue culture dishes (5 × 105 cells/dish) 5 h prior to transfection. The calcium
phosphate transfection method (34) was used for NIH 3T3
cells with slight modification. All transfections were done in
duplicate in each experiment, and all experiments were performed at
least three times. p16INK4a protein levels were
overexpressed at 4, 16, 24, and 48 h posttransfection (data not
shown) as detected by standard Western blot analysis using rabbit
polyclonal anti-p16 antibody (catalog no. SC-1207; Santa Cruz) followed
by incubation with a sheep anti-rabbit immunoglobulin linked with
horseradish peroxidase.
Cell cycle arrest analysis.
Cells were transiently
cotransfected with pEGFPF (2 µg), an enhanced membrane-targeted green
fluorescent protein farncsylated (EGFPF) construct (14),
and one of the p16INK4a or p19ARF constructs
described above (18 µg). The cells were harvested 48 h
posttransfection. Dead cells were removed with Ficoll-Paque (Pharmacia
Biotech), and the remaining live cells were washed twice with
phosphate-buffered saline (containing 0.1% bovine serum albumin and
0.1% EDTA) and fixed in 70% ethanol for 1 h at 4°C. The fixed
cells were washed once with phosphate-buffered saline containing 0.1%
bovine serum albumin and 0.1% EDTA; DNA was stained with propidium
iodide (50 µg/ml) containing 250 µg of RNase A/ml for 30 min at
room temperature. Flow cytometry analysis was conducted with a
Becton-Dickinson FACScan. EGFPF was used as a marker for analysis of
transfected cells. The gate was set to select EGFPF-positive cells with
a green fluorescent signal at least 40 times stronger than that of
negative cells. The DNA content from at least 4,000 EGFPF-positive
cells is presented in the DNA histograms. Modfit LT software (Verity
Software House, Inc.) was used to analyze DNA content and determine the
percentage of cells in the G1, S, and G2/M
phases of the cell cycle. To analyze apoptosis in response to
adriamycin treatment, 4 × 105 cells/ml were treated
with adriamycin (Sigma, St. Louis, Mo.) and assayed by FACScan analysis
of Annexin V-fluorescein isothiocyanate binding (Oncogene Research
Products, Cambridge, Mass.) at four time points within 24 h of
treatment. The percentage of specific apoptosis was calculated as
100 × (experimental apoptosis
spontaneous apoptosis)/(100
spontaneous apoptosis) (33).
Ras transformation assays.
NIH 3T3 cells were maintained in
Dulbecco's modified Eagle's medium containing 10% fetal calf serum,
and fresh medium was added twice a week. For transfection, cells were
plated in 35-mm-diameter dishes at a density of 105/plate,
and transfection was performed using the standard calcium phosphate
method (44). NIH 3T3 cells were transfected using a
constant amount of v-ras (150 ng) expression plasmid (pPA90) and an increasing amount of DBA/2 p16 or p19 or BALB/c p16 or p19. Foci
were counted 7 days after transfection.
 |
RESULTS |
Congenic strains of mice with DBA/2 alleles of genes surrounding
Cdkn2a are relatively resistant to tumor induction.
In
previous experiments, congenic strains of mice carrying DBA/2 alleles
on a BALB/c background had limited the location of Pctr1 to
a 5.7-cM interval on mouse chromosome 4 (28). In this study, a new strain was constructed to carry an interval of 1 to 2 cM
composed of DBA/2 alleles surrounding Cdkn2a and
D4Mit15 on a BALB/c background. This strain was found to be
significantly more resistant (Fig. 1)
than BALB/c. These results served to narrow the genetic interval
surrounding the Pctr1 modifier locus from a 5.7- to a 1.5-cM
interval, an interval found to retain the DBA alleles of
Cdkn2a and D4Mit15.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 1.
C.DAG-Pctr1 Cdkn2a D4Mit15 mice carry a
1.5-cM segment derived from DBA/2 chromatin (DBA alleles at
Cdkn2a and D4Mit15; BALB/c alleles at
Jun and D4Mit187) and were found to be resistant
to plasmacytomagenesis relative to the susceptible BALB/cAn strain.
Chr, chromosome.
|
|
Knockout mice for the Cdkn2a locus
(INK4a
2/3 knockouts) develop accelerated
plasmacytomagenesis.
INK4a
2/3 mice, which were
generated by deleting exons 2 and 3 of the Cdkn2a locus
(36), are functional knockouts for both
p16INK4a and p19ARF genes, which share exons 2 and 3 of the Cdkn2a locus. To determine if the
Cdkn2a locus influences susceptibility to plasmacytoma development, homozygous and heterozygous mutant
(INK4a
2/3) C57BL/6 mice, as well as wild-type C57BL/6
and BALB/cAn mice, were treated with pristane and examined for plasma
cell tumors. The normal induction regimen for BALB/cAn involves three
0.5-ml intraperitoneal injections of pristane given at 60-day
intervals, with plasmacytomas developing in 50 to 60% of the mice
between 180 and 350 days after the first injection (Fig. 1 and
2). Remarkably, among 30 treated
INK4a
2/3 knockout mice, 1 mouse developed a plasmacytoma
60 days after the first pristane injection (Fig. 2, left inset) and
three additional cases were noted by 120 days after the first injection
(Fig. 2). Histopathologic sections of tissues obtained at autopsy
identified an additional mouse with a plasmacytoma and seven more mice
with large numbers of atypical plasma cells; two of these mice also had
diffuse large-cell lymphomas. Three other pristane-treated knockout
mice developed histiocytic sarcomas. No plasmacytomas were observed in
untreated mice or in pristane-treated C57BL/6 mice or mice
heterozygous for the INK4a
2/3 allele (Fig. 2).
Thus, the Cdkn2a locus can modify both the incidence and latency of plasma cell tumor development.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 2.
