INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

In the yeast Saccharomyces cerevisiae, transferred DNA undergoes homologous recombination with cognate chromosomal sequences (gene targeting) according to the double-strand-break repair (DSBR) model of recombination (34, 37, 44). Features of meiotic recombination in S. cerevisiae are also consistent with repair of chromosomal double-strand breaks (DSBs) by this model (15, 33, 35, 39, 40, 44). According to the canonical DSBR model (34, 37, 44) and its later revision (42), as illustrated in Fig. 1 for a typical gene targeting reaction, recombination is initiated by a DSB in the vector-borne region of homology to the chromosome. The DSB undergoes 5'3' resection (Fig. 1A) resulting in the formation of two 3'-ending single strands which invade cognate chromosomal sequences (Fig. 1B). The invading 3' ends prime DNA synthesis, finally generating two Holliday junctions (Fig. 1C). Opposite-sense cleavage of the Holliday junctions in the joint molecule (Fig. 1D) results in crossover, integrating the vector into the chromosome and duplicating the region of shared homology (Fig. 1E and F).

View larger version (23K): [in this window] [in a new window]   FIG. 1.   DSBR model of recombination. The mechanism of recombination between a linearized DNA transfer vector and the homologous chromosomal locus is depicted. The targeting vector (A) is indicated by thick lines while the homologous chromosomal locus is indicated by thin lines. The 3' ends of the DNA molecules are indicated by half arrows. After strand invasion (B), regions of newly synthesized chromosomal DNA (C) are represented by thin dotted lines. The numbered positions denoted by arrows indicate potential Holliday junction cleavage sites. Potentially, the joint molecule (D) can be cleaved in two alternate modes, resulting in vector integration into the chromosome. Cleavage at positions 1 and 3 generates the integrated structure shown in panel E, while the 2,4-cleavage mode generates the structure shown in panel F. The structures in panels E and F differ with respect to the position of gene conversion (C) and hDNA (H) tracts in the inner and outer marker positions. For further details, refer to the text.

Our laboratory has been investigating mechanisms of homologous recombination in mammalian somatic cells using a gene targeting assay as one approach. By examining the segregation patterns of small palindromic insertions, which frequently escape mismatch repair (MMR) when encompassed within heteroduplex DNA (hDNA) formed in vivo during homologous recombination, we have shown that (i) hDNA is formed on each side of the vector-borne DSB and (ii) palindrome markers in hDNA formed in each homology region reside in a trans configuration (25, 26). These and other (45) features of the mammalian gene targeting reaction are consistent with predictions of the yeast DSBR model.

In the joint molecule (Fig. 1D), crossover resolution may occur in either of the following two ways: (i) crossing strands in the left junction may be cut horizontally while noncrossing strands in the right junction are cut vertically (1,3-cleavage; Fig. 1E) or (ii) noncrossing strands at the left junction may be cut vertically while crossing strands at the right junction are cut horizontally (2,4-cleavage; Fig. 1F). The two crossover modes lead to different predicted marker configurations in the inner and outer positions in the recombinants. In the absence of MMR, the 2,4-cleavage mode is expected to generate recombinants in which hDNA is present in the inner positions, to the right and left of the DSB, while a conversion tract is present in the outer positions, to the left and right of the DSB. For the 1,3-cleavage mode, the opposite pattern is expected. Assuming no bias in strand cleavage, the two types of crossover products are expected to be recovered at an equal frequency. However, Gilbertson and Stahl (15), as discussed further by Foss et al. (14), in studying meiotic DSBR events at the ARG4 locus in S. cerevisiae reported a bias in the mode of crossover resolution that favors the generation of recombinant products that are equivalent to the recombinant structure shown in Fig. 1F. As an explanation for the bias, they propose that the dispensation of the newly synthesized DNA creates an inherent structural asymmetry in the joint molecule that dictates which strands of a Holliday junction are to be cut.

