Previous Article | Next Article ![]()
Molecular and Cellular Biology, May 2001, p. 3514-3522, Vol. 21, No. 10
Department of Biochemistry and Cell Biology,
State University of New York, Stony Brook, New York 11794-5215
Received 20 November 2000/Returned for modification 3 January
2001/Accepted 15 February 2001
In the yeast Saccharomyces cerevisiae, a and The silent mating-type loci
(HML and HMR) in the yeast Saccharomyces
cerevisiae are maintained in a transcriptionally inactive state
due to the formation of a specialized chromatin structure analogous to
heterochromatin of higher eukaryotes (reviewed in references 24
and 25). Both cis-acting elements and
trans-acting factors have been identified that are required
for silencing of the mating-type loci. The transcription factors Rap1
and Abf1 and the multisubunit origin recognition complex (ORC), which
is essential for replication, bind to sequences within the E and I
silencers that flank the silent mating-type loci (24, 29). The role of these proteins is to recruit other silencing proteins, Sir1, Sir2, Sir3, and Sir4. Orc1, for example, binds to and recruits Sir1 to the silent mating loci (35), and Rap1 binds to and
recruits Sir3 and Sir4 (26, 32). The Sir proteins then
participate in the formation of heterochromatin.
Sir3 and Sir4 probably function as structural components of
heterochromatin (9). Sir2 has recently been shown to be a
novel NAD+-dependent protein deacetylase (12, 18,
30). It is the deacetylase activity of Sir2, most probably
acting on histones, that is thought to be required for silencing
(3, 8, 12, 18, 30). SIR2 is a member of a
highly conserved, multigene family that in S. cerevisiae
also includes HST1 through HST4 (2).
Of the four Hst proteins, Hst1 is most similar to Sir2 (2,
6) and, when expressed from a high-copy-number plasmid, can
partially suppress the silencing defects of a strain with
SIR2 deleted (2, 6). However,
Strains with a deletion of SIR2, SIR3, or SIR4,
or of two of the three protein binding sites of the HMR-E
silencer, cause a complete loss of silencing at this locus
(24). The consequence of this is that a
mating-type information is expressed and MAT Very recently, the wild-type Sum1 protein has been implicated in the
transcriptional repression of certain sporulation-specific genes during
vegetative growth (37). The promoters of genes that are
repressed by Sum1 contain a cis-acting element called middle
sporulation element (MSE) that is required not only for mitotic
repression (37) but also for meiotic induction
(5). During mitotic growth, strains with SUM1
deleted have elevated levels of expression of a number of genes
containing this element, including SMK1 and SPR3.
Sum1 binds to MSE DNA (37). Interestingly, strains with
mutations in HST1, the SIR2 homolog, also have
elevated levels of transcription of these MSE-controlled genes,
although the effects are not as great as when SUM1 is
deleted (37). Hst1 also coimmunoprecipitates with Sum1 (A. Vershon, personal communication). These data suggest that Sum1 and Hst1
interact to cause transcriptional repression of MSE-controlled genes.
Here we show that SUM1-1 requires HST1 for its
role in repression of HMR transcription. We also provide
evidence suggesting that Hst1, like Sir2, is an
NAD+-dependent protein deacetylase and that the deacetylase
activity of Hst1 is required for Sum1-1 silencing of HMR and
for Sum1 repression of MSE-regulated genes. We further show that the
novel silencing of HMR by Sum1-1 requires ORC and that
components of ORC interact with Sum1-1 in vivo. The data presented
suggest a model whereby ORC recruits Sum1-1 to the HMR locus
and, in turn, Sum1-1 recruits Hst1. Hst1 then deacetylates either
histones or other chromatin-associated proteins to form silenced heterochromatin.
Strains, plasmids, and sequence analysis.
The yeast strains
used in this study are listed in Table 1.
