Previous Article | Next Article ![]()
Molecular and Cellular Biology, May 2001, p. 3491-3502, Vol. 21, No. 10
Departments of Biochemistry & Molecular
Biology1 and Microbiology & Immunology,2 Dalhousie University, Halifax,
Nova Scotia, Canada B3H 4H7
Received 5 January 2001/Accepted 23 February 2001
The FACT complex of vertebrate cells, comprising the Cdc68 (Spt16)
and SSRP1 proteins, facilitates transcription elongation on a
nucleosomal template and modulates the elongation-inhibitory effects of
the DSIF complex in vitro. Genetic findings show that the related yeast
(Saccharomyces cerevisiae) complex, termed CP, also
mediates transcription. The CP components Cdc68 and Pob3 closely
resemble the FACT components, except that the C-terminal high-mobility
group (HMG) box domain of SSRP1 is not found in the yeast homolog Pob3.
We show here that Nhp6a and Nhp6b, small HMG box proteins with
overlapping functions in yeast, associate with the CP complex and
mediate CP-related genetic effects on transcription. Absence of the
Nhp6 proteins causes severe impairment in combination with mutations
impairing the Swi-Snf chromatin-remodeling complex and the DSIF (Spt4
plus Spt5) elongation regulator, and sensitizes cells to 6-azauracil,
characteristic of elongation effects. An artificial SSRP1-like protein,
created by fusing the Pob3 and Nhp6a proteins, provides both Pob3 and
Nhp6a functions for transcription, and competition experiments indicate
that these functions are exerted in association with Cdc68. This
particular Pob3-Nhp6a fusion protein was limited for certain Nhp6
activities, indicating that its Nhp6a function is compromised. These
findings suggest that in yeast cells the Cdc68 partners may be both
Pob3 and Nhp6, functioning as a bipartite analog of the vertebrate SSRP1 protein.
Transcription of eukaryotic
protein-coding genes takes place in the context of chromatin. In
chromatin, DNA is associated with histone proteins in a nucleosomal
configuration and with other proteins that have structural and/or
regulatory roles. This intricate assembly of structural and regulatory
proteins with DNA is generally inhibitory for transcription through the
interference with transcription activator proteins and general
transcription factors (reviewed in reference 57) and
obstruction of the RNA polymerase II (RNAP II) elongation complex by
nucleosomes (8; reviewed in reference 57).
The processivity of elongation complexes is also inhibited by several
nonnucleosomal chromatin components (19, 50, 60). Among
the proteins regulating both nucleosomal and nonnucleosomal
transcriptional inhibition is one named FACT (51).
FACT is an abundant nuclear protein complex that has been purified and
characterized based on its ability to allow transcription elongation
along a nucleosomal template in vitro (27, 33, 34). In
keeping with this activity, the FACT complex (also termed DUF
[32]) has been shown to interact with nucleosomes and
with histone H2A-H2B dimers and to have DNA-untwisting activity in vitro (32, 34). FACT has also been found to counteract the inhibitory effects on transcripton elongation imposed in vitro by the
DSIF complex (51). In the budding yeast
Saccharomyces cerevisiae, FACT has a structural, and
possibly functional, homolog in the form of the CP complex, which has
been implicated by genetic evidence in the interaction of chromatin
with components of the transcription and replication machineries
(5, 13, 29, 30, 39, 55, 56, 60) and in the process of
transcription elongation in vivo (34). Thus, genetic and
biochemical evidence suggests that FACT or CP facilitates these
activities by regulating chromatin. The CP complex can be purified from
yeast cells as a 1:1 complex of the Cdc68 protein and the Pob3 protein
(5, 56). Similarly, FACT from vertebrate cells is composed
of a 1:1 complex of the human version of the Cdc68 protein and SSRP1,
the human structural analog of the yeast protein Pob3 (32,
34).
The yeast and human Cdc68 proteins are structurally related throughout
their lengths (34). Likewise, throughout its length the
yeast Pob3 protein is similar to SSRP1 proteins from various sources
(55; our analysis). However, the Pob3 protein does not contain sequences related to the C-terminal portion of SSRP1. These
C-terminal SSRP1 sequences absent from Pob3 include a high-mobility group (HMG) box domain, suggesting that HMG sequences not found in Pob3
may be provided to the CP complex by another protein.
Yeast cells do indeed contain an HMG protein that resembles the HMG box
domain of SSRP1. This yeast protein, termed Nhp6, is present as two
virtually identical isoforms, Nhp6a and Nhp6b, differing slightly in
length and encoded by a gene pair (24). Nhp6 is small,
consisting of only 93 (Nhp6a) and 99 (Nhp6b) residues, and highly
abundant: the combined amounts of Nhp6a and Nhp6b are at least 50,000 copies per haploid nucleus (36), somewhat greater than the
abundance of the CP complex (5, 56) and about equal to the
number of nucleosomes.
In this report, we describe biochemical and genetic studies showing
that the small HMG box protein Nhp6 associates and functions with the
yeast complex of Pob3 and Cdc68 proteins and mediates CP-related
transcriptional effects in vivo. Our finding that Pob3 and Nhp6
associate in the same complex suggests that these two yeast proteins,
structurally analogous to different domains of the vertebrate SSRP1
protein, may function as a bipartite yeast analog of SSRP1.
Growth conditions and extract preparation.
Yeast strains are
listed in Table 1. Cells were routinely
grown at 30°C or, if temperature sensitive, at 23°C, with orbital shaking in 50 to 100 ml of adenine-supplemented (20 mg/liter) rich
medium to 1 × 107 to 5 × 107
cells/ml; plasmid-bearing cells were grown in enriched selective medium
(5). Whole-cell extracts were prepared by pressurizing a
suspension of cells (~109 cells/ml) in extraction buffer
(NaCl or potassium acetate at the indicated concentration, 50 mM HEPES
[pH 7.4], 10% glycerol, 1 mM dithiothreitol, 5 mM EDTA, 0.1% Tween
20, protease-inhibitor cocktail [5]) to 16,000 lb/in2 in a French press, followed by slow release. The
resultant suspension was centrifuged at 13,500 rpm for 10 min in an
Eppendorf centrifuge, and the supernatant was saved as a whole-cell
extract.
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.10.3491-3502.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
A Bipartite Yeast SSRP1 Analog Comprised of
Pob3 and Nhp6 Proteins Modulates Transcription
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Yeast strains
Immunoprecipitation and Western blots. Immunoprecipitations were performed on 0.4-ml volumes (2 to 5 mg of soluble protein/ml) using 6 µl of anti-Cdc68 antiserum or preimmune serum, 5 µg of antihemagglutinin (anti-HA) monoclonal antibody (12CA5; Boehringer Mannheim) or 2 µg of anti-V5 monoclonal antibody (Invitrogen) and a 1-h incubation at 4°C. A second 1-h 4°C incubation was then carried out with 25 µl of protein A-agarose or G-Sepharose beads (Sigma) and constant mixing. The resultant bead-bound immunoprotein mix was washed twice with 10 volumes of extraction buffer and then denatured at 90°C for 5 to 10 min in 50 µl of electrophoresis sample buffer. Proteins were visualized by the above antibodies on Western blots (5) of samples resolved electrophoretically on 8, 15, or 6-10-15% (step-gradient) polyacrylamide-sodium dodecyl sulfate gels. Nhp6 proteins were detected using a 1/1,000 dilution of anti-Nhp6a antiserum (36) and overnight incubation at 4°C.
Gel filtration and metal affinity chromatography. Fractionation of 200,000 × g supernatant material by gel filtration used S-300 Sephacryl as described previously (5). Batch purification of His6-tagged CP complex from whole-cell extract (50 mM potassium acetate extraction buffer without EDTA, pH 8.2) used Talon metal affinity resin (Clontech) according to the manufacturer's instructions. The elution buffer was extraction buffer containing 300 mM imidazole, pH 7.4. Protein concentrations were determined by the Bradford microassay (Bio-Rad).