As there are similarities between DSBR in yeast and mammalian cells, it was of interest to determine whether or not DSBR in mammalian somatic cells displays a favored sense of crossover resolution. Therefore, we exploited our gene targeting assay to investigate this important question. The vector-borne DSB site was flanked with small palindromic insertions to preserve evidence of hDNA. The recovery of recombinants was performed under conditions described previously (25, 31) which ensured that all products of individual crossover events were available for molecular analysis. Our results suggest that, like meiotic recombination in S. cerevisiae, crossover events in mitotic mammalian cells are biased toward the 2,4-cleavage mode of crossover resolution illustrated in Fig. 1F. This novel finding provides support for the joint molecule depicted in Fig. 1D being an important intermediate in the mammalian gene targeting pathway. It also supports the concept that in mammalian cells a structural asymmetry exists in the joint molecule that dictates which DNA strands are to be cut. The bias in junction cutting permitted us to interpret the marker segregation patterns in the recombinants with regard to the potential consequences the junction cuts might have on end-directed MMR activities. The results presented in this study reveal important features about the DSBR process in mammalian cells.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Recipient hybridoma cell line and targeting vector. The wild-type hybridoma cell line Sp6/HL was used as the recipient for gene targeting. It bears a single copy of the trinitrophenyl-specific chromosomal immunoglobulin µ heavy chain gene that serves as the target for homologous recombination. The origin of this cell line along with the conditions used for cell culture have been described previously (22, 23).

Recovery and characterization of targeted hybridoma cells. Transfer of vector DNA into the Sp6/HL hybridoma cell line was performed by electroporation according to conditions described previously (3). Following transfection, hybridoma cells were distributed to the individual wells of 96-well tissue culture plates at a low cell density and placed under G418 selection as described earlier (25, 26). This procedure ensures that each G418-resistant (G418^r) transformant represents the progeny of a single G418^r cell deposited in the culture well (25, 26, 31). Selection for G418^r transformants and identification of hybridoma cell lines in which the haploid, chromosomal µ gene is modified by targeted vector insertion were performed according to procedures published elsewhere (25, 26, 31). Genomic DNA was prepared from the G418^r hybridoma cell lines by the method of Gross-Bellard et al. (17). Restriction enzymes used in DNA digestion were purchased from Bethesda Research Laboratories (Gaithersburg, Md.), New England Biolabs (Beverly, Mass.), and Pharmacia Inc. (Piscataway, N.J.) and used in accordance with the manufacturers' specifications. Gel electrophoresis, transfer of DNA onto a nitrocellulose membrane, ³²P-labeled probe preparation, and hybridization were all performed according to standard procedures (38). The conditions used for PCR amplification of the 5' and 3' Cµ regions in the targeted G418^r recombinants have been described previously (31). The sequences and binding sites of primers AB9703, AB9745, and AB9438 have been reported previously (26, 31). The primer AB22339 binds to the noncoding strand of the herpes simplex virus type 1 (HSV-1) thymidine kinase (tk) gene beginning at position 1117 and has the following sequence: 5' CCAACGGCGACCTGTATAACGTGT 3'.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Recombinant isolation and identification. Our recombination system has been described previously (3, 31). In brief, it detects interactions between a gene targeting vector and the haploid, chromosomal immunoglobulin µ heavy chain locus in a mouse hybridoma cell line (Fig. 2A). In this study, mechanisms of crossover were investigated and this required that evidence of hDNA generated during recombination be preserved. As shown previously (25), a small (30 bp) palindrome insertion containing a diagnostic NotI restriction enzyme site is poorly repairable by the MMR machinery. Important information about hDNA formation during homologous recombination can be obtained from the position of sectored sites in the recombinants.