Cdkn2a (INK4a 2/3;
p16INK4a and p19ARF) knockout (ko) mice on the
C57BL/6 genetically resistant background develop plasmacytomas (PCTs)
with a shorter latency period than that seen in BALB/cAnPt mice. Mice
were given two 0.5-ml intraperitoneal injections of pristane at days 0 and 60. Homozygous knockout mice were autopsied at day 120 due to their
significant morbidity. Insets are photomicrographs of
Wright-Giemsa-stained slides of peritoneal exudate cells from knockout
(left) and normal (right) mice.
|
|
As is true of Burkitt's lymphoma in humans, myc activation
by translocation has been considered the hallmark lesion of mouse plasmacytomas, with approximately 90 to 95% of pristane-induced plasma
cell tumors harboring t(12;15) translocations between myc and IgH sequences that are detectable by Southern blot and
PCR analyses (18). Strikingly, only one of four plasma
cell tumors that arose in the homozygous null INK4a
2/3
mice was found to harbor a t(12;15) translocation involving the myc oncogene and IgH
sequences. This tumor was
the one that had arisen within the first 60 days post-pristane
treatment. Northern blot analysis of the four tumors from
INK4a
2/3 mice revealed that the Myc
transcript from the tumor harboring a t(12;15) translocation was in
high abundance and smaller in size, consistent with a translocation
junction between exons 1 and 2. In contrast, three tumors with
undetectable translocations expressed lower levels of Myc
which were the same size as germ line transcripts (data not shown). The
most straightforward interpretation of these results is that
myc activation by translocation may not be necessary for
plasmacytoma development in the Cdkn2a null background, although myc activation, when it does arise, may serve to
accelerate the tumorigenic process in these mice. However, in the
absence of karyotypic data, it remains possible that
low-Myc-expressing tumors might have sustained a
translocation that was undetectable by Southern blot and PCR analyses.
Allelic variants in the p16INK4a locus differ in their
abilities to induce G1 arrest.
The susceptibility of
the INK4a
2/3 mice to pristane-induced plasmacytomas
implied that the Pctr1 modifier locus in BALB/c mice might
be represented by the gene for p16INK4a or
p19ARF alone or both genes together. Alleles of the
Cdkn2a locus contain sequence differences in exon 1
and
exon 2 of the p16INK4a gene and in exon 2 of the
p19ARF gene (45). BALB/cAnPt and ABP/Le mice
have rare alleles of the p16INK4a gene (encoding proline
and isoleucine at positions 18 and 51, respectively) and the
p19ARF gene (encoding histidine at amino acid 72) in
contrast to DBA/2N and C57BL/6 mice, which carry the more common allele
for these two genes (encoding histidine and valine at positions 18 and
51 in p16INK4a and arginine at position 72 in
p19ARF). Therefore, the sequence divergence between the
BALB/c and DBA/2 coding regions of the two genes made both genes
potential candidates for the Pctr1 modifier. To determine
whether one or both genes could be implicated as the modifier, we
initially compared the abilities of the BALB/c and DBA/2 coding
sequences of p16INK4a and p19ARF to inhibit
cell growth, since several studies have shown that overexpression of
either p16INK4a or p19ARF can lead to cell
cycle arrest in G1 (17, 31).
NIH 3T3 and two plasmacytoma cell lines derived from BALB/cAn mice were
transiently transfected with isogenic BALB/c and DBA/2 allelic variants
of these genes. Overexpression of the DBA/2 p16INK4a
variant led to G1 arrest for both plasmacytoma cell lines,
MOPC460 and TEPC1165 (Fig. 3), with
almost twice as many cells in G1 compared to cells
transfected with the empty vector. In contrast, when the BALB/c
p16INK4a allele was overexpressed in the same cell lines,
there was only a marginal increase (2 to 6%) in the proportion of
cells in G1. Thus, the proliferative phenotype of the
plasmacytoma cell lines could be rescued by overexpression of the more
common (or wild-type) allele, while the BALB/c variant of p16 was much
less efficient in inducing G1 arrest.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 3.
Cell cycle analysis of DBA/2 and BALB/cAn variants of
p16INK4a. Overexpression of DBA/2N, but not BALB/cAnPt,
p16INK4a by transient transfection can lead to
G1 arrest in plasmacytoma cell lines. The inefficiency of
p16INK4a function in BALB/cAn is largely attributable to
the codon change seen in exon 1 . DNA content was measured by
propidium iodide (PI) staining. All transfections were done in
duplicate in each experiment, and all experiments were performed at
least three times. The means and standard errors across experiments for
the number of TEPC1165 cells in G1 are as follows: empty
vector, 37 ± 3.2; DBA p16, 69 ± 3.5; BALB exon 2, 58 ± 2.2; BALB exon 1, 37 ± 0.3; BALB/c p16, 37 ± 0.7. The
means and standard errors across experiments for the number of MOPC460
cells in G1 are as follows: empty vector, 20 ± 1.5;
DBA p16, 40 ± 4; BALB exon 2, 30 ± 1; BALB exon 1, 22 ± 1.5; BALB/c p16, 21 ± 2.
|
|
To investigate whether one or both of the codon changes in the BALB/c
p16INK4a allele was functionally relevant to the genetic
inhibitory activity, constructs were engineered which contained only
the exon 1
or exon 2 BALB/c variants. When expressed in the
plasmacytomas, the exon 1
mutant allele was as deficient as the
BALB/c variant allele (Fig. 3) while the exon 2 mutant construct was
almost as active as the DBA/2 allele. The greater impairment of the
exon 1
mutant correlates with its variant amino acid (proline versus
histidine at residue 18) being less conservative than the exon 2 variant amino acid (isoleucine to valine at residue 51).
Overexpression of BALB/c or DBA/2 p19ARF variants leads
to p53-dependent growth arrest.