Construction of a POB3-NHP6A fusion gene.
Plasmid pYESPN carries the POB3-NHP6A fusion gene under the
control of the GAL1 promoter and was constructed by
inserting a 300-bp PCR product containing the NHP6A open
reading frame (ORF), minus the first three codons, into the unique
BstEII site of pYESP, a 2µm-based URA3 plasmid
carrying a C-terminally (V5+His6)-tagged POB3
ORF in the pYES2/GS vector (Invitrogen). The 300-bp NHP6A PCR product was generated from the plasmid pRJ1364 (61)
template using primers
5'-AGCACAGTCCATATGGGTCACCCAAGAGAGAACCTAAGAAGAGAACC (containing NdeI and BstEII sites) and
5'-AAACGCGGGGCGGCCGCGGTGACCAGCCAAAGTGGCGTTATATAACTCCTT (containing BstEII and NotI sites). The
POB3-NHP6A integration plasmid pYESPN
C was derived from
pYESPN by removing a 4-kbp ClaI fragment containing the
2µm sequences and the 5' portion of the POB3 ORF. A
TRP1 version of pYESPN
C was constructed by ligating a
3.1-kbp ScaI-ClaI fragment of pYESPN with a
2.5-kbp ScaI-ClaI fragment of pRS304
(47), generating pPNT. Replacement of the chromosomal
POB3 gene with the POB3-NHP6A fusion gene used
pPNT linearized at a unique BclI site in the POB3
ORF and selection for Trp+ transformants.
NHP6A plasmid manipulations.
Plasmid p314NV5, a
pRS314 (47) derivative carrying the NHP6A
promoter and ORF modified to encode C-terminally
(V5+His6)-tagged Nhp6a protein, was generated by replacing
a 300-bp NdeI-BamHI fragment of pRJ1364 with an
800-bp PCR product from pYESPN, comprising the
(V5+His6)-tagged NHP6A ORF and the
CYC1 transcription terminator. PCR used primer
5'-TTCTGTGGATCCCCGTATTACCGCCTTTGAGTGAGC (encoding a
BamHI site) and the above-described primer encoding
NdeI and BstEII sites. The 1.3-kbp
XhoI-BamHI fragment of p314NV5 containing the
entire tagged NHP6A ORF, ~500 bp of 5' noncoding sequence, and ~500
bp of 3' plasmid sequences (including the CYC1 transcription terminator) was ligated into pRS424 and pRS423 (9) to
generate p424NV5 and p423NV5, respectively. Plasmid pHAPNV5, which
expresses HA-Pob3 and Nhp6a-V5-His6 proteins from
independent genes, was generated by inserting a 1.3-kbp
XhoI-BamHI p314NV5 fragment, blunt-ended with
mung bean exonuclease, into the SmaI site of p424-HAPOB (see
below). The NHP6A-V5-His6 integration plasmid p303-N
XN was generated by blunt-end (exonuclease) religation after
removing a 500-bp XhoI-NdeI sequence from
p303-NV5, which was itself created by inserting a 1.3-kbp
XhoI-BamHI NHP6A fragment from
p314-NV5 into pRS303 (47). Replacement of the chromosomal NHP6A gene with the V5-tagged version used p303-N
XN
linearized with EcoRV and selection for His+ transformants.
POB3 plasmid manipulations.
Plasmid p424-HAPOB
was generated by inserting a 3-kbp KpnI-EcoRI
fragment of YEpHAPOB (5), comprising the HA-Pob3 ORF plus 5' and 3' noncoding sequences, into pRS424. The integration plasmid pPH6TI carrying the C-terminal half of the ORF encoding
Pob3-V5-His6 was created by ligating a 2.8-kbp
ClaI-ScaI fragment of pYESP with a 2.5-kbp
ClaI-ScaI fragment of pRS304. Integration plasmid pYESP
C was created by removing a 4-kbp ClaI fragment from
pYESP. Replacement of the chromosomal POB3 gene with the
tagged version used pYESP
C (URA3) or pPH6TI
(TRP1) linearized with BclI.
| |
RESULTS |
|---|
|
|
|---|
Nhp6a/b protein associates with the CP
complex.
The close structural relationship between the yeast CP
complex (Cdc68 plus Pob3) and the analogous vertebrate complexes
comprising Cdc68 and the Pob3- and Nhp6-related protein SSRP1
(32, 34) suggests that the yeast Nhp6 and Cdc68 proteins
may associate in the same complex. To determine if the Nhp6 proteins do
indeed associate physically with Cdc68, Western blots of anti-Cdc68
immunoprecipitated protein (5) were probed for the
presence of Nhp6 using polyclonal anti-Nhp6a antibody
(36), which detects both Nhp6 isoforms. Nhp6a and/or Nhp6b
(here termed Nhp6a/b) was not found in anti-Cdc68 immunoprecipitates
using our previously reported conditions, and varying the pH (pH 7.4, 8.4, and 9.0) of the extraction buffer had little effect (data not
shown). On the other hand, the use of 50 mM potassium acetate in place
of 350 mM NaCl resulted in the presence of Nhp6a/b in the anti-Cdc68
immunoprecipitate (Fig. 1A). This
coimmunoprecipitation of Nhp6a/b with Cdc68, and thus the CP complex,
was unaffected over the pH range described above (data not shown) but
was lost at potassium acetate concentrations
100 mM (Fig. 1A).
|
nhp6a/b mutant cells and is therefore independent of Nhp6
protein (data not shown). The soluble fraction and the high-molecular-weight material, resuspended in extraction buffer containing either 50 mM potassium acetate or 350 mM NaCl, were then
subjected to immunoprecipitation. Similar amounts of Cdc68 protein
immunoprecipitated with anti-Cdc68 antibody from all three fractions.
Probing the same blot with anti-V5 antibody showed that Nhp6a
coimmunoprecipitated with Cdc68 predominantly from the
high-molecular-weight fraction resuspended in 50 mM potassium acetate
buffer (Fig. 1E). The presence of ethidium bromide during resuspension
and immunoprecipitation did not decrease this coimmunoprecipitation (data not shown), suggesting that protein-protein interactions rather
than protein-DNA interactions mediate the association of Nhp6 with
Cdc68 (25). As found when using whole-cell extracts, coimmunoprecipitation of Nhp6a protein with Cdc68 was markedly decreased when using high-molecular-weight material resuspended in
350 mM NaCl buffer, indicating that these conditions destabilize interactions responsible for Cdc68-Nhp6a association (Fig. 1E). Despite
the similar amounts of Nhp6a in all three fractions, Cdc68 was
effectively coimmunoprecipitated with Nhp6a (anti-V5 antibody) only
from the high-molecular-weight fraction resuspended in 50 mM
potassium acetate buffer, thus mirroring the anti-Cdc68
coimmunoprecipitation results (Fig. 1E). These findings verify the
association of Nhp6a protein with the CP complex and suggest that this
association may be stabilized by alterations to the CP complex and/or
Nhp6a which facilitate CP complex and/or Nhp6a interactions with other proteins.
Nhp6 protein mediates promoter repression.
Genetic and
biochemical assays have implicated both the CP complex and the Nhp6
proteins in transcriptional regulation (13, 29, 30, 36,
43). The Nhp6a and Nhp6b proteins are functionally redundant and
important yet not essential for growth (10, 36), allowing
the use of null alleles of the NHP6A and NHP6B
genes (nhp6a
::URA3 and
nhp6b
::LEU2) (36).