View larger version (17K): [in this window] [in a new window]   FIG. 2.   Gene targeting system. (A) This panel presents the structure of the recipient haploid chromosomal immunoglobulin µ gene in the wild-type Sp6/HL hybridoma cell line (22, 23). It is present on a 12.5-kb EcoRI (E) fragment. The location of the trinitrophenyl-specific heavy chain variable (VHTNP) region and the four Cµ region exons is indicated. The endogenous BamHI (B) and ApaI (A) restriction enzyme sites serve as diagnostic markers of the chromosomal Cµ region. The endogenous Cµ region can be amplified by PCR using the primer pair AB9703-AB9438 as described previously (31) to yield a specific 4,621-bp fragment. (B) The structure of the 11.4-kb enhancer-trap sequence insertion vector. The vector bears a 4.3-kb segment of homology derived from the Sp6/HL chromosomal Cµ region inserted into a derivative of the vector, pSV2neo (41), from which the SV40 early region enhancer responsible for neo gene expression has been removed. Although not relevant to this study, the targeting vector also contains the tk gene from HSV-1. A perfect 30-bp palindrome containing a diagnostic NotI restriction enzyme site (the palindrome sequence is presented in Materials and Methods) replaces the vector-borne BamHI (bN) and ApaI (aN) restriction enzyme sites located left (605 bp) and right (436 bp) of the unique BstXI site (position 0) that was used to introduce the DSB into the vector. With the exception of the single palindrome insertion at each site, the vector-borne and chromosomal Cµ regions are otherwise isogenic. Following cleavage with BstXI, the vector-borne Cµ region bears 1.5 and 2.8 kb of homology to the Sp6/HL chromosomal Cµ region on the left- and right-hand sides of the DSB, respectively. (C) The structure of the recombinant chromosomal µ gene. Targeted integration of a single copy of the transfer vector into the Sp6/HL chromosomal µ gene replaces the endogenous 12.5-kb EcoRI µ gene fragment with the novel 16.2- and 7.7-kb EcoRI µ fragments shown. The inner and outer Cµ region positions in the recombinant bear the symbol "?" because each recombination event has the potential to produce a different marker pattern in these regions. The primer pair AB9703-AB9745 generates a specific 4,765-bp PCR product from the 5' Cµ region, while the primer pair AB22339-AB9438 generates a specific 5,150-bp PCR product from the 3' Cµ region. Both primer sets bind outside of the vector-borne Cµ region. Details regarding the sequence and binding sites of the primers are given in Materials and Methods. Southern blots were hybridized with probe F, an 870-bp XbaI/BamHI fragment specific for the Cµ region. (D) Restriction enzyme mapping of the 5' and 3' Cµ region PCR products. As shown in panel C and at the bottom of this diagram, amplification of genomic DNA from the targeted recombinants with primer pair AB9703-AB9745 generates a specific 4,765-bp PCR product from the 5' Cµ region, while amplification with primer pair AB22339-AB9438 generates a specific 5,150-bp PCR product from the 3' Cµ region (in parentheses). In this diagram, the Cµ primers are depicted as oppositely oriented half arrows. The fragment sizes (in base pairs) that the indicated restriction enzymes should generate are shown without parentheses for cleavage of the 5' Cµ region PCR product and with parentheses for cleavage of the 3' Cµ region PCR product. The various diagrams in panels A to D are not drawn to scale.

Determination of Cµ region genetic markers. The determination of the Cµ region genetic markers in the 26 targeted recombinants was performed according to PCR and gel analysis methods described previously (31). As indicated in Fig. 2C, PCR amplification using primer pair AB9703-AB9745 generates a specific 4,765-bp product from the 5' Cµ region while primer pair AB22339-AB9438 generates a specific 5,150-bp product from the 3' Cµ region. Digestion of the PCR products with restriction enzymes specific for the chromosomal Cµ region sites (BamHI and ApaI) as well as with NotI (specific for the vector-borne palindrome) yields diagnostic fragments that can be resolved by standard gel electrophoresis (Fig. 2D). The results of these digests (data not shown) are summarized in Fig. 3. Recombinants identified from the two separate electroporations are indicated by the coding "/1" or "/2", respectively. Inner positions are defined as those that lie to the right and left of the DSB in the 5' and 3' Cµ regions, respectively. Outer positions are defined as those residing to the left and right of the DSB in the 5' and 3' Cµ regions, respectively. In the 5' Cµ region of a single recombinant (62/1), neither the vector-borne NotI palindrome nor the chromosomal BamHI site was present, suggesting that a subtle mutation had occurred at this site (marker loss indicated by the cross-hatched circle).