To determine whether the genetic
polymorphism in exon 2 of the Cdkn2a locus affected
p19ARF function, isogenic constructs containing the
variants were transiently transfected into the two plasmacytoma cell
lines and also into NIH 3T3 cells. Both p19ARF alleles were
equally efficient at inducing G1 arrest in NIH 3T3 and
TEPC1165 cells (Fig. 4), a finding in
accord with the highly conservative nature of the amino acid
substitution (histidine versus arginine at residue 72). Almost twice as
many NIH 3T3 and TEPC1165 cells were in G1 following
transfection with either construct compared with cells transfected with
the empty vector. These results argue that the exon 2 sequence
divergence in the BALB/c p19ARF gene does not render its
product less active biologically than the DBA/2 p19ARF.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 4.
Cell cycle analysis of BALB/cAnPt and DBA/2N
p19ARF allelomorphs indicated normal function of each
allele. Ectopic expression of all p19ARF variants led to
G1 growth arrest in NIH 3T3 fibroblasts and TEPC1165
plasmacytoma cells but not in the p53 compromised MOPC460 plasmacytoma
cells. PI, propidium iodide.
|
|
Unexpectedly, MOPC460 plasmacytoma cells did not undergo G1
arrest when either allele of the p19ARF gene was
overexpressed. p19ARF is known to induce cell cycle arrest
and apoptosis by blocking the ability of Mdm2 to target p53
for degradation (2, 27, 39, 46, 47), suggesting that the
failure of p19ARF variants to induce G1 arrest
in MOPC460 could be due to alterations in MDM2 or p53 signaling. p53
mRNA and protein levels were found to be equivalent in all cell lines
except for MOPC460, which had high levels of p53 expression (data not
shown). cDNA and genomic sequencing of the p53 genes in a total of five
plasmacytoma cell lines revealed that four (TEPC1165, X24, TEPC2027,
and MOPC265) of the five lines contained only wild-type p53 while that
of MOPC460 harbored a 21-bp in-frame deletion involving the splice
acceptor site of exon 5. To determine if the MOPC460 p53 gene was
functionally compromised, we treated both TEPC1165 and MOPC460 cells
with adriamycin, an agent that induces cell cycle arrest and apoptosis
(38). At 24 h after the start of adriamycin treatment
(0.5 µg/ml), almost 50% of TEPC1165 cells were arrested in
G2/M and exhibited apoptosis. In contrast, approximately
90% of the MOPC460 cells were arrested in G2/M, and modest
levels of apoptosis were observed (Fig.
5). Taken together, the results suggest
that the p53 pathway is intact in most plasmacytoma cell lines but that
it is altered in MOPC460 by the in-frame p53 deletion specific to this
cell line.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 5.
TEPC1165 (wild-type p53) and MOPC460 (21-bp deletion of
p53) plasmacytoma cells differed in induction of specific apoptosis
induced by adriamycin treatment (0.1 to 0.5 µg/ml). MOPC460 cells
exhibited attenuated apoptotic responses following treatment with
adriamycin.
|
|
Inhibition of ras transformation by
p16INK4a or p19ARF.
To further test the
relative biological activities of the BALB/c and DBA/2
p16INK4a and p19ARF proteins, we compared their
abilities to inhibit focal transformation induced by an oncogenic
ras. In these experiments, NIH 3T3 cells, in which the
endogenous Cdkn2a locus is mutationally inactivated (30, 31), were cotransfected with a constant amount of
v-ras and increasing amounts of DBA/2 p16 or p19 or BALB/c
p16 or p19 (44). Under these conditions,
p16INK4a and p19ARF from either mouse strain
inhibited the formation of ras-transformed foci in a
dose-dependent manner (Fig. 6). However,
the BALB/c p16INK4a, at any of three different doses, was
less efficient than its DBA/2 counterpart, while the BALB/c
p19ARF variant was as active as DBA/2 p19ARF in
suppressing ras transformation. These results therefore
parallel those obtained with the plasmacytoma cell lines in showing
that the BALB/c p16INK4a is less active than that of DBA/2,
while p19ARF proteins from both strains appear to possess
similar degrees of activity. Furthermore, in contrast to the low
activity of BALB/c p16INK4a in the G1 arrest
assay of the plasmacytomas, its dose-dependent ability to inhibit
ras-induced transformation clearly indicates that BALB/c
p16INK4a retains biological activity.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 6.
Inhibition of ras-mediated focus formation.
(A and B) Cotransfection of BALB/c and DBA/2 variants of
p16INK4a in pcDNA3.1 with v-ras in NIH 3T3
cells. The percentages of residual foci formed relative to the foci
detected on the plates transfected with ras alone are shown.
(C and D) Cotransfection of BALB/c and DBA/2 variants of
p19ARF in pcDNA3.1 with v-ras in NIH 3T3 cells.
The transfection assays were repeated three times with similar
results.
|
|
 |
DISCUSSION |
The current data provide evidence that efficiency alleles of the
p16INK4a gene are likely to serve as modifiers of plasma
cell tumor susceptibility among inbred strains of mice. In the present
congenic mouse studies, the Pctr1 interval was narrowed from
5.7 to 1.5 cM by introgressively backcrossing resistant DBA/2 alleles
from the Pctr1 interval, which includes Cdkn2a,
onto a susceptible BALB/c background. Compared with wild-type BALB/cAn
mice, the congenic displayed a delayed onset of plasmacytomagenesis and
decreased tumor incidence. Although the DBA/2 Cdkn2a locus
was present in the congenic strain, it could not be determined whether
the Pctr1 modifier was the Cdkn2a locus or
another tightly linked DBA/2 gene within the congenic interval. In the
knockout studies, the impact of the Cdkn2a locus on
plasmacytoma susceptibility is underscored by the short latency period
and increased incidence of clinically apparent tumors by 120 days after
pristane treatment, even though the knockout of the Cdkn2a
locus was on the plasmacytoma-resistant C57BL/6 (N4) background strain.