Studies were carried out using nhp6a
nhp6b
double-mutant null cells (designated here as
nhp6a/b
cells) and the plasmid-borne NHP6A gene, which encodes the
more abundant Nhp6 isoform (36).
and lys2-128
(53,
54). Transcription from each of these genes is altered by the
insertion of a Ty 1 retrotransposon long terminal repeat (
element);
as a result, cells harboring these mutant alleles are unable to make
functional his4-912
and lys2-128
transcripts and are auxotrophic for histidine and lysine. Restoration
of functional transcription at these alleles allows growth on medium
lacking histidine and/or lysine. This effect (known as the
Spt
phenotype) has been demonstrated for several
mutations that affect chromatin function, including cdc68
and pob3 mutations (13, 30, 45, 58).
Growth of haploid
nhp6a/b his4-912
lys2-128
segregants on medium lacking histidine was
significant at 23°C, although less robust than the growth of
nhp6a/b HIS4 segregants from the same cross. Similarly,
nhp6a/b lys2-128
segregants grew on medium lacking
lysine but in a temperature-dependent fashion, showing better growth at
30 than at 23°C (data not shown). Suppression of the
His
phenotype of his4-912
was seen only in
segregants containing both the nhp6a
and
nhp6b
mutations (Fig. 2A).
Transformation of
nhp6a/b his4-912
lys2-128
cells with a low-copy-number NHP6A plasmid restored the histidine and lysine auxotrophies (data not shown), confirming that repression of functional transcription at
his4-912
and lys2-128
is mediated by Nhp6
protein.
|
lys2-128
cells on medium lacking histidine and lysine
(5, 30). In contrast, neither a high-copy NHP6A
plasmid nor the increased dosage of both NHP6A and
POB3 together had any effect on the His
or
Lys
phenotype of his4-912
lys2-128
cells (data not shown). Furthermore, neither
increased dosage of NHP6A nor increased dosage of both NHP6A and POB3 suppressed the Spt
(His+ Lys+) phenotype of his4-912
lys2-128
cells arising from increased CDC68
dosage (data not shown). The benign effect of excess Nhp6a protein is
similar to the lack of effect of increased POB3 gene dosage
on the his4-912
and lys2-128
reporter genes
(5).
Chromatin is thought to maintain repression at the SUC2 gene
promoter in the absence of SUC2 upstream activating
sequences (UAS). Transcription from the core promoter of this
suc2
UAS mutant allele, as indicated by growth
on solid medium containing sucrose or raffinose as the sole carbon
source, can be increased by mutating Cdc68 (13, 30, 39,
58) and proteins that alter chromatin (39). On
sucrose medium at 30°C,
nhp6a/b suc2
UAS
segregants grew significantly better than did NHP6A NHP6B
suc2
UAS segregants from the same genetic cross and
showed only marginally less growth than NHP6A NHP6B SUC2
segregants. A low-copy NHP6A plasmid in
nhp6a/b
suc2
UAS cells prevented growth on sucrose medium,
indicating that Nhp6a protein helps to maintain chromatin repression at
the suc2
UAS core promoter (Fig. 2B). The
degree of suppression of the suc2
UAS
Suc
phenotype for cells lacking the Nhp6 proteins was
similar to that for NHP6A NHP6B suc2
UAS cells
harboring the cdc68-
922 mutation (13 and data not shown). Therefore Nhp6 protein, like
Cdc68, helps to maintain repression at a core promoter.
Nhp6 protein facilitates transcription. Like CP (13, 29, 43), Nhp6 protein facilitates activated transcription, in vivo and in vitro (36, 46). The interactions of Nhp6 with different transcription modulators were therefore investigated genetically.
Transcription of a subset of genes is brought about in part through the actions of the Swi-Snf complex (reviewed in reference 23), a chromatin-remodeling complex that interacts genetically with the CP complex (13, 30). Cells missing the Swi-Snf component Snf5 are unable to assemble a functional Swi-Snf complex (37); as a consequence, snf5 cells exhibit a mild growth impairment on rich medium. Using standard genetic techniques, the nhp6a
::URA3, nhp6b
::LEU2, and
snf5-5::URA3 mutant alleles were
reassorted in meiotic tetrads, and initial analysis focused on a tetrad
in which the URA3 genes marking snf5 and
nhp6a
cosegregated in two of the segregants, one of which
also contained nhp6b
::LEU2. This
nhp6a/b snf5 triple-mutant segregant grew poorly on solid
rich medium and had the novel phenotype of temperature sensitivity at
32.5°C (data not shown). In contrast, the other segregants from the
same tetrad and additional segregants that retained either Swi-Snf or
Nhp6 (Nhp6a and/or Nhp6b) function grew much more effectively at this
temperature, as did the NHP6A NHP6B snf5 and
nhp6a/b SNF5 parental strains (Fig. 2C). Thus the
combination of
nhp6a/b and snf5 creates a
synthetic lethality at 32.5°C. The NHP6A gene on a
low-copy-number plasmid eliminated the 32.5°C growth defect of these
nhp6a/b snf5 triple-mutant cells and allowed growth equivalent to that of the NHP6A NHP6B snf5 parental control
cells (Fig. 2C). Furthermore, the temperature sensitivity of
nhp6a/b snf5 cells was partially alleviated by the
inclusion of sorbitol in the growth medium (Fig. 2C), a situation which
also partially alleviates the high-temperature (38°C) growth
defect of
nhp6a/b mutant cells (10). These
observations indicate that Nhp6 protein and the Swi-Snf complex
similarly facilitate transcription important for growth at 32.5°C;
consequently, the absence of Nhp6 protein imposes a need for the
Swi-Snf complex at certain genes (and vice versa).
The Swi-Snf complex facilitates transcription of the SUC2
gene (1, 21), as evidenced by the poor growth of
snf5 mutant cells using sucrose as a carbon source. We noted
that
nhp6a/b snf5 cells grow poorly on sucrose medium
even at 23°C (data not shown), but the general growth impairment of
these mutant cells, and its incomplete remediation by sorbitol,
confounded our attempts to assess genetic interactions in
SUC2 transcription. In cells with Swi-Snf function, the
absence of Nhp6 protein did not impair growth on sucrose medium (data
not shown), indicating that Nhp6 is dispensable for Swi-Snf-activated
SUC2 transcription.
The synthetic lethality seen for
nhp6a/b snf5 cells
contrasts with the suppression of the effects of snf5 and
another Swi-Snf mutation by alteration of the CP complex (13,
30). This difference suggests that the CP complex and Nhp6
interact functionally with the Swi-Snf complex in different ways. Gene
dosage effects also indicate a functional difference. An increased
dosage of the CDC68 and/or POB3 genes suppresses
several effects of Swi-Snf dysfunction (5, 30), whereas an
increased dosage of the NHP6A gene did not alleviate the
Suc
and Ino
consequences of the
snf5 mutation (data not shown).
Another transcription modulator is the complex containing the Spt4 and
Spt5 proteins (19, 50). This complex, like CP, has both
positive and negative effects on yeast cell growth (19), while the mammalian Spt4-Spt5 complex, termed DSIF, has been found to
modulate the acquisition of elongation competence in vitro by the
transcriptionally engaged RNAP II enzyme (50). The absence of Nhp6 protein produces a synthetic lethality with the
spt5-194 mutation (19) (Fig. 2D), implicating
Nhp6 in transcription elongation.
Mutations that affect transcription elongation, such as
ppr2, which eliminates sequences encoding
transcription elongation factor TFIIS (15, 31), may confer
sensitivity to the analog 6-azauracil (6AU). We found that
nhp6a/b mutant cells were sensitive to 6AU (Fig. 2E),
consistent with a role for Nhp6 protein in modulating transcription
elongation. Over a range of 6AU concentrations, the sensitivity of
nhp6a/b
ppr2 triple-mutant cells was no
greater than that of
nhp6a/b or
ppr2 cells
(data not shown), consistent with Nhp6 modulation of 6AU resistance
through TFIIS function. Thus, several indicators implicate Nhp6 in
transcription, specifically in elongation.
cdc68-
922 has effects resembling those
caused by the absence of Nhp6 protein.