View larger version (20K): [in this window] [in a new window]   FIG. 3.   Inner and outer Cµ region marker patterns in the recombinants. The pSV2neo sequences separating the 5' and 3' Cµ regions in the recombinants are denoted neo. Inner positions are defined as those that lie to the right and left of the DSB in the 5' and 3' Cµ regions, respectively. Outer positions are defined as those residing to the left and right of the DSB in the 5' and 3' Cµ regions, respectively. Positions bearing the vector-borne NotI palindrome are indicated by a filled circle, those with a chromosomal marker are indicated by an open circle, and those that are sensitive to cleavage with restriction enzymes diagnostic of both the chromosome and vector-borne markers (i.e., sectored sites indicative of hDNA formed during homologous recombination) are indicated by half-filled circles. In a single recombinant (62/1), the outer marker position in the 5' Cµ region contains neither the vector-borne NotI palindrome nor the chromosomal BamHI marker, suggesting a mutation at this site (indicated by a cross-hatched circle). The position of the markers relative to the site of the DSB at BstXI is indicated at the bottom of the diagram.

Biased distribution of the Cµ region genetic markers. A total of 17 of the 26 recombinants (65%) were sectored for one or more Cµ region positions, providing strong evidence for formation of hDNA during recombination. Sectored sites were revealed by the partial sensitivity of the 5' and/or 3' Cµ region PCR products to cleavage with the palindrome-specific NotI enzyme and either BamHI or ApaI, which was diagnostic of chromosomal markers. Sectored sites were observed in both Cµ regions and on opposite sides of the vector-borne DSB site as reported previously (26). Where examined (data not shown), the results also confirmed previous studies (25, 26), showing that palindrome markers present in sectored sites in the 5' and 3' Cµ regions resided in a trans configuration as indicated for recombinants 15/1, 44/1, 39/2, 44/2, 49/2, and 63/2 in Fig. 3. That is, analysis of marker segregation patterns in individual subclones of each parental recombinant (started from a single cell) revealed two cell types. In one type, the vector-borne NotI palindrome marker residing in the 5' Cµ region site was linked to a chromosomal marker in the 3' Cµ region site, while in the second cell type, the chromosomal marker in the 5' Cµ region site was linked to the NotI palindrome marker in the 3' Cµ region site. A novel finding was the marker patterns of three of the recombinants (52/1, 39/2, and 44/2). In these cell lines, sectoring was observed on both sides of the DSB in one of the Cµ regions. With the exception of the sectored sites, the remaining Cµ region positions in the recombinants were completely sensitive to digestion with either NotI or one of the enzymes specific for the chromosomal markers. The marker frequencies for the inner and outer Cµ region positions in the recombinants are summarized in Table 1.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

A nonrandom distribution of Cµ region genetic markers was evident in the 26 independent recombinants examined in this study. As indicated in Fig. 3 and summarized in Table 1, there was a significant bias toward chromosomal markers in the outer Cµ region positions. In the inner Cµ region positions, hDNA and the NotI palindrome marker predominated. The positions bearing the NotI palindrome can be explained by restorative MMR of hDNA (discussed further below). Thus, if the number of sectored sites and those bearing the NotI palindrome are combined as total evidence of hDNA, a ² test reveals a significantly higher frequency of hDNA in the inner Cµ region positions (² = 15.51; P < 0.001).

The bias toward chromosomal markers in the outer Cµ region positions and hDNA in the inner Cµ region positions can be explained according to the DSBR model of recombination if crossover involves favored-sense cleavage of the joint molecule. The joint molecule intermediate of DSBR is illustrated in Fig. 4. The intermediate is presented as having 3'-ending, single-stranded tails in accord with studies of homologous recombination in S. cerevisiae. In this organism, DSBs are subject to resection of their 5' termini in both meiosis (1) and mitosis (46), yielding 3' single-stranded tails that are approximately 600 nucleotides (nt) in length (8, 9, 42). In mammalian cells, the available evidence suggests that 5'3' resection of the ends of transferred DNA can exceed 1,000 nt (19, 24). Therefore, as shown in Fig. 4, it is reasonable to assume that DSB resection may have frequently proceeded past the palindrome markers (denoted bN and aN), generating 3' single-stranded tails of at least 605 nt in length. Further support for this assumption is the fact that if the DSB was subject to little or no 5' resection, then examples of crossover at or near the DSB would have been expected. Such recombinants would bear the NotI palindrome in the inner Cµ region positions and chromosomal markers in the outer Cµ region positions, and these were not observed (Fig. 3). In principle, the joint molecule can be resolved by cutting the DNA strands of the Holliday junctions either at positions 1 and 3 or at positions 2 and 4. As hDNA and conversion tracts reside in different regions of the joint molecule, the two modes of cleavage are expected to yield recombinants with different marker patterns in the inner and outer Cµ region positions. The 1,3-cleavage mode yields a recombinant in which gene conversion is predominant in the inner Cµ region positions whereas hDNA is predominant in the outer Cµ region positions. This result is contrary to the Cµ region marker patterns that were observed in the recombinants. However, if the joint molecule is resolved according to the 2,4-cleavage mode, the outer Cµ region positions will bear predominantly chromosomal markers whereas the inner Cµ region positions will contain hDNA. This is precisely the result that was obtained. Thus, whereas the canonical DSBR model predicts that both modes of crossover resolution should occur with the same frequency, our results reveal the contrary, as crossover resolution during mammalian mitotic recombination exhibits a bias in strand cleavage.