In models of accelerated plasmacytomagenesis, by the
INK4a
2/3 knockout or by the inoculation of retroviruses
harboring combinations of myc and ras or
abl oncogenes (20, 43), it is plausible to
hypothesize that the shorter latency period results from fewer required
genetic changes. Consistent with this possibility, rearrangement of the
myc gene does not occur in the retroviral systems
(43) and was identified in only one out of four plasma
cell tumors that arose in the INK4a
2/3 knockout mice by
assays that can identify rearrangement of myc in more than
90% of these tumors in BALB/c mice.
Fibrosarcomas and lymphomas have been the two most common spontaneous
tumor types described for the INK4a
2/3 knockout of the
Cdkn2a locus and for p19ARF knockout mice
(15, 36). These tumors developed more slowly than those in
the present study and were either spontaneous or induced with two-stage
carcinogenesis protocols involving the reagents DMBA and UVB commonly
used to induce skin tumors. In this report, the plasma cell tumors were
induced with pristane, which promotes chronic inflammation and
increased production of IL-6 (29, 37). The short latency
period for plasmacytoma formation in the INK4a
2/3
knockout mice probably results from inactivation of both
p16INK4a and p19ARF, which disrupt the Rb and
p53 pathways, respectively. In our present studies, BALB/c mice exhibit
partially impaired p16INK4a function but appear to have an
intact p19ARF-mdm2-p53 pathway in normal cells and in most
plasmacytomas. The longer tumor latency period in BALB/c mice probably
results from the partially functional p16INK4a gene and
completely functional p19ARF gene. The development of the
tumors in the knockout mice resulted from the homozygous disruption of
the Cdkn2a locus, since neither the C57BL/6 mice nor the
INK4a
2/3 heterozygotes developed plasma cell tumors. The
tumor incidence studies in the Cdkn2a knockouts support the
view that one or both of the genes included in the Cdkn2a
locus govern susceptibility to pristane-induced plasmacytomagenesis.
Since the Cdkn2a locus includes two genes that inhibit cell
growth, several biological studies were carried out to determine whether the BALB/c modifier locus was a result of p16INK4a
and/or p19ARF alleles. In two different assays, the BALB/c
p16INK4a protein variant was found to be less active than
DBA/2 p16INK4a, while the p19ARF variants of
the two strains behaved similarly. Overexpression of the BALB/c allele
was not sufficient to induce G1 arrest in mouse plasma cell
tumor lines. Furthermore, overexpression of the wild-type (DBA/2 and
C57BL/6) allele of p16INK4a was able to complement the
defect inherent in the BALB/c-derived plasma cell tumor lines.
Inefficient BALB/c p16INK4a may allow phosphorylation of Rb
and its release from promoter-bound E2F transcription factor, which
leads to the transactivation of several genes involved in S-phase
progression (24, 42); this results in cells progressing
through the cell cycle and allows for sustained rounds of
proliferation. Our present biological studies support the notion that
BALB/c p16INK4a is less effective in inducing
G1 arrest and that it could in fact contribute to continued
rounds of B-cell proliferation and the possible accumulation of further
genetic changes, leading to neoplasia.
In another bioassay, the abilities of the alleles to inhibit focal
transformation of NIH 3T3 cells by activated ras were
examined. Activation of the Ras pathway has been implicated in mouse
plasmacytomas, since the combination of constitutively active
ras and myc can collaborate to induce
plasmacytomas (20) whose growth is dependent upon IL-6
(5). IL-6 can activate the Ras pathway (23,
26). In the in vitro ras transformation assay, we
found, in four separate assays, that BALB/c p16INK4a
suppressed ras-induced transformation in a dose-dependent
manner, although this allele was less efficient than the DBA allele.
These biological results confirm the relevance of our previous
biochemical assays for BALB/c versus DBA/2 p16INK4a
proteins. Taken together, these data argue that the Pctr1
modifier is encoded by the p16INK4a gene and that the
BALB/c p16INK4a allele is functional, but less active, than
the more common allele found in DBA/2 and C57BL/6 mice. Using the cell
cycle and ras suppression bioassays, the BALB/c and DBA/2
p19ARF proteins were found to be equally active. Therefore,
we have no evidence that the p19ARF gene is part of the
Pctr1 modifier, although it remains possible that other
assays might uncover biological differences between them.
In contrast to the Pctr1 plasmacytoma modifier described
here, mouse strains which carry the recessive susceptibility allele of
the Mom1 modifier have sustained a frameshift
loss-of-function mutation in its encoded PLA2G2A protein
(19). In the plasmacytoma system, the recessive
susceptible allele (a single-base substitution) encodes a mutant
full-length p16INK4a protein that is less efficient
biologically and biochemically. Our data are in keeping with
information derived from studies of a growing number of disease gene
alleles in which point mutations account for differences in disease
susceptibility (1, 4, 10, 11, 35, 41).
The molecular identification of modifier loci leading to a genetic
predisposition for mouse plasmacytomas provides a powerful model for
predicting genes and pathways involved in the etiologies of a variety
of human B-cell neoplasias. Recently, a multiple-myeloma patient was
described who was a member of a melanoma-prone family and had a germ
line mutation in the Cdkn2a locus consisting of a
duplication of the first eight codons of the p16INK4a gene,
a lesion previously identified in other melanoma-prone families
(8). Subsequent analysis of bone marrow plasma cells from
the patient revealed loss of the wild-type CDKN2A allele. The results
reported here should stimulate efforts to identify similar linkage in
humans afflicted with plasmacytomas, Burkitt's lymphomas, and multiple
myelomas. In many human and mouse tumors, it is already known that
there is somatic selection against functional CDKN2A by either
homozygous deletion or hypermethylation (9, 12, 16, 25, 32,
40). Relatively few tumors outside of melanoma and certain
digestive cancers have shown missense mutations in the
p16INK4a gene (32). Our results suggest that
single-base changes in important growth-regulatory genes, particularly
when they are present as several defective efficiency alleles, may be
frequent predisposing events in tumorigenesis.