Cells lacking both Nhp6a
and Nhp6b proteins are temperature sensitive at 38°C, as are cells
harboring the cdc68-
922 allele (10, 13,
36). Cells lacking Nhp6 are also sensitive to nitrogen starvation, as indicated by a loss of viability during incubation under
nitrogen-deficient conditions (10); similarly,
cdc68-
922 mutant cells were also found to be
sensitive to nitrogen starvation. Cells were replica plated to
synthetic medium without ammonium sulfate and incubated at 23°C for
starvation, and then replica plated to rich medium for further
incubation at 23°C to assess cell growth as a measure of cell
survival. After 4 days of nitrogen starvation, the
cdc68-
922 mutant cells exhibited significantly less growth on rich medium than did wild-type cells (Fig.
3A), indicating that many of the starved
cdc68-
922 cells lost the capacity for colony
formation. The cdc68-
922 colonies that did form were not the consequence of additional mutations, as cells from
several cdc68-
922 colonies that formed after
nitrogen starvation displayed the same overall sensitivity to nitrogen
starvation as that of the original cdc68-
922
cells (data not shown). Survival decreased with starvation time, as
indicated by the virtual absence of regrowth of
cdc68-
922 cells, and of
nhp6a/b
cells, after 5 days of nitrogen starvation; in contrast, wild-type
cells similarly starved showed significant regrowth (data not shown).
Thus, cells with the cdc68-
922 mutant version
of the CP complex display a growth phenotype resembling that caused by
the absence of Nhp6 protein.
|
nhp6a/b mutant cells are partially alleviated by the
presence of the osmotic stabilizer sorbitol (10; our
observations). However, sorbitol (1 M) did not alleviate the
temperature sensitivity or the starvation sensitivity of
cdc68-
922 mutant cells (data not shown). This
observation suggests that the temperature and starvation sensitivities
of
nhp6a/b and of cdc68-
922 are
due to different effects.
Nhp6 protein facilitates CP activity in vivo.
A cross
between
nhp6a/b and
cdc68-
922 parental strains showed that
nhp6a/b cdc68-
922 triple-mutant segregants
were compromised for growth and survival compared to
cdc68-
922 segregants with either Nhp6a or
Nhp6b function and to parental cells. The
nhp6a/b cdc68-
922 triple-mutant cells were temperature
sensitive for growth at 34°C, a temperature at which the
nhp6a/b and cdc68-
922 parental
strains and segregants with these genotypes show good growth (Fig.
3B), and lost viability more rapidly upon nitrogen starvation
(Fig. 3C). The more severe temperature and starvation sensitivities of
nhp6a/b
cdc68-
922 cells were alleviated by a low-copy-number
NHP6A plasmid (Fig. 3B and C) or a low-copy-number CDC68 plasmid (data not shown). Thus, the absence of Nhp6
protein is synthetically lethal with the
cdc68-
922 mutation, a finding that strengthens
the view that Nhp6 and the CP complex have related effects on
transcription. In contrast to what is seen for the temperature
sensitivity of
nhp6a/b CDC68 cells, 1 M sorbitol did not
alleviate the synthetically enhanced temperature sensitivity of
nhp6a/b cdc68-
922 cells (data not shown).
This synthetic enhancement is therefore a likely consequence of an
impaired CP complex, rather than the absence of Nhp6 protein, so
that CP-related temperature sensitivity is exacerbated in
nhp6a/b cdc68-
922 triple-mutant
cells. Thus Nhp6 facilitates high-temperature growth when the CP
complex is compromised by mutation.
Pob3-Nhp6a fusion creates a yeast version of SSRP1 with Pob3
function.
The biochemical and genetic findings discussed above
suggest that the Nhp6 protein may function in association with the CP complex of Cdc68 and Pob3 and that the yeast Pob3 and Nhp6 proteins, structurally homologous to N-terminal and C-terminal regions, respectively, of the vertebrate SSRP1 protein, may function together. To test these ideas, the Nhp6a protein was covalently attached to the C
terminus of Pob3, resulting in a Pob3-Nhp6a fusion protein that
resembles SSRP1 (in primary sequence). The Pob3-Nhp6a fusion protein
contains the entire sequence of Pob3, a 7-residue spacer, the entire
Nhp6a sequence minus the first three amino acids (which are dispensable
for Nhp6a function [61]), and the V5 epitope and
His6 tag at its C terminus (Fig.
4A).
|
pob3 mutant cells kept alive by the POB3
plasmid pGADPOB (5). Transformants were then grown in
selective medium containing galactose and screened for leucine
auxotrophy, indicating loss of the pGADPOB plasmid. The
pob3 mutant cells that had lost pGADPOB but retained the
POB3-NHP6A plasmid showed robust growth on galactose,
indicating that the Pob3-Nhp6a fusion protein provides Pob3 function
(data not shown). On glucose medium, which represses transcription of the plasmid-borne POB3-NHP6A gene, growth was greatly
inhibited (data not shown), indicating that the Pob3-Nhp6a protein
provides the essential function(s) of Pob3.
The chromosomal copy of the POB3 gene was replaced with the
POB3-NHP6A gene under the control of POB3
transcription regulatory sequences. These transformants, containing
Pob3-Nhp6a instead of Pob3 protein, grew as robustly as wild-type
cells, indicating that the POB3-NHP6A gene, expressed at
normal POB3 levels, provides wild-type Pob3 function (see
Fig. 5). The Pob3-Nhp6a fusion protein in these cells migrated at an
apparent size consistent with the addition of the
Nhp6a-V5-His6 polypeptide to Pob3 protein (70 kDa)
(5). Moreover, the Pob3-Nhp6a fusion protein is fully intact in vivo (Fig. 4B); therefore, biological activity of the POB3-NHP6A gene can be attributed to full-length Pob3-Nhp6a protein.
Pob3-Nhp6a protein provides Nhp6a activity.
The chromosomal
replacement of POB3 with POB3-NHP6A was made in
cells lacking Nhp6 protein (Table 1). The replacement of the
POB3 gene with POB3-NHP6A in
nhp6a/b mutant cells restores growth at 38°C (Fig. 5)
and sensitivity to 6AU (Fig. 2E), while POB3-NHP6A
expression in
nhp6a/b cells alleviates synthetic
interaction with spt5-194 (data not shown). The Pob3-Nhp6a
protein also allows
nhp6a/b cells to survive nitrogen
starvation, although growth of
nhp6a/b POB3-NHP6A cells
after starvation was less substantial than that of wild-type cells
(Fig. 5). Another test of Nhp6 function is growth on galactose. Cells lacking Nhp6a and Nhp6b are impaired for
GAL1 induction (36) and unable to grow
effectively using galactose as the carbon source (62).
Similarly, we saw an extended (7-day) lag for
nhp6a/b
mutant cells on galactose solid medium at 23°C, and only low-level
growth was ever achieved (Fig. 5). In contrast, robust
galactose-dependent growth was evident after a 2-day incubation for
nhp6a/b cells that contained the Pob3-Nhp6a protein in
place of Pob3 (Fig. 5) and was indistinguishable from the growth of
nhp6a/b cells harboring the wild-type NHP6A
gene on a low-copy-number plasmid (data not shown). Thus, by several criteria the Pob3-Nhp6a fusion protein supplies both Pob3 and Nhp6a
function in vivo.
|
Pob3-Nhp6a fusion protein associates with Cdc68 in the CP
complex.
A high-speed supernatant fraction from
nhp6a/b
POB3-NHP6A cells was size-fractionated and assayed for the
distributions of Cdc68 and Pob3-Nhp6a. As shown in Fig.