View larger version (22K): [in this window] [in a new window]   FIG. 4.   Crossover resolution of the joint molecule. The joint molecule intermediate of DSBR is shown at the top of the diagram. For clarity in relating the structure of the joint molecule intermediate to the various recombinants, it is labeled to show the positions of the chromosomal BamHI (B) and ApaI (A) markers as well as those of the vector, namely the NotI-replaced BamHI (bN) and the NotI-replaced ApaI (aN) sites. To generate a crossover product, the joint molecule can be cleaved by cutting the DNA strands either at positions 2 and 4 or at positions 1 and 3. Following cleavage, crossover incorporates the vector (thick line) into the chromosome (thin line). The two modes of crossover resolution generate different predicted patterns for gene conversion (C) and hDNA (H) in the inner and outer Cµ region marker positions in the recombinants.

This study is the first to report results that are consistent with crossover in mitotic mammalian cells proceeding according to favored-sense cleavage of the joint molecule. The same bias in the mode of crossover resolution has been reported previously but in studies examining meiotic recombination in S. cerevisiae (13, 15, 20, 47). As an explanation for the bias in strand cleavage, Foss et al. (14), in their studies of DSBR at the ARG4 locus in S. cerevisiae, suggest that the joint molecule bears a structural asymmetry resulting from the new DNA or its synthesis that dictates which strands of the Holliday junctions are to be cut. Thus, like meiotic recombination in yeast, targeted vector integration in mitotic mammalian cells is consistent with a preferred mode of resolution that involves the cutting of those DNA strands that are newly synthesized at the junction.

Mismatches involving the small palindrome are poorly repairable by the cellular MMR machinery in yeast (28) and mammalian cells (25). Nevertheless, the results presented here and in our previous studies (25, 26) reveal that some mismatches involving the palindrome are subject to repair. The finding that targeted vector integration results from a bias in strand cleavage permits the potential consequences of MMR acting on the recombination intermediate to be addressed. In this regard, the studies of Foss et al. (14) are relevant. As shown in Fig. 5, MMR might occur early in the recombination process, being initiated by invasion of the two 3' single strands. Early MMR might involve DNA excision beginning from the 3' end of one or both invading strands followed by resynthesis using the chromosomal sequence as template, generating the indicated gene conversion event. Alternatively, an invading 3' end might direct highly biased MMR that leads to preferential correction (gene conversion) of the sequence on the interrupted strand, as suggested previously for mitotic (18, 27) and meiotic (36) recombination in S. cerevisiae. Formally, gene conversion might also result from repair of a small gap created during vector transfer, as suggested previously (31). Comparison of the predictions of Fig. 5 with the marker segregation patterns in the recombinants (Fig. 3) suggests that early MMR can account for the marker patterns in only 3 of the 26 recombinants (120/1, 42/1, and 30/2). Therefore, early MMR alone is probably not an important mechanism in targeted vector integration, a conclusion that was also reached by Foss et al. (14). This suggests that discontinuities elsewhere in the recombination intermediate might be more important for triggering MMR. Vector integration arising from Holliday junction cleavage in the favored 2,4-cleavage mode is expected to leave breaks in the DNA at positions a, b, c, and d, as indicated at the top of Fig. 6. DNA ends can trigger MMR and direct it to occur on the discontinuous strand (2). Therefore, the DNA ends generated by favored-sense resolution serve as potential sites for initiating late MMR events, resulting in partial or continuous excision of markers in cis to the strand end (2, 14, 40). MMR may involve excision from one strand end or simultaneous excision from two DNA ends involving both Cµ regions. Late MMR directed by the breaks at position a or d generates a restoration to the NotI palindrome in the inner marker positions. Alternatively, late MMR directed by breaks at position b or c which involves excision of DNA to the left of the DSB site will result in a gene conversion tract that would be indistinguishable from an early MMR event. Other patterns can arise if MMR is triggered by strand breaks in both Cµ regions (i.e., at positions a and b, positions a and d, etc.) or if MMR is triggered by a combination of both early and late MMR events. Alternatively, the recombination intermediate might escape MMR.