The plasmids for the two-hybrid analysis were created as follows. A
fragment of SUM1 (encoding amino acid 775-end) was amplified from the genome by PCR with a BamHI site at the 5' end and a
PstI site at the 3' end. This fragment was cloned into the
BamHI-PstI sites of pSTT91 (pBTM116
[1] with the ADE2 gene inserted) such that
SUM1 is in frame with lexA to create pJL029. The
analogous fragment of SUM1-1 was cloned into pSTT91 to
create pJL030. This plasmid was used as the bait in the two-hybrid
screen. A BamHI-PstI fragment of SUM1
from pJL029 was cloned into the BamHI-PstI sites of pGAD424 such that SUM1 is in frame with GAD to
create pRH01. A BamHI-PstI fragment of
SUM1-1 from pJL030 was cloned into the BamHI-PstI sites of pGAD424 such that
SUM1-1 is in-frame with GAD to create pRH02. A
fragment containing all of ORC5 was amplified from the
genome with the addition of an EcoRI site at the 5' end and
a BamHI site at the 3' end. This fragment was cloned into pBTM116 such that ORC5 is in frame with lexA to
create pTT93. An EcoRI-HindIII fragment
containing HMR from pLSD1 (HMR in pUC13 [obtained from D. Shore]) was cloned into pRS426 to create pRH34. pLP0349 is SIR2 cloned into YEp351 (obtained from L. Pillus). pGK16 contains SPR3:lacZ in YCp50 (10)
and was obtained from A. Neiman. pJX43 contains the MSE from
SMK1 cloned into a lacZ reporter plasmid
(37) and was obtained from A. Vershon. A fragment containing all but the first 69 nucleotides of HST1 was
amplified by PCR from the genome with a 5' NcoI site and a
3' XhoI site. The fragment was cloned into pET28c to create
pAGN24, which encodes all of Hst1 except the first 23 amino acids and
has a His6 tag at the carboxyl terminus.
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.10.3514-3522.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
A Novel Form of Transcriptional Silencing by Sum1-1
Requires Hst1 and the Origin Recognition Complex
and
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
mating-type information is stored in transcriptionally silenced
cassettes called HML and HMR. Silencing of
these loci, maintained by the formation of a specialized type of
heterochromatin, requires trans-acting proteins and
cis-acting elements. Proteins required for silencing include the Sir2 NAD+-dependent deacetylase, Sir3, and
Sir4. Factors that bind to the cis elements at
HMR and HML and that are important for
silencing include the origin recognition complex (ORC). Mutations of
any of these Sir proteins or combinations of cis elements
result in loss of silencing. SUM1-1 was previously
identified as a dominant mutation that restores silencing to
HMR in the absence of either the Sir proteins or some of
the cis elements. We have investigated the novel mechanism
whereby Sum1-1 causes Sir-independent silencing at HMR and
present the following findings: Sum1-1 requires the Sir2 homolog, Hst1,
for silencing and most probably requires the NAD+-dependent
deacetylase activity of this protein. Sum1-1 interacts strongly with
ORC, and this strong interaction is dependent on HMR DNA.
Furthermore, ORC is required for Sum1-1-mediated silencing at
HMR. These observations lead to a model for Sum1-1
silencing of HMR in which Sum1-1 is recruited to
HMR by binding to ORC. Sum1-1, in turn, recruits Hst1. Hst1
then deacetylates histones or other chromatin-associated proteins to
cause chromatin condensation and transcriptional silencing.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
hst1 mutants do not have silencing defects (2,
6).
strains
become nonmaters. A number of years ago, a mutation called
SUM1-1 was obtained that restored the mating ability to a
sir2 MAT
strain (16). The
SUM1-1 mutation was subsequently found to be dominant in
most strain backgrounds (19), to restore mating by causing
repression of transcription at the silent mating-type loci (4,
19, 21), and to restore silencing at HMR more efficiently than at HML (4, 16, 19, 21). The
silencing of HMR by SUM1-1 is novel in that it is
independent of any of the Sir proteins (19). The function
of the wild-type Sum1 protein in the cell remained unclear, since
strains with SUM1 deleted have few or no silencing defects
(4). Sum1-1 differs from Sum1 at a single amino acid
(codon 988) near the carboxyl terminus, where a threonine residue is
replaced by an isoleucine. This mutation seems to cause novel
properties in Sum1-1, rather than increased levels, since
SUM1 expressed from a high-copy-number plasmid does not
suppress the mating defects of a
sir2 strain
(4).