The majority of human cancers are not the clear result of
predisposition determined by a single genetic defect. Instead, they are
likely to represent the outcome of complex interactions between multiple genetic alleles and environmental factors. Mouse plasma cell
tumors provide a model system for studying neoplastic processes which
result from the complex interplay among several predisposing genetic
factors and environmental stresses.
 |
ACKNOWLEDGMENTS |
We acknowledge Richard Nordan, who passed away during the course
of these studies, and his colleague Cindy Thompson for providing us
with IL-6 and valuable advice concerning transfections of plasmacytoma cells. We thank Wei Jiang for providing us with the EGFPF vector for
use in our transfections and Han-Woong Lee for advice on breeding the
p16 knockout mice. In addition, we thank Douglas Lowy for his
insightful editorial comments and Xiaolan Qian for her involvement in
the ras transformation assays.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Bldg. 37, Rm.
2B-08, 37 Convent Dr., MSC 4255, NCI, NIH, Bethesda, MD 20892-4255. Phone: (301) 496-2360 or (301) 496-3381. Fax: (301) 402-1031. E-mail: bev{at}helix.nih.gov.
We dedicate this paper to the memory of Richard P. Nordan.
 |
REFERENCES |
| 1.
|
Ahmad, N. N.,
M. D. Barbosa de Melo,
A. D. Singh,
L. A. Donoso, and J. A. Shields.
1999.
A possible hot spot in exon 21 of the retinoblastoma gene predisposing to a low penetrant retinoblastoma phenotype?
Ophthalmic Genet.
20:225-231[CrossRef][Medline].
|
| 2.
|
Bates, S.,
A. C. Phillips,
P. A. Clark,
F. Stott,
G. Peters,
R. L. Ludwig, and K. H. Vousden.
1998.
p14ARF links the tumor suppressors RB and p53.
Nature
395:124-125[CrossRef][Medline].
|
| 3.
|
Brown, R. T.,
I. Z. Ades, and R. P. Nordan.
1995.
An acute phase response factor/NF- B site downstream of the junB gene that mediates responsiveness to interleukin-6 in a murine plasmacytoma.
J. Biol. Chem.
270:31129-31135[Abstract/Free Full Text].
|
| 4.
|
Carter, A. M.,
A. J. Catto, and P. J. Grant.
1999.
Association of the alpha-fibrinogen Thr312Ala polymorphism with poststroke mortality in subjects with atrial fibrillation.
Circulation
99:2423-2426[Abstract/Free Full Text].
|
| 5.
|
Clynes, R. J.,
J. Wax,
L. W. Staton,
S. Smith-Gill,
M. Potter, and K. B. Marcu.
1988.
Rapid induction of IgM secreting murine plasmacytomas by pristane and an IgH promoter-enhancer driven c-myc/v-Ha-ras retrovirus.
Proc. Natl. Acad. Sci. USA
85:6067-6071[Abstract/Free Full Text].
|
| 6.
|
Cormier, R. T.,
K. H. Hong,
R. B. Halberg,
T. L. Hawkins,
P. Richardson,
R. Mulherkar,
W. F. Dove, and E. S. Lander.
1997.
Secretory phospholipase Pla2g2a confers resistance to intestinal tumorigenesis.
Nat. Genet.
17:88-91[CrossRef][Medline].
|
| 7.
|
Dietrich, W. F.,
E. S. Lander,
J. S. Smith,
A. R. Moser,
K. A. Gould,
C. Luongo,
N. Borenstein, and W. Dove.
1993.
Genetic identification of Mom-1, a major modifier locus affecting Min-induced intestinal neoplasia in the mouse.
Cell
75:631-639[CrossRef][Medline].
|
| 8.
|
Dilworth, D.,
L. Liu,
A. K. Stewart,
J. R. Berenson,
N. Lassman, and D. Hogg.
1999.
Germline CDKN2A mutation implicated in predisposition to multiple myeloma.
Blood
95:1869-1871[Abstract/Free Full Text].
|
| 9.
|
Drexler, H. G.
1998.
Review of alterations of the cyclin-dependent kinase inhibitor INK4 family genes p15, p16, p18 and p19 in human leukemia-lymphoma cells.
Leukemia
12:845-859[CrossRef][Medline].
|
| 10.
|
Farker, K.,
M. H. Lehmann,
R. Kastner,
J. Weber,
V. Janitzky,
J. Schubert, and A. Hoffmann.
2000.
Analysis of point mutation in exon 2 of CYP2E1 gene in renal cell/urothelial cancer patients in comparison with control population.
Int. J. Clin. Pharmacol. Ther.
38:30-34[Medline].
|
| 11.
|
Ford, M. E., and D. C. Whitcomb.
1999.
Analysis of the hereditary pancreatitis-associated cationic trypsinogen gene mutations in exons 2 and 3 by enzymatic mutation detection from a single 2.2-kb polymerase chain reaction product.
Mol. Diagn.
4:211-218[CrossRef][Medline].
|
| 12.
|
Haidar, M. A.,
X.-B. Cao,
T. Manshouri,
L. L. Chan,
A. Glassman,
H. M. Kantarjian,
M. J. Keating,
M. S. Beran, and M. Albitar.
1995.
p16INK4a and p15INK4b gene deletions in primary leukemias.
Blood
86:311-315[Abstract/Free Full Text].
|
| 13.
|
Ho, S. N.,
H. D. Hunt,
R. M. Horton,
J. K. Pullen, and L. R. Pease.
1989.
Site-directed mutagenesis by overlap extension using the polymerase chain reaction.
Gene
77:51-59[CrossRef][Medline].
|
| 14.
|
Jiang, W., and T. Hunter.