View larger version (18K): [in this window] [in a new window]   FIG. 5.   Early MMR followed by favored-sense crossover resolution. Early MMR is guided by the 3' ends of the invading single-stranded vector DNA and may involve DNA excision on one or both sides of the DSB, followed by DNA synthesis to complete the joint molecule. Early MMR results in gene conversion (C) in the indicated region. The Cµ region marker patterns in three recombinants are consistent with this mechanism. H, hDNA.

View larger version (28K): [in this window] [in a new window]   FIG. 6.   Possible consequences of late MMR alone or the combination of early and late MMR. The top diagram illustrates the intermediate resulting from crossover resolution of the joint molecule in the favored sense. Holliday junction cleavage at positions 2 and 4 is expected to leave breaks in the DNA at the positions indicated by open triangles (a, b, c, and d). Late MMR may involve resection of DNA from a single break site in either the 5' or 3' Cµ region or from pairs of break sites in both Cµ regions. Alternatively, MMR might involve the combination of both early MMR (Fig. 5) and late MMR. Only those early MMR events for which a round of late MMR would produce a change in the marker pattern are illustrated. As indicated, the Cµ region marker patterns in several recombinants are consistent with the predicted outcomes of the various events. The recombination intermediate may also completely escape MMR, as is the case for the single recombinant 49/2. As in the previous diagrams, thick lines represent vector sequences, thin lines represent chromosomal sequences, and regions corresponding to newly synthesized chromosomal markers are presented as thin dotted lines. DNA synthesis that involves copying of the vector-borne NotI palindrome marker and generates a restoration event (R) is indicated by thick dotted lines. All other abbreviations are the same as those defined in the legend to Fig. 4.

As can be seen by comparison of Fig. 5 and 6, depending on the location of the affected mismatch relative to the cut end, the products of late MMR can produce both restorations and gene conversions, while early MMR events generate only gene conversions. Thus, there is some overlap in the products that are generated. As suggested by Foss et al. (14), late MMR directed by the junction cuts may involve a competition between the cut junctions for the likelihood of repairing a mismatch: mismatches in close proximity to a cut junction may be more likely to undergo repair directed by that junction. Therefore, from Fig. 6 it is evident that following favored-sense cleavage, a mismatch on the same side of the DSB as the cut junction would undergo restoration, whereas if the mismatch was located on the other side of the DSB from the cut junction, it would undergo gene conversion. This implies that mismatches located far from the DSB are more likely to undergo restorative-type repair than conversion-type repair.

When the Cµ region marker patterns in the recombinants are considered with respect to the possible consequences of early and/or late MMR, the following observation emerges. In one recombinant (49/2), the Cµ region marker pattern is consistent with favored junction resolution alone, with no MMR. However, the remaining 25 of the 26 recombinants can be explained on the basis of favored junction resolution in conjunction with early and/or late MMR activites. In 16 of the 25 recombinants, the Cµ region marker patterns are consistent with the occurrence of late MMR. Of these, 13 recombinants (26/1, 33/1, 41/1, 48/1, 62/1, 84/1, 106/1, 119/1, 125/1, 144/1, 22/2, 24/2, and 48/2) exhibited a restoration event to the NotI palindrome. The apparent association of late MMR with restorative-type repair during these mammalian mitotic recombination events is reminiscent of meiotic recombination in S. cerevisiae (10, 14). These authors reported that markers far from the DSB site undergo MMR that is directed by the junction cuts leading to restoration, whereas markers located close to the DSB undergo more frequent gene conversion. Further, they suggested that this makes an important contribution to the meiotic conversion gradient. In mitotic cells, most evidence suggests against a strong polarity gradient (35), although for the spontaneous recombination events discussed in that review, the nature of the recombination-initiating lesions is unknown. Where the position of the initiating DSB is known, evidence for mitotic conversion tract directionality has been obtained (27, 43). Conversion tracts are influenced by the location of initiating DSB as well as by the position of frameshift mutations in donor and recipient alleles (43). In mammalian somatic cells, a decrease in conversion frequency was observed as the distance between the genetic marker and the initiating DSB increased (11). Perhaps restorative-type MMR directed by junction cuts as proposed here makes a contribution to the conversion tract directionality in the above mitotic recombination studies.