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
S. cerevisiae strains used in this study
Media and genetic methods. All strains were grown in yeast extract-peptone-dextrose (YPD) medium supplemented with adenine at 25 µg/ml or in supplemented SD medium (drop-out medium) (15). Patch-mating assays were performed by growing patches of strains to be tested on YPD medium or the appropriate drop-out medium for 2 days at 30°C. Patches were then replica plated to SD plates onto which a mating tester strain had been spread. The plates were incubated for 2 days at 30°C before being photographed.
Mutagenesis of HST1.
A SacI fragment
containing the HST1 gene and flanking sequences was isolated
from plasmid pCAR158 [HST1 in pBS KS(
) from J. Boeke]
and cloned into pRS314 to create pJC7a. pCAR158 was used as a template
for in vitro mutagenesis to change the first pair of cysteines (C320
and C323) in the zinc finger of Hst1 to alanines. A PstI
site was engineered into the mutated region to screen for the mutation.
The oligonucleotides used
were 5'CGGTTCATTCGCCACTGCATCTGCAGTGACTGCCCATTGGCAAAT ACCTGG3'
and 5'CCAGGTATTTGCCAATGGGCAGTCACTGCAGATGCAGTGGCGAATGAACCG3'. The mutagenesis was done with the QuikChange site-directed
mutagenesis kit (Stratagene) as specified by the manufacturer. A
StyI-BglII fragment, which included the mutated
region, was used to replace the equivalent wild-type sequences in pJC7a
to create pJC10a. The StyI-BglII DNA was checked
by sequencing.
Gene deletions and epitope tagging. The entire open reading frame of HST1 in strains YRH34 and RS1056 was replaced with the kanMX6 cassette using the method described previously (22) to create strains YRH38 and JLY04. The entire open reading frame except the sequence encoding the first 13 amino acids of NPT1 in YRH34 was replaced with the kanMX6 sequence to create strain YRH35. The SIR2 open reading frame in W303-1b and MC89 was replaced with the his5+ gene of Schizosaccharomyces pombe to create YRH15 and YRH34. The following oligonucleotides were used to replace HMR-I in strain RS1056 with the kanMX6 cassette: 5'CTAAAGGAAAAGAAGAGAGAAAATAGCT ATTTACCTCAACATTTAAAGGTGAATTCGAGCTCGTTTAAAC3' and 5'GCGATAAAGTTATTATTTAGATTACATGTCACCAACATTTTCGTAT ATGGCGGATCCCCGGTTAATTAA3'. Thirteen myc tags were added to the carboxyl terminus of Sum1 in strain YRH15 using the pFA6a-13Myc-TRP1 module (22) to create YRH20 and to SUM1-1 in strains RS1056 and YRH34 to create YRH21 and YRH36.
Two-hybrid and
-galactosidase analyses.
To identify
proteins that interact with Sum1-1, we used the version of the
two-hybrid system previously described (11) and a yeast
GAD library provided by P. James (14). The original clone
obtained from the library encoded an in-frame fusion between GAD and
amino acids 527 to 551 of Top3, followed by all but the first 6 amino
acids of Orc5.
-galactosidase for the two-hybrid analysis and for
the MSE repression assays were as described previously (1)
except that nitrocellulose filters were used. Quantitative
-galactosidase assays were done using three independent cultures for
each strain and the permeabilized cell assay described previously (15).
Immunological analyses. For the Western analysis in Fig. 3, extracts were prepared as described previously (33). Following electrophoresis, proteins were transferred to Immobilon-P membranes and detected using anti-Gal4-TA antibody (Santa Cruz) at 1:2,000 dilution followed by peroxidase-conjugated anti-mouse immunoglobulin G (IgG) secondary antibody at 1:5,000 dilution. The antibody complexes were detected using ECL-Plus reagents (Amersham Pharmacia) as specified by the manufacturer. The coimmunoprecipitation analyses were carried out essentially as described previously (31) with the following modifications. Extracts containing 3.7 mg of protein in 250 µl were diluted into 250 µl of 2× immunoprecipitation (IP) buffer without ammonium acetate. The extracts were incubated at 4°C overnight with 20 µl of cell culture supernatant from 9E10 anti-myc monoclonal antibodies (gift of F. McKenzie). Immunoprecipitates were collected following a 2-h incubation at 4°C with 30 µl of protein G-Sepharose beads and washed twice with IP buffer plus bovine serum albumin (BSA) and twice with IP buffer without BSA as described previously (31). Precipitates were resuspended in 30 µl of sodium dodecyl sulfate (SDS) sample buffer and run on an SDS-8% polyacrylamide gel. Following transfer to Immobilon-P, proteins were detected with either tissue culture supernatant from the 9E10 anti-myc antibody (1:100 dilution) or anti-Orc3 monoclonal antibody (1:50,000 dilution [a gift of B. Stillman]). The treatment of membranes with secondary antibody and detection with ECL reagents was as described above.