1998.
Analysis of cell-cycle profiles in transfected cells using a membrane-targeted GFP.
BioTechniques
24:348-354.
|
| 15.
|
Kamijo, T.,
F. Zindy,
M. F. Roussel,
D. E. Quelle,
J. R. Downing,
R. A. Ashmun,
G. Grosveld, and C. J. Sherr.
1997.
Tumor suppression at the mouse INK4a locus mediated by the alternative reading frame product p19ARF.
Cell
91:649-659[CrossRef][Medline].
|
| 16.
|
Klangby, U.,
I. Okan,
K. P. Magnusson,
M. Wendland,
P. Lind, and K. G. Wiman.
1998.
p16/INK4a and p15/INK4b gene methylation and absence of p16/INK4a mRNA and protein expression in Burkitt's lymphoma.
Blood
91:1680-1687[Abstract/Free Full Text].
|
| 17.
|
Koh, J.,
G. H. Enders,
B. D. Dynlacht, and E. Harlow.
1995.
Tumour-derived p16 alleles encoding proteins defective in cell-cycle inhibition.
Nature
375:506-510[CrossRef][Medline].
|
| 18.
|
Kovalchuk, A. L.,
E. B. Mushinski, and S. Janz.
2000.
Clonal diversification of primary BALB/c plasmacytomas harboring T(12;15) chromosomal translocations.
Leukemia
14:909-921[CrossRef][Medline].
|
| 19.
|
MacPhee, M.,
K. P. Chepenik,
R. A. Liddell,
K. K. Nelson,
L. D. Siracusa, and A. M. Buchberg.
1995.
The secretory phospholipase A2 gene is a candidate for the Mom1 locus, a major modifier of ApcMin-induced intestinal neoplasia.
Cell
81:957-966[CrossRef][Medline].
|
| 20.
|
Mock, B.,
J. Wax,
R. Clynes,
K. B. Marcu, and M. Potter.
1988.
The genetics of susceptibility to RIM-induced plasmacytomagenesis.
Curr. Top. Microbiol. Immunol.
141:125-127[Medline].
|
| 21.
|
Mock, B. A.,
J. Hartley,
P. Le Tissier,
J. S. Wax, and M. Potter.
1997.
The plasmacytoma resistance gene, Pctr2, delays the onset of tumorigenesis and resides in the telomeric region of Chromosome 4.
Blood
90:4092-4098[Abstract/Free Full Text].
|
| 22.
|
Mock, B. A.,
M. A. Krall, and J. K. Dosik.
1993.
Genetic mapping of tumor susceptibility genes involved in mouse plasmacytomagenesis.
Proc. Natl. Acad. Sci. USA
90:9499-9503[Abstract/Free Full Text].
|
| 23.
|
Neumann, C.,
G. Zehentmaier,
S. Danhauser-Riedl,
B. Emmerich, and M. Hallek.
1996.
Interleukin-6 induces tyrosine phosphorylation of the Ras activating protein Shc, and its complex formation with Grb2 in the human multiple myeloma cell line LP-1.
Eur. J. Immunol.
26:379-384[Medline].
|
| 24.
|
Nevins, J. R.
1998.
Towards an understanding of the functional complexity of the E2f and retinoblastoma families.
Cell Growth Differ.
9:585-593[Medline].
|
| 25.
|
Ng, M. H. L.,
Y. F. Chung,
K. W. Lo,
N. W. R. Wickham,
J. C. K. Lee, and D. P. Huang.
1997.
Frequent hypermethylation of p16 and p15 genes in multiple myeloma.
Blood
89:2500-2506[Abstract/Free Full Text].
|
| 26.
|
Ogata, A.,
D. Chauhan,
G. Teoh,
S. P. Treon,
M. Urashima,
R. L. Schlossman, and K. C. Anderson.
1997.
IL-6 triggers cell growth via the ras-dependent mitogen-activated protein kinase cascade.
J. Immunol.
159:2212-2221[Abstract/Free Full Text].
|
| 27.
|
Pomerantz, J.,
N. Schreiber-Agus,
N. J. Liegeois,
A. Silverman,
L. Alland,
L. Chin,
J. Potes,
K. Chen,
I. Orlow,
H.-W. Lee,
C. Cordon-Cardo, and R. A. DePinho.
1998.
The Ink4a tumor suppressor gene product, p19ARF, interacts with MDM-2 and neutralizes MDM2's inhibition of p53.
Cell
92:713-723[CrossRef][Medline].
|
| 28.
|
Potter, M.,
E. B. Mushinski,
J. S. Wax,
J. Hartley, and B. Mock.
1994.
Two genes on Chromosome 4 determine resistance to plasmacytoma induction in mice.
Cancer Res.
54:969-975[Abstract/Free Full Text].
|
| 29.
|
Potter, M., and C. L. Robertson.
1960.
Development of plasma cell neoplasms in BALB/c mice after intraperitoneal injection of paraffin-oil adjuvant, heat-killed staphylococcus mixtures.
J. Natl. Cancer Inst.
25:847-861.
|
| 30.
|
Quelle, D. E.,
M. Cheng,
R. A. Ashmun, and C. J. Sherr.
1997.
Cancer-associated mutations at the INK4a locus cancel cell cycle arrest by p16INK4a but not by the alternative reading frame protein p19ARF.
Proc. Natl. Acad. Sci. USA
94:669-673[Abstract/Free Full Text].
|
| 31.
|
Quelle, D. E.,
F. Zindy,
R. A. Ashmun, and C. J. Sherr.
1995.
Alternative reading frames of the INK4a tumor suppressor gene encode two unrelated proteins capable of inducing cell cycle arrest.
Cell
83:993-1000[CrossRef][Medline].
|
| 32.
|
Quesnel, B.,
C. Preudhomme, and P. Fenaux.
1996.
p16INK4a gene and hematological malignancies.