6A, both proteins cofractionated in the
size range of the Cdc68 + Pob3 (CP) complex (5),
suggesting that the Cdc68 and Pob3-Nhp6a proteins form an in vivo
complex analogous to the CP complex. To verify this association, the
proteins were separately immunoprecipitated from a clarified whole-cell extract using anti-V5 and anti-Cdc68 antisera. The anti-V5 antibody immunoprecipitated Pob3-Nhp6a, as expected, and coimmunoprecipitated Cdc68 (Fig. 6B). The reciprocal experiment using anti-Cdc68 antiserum to immunoprecipitate Cdc68 from the same clarified whole-cell extract
showed that Pob3-Nhp6a coimmunoprecipitated with Cdc68 (Fig. 6B).
Comparisons of the amounts of immunoprecipitated material versus
residual soluble material (Fig. 6B) indicated that Cdc68 and Pob3-Nhp6a
are present in the complex in equal stoichiometric amounts, as
previously demonstrated for the CP complex of Cdc68 and wild-type Pob3
(5). These observations suggest that the Nhp6 activity
attributed above to the Pob3-Nhp6a fusion protein is largely due to
Nhp6a in covalent association with the CP complex.
|
Nhp6 functions of Pob3-Nhp6a protein may depend on Cdc68 association. Both Pob3 and the Pob3-Nhp6a fusion protein can associate with Cdc68; Pob3-Nhp6a protein, however, has the added ability to provide Nhp6a function. Pob3-Nhp6a protein may even be physically associated with Cdc68 for this Nhp6a function. To test this idea, the ability of Pob3 protein to displace Pob3-Nhp6a from Cdc68 was assessed under growth conditions that necessitate the Nhp6a activity of the Pob3-Nhp6a protein.
For this experiment,
nhp6a/b POB3-NHP6A cells were
transformed with a multicopy plasmid expressing HA-Pob3 from the
POB3 promoter. In parallel, the same
nhp6a/b
POB3-NHP6A cells were transformed with a multicopy plasmid
expressing both POB3 (HA-Pob3) and NHP6A
(Nhp6a-V5-His6) as separate genes. Both transformant types,
plus a vector-transformant control, were grown at 37°C, a temperature
at which Nhp6 function is necessary for robust growth, and harvested in
mid-log phase for the preparation of whole-cell extracts. Anti-Cdc68
antiserum was used to immunoprecipitate the CP complex, and levels of
coimmunoprecipitating Pob3-Nhp6a protein were determined. Under these
37°C growth conditions, Pob3-Nhp6a was associated with Cdc68 in all
cases but in amounts twofold greater in the absence of the individual
Nhp6a and HA-Pob3 proteins than in their presence (Fig.
7A, compare lanes 1 and 3). The presence of HA-Pob3 alone did not decrease the amount of Pob3-Nhp6a associated with Cdc68 (Fig. 7A, lane 2). These observations indicate that growth
at 37°C favors the association of Cdc68 with Pob3-Nhp6a rather than
Pob3 (in the absence of native Nhp6 protein). To show that HA-Pob3
displaces Pob3-Nhp6a from Cdc68 when Nhp6a is present, the same blot
was probed with anti-HA to assess the level of HA-Pob3 in the CP
complex. Although at 37°C a small fraction of HA-Pob3 was
incorporated into the CP complex in the absence of Nhp6a (Fig. 7A, lane
2), there was a marked increase in the level of HA-Pob3 in the CP
complex when Nhp6a was present in the cell (Fig. 7A, lane 3). The
increased amount of Cdc68-associated HA-Pob3 was consistent with the
degree of displacement of Pob3-Nhp6a under those conditions. Similar
experiments suggest that the association of Pob3-Nhp6a with Cdc68 also
facilitates growth on galactose (data not shown). These findings
therefore suggest that for some aspects of Nhp6a function, including
37°C growth and galactose catabolism, the Nhp6a protein may have to
be associated with the CP complex, a situation that can be satisfied by
either covalent (Pob3-Nhp6a) or noncovalent interactions.
|
Pob3-Nhp6a is compromised for certain Nhp6a functions.
Despite
the above findings,
nhp6a/b POB3-NHP6A cells do not grow
as well as cells in which native Nhp6a protein is present, suggesting
that the Pob3-Nhp6a protein lacks full Nhp6a activity. Inadequacy is
also evident for Nhp6a activities related to chromatin repression: the
Pob3-Nhp6a protein could not suppress the His+
Lys+ phenotype or the Suc+ phenotype of
nhp6a/b his4-912
lys2-128
suc2
UAS mutant cells. On the other hand, the Pob3-Nhp6a protein in place of Pob3 does not
diminish promoter repression at the his4-912
,
lys2-128
, and suc2
UAS loci in cells containing
the Nhp6a/b proteins (data not shown), and Nhp6a protein restores
robust growth to
nhp6a/b POB3-NHP6A cells (data not
shown), indicating that the Pob3-Nhp6a protein does not interfere with
the interactions of native Nhp6a protein. In
nhp6a/b POB3
cells, expression of the POB3-NHP6A gene from the
GAL1 promoter on a multicopy plasmid improves cell growth as
expected but still does not suppress the His+
Lys+ phenotype (data not shown), making it unlikely that
the chromosomal POB3-NHP6A gene simply produces insufficient
protein for all Nhp6 activities. We considered the idea that the Nhp6a
portion of the Pob3-Nhp6a fusion protein may not properly associate
with the CP complex, in which case Nhp6a may be able to interact with
the Pob3-Nhp6a version of the CP complex to restore full function. To
test this idea, the CP complex was immunoprecipitated with anti-Cdc68
antibody from
nhp6a/b POB3 cells and
nhp6a/b
POB3-NHP6A cells that also harbored a low-copy-number plasmid
expressing (V5+His6)-tagged Nhp6a protein and the amount of
tagged Nhp6a coimmunoprecipitating with Cdc68 was determined. These
results showed that Nhp6a coimmunoprecipitates equally well with the
(Cdc68 + Pob3) and the (Cdc68 + Pob3-Nhp6a) complexes (Fig.
7B). The amount of Nhp6a associated with each of these versions of the CP complex was not increased by an increased dosage of the
NHP6A gene, suggesting that the Nhp6a protein interacts with
a specific binding site associated with both versions of the complex
(data not shown). The Nhp6a portion of Pob3-Nhp6a may not properly
occupy an Nhp6-binding site associated with the CP complex, but can
nonetheless provide certain Nhp6a functions by virtue of its physical
attachment to Pob3.
| |
DISCUSSION |
|---|
|
|
|---|
The budding yeast S. cerevisiae contains a nuclear protein complex that is related structurally and functionally to the FACT complex of human cells and the DUF complex of Xenopus (32, 34). Both the yeast and vertebrate complexes contain the Cdc68 (Spt16) protein, and both also contain the structurally related proteins SSRP1 (vertebrate) and Pob3 (yeast). The yeast Pob3 protein does not contain the HMG box domain found at the C terminus of SSRP1; however, yeast cells have several small HMG box proteins. Here we provide evidence that members of a functionally redundant pair of small HMG box proteins, Nhp6a and Nhp6b, associate physically with the yeast complex of Pob3 and Cdc68 proteins and have effects on transcription that are related to those of the CP (Cdc68-Pob3) complex. These conclusions are derived in part from a functional analysis of a Pob3-Nhp6a fusion protein constructed to resemble an SSRP1 protein. Our findings suggest that Nhp6 protein (Nhp6a and/or Nhp6b) may associate with and function along with the Pob3 protein to make up a functional, but bipartite, yeast analog of the vertebrate SSRP1 protein.