Protein expression and exchange assays.
Hst1 was expressed
from pAGN24 in Escherichia coli strain BL21(DE3) with a 3-h
induction with 0.35 mM isopropyl-
-D-thiogalactoside (IPTG) at room temperature. Extracts were prepared using BugBuster (Novagen) as specified by the manufacturer. Exchange reactions were
performed as previously described (18) with the following modifications. Reactions were carried out for 45 min at 30°C, E. coli extracts instead of purified proteins were used in
the assay, and the films were exposed for 5 to 7 days. The H4 peptide consisted of the first 20 amino acids of histone H4, with K16 acetylated.
| |
RESULTS |
|---|
|
|
|---|
Suppression of silencing defects at HMR by
SUM1-1 requires HST1.
Because it had
recently been shown that SUM1 requires HST1 for
maximal repression of transcription from MSE-regulated promoters (37), we wondered whether SUM1-1 similarly
requires HST1 for silencing of the HMR locus in
sir mutants. To address this, we compared the mating ability
of a
sir2 SUM1-1 strain to that of a
sir2 SUM1-1
hst1 strain. SUM1-1 restored mating to a
MAT
sir2 strain (Fig.
1). This effect of SUM1-1 has
previously been shown to result from repression of
HMRa1 transcription (4, 19,
21). However, SUM1-1 is unable to restore mating to a
sir2 strain that also lacks HST1 (Fig. 1).
Thus, repression of HMR by Sum1-1 absolutely requires Hst1.
|
Hst1 is an NAD+-dependent deactylase.
HST1 is a member of a highly conserved gene family that also
consists of SIR2 and HST2-4 in S. cerevisiae. We and others have recently demonstrated that yeast
Sir2 and Hst2, as well as Sir2 homologs from human, Salmonella
enterica serovar Typhimurium, and Archaeoglobus
fulgidus, are NAD+-dependent protein deacetylases in
vitro, and this is most likely to be their function in vivo (12,
18, 30). To determine whether Hst1 is also an
NAD+-dependent deacetylase, we expressed a His-tagged
version of the protein in E. coli cells. In contrast to Sir2
and Hst2 (18), Hst1 made in E. coli is largely
insoluble. Therefore, it has been very difficult to detect in vitro
activity of this protein. Our most sensitive assay for
NAD+-dependent deacetylases is a
nicotinamide-NAD+ exchange reaction (18). This
assay is based on the fact that the Sir2 family of deacetylases cleaves
the glycosidic bond between nicotinamide and ADP-ribose in
NAD+ (17, 34). This reaction leads to the
establishment of the following equilibrium: NAD+ + enzyme
enzyme-ADP ribose + nicotinamide. This reaction is absolutely dependent on the presence of an acetylated substrate (18). Incubating radioactive nicotinamide with
NAD+ and enzyme leads to the NAD+ becoming
radioactive. Fig. 2A shows the results of
an exchange assay using E. coli extracts expressing Hst1.
Weak exchange activity was found for Hst1. The activity was dependent
on the presence of an acetylated substrate, either an H4 peptide
acetylated on K16 or chemically acetylated BSA. For comparison,
purified Hst2 showed much greater activity in this assay. The Hst1
activity was reproducibly greater than that seen for an E. coli extract not expressing Hst1 (vector, Fig. 2A). We think the
latter activity is due to CobB, the E. coli Sir2 homolog,
which we have previously shown to have exchange and deacetylation
activity (18). Note that the putative CobB activity is
also dependent on the presence of an acetylated substrate. Based on the
tight coupling of NAD hydrolysis and deacetylation for this class of
enzymes (17, 18, 34), these results demonstrate that Hst1
also is a protein deacetylase. We believe the low level of activity in
the Hst1 extracts reflects the fact that almost all of the protein is
insoluble. However, it may also result because we have not found the
optimal acetylated substrate to drive the reaction.
|
sir2 SUM1-1 strain to see whether the
silencing at HMR by Sum1-1 and Hst1 is also sensitive to
cellular NAD+ levels. The results of this analysis (Fig.