The Cµ region marker patterns in the remaining 9 of the 26 recombinants (6/1, 15/1, 44/1, 52/1, 58/1, 36/2, 39/2, 44/2, and 63/2) are also consistent with favored junction resolution and late MMR activities. However, the presence of a sectored site or NotI palindrome in an outer Cµ region position(s) requires that 5'3' strand resection not remove the palindrome from at least one side of the DSB so that palindromes in both DNA strands are available for inclusion in hDNA. Thus, while the generation of the majority of recombinants is consistent with 5' resection on both sides of the DSB, yielding 3'-ended, single-strand tails as explained above, the generation of a few recombinants can be accounted for on the basis of the formation of a slightly shorter 3' tail on one side of the DSB.

In this study, the Cµ region marker patterns in the recombinants are compatible with MMR activities being directed by junction cuts arising from biased crossover resolution. The MMR tracts observed in recombinants described in previous studies can also be interpreted in this way (25, 26, 31). However, in some of the recombinants studied previously, MMR tracts were not always long and continuous but rather were punctuated. Recombinants with punctuated tracts were observed for poorly repaired palindrome markers as well as for simple restriction enzyme site polymorphisms that might be expected to undergo efficient MMR. This suggests that short tract repair contributes to the cellular mitotic MMR activity.

Finally, we believe that the Cµ region marker patterns of three recombinants in this study (52/1, 39/2, and 44/2) provide additional support for our interpretation of targeted vector integration according to the DSBR model. A novel feature of these recombinants is the presence of hDNA on both sides of the DSB in the same Cµ region (Fig. 3). This marker pattern is consistent with the DSBR reaction if strand invasion involves shorter 3' tails and if Holliday junction branch migration generates symmetric hDNA on both sides of the DSB. While we have interpreted our data according to the DSBR model, it has been suggested that targeted vector integration might proceed according to alternative models, including one-sided invasion (6), which essentially is similar to synthesis-dependent strand annealing (29), and the migrating D-loop model (12). These models differ from the DSBR model in proposing (i) that an invading 3' end generates a D-loop that fails to undergo complementary base pairing with the remaining 3'-ended, single-stranded tail and (ii) the formation of a single Holliday junction. Several points are relevant in considering whether these alternative models provide a satisfactory explanation for our data. First, with only a single Holliday junction, it is difficult to explain the formation of hDNA on both sides of the DSB in one Cµ region as was observed in the recombinants described above. Also, in its simplest form, the migrating D-loop model generates a conversion tract in an inner marker position, a feature that was infrequently observed in the present study. Second, random nicking of the unpaired D-loop has the potential to generate recombinants in which there is both a homologous and a nonhomologous junction. However, within the resolution limits defined by Southern and PCR analysis, targeted recombinants in this and our previous studies (3, 25, 26, 30-32) revealed only the correct µ gene fragment sizes expected for conservative homologous recombination. Third, it is not clear why the free D-loop would fail to undergo complementary base pairing with the second available 3'-ending single strand unless one postulates that this end is specifically blocked. Fourth, a main impetus for proposing both the one-sided invasion and migrating D-loop models was to account for observations that gene conversion and reciprocal crossover were not always associated as proposed in the canonical DSBR model. However, it is important to point out that modifications to the DSBR model can also explain this recombination data (15). In conclusion, we suggest that the simplicity of the DSBR model appears best suited to explaining our results.