Leuk. Lymphoma
22:11-24[Medline].
|
| 33.
|
Robles, A. I.,
X. W. Wang, and C. C. Harris.
1999.
Drug-induced apoptosis is delayed and reduced in XPD lymphoblastoid cell lines: possible role of TFIIH in p53-mediated apoptotic cell death.
Oncogene
18:4681-4688[CrossRef][Medline].
|
| 34.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 35.
|
Schaffner, C.,
S. Stilgenbauer,
G. A. Rappold,
H. Dohner, and P. Lichter.
1999.
Somatic ATM mutations indicate a pathogenic role of ATM in B-cell chronic lymphocytic leukemia.
Blood
94:748-753[Abstract/Free Full Text].
|
| 36.
|
Serrano, M.,
H.-W. Lee,
L. Chin,
C. Cordon-Cardo,
D. Beach, and R. A. DePinho.
1996.
Role of the INK4a locus in tumor suppression and cell mortality.
Cell
85:27-37[CrossRef][Medline].
|
| 37.
|
Shacter, E.,
G. K. Arzadon, and J. Williams.
1992.
Elevation of interleukin-6 in response to a chronic inflammatory stimulus in mice: inhibition by indomethacin.
Blood
80:194-202[Abstract/Free Full Text].
|
| 38.
|
Tanaka, H.,
H. Arakawa,
T. Yamaguchi,
K. Shiraishi,
S. Fukuda,
K. Matsui,
Y. Takei, and Y. Nakamura.
2000.
A ribonucleotide reductase gene involved in a p53-dependent cell-cycle checkpoint for DNA damage.
Nature
404:42-49[CrossRef][Medline].
|
| 39.
|
Tao, W., and A. J. Levine.
1999.
p19ARF stabilizes p53 by blocking nucleo-cytoplasmic shuttling of Mdm2.
Proc. Natl. Acad. Sci. USA
96:6937-6941[Abstract/Free Full Text].
|
| 40.
|
Tasaka, T.,
J. Berenson,
R. Vescio,
T. Hirama,
C. W. Miller,
M. Nagai,
J. Takahara, and H. P. Koeffler.
1997.
Analysis of the p16INK4A, p15INK4B and p18INK4C genes in multiple myeloma.
Br. J. Haematol.
96:98-102[CrossRef][Medline].
|
| 41.
|
Wallis, Y. L.,
D. G. Morton,
C. M. McKeown, and F. Macdonald.
1999.
Molecular analysis of the APC gene in 205 families: extended genotype-phenotype correlations in FAP and evidence for the role of APC amino acid changes in colorectal cancer predisposition.
J. Med. Genet.
36:14-20[Abstract/Free Full Text].
|
| 42.
|
Weinberg, R. A.
1995.
The retinoblastoma protein and cell cycle control.
Cell
81:323-330[CrossRef][Medline].
|
| 43.
|
Wiener, F.,
A. Coleman,
B. A. Mock, and M. Potter.
1995.
Nonrandom chromosomal change (trisomy 11) in murine plasmacytomas induced by an ABL-MYC retrovirus.
Cancer Res.
55:1181-1188[Abstract/Free Full Text].
|
| 44.
|
Willumsen, B. M.,
W. C. Vass,
T. J. Velu,
A. G. Papageorge,
J. Schiller, and D. R. Lowy.
1991.
The BPV E5 oncogene can cooperate with ras: identification of a p21 amino acid segment required for transformation by c-rasH but not v-rasH.
Mol. Cell. Biol.
9:6026-6033.
|
| 45.
|
Zhang, S.,
E. S. Ramsay, and B. A. Mock.
1998.
Cdkn2a, the cyclin dependent kinase inhibitor encoding p16INK4a and p19ARF, is a candidate for the plasmacytoma susceptibility locus, Pctr1.
Proc. Natl. Acad. Sci. USA
95:2429-2434[Abstract/Free Full Text].
|
| 46.
|
Zhang, Y., and Y. Xiong.
1999.
Mutations in human ARF exon 2 disrupt its nucleolar localization and impair its ability to block nuclear export of MDM2 and p53.
Mol. Cell.
3:579-591[CrossRef][Medline].
|
| 47.
|
Zhang, Y.,
Y. Xiong, and W. G. Yarbrough.
1998.
ARF promotes MDM2 degradation and stabilizes p53: ARF-INK4a locus deletion impairs both the Rb and p53 tumor suppression pathways.
Cell
92:725-734[CrossRef][Medline].
|
Molecular and Cellular Biology, January 2001, p. 310-318, Vol. 21, No. 1
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.1.310-318.2001
This article has been cited by other articles:
-
Jawad, M, Giotopoulos, G, Cole, C, Plumb, M
(2007). Target cell frequency is a genetically determined risk factor in radiation leukaemogenesis. Br. J. Radiol.
80: S56-S62
[Abstract]
[Full Text]
-
Dib, A., Barlogie, B., Shaughnessy, J. D. Jr, Kuehl, W. M.
(2007). Methylation and expression of the p16INK4A tumor suppressor gene in multiple myeloma. Blood
109: 1337-1338
[Full Text]
-
Hill, R., Song, Y., Cardiff, R. D., Van Dyke, T.
(2005). Heterogeneous Tumor Evolution Initiated by Loss of pRb Function in a Preclinical Prostate Cancer Model. Cancer Res.
65: 10243-10254
[Abstract]
[Full Text]
-
Luo, H., Li, Q., O'Neal, J., Kreisel, F., Le Beau, M. M., Tomasson, M. H.
(2005). c-Myc rapidly induces acute myeloid leukemia in mice without evidence of lymphoma-associated antiapoptotic mutations. Blood
106: 2452-2461
[Abstract]
[Full Text]
-
Park, S. S., Shaffer, A. L., Kim, J. S., duBois, W., Potter, M., Staudt, L. M., Janz, S.