2B) show that the npt1 mutation abolishes the mating of the
SUM1-1
sir2 strain. This suggests that Hst1,
like Sir2, is dependent on NAD+ for activity and that
npt1 mutants lack sufficient NAD+ for Hst1 to
function with Sum1-1 in HMR silencing.
A second line of evidence that Hst1 functions as a protein deacetylase
in vivo comes from our analysis of effects of mutations in Hst1 on
Sum1-1 and Sum1 function. All of the members of the Sir2 family contain
a core domain that includes four cysteines of a zinc finger. Mutation
of either pair of these cysteines to alanines in Sir2 disrupts
silencing (28), and we have found that mutations in the
zinc finger cysteines also abolish the in vitro deacetylase activity of
the Sir2 protein (S. Tafrov, R. Heller, and R. Sternglanz, unpublished
results). We reasoned that if mutations in the zinc finger of Hst1 also
abolish its functions, it is likely that Hst1 is also a deacetylase in
vivo. Therefore, we used in vitro mutagenesis to change the first pair
of cysteines (C320 and C323) in the Hst1 zinc finger to alanines. We
tested the function of the HST1 C320A, C323A
(hst1-10) mutant in both HMR silencing and
MSE-mediated repression. In the first assay, a MAT
hst1
sir2 SUM1-1 strain was transformed
with either HST1 or hst1-10 on a low-copy-number
plasmid and tested for mating. While the strain with wild-type
HST1 mated well in this assay, the strain with
hst1-10 mated no better than did a strain transformed with
empty vector (Fig. 2C). Therefore, the cysteines of the zinc finger of
Hst1 are essential for its function in SUM1-1 silencing. For
the MSE-mediated repression assay, we tested the level of lacZ expression from a promoter-reporter construct
containing the SPR3 MSE site upstream of lacZ.
Strains with a chromosomal deletion of HST1, transformed
with wild-type HST1 on a low-copy-number plasmid, showed
strong repression of lacZ in this assay (Fig. 2C). The same
strain transformed with a plasmid containing hst1-10 showed
high levels of lacZ expression which were comparable to the
levels produced in a strain transformed with vector alone (Fig. 2C).
Therefore, mutation of two cysteines in the zinc finger of Hst1 also
abolished its function in Sum1-mediated repression of an MSE-regulated
gene. Because Hst1 is so similar to Sir2 and because mutation of the
zinc finger of Sir2 abolished its NAD+-dependent
deacetylase activity, it is most likely that the zinc finger mutant of
Hst1 no longer functions due to loss of a similar deacetylase activity.
SUM1-1, but not SUM1, interacts with
ORC5 in a two-hybrid assay.
To try to understand the
mechanism by which SUM1-1, but not SUM1,
suppresses the mating defect of sir mutants, we initiated a
search for proteins that interact with Sum1-1. For the search, we used
the two-hybrid system with a construct encoding a fusion between LexA
and the carboxy-terminal 288 amino acids of Sum1-1 as the bait. This
part of Sum1-1 contains the T988I mutation, which is responsible for
the novel properties of the protein. We screened more than 1.6 × 106 library transformants with this bait and obtained two
interacting clones. One clone included all but the first 6 amino acids
of the Orc5 protein. To test whether this library clone also interacted with SUM1, we made a lexA-SUM1 fusion construct
containing the region of SUM1 comparable to that used for
lexA-SUM1-1. However, we found that this construct activated
the transcription of the two-hybrid reporter genes in the absence of
any other plasmid and thus could not be tested for interaction with
Orc5. We therefore constructed new hybrid proteins in which the same
carboxyl termini of Sum1 and Sum1-1 were fused to GAD. In this case,
the GAD-Sum1 fusion did not activate transcription of the reporter
genes. We then tested these constructs for two-hybrid interactions with lexA-ORC5 and found that GAD-SUM1-1, but not
GAD-SUM1, interacted with lexA-ORC5 (Fig.