Here we have demonstrated a physical association of Nhp6 with the CP
complex by coimmunoprecipitation and affinity purification. Both
procedures showed that a significant amount of Nhp6 protein could be
isolated along with the CP complex, and that this CP-Nhp6 ensemble is
for the most part associated with high-molecular-weight material that
pellets at 200,000 × g; this material would include chromatin. In contrast, the CP that remained soluble during this fractionation associated poorly with Nhp6. Association of CP with Nhp6
was not improved by Nhp6a overexpression, suggesting that the affinity
of Nhp6 for CP may be regulated and correlated with retention of CP
and/or Nhp6 in high-molecular-weight material. Nhp6 has
sequence-nonspecific DNA-binding ability (35, 61), but
this DNA-binding activity is not solely responsible for the association
of CP with high-molecular-weight material, for CP was also found in the
200,000 × g pellet made from extracts of
nhp6a/b mutant cells. The molecular bases for the
high-molecular-weight associations of CP and the differences in CP-Nhp6
affinity, and indeed whether the association between Nhp6 and CP is
direct or indirect, remain to be determined.
The human FACT complex can facilitate transcription elongation on a
nucleosomal template in vitro (27, 33), while genetic findings from yeast are consistent with an analogous role in vivo for
the CP complex (34). The Cdc68 and Pob3 proteins
constituting CP are both essential, as might be expected for global
modulators of transcription (30, 55). In contrast, the
Nhp6a-Nhp6b protein pair is dispensable for life and for the
transcription of many genes (10, 36). Is this
dispensability accounted for by the function of another homolog?
Another small HMG box protein that resembles the C terminus of SSRP1 is
Nhp10 (28). However, the Nhp10 protein is unlikely to have
Nhp6-like function, because synthetic interactions between
nhp6a/b and the complete absence of Nhp10 protein could
not be detected (our unpublished observations). Likewise, no
synthetic interactions were detected between
nhp6a/b and the complete absence of Hmo1, another HMG box protein
(28). These negative findings suggest that an HMG box
domain is dispensable for some of the transcription functions of the CP complex.
Despite the dispensability of Nhp6 protein for some CP functions, our
findings indicate a direct involvement of CP in Nhp6-mediated transcription. Nhp6 proteins do facilitate the transcription of a
subset of genes (36, 46), and the galactose auxotrophy
that we and others (62) find for
nhp6a/b
cells supports an important role for Nhp6 in GAL gene
transcription. For effective growth on galactose, Nhp6 activity can be
supplied by the Pob3-Nhp6a fusion protein, in association with Cdc68.
Thus Nhp6 may function in a gene-specific manner through association
with the CP complex.
The nature of one transcriptional role for Nhp6 may be indicated by the genetic relationship between Nhp6 and the Swi-Snf complex, a chromatin-remodeling machine that facilitates the transcription of several genes (reviewed in reference 23). We find that the absence of Nhp6 proteins increases the reliance on the Swi-Snf complex for overall growth, especially at elevated temperatures. These findings indicate that Nhp6 and the Swi-Snf complex affect the same process but in different ways.
Genetic interactions analogous to those reported here between Nhp6 and Swi-Snf are also found for Nhp6 proteins and the Gcn5 protein (62), which is the catalytic subunit of several histone acetyltransferase complexes (16, 38, 44), and for Gcn5 and Swi-Snf (3, 12, 18, 38, 41, 42, 48). Therefore, Nhp6 protein, the Swi-Snf complex, and Gcn5-mediated histone acetylation have mutually complementary effects that facilitate transcription. These common effects may assist transcriptional activators. Nhp6 can facilitate the binding of the TATA-binding protein component of TFIID to TATA sequences in vitro (36), and overexpression of Nhp6 protein increases transcription activation by mutated forms of the activator SBF (Swi4-Swi6) that retain sequence-specific DNA-binding ability (14, 46). Swi-Snf facilitates activator function through the remodeling of chromatin, whereas the chromatin-remodeling ability of Nhp6, in association with the CP complex or independently, is not known. Nhp6 proteins do, however, bend and partially unwind DNA by binding in a sequence-nonspecific manner in the minor groove (2, 35, 61). Negative supercoiling, as would result from Nhp6 binding, is correlated with disruption of nucleosome structure (26) and may therefore be involved in the facilitation of transcription by Nhp6 protein. Yeast Swi-Snf and mammalian Swi-Snf-like complexes can also bind the minor groove of DNA in a relatively sequence-nonspecific manner, with an affinity for bent and partially unwound DNA (40, 52), but this binding induces positive DNA supercoiling and may therefore have different consequences. Therefore, Nhp6 and Swi-Snf may facilitate the binding of general transcription factors by different mechanisms.
Our findings indicate that the Nhp6 protein has transcriptional effects similar to those of CP (13, 30) and can physically associate with CP. However, several Nhp6 functions are not provided by the Pob3-Nhp6a fusion protein. Our finding that native Nhp6a protein can associate with the Cdc68 + Pob3-Nhp6a complex is evidence that this particular fusion protein is not constructed to allow optimal Nhp6a interaction with CP-associated material, a situation which may prevent the full spectrum of Nhp6a activity. Alternatively, tethering Nhp6 to CP via Pob3-Nhp6a may interfere with other Nhp6 associations. Our biochemical findings are consistent with this possibility, in that not all native Nhp6 protein can be found to be associated with the CP complex. There are many examples of transcription-related proteins seen in multiple complexes. Those related to RNAP II activity include several components common to the SAGA, ADA and TFIID complexes (12, 17); the Anc1 (Swp29, Tfg3, or Taf30) protein that is a component of Swi-Snf (6), the NuA3 histone acetyltransferase (22), the mediator complex that binds RNAP II, and the general transcription factor TFIIG (20); the Arp7 and Arp9 proteins that are members of both the Swi-Snf and RSC chromatin-remodeling complexes (7); and undoubtedly others as well. The degree to which the CP complex and Nhp6 may be functionally congruent or distinct is open to further analysis.
| |
ACKNOWLEDGMENTS |
|---|
We thank Reid Johnson for strains, plasmids, and antibodies, Fred Winston for strains, Fred Cross for plasmids, and David Carruthers, Kendra Gillis, and Amy Wheeler Reich for technical assistance.
This work was supported by a grant to G.C.J. and R.A.S. from the Medical Research Council of Canada/Canadian Institutes of Health Research.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biochemistry & Molecular Biology, Dalhousie University, Halifax, Nova Scotia, Canada B3H 4H7. Phone: (902) 494-8847. Fax: (902) 494-1355. E-mail: rasinger{at}is.dal.ca.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Abrams, E.,
L. Neigeborn, and M. Carlson.
1986.
Molecular analysis of SNF2 and SNF5, genes required for expression of glucose-repressible genes in Saccharomyces cerevisiae.
Mol. Cell. Biol.
6:3643-3651 |
| 2. | Allain, F. H.-T., Y.-M. Yen, J. E. Masse, P. Schultze, T. Dieckmann, R. C. Johnson, and J. Feigon. 1999. Solution structure of the HMG protein NHP6A and its interaction with DNA reveals the structural determinants for non-sequence-specific binding. EMBO J. 18:2563-2579[CrossRef][Medline]. |
| 3. | Biggar, S. R., and G. R. Crabtree. 1999. Continuous and widespread roles for the Swi-Snf complex in transcription. EMBO J. 18:2254-2264[CrossRef][Medline]. |
| 4. | Bortvin, A., and F. Winston. 1996. Evidence that Spt6p controls chromatin structure by a direct interaction with histones. Science 272:1473-1476[Abstract]. |
| 5. |
Brewster, N. K.,
G. C. Johnston, and R. A. Singer.
1998.
Characterization of the CP complex, an abundant dimer of Cdc68 and Pob3 proteins that regulates yeast transcriptional activation and chromatin repression.