(2005). Insertion of Myc into Igh Accelerates Peritoneal Plasmacytomas in Mice. Cancer Res.
65: 7644-7652
[Abstract]
[Full Text]
-
Mock, B. A., Zhang, S., Ramsay, E. S., Bliskovsky, V., Zhang, K., Shi, W., DuBois, W.
(2005). Strategies for Dissecting Complex Traits Associated with Cancer: Lessons from Plasma Cell Tumors. aacredbook
2005: 273-276
[Full Text]
-
Matheu, A., Pantoja, C., Efeyan, A., Criado, L. M., Martin-Caballero, J., Flores, J. M., Klatt, P., Serrano, M.
(2004). Increased gene dosage of Ink4a/Arf results in cancer resistance and normal aging. Genes Dev.
18: 2736-2746
[Abstract]
[Full Text]
-
Bauer, A. K., Malkinson, A. M., Kleeberger, S. R.
(2004). Susceptibility to neoplastic and non-neoplastic pulmonary diseases in mice: genetic similarities. Am. J. Physiol. Lung Cell. Mol. Physiol.
287: L685-L703
[Abstract]
[Full Text]
-
Felix, K., Gerstmeier, S., Kyriakopoulos, A., Howard, O. M. Z., Dong, H.-F., Eckhaus, M., Behne, D., Bornkamm, G. W., Janz, S.
(2004). Selenium Deficiency Abrogates Inflammation-Dependent Plasma Cell Tumors in Mice. Cancer Res.
64: 2910-2917
[Abstract]
[Full Text]
-
Sachs, Z., Sharpless, N. E., DePinho, R. A., Rosenberg, N.
(2004). p16Ink4a Interferes with Abelson Virus Transformation by Enhancing Apoptosis. J. Virol.
78: 3304-3311
[Abstract]
[Full Text]
-
Fonseca, R., Barlogie, B., Bataille, R., Bastard, C., Bergsagel, P. L., Chesi, M., Davies, F. E., Drach, J., Greipp, P. R., Kirsch, I. R., Kuehl, W. M., Hernandez, J. M., Minvielle, S., Pilarski, L. M., Shaughnessy, J. D. Jr., Stewart, A. K., Avet-Loiseau, H.
(2004). Genetics and Cytogenetics of Multiple Myeloma: A Workshop Report. Cancer Res.
64: 1546-1558
[Abstract]
[Full Text]
-
Felix, K., Polack, A., Pretsch, W., Jackson, S. H., Feigenbaum, L., Bornkamm, G.-W., Janz, S.
(2004). Moderate Hypermutability of a Transgenic lacZ Reporter Gene in Myc-Dependent Inflammation-Induced Plasma Cell Tumors in Mice. Cancer Res.
64: 530-537
[Abstract]
[Full Text]
-
Silva, S., Kovalchuk, A. L., Kim, J. S., Klein, G., Janz, S.
(2003). BCL2 Accelerates Inflammation-induced BALB/c Plasmacytomas and Promotes Novel Tumors with Coexisting T(12;15) and T(6;15) Translocations. Cancer Res.
63: 8656-8663
[Abstract]
[Full Text]
-
Bliskovsky, V., Ramsay, E. S., Scott, J., DuBois, W., Shi, W., Zhang, S., Qian, X., Lowy, D. R., Mock, B. A.
(2003). Frap, FKBP12 rapamycin-associated protein, is a candidate gene for the plasmacytoma resistance locus Pctr2 and can act as a tumor suppressor gene. Proc. Natl. Acad. Sci. USA
100: 14982-14987
[Abstract]
[Full Text]
-
Macdiarmid, J., Stevenson, D., Campbell, D. H., Wilson, J. B.
(2003). The latent membrane protein 1 of Epstein-Barr virus and loss of the INK4a locus: paradoxes resolve to cooperation in carcinogenesis in vivo. Carcinogenesis
24: 1209-1218
[Abstract]
[Full Text]
-
Dragani, T. A.
(2003). 10 Years of Mouse Cancer Modifier Loci: Human Relevance. Cancer Res.
63: 3011-3018
[Abstract]
[Full Text]
-
Blackburn, A. C., Brown, J. S., Naber, S. P., Otis, C. N., Wood, J. T., Jerry, D. J.
(2003). BALB/c Alleles for Prkdc and Cdkn2a Interact to Modify Tumor Susceptibility in Trp53+/- Mice. Cancer Res.
63: 2364-2368
[Abstract]
[Full Text]
-
Kovalchuk, A. L., Kim, J. S., Park, S. S., Coleman, A. E., Ward, J. M., Morse, H. C. III, Kishimoto, T., Potter, M., Janz, S.
(2002). IL-6 transgenic mouse model for extraosseous plasmacytoma. Proc. Natl. Acad. Sci. USA
10.1073/pnas.022643999v1
[Abstract]
[Full Text]
-
Bardeesy, N., Morgan, J., Sinha, M., Signoretti, S., Srivastava, S., Loda, M., Merlino, G., DePinho, R. A.
(2002). Obligate Roles for p16Ink4a and p19Arf-p53 in the Suppression of Murine Pancreatic Neoplasia. Mol. Cell. Biol.
22: 635-643
[Abstract]
[Full Text]
-
Kovalchuk, A. L., Kim, J. S., Park, S. S., Coleman, A. E., Ward, J. M., Morse, H. C. III, Kishimoto, T., Potter, M., Janz, S.
(2002). IL-6 transgenic mouse model for extraosseous plasmacytoma. Proc. Natl. Acad. Sci. USA
99: 1509-1514
[Abstract]
[Full Text]
-
Wei, Q., Adelstein, R. S.
(2002). Pitx2a Expression Alters Actin-Myosin Cytoskeleton and Migration of HeLa Cells through Rho GTPase Signaling. Mol. Biol. Cell
13: 683-697
[Abstract]
[Full Text]