J. Biol. Chem.
273:21972-21979 |
| 6. | Cairns, B. R., N. L. Henry, and R. D. Kornberg. 1996. TFG3/TAF30/ANC1, a component of the yeast SWI/SNF complex that is similar to the leukemogenic proteins ENL and AF-9. Mol. Cell. Biol. 16:3308-3316[Abstract]. |
| 7. | Cairns, B. R., H. Erdjument-Bromage, P. Tempst, F. Winston, and R. D. Kornberg. 1998. Two actin-related proteins are shared functional components of the chromatin-remodeling complexes RSC and SWI/SNF. Mol. Cell 2:639-651[CrossRef][Medline]. |
| 8. |
Chang, C.-H., and D. S. Luse.
1997.
The H3/H4 tetramer blocks transcript elongation by RNA polymerase II in vitro.
J. Biol. Chem.
272:23427-23434 |
| 9. | Christianson, T. W., R. S. Sikorski, M. Dante, J. H. Shero, and P. Hieter. 1992. Multifunctional yeast high-copy-number shuttle vectors. Gene 110:119-122[CrossRef][Medline]. |
| 10. |
Costigan, C.,
D. Kolodrubetz, and M. Snyder.
1994.
NHP6A and NHP6B, which encode HMG1-like proteins, are candidates for downstream components of the yeast SLT2 mitogen-activated protein kinase pathway.
Mol. Cell. Biol.
14:2391-2403 |
| 11. | Cross, F. R. 1997. `Marker swap' plasmids: convenient tools for budding yeast molecular genetics. Yeast 13:647-653[CrossRef][Medline]. |
| 12. |
Eberharter, A.,
D. E. Sterner,
D. Schieltz,
A. Hassan,
J. R. Yates III,
S. L. Berger, and J. L. Workman.
1999.
The ADA complex is a distinct histone acetyltransferase complex in Saccharomyces cerevisiae.
Mol. Cell. Biol.
19:6621-6631 |
| 13. |
Evans, D. R. H.,
N. K. Brewster,
Q. Xu,
A. Rowley,
B. A. Altheim,
G. C. Johnston, and R. A. Singer.
1998.
The yeast protein complex containing Cdc68 and Pob3 mediates core-promoter repression through the Cdc68 N-terminal domain.
Genetics
150:1393-1405 |
| 14. | Ewaskow, S. P., J. M. Sidorova, J. Hendle, J. C. Emery, D. E. Lycan, K. Y. Zhang, and L. L. Breeden. 1998. Mutation and modeling analysis of the Saccharomyces cerevisiae Swi6 ankyrin repeats. Biochemistry 37:4437-4450[CrossRef][Medline]. |
| 15. | Exinger, G., and F. Lacroute. 1992. 6-Azauracil inhibition of GTP biosynthesis in Saccharomyces cerevisiae. Curr. Genet. 22:9-11[CrossRef][Medline]. |
| 16. |
Grant, P. A.,
L. Duggan,
J. Côté,
S. M. Roberts,
J. E. Brownell,
R. Candau,
R. Ohba,
T. Owens-Hughes,
C. D. Allis,
F. Winston,
S. L. Berger, and J. L. Workman.
1997.
Yeast Gcn5 functions in two multisubunit complexes to acetylate nucleosomal histones: characterization of an Ada complex and the SAGA (Spt/Ada) complex.
Genes Dev.
11:1640-1650 |
| 17. | Grant, P. A., D. Schieltz, M. G. Pray-Grant, D. J. Steger, J. C. Reese, J. R. Yates III, and J. L. Workman. 1998. A subset of TAFIIs are integral components of the SAGA complex required for nucleosome acetylation and transcriptional stimulation. Cell 94:45-53[CrossRef][Medline]. |
| 18. | Gregory, P. D., A. Schmid, M. Zavari, M. Münsterkötter, and W. Hörz. 1999. Chromatin remodelling at the PHO8 promoter requires SWI-SNF and SAGA at a step subsequent to activator binding. EMBO J. 18:6407-6414[CrossRef][Medline]. |
| 19. |
Hartzog, G. A.,
T. Wada,
H. Handa, and F. Winston.
1998.
Evidence that Spt4, Spt5, and Spt6 control transcription elongation by RNA polymerase II in Saccharomyces cerevisiae.
Genes Dev.
12:357-369 |
| 20. |
Henry, N. L.,
A. M. Campbell,
W. J. Feaver,
D. Poon,
P. A. Weil, and R. D. Kornberg.
1994.
TFIIF-TAF-RNA polymerase II connection.
Genes Dev.
8:2868-2878 |
| 21. |
Hirschhorn, J. N.,
S. A. Brown,
C. D. Clark, and F. Winston.
1992.
Evidence that SNF2/SWI2 and SNF5 activate transcription in yeast by altering chromatin structure.
Genes Dev.
6:2288-2298 |
| 22. |
John, S.,
L. Howe,
S. T. Tafrov,
P. A. Grant,
R. Sternglanz, and J. L. Workman.
2000.
The Something About Silencing protein, Sas3, is the catalytic subunit of NuA3, a yTAFII30-containing HAT complex that interacts with the Spt16 subunit of the yeast CP (Cdc68/Pob3)-FACT complex.
Genes Dev.
14:1196-1208 |
| 23. |
Kingston, R. E., and G. J. Narlikar.
1999.
ATP-dependent remodeling and acetylation as regulators of chromatin fluidity.
Genes Dev.
13:2339-2352 |
| 24. |
Kolodrubetz, D., and A. Burgum.
1990.
Duplicated NHP6 genes of Saccharomyces cerevisiae encode proteins homologous to bovine high mobility group protein 1.
J. Biol. Chem.
265:3234-3239 |
| 25. |
Lai, J.-S., and W. Herr.
1992.
Ethidium bromide provides a simple tool for identifying genuine DNA-independent protein associations.
Proc. Natl. Acad. Sci. USA
89:6958-6962 |
| 26. |
Lee, M. S., and W. T. Garrard.
1991.
Positive DNA supercoiling generates a chromatin conformation characteristic of highly active genes.
Proc. Natl. Acad. Sci. USA
88:9675-9679 |
| 27. |
LeRoy, G.,
G. Orphanides,
W. S. Lane, and D. Reinberg.
1998.
Requirement of RSF and FACT for transcription of chromatin templates in vitro.
Science
282:1900-1904 |
| 28. |
Lu, J.,
R. Kobayashi, and S. J. Brill.
1996.
Characterization of a high mobility group 1/2 homolog in yeast.
J. Biol. Chem.
271:33678-33685 |
| 29. |
Lycan, D.,
G. Mikesell,
M. Bunger, and L. Breeden.
1994.
Differential effects of Cdc68 on cell cycle-regulated promoters in Saccharomyces cerevisiae.
Mol. Cell. Biol.
14:7455-7465 |
| 30. |
Malone, E. A.,
C. D. Clark,
A. Chiang, and F. Winston.
1991.
Mutations in SPT16/CDC68 suppress cis- and trans-acting mutations that affect promoter function in Saccharomyces cerevisiae.
Mol. Cell. Biol.
11:5710-5717 |
| 31. |
Nakanishi, T.,
A. Nakuno,
K. Nomura,
K. Sekimizu, and S. Natori.
1992.
Purification, gene cloning, and gene disruption of the transcription factor SII in Saccharomyces cerevisiae.
J. Biol. Chem.
267:13200-13204 |
| 32. | Okuhara, K., K. Ohta, H. Seo, M. Shioda, T. Yamada, Y. Tanaka, N. Dohmae, Y. Seyama, T. Shibata, and H. Murofushi. 1999. A DNA unwinding factor involved in DNA replication in cell-free extracts of Xenopus eggs. Curr. Biol. 9:341-350[CrossRef][Medline]. |
| 33. | Orphanides, G., G. LeRoy, C.-H. Chang, D. S. Luse, and D. Reinberg. 1998. FACT, a factor that facilitates transcript elongation through nucleosomes. Cell 92:105-116[CrossRef][Medline]. |
| 34. | Orphanides, G., W.-H. Wu, W. S. Lane, M. Hampsey, and D. Reinberg. 1999. The chromatin-specific transcription elongation factor FACT comprises human SPT16 and SSRP1 proteins. Nature 400:284-288[CrossRef][Medline]. |
| 35. |
Paull, T. T., and R. C. Johnson.
1995.
DNA looping by Saccharomyces cerevisiae high mobility group proteins NHP6A/B.
J. Biol. Chem.
270:8744-8754 |
| 36. |
Paull, T. T.,
M. Carey, and R. C. Johnson.
1996.
Yeast HMG proteins NHP6A/B potentiate promoter-specific transcriptional activation in vivo and assembly of preinitiation complexes in vitro.
Genes Dev.
10:2769-2781 |
| 37. |
Peterson, C. L.,
A. Dingwall, and M. P. Scott.
1994.
Five SWI/SNF gene products are components of a large multisubunit complex required for transcriptional enhancement.
Proc. Natl. Acad. Sci. USA
91:2905-2908 |
| 38. | Pollard, K. J., and C. L. Peterson. 1997. Role for ADA/GCN5 products in antagonizing chromatin-mediated transcriptional repression. Mol. Cell. Biol. 17:6212-6222[Abstract]. |
| 39. | Prelich, G., and F. Winston. 1993. Mutations that suppress the deletion of an upstream activating sequence in yeast: involvement of a protein kinase and histone H3 in repressing transcription in vivo. Genetics 135:665-676[Abstract]. |
| 40. | Quinn, J., A. M. Fyrberg, R. W. Ganster, M. C. Schmidt, and C. L. Peterson. 1996. DNA-binding properties of the yeast SWI/SNF complex. Nature 379:844-847[CrossRef][Medline]. |
| 41. | Recht, J., and M. A. Osley. 1999. Mutations in both the structured domain and N-terminus of histone H2B bypass the requirement for Swi-Snf in yeast. EMBO J. 18:229-240[CrossRef][Medline]. |
| 42. | Roberts, S. M., and F. Winston. 1997. Essential functional interactions of SAGA, a Saccharomyces cerevisiae complex of Spt, Ada, and Gcn5 proteins, with the Snf/Swi and Srb/mediator complexes. Genetics 147:451-465[Abstract]. |
| 43. |
Rowley, A.,
R. A. Singer, and G. C. Johnston.
1991.
CDC68, a yeast gene that affects regulation of cell proliferation and transcription, encodes a protein with a highly acidic carboxyl terminus.
Mol. Cell. Biol.
11:5718-5726 |
| 44. |
Saleh, A.,
D. Schieltz,
N. Ting,
S. B. McMahon,
D. W. Litchfield,
J. R. Yates III,
S. P. Lees-Miller,
M. D. Cole, and C. J. Brandl.
1998.
Tra1p is a component of the yeast Ada-Spt transcriptional regulatory complexes.
J. Biol. Chem.
273:26559-26565 |
| 45. |
Schlesinger, M. B., and T. Formosa.
2000.
POB3 is required for both transcription and replication in the yeast Saccharomyces cerevisiae.
Genetics
155:1593-1606 |
| 46. |
Sidorova, J., and L. Breeden.
1999.
The MSN1 and NHP6A genes suppress SW16 defects in Saccharomyces cerevisiae.
Genetics
151:45-55 |
| 47. |
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27 |
| 48. | Sudarsanam, P., Y. Cao, L. Wu, B. C. Laurent, and F. Winston. 1999. The nucleosome remodeling complex, Snf/Swi, is required for the maintenance of transcription in vivo and is partially redundant with the histone acetyltransferase, Gcn5. EMBO J. 18:3101-3106[CrossRef][Medline]. |
| 49. |
Swanson, M. S.,
E. A. Malone, and F. Winston.
1991.
SPT5, an essential gene important for normal transcription in Saccharomyces cerevisiae, encodes an acidic nuclear protein with a carboxy-terminal repeat.
Mol. Cell. Biol.
11:3009-3019 |
| 50. |
Wada, T.,
T. Takagi,
Y. Yamaguchi,
A. Ferdous,
T. Imai,
S. Hirose,
S. Sugimoto,
K. Yano,
G. A. Hartzog,
F. Winston,
S. Buratowski, and H. Handa.
1998.
DSIF, a novel transcription elongation factor that regulates RNA polymerase II processivity, is composed of human Spt4 and Spt5 homologs.
Genes Dev.
12:343-356 |
| 51. | Wada, T., G. Orphanides, J. Hasegawa, D.-K. Kim, D. Shima, Y. Yamaguchi, A. Fukuda, K. Hisatake, S. Oh, D. Reinberg, and H. Handa. 2000. FACT relieves DSIF/NELF-mediated inhibition of transcriptional elongation and reveals functional differences between P-TEFb and TFIIH. Mol. Cell 5:1067-1072[CrossRef][Medline]. |
| 52. |
Wang, W.,
T. Chi,
Y. Xue,
S. Zhou,
A. Kuo, and G. R. Crabtree.
1998.
Architectural DNA binding by a high-mobility-group/kinesin-like subunit in mammalian SWI/SNF-related complexes.
Proc. Natl. Acad. Sci. USA
95:492-498 |
| 53. | Winston, F. 1992. Analysis of SPT genes: a genetic approach toward analysis of TFIID, histones, and other transcription factors of yeast, p. 1271-1293. In S. L. McKnight, and K. R. Yamamoto (ed.), Transcriptional regulation. Cold Spring Harbor Laboratory Press, Plainview, N.Y. |
| 54. | Winston, F., and M. Carlson. 1992. Yeast SNF/SWI transcriptional activators and the SPT/SIN chromatin connection. Trends Genet. 8:387-391[Medline]. |
| 55. |
Wittmeyer, J., and T. Formosa.
1997.
The Saccharomyces cerevisiae DNA polymerase catalytic subunit interacts with Cdc68/Spt16 and with Pob3, a protein similar to an HMG1-like protein.
Mol. Cell. Biol.
17:4178-4190[Abstract].
|
| 56. |
Wittmeyer, J.,
L. Joss, and T. Formosa.
1999.
Spt16 and Pob3 of Saccharomyces cerevisiae form an essential, abundant heterodimer that is nuclear, chromatin-associated, and copurifies with DNA polymerase .
Biochemistry
38:8961-8971[CrossRef][Medline].
|
| 57. | Workman, J. L., and R. E. Kingston. 1998. Alteration of nucleosome structure as a mechanism of transcriptional regulation. Annu. Rev. Biochem. 67:545-579[CrossRef][Medline]. |
| 58. |
Xu, Q.,
G. C. Johnston, and R. A. Singer.
1993.
The Saccharomyces cerevisiae Cdc68 transcription activator is antagonized by San1, a protein implicated in transcriptional silencing.
Mol. Cell. Biol.
13:7553-7565 |
| 59. | Xu, Q., R. A. Singer, and G. C. Johnston. 1995. Sug1 modulates yeast transcription activation by Cdc68. Mol. Cell. Biol. 15:6025-6035[Abstract]. |
| 60. | Yamaguchi, Y., T. Takagi, T. Wada, K. Yano, A. Furuya, S. Sugimoto, J. Hasegawa, and H. Handa. 1999. NELF, a multisubunit complex containing RD, cooperates with DSIF to repress RNA polymerase II elongation. Cell 97:41-51[CrossRef][Medline]. |
| 61. |
Yen, Y.-M.,
B. Wong, and R. C. Johnson.
1998.
Determinants of DNA binding and bending by the Saccharomyces cerevisiae high mobility group protein NHP6A that are important for its biological activities.
J. Biol. Chem.
273:4424-4435 |
| 62. |
Yu, Y.,
P. Eriksson, and D. J. Stillman.
2000.
Architectural transcription factors and the SAGA complex function in parallel pathways to activate transcription.
Mol. Cell. Biol.
20:2350-2357 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»