3A). Western analysis of the proteins
produced from these constructs showed that GAD-Sum1 and GAD-Sum1-1
were produced in approximately equal amounts in the cell (Fig. 3B). Thus, the two-hybrid results show that Orc5 interacts specifically with
Sum1-1 and not with Sum1.
|
Sum1-1 associates with ORC in vivo.
To establish that the
interaction between Sum1-1 and Orc5 was physiologically significant, we
carried out a co-IP analysis. To do this, we created strains in which
chromosomally encoded Sum1 and Sum1-1 included 13 copies of the myc
epitope at their carboxyl termini. We immunoprecipitated these proteins
from cell extracts and tested whether we could detect Orc5 in either
precipitate. Unfortunately, the Orc5 protein comigrates with the IgG
heavy chain and was impossible to detect in our analyses. We reasoned that if Sum1-1 interacts with Orc5, it might also interact with other
subunits of the ORC complex. Therefore, we tested the
immunoprecipitates for the presence of Orc3. The results in Fig.
4A show that immunoprecipitates of
Sum1-1-myc do contain easily detectable amounts of Orc3. This result
is in contrast to that for Sum1-myc, which is approximately equally
well precipitated by the myc antibody but brings down much less Orc3
(Fig. 4A and B). These results confirm and extend the results of the
two-hybrid analysis and show that in vivo, ORC interacts much more
strongly with Sum1-1 than with Sum1. The results shown in Fig. 4A are
from strains that were transformed with HMR on a
high-copy-number plasmid. We found that the co-IP between Orc3 and
Sum1-1 was much more easily detected when extra copies of
HMR were present. This result suggests that Sum1-1 interacts with ORC at the HMR locus and that HMR DNA
somehow stabilizes the interaction.
|
sir2
SUM1-1-myc strain mated almost as well as a MAT
sir2 SUM1-1 strain (Fig. 4C). Therefore, the myc tag does
not significantly affect the function of Sum1-1 in silencing. To test
the function of the tagged Sum1 protein, we measured Sum1 repression of
MSE-regulated genes. For this analysis, we used a lacZ
promoter-reporter plasmid with the MSE from SMK1. Using
quantitative
-galactosidase assays, we found that the epitope-tagged
SUM1-myc strain repressed the transcription of the
MSE-lacZ reporter as well as the untagged SUM1
strain did (Fig. 4D). We also compared the repression of this reporter
by Sum1-1 and Sum1-1-myc and found that epitope-tagged Sum1-1-myc repressed transcription of the reporter to the same extent as untagged
Sum1-1 did (Fig. 4D). Therefore, the myc tag appears not to impair the
function of either Sum1 or Sum1-1.
Interestingly, Sum1-1 did not function as well as Sum1 in repression of
MSE-lacZ, although it showed more repression than a strain
with SUM1 deleted (Fig. 4D). This result was somewhat surprising, since it has previously been reported that both proteins repress this reporter equally well (37). Our result is
supported by results of chromatin IP experiments, where we found that
Sum1-myc bound much better to the MSE of SMK1 than
Sum1-1-myc did (data not shown). We do not understand the reason for
the difference between our result and the one reported previously.
A silencing-defective orc mutation abolishes
SUM1-1-dependent silencing at HMR.
ORC is
essential for replication and important for Sir-dependent silencing at
HMR and HML. Mutations have been isolated in ORC5 (orc5-1) that abolish Sir-dependent
silencing from a weakened HMR-E silencer but not viability
(replication) of cells grown at 24°C (7, 23). Because of
the two-hybrid interaction between Orc5 and Sum1-1, we examined the
effect of the orc5-1 mutation on HMR silencing by
SUM1-1. We crossed a SUM1-1
sir2
strain with an orc5-1 strain. We then tested the
sir2 ORC5 progeny for mating competence at 24°C. Of the
sir2 ORC5 progeny, 27% (9 of 33) could mate and all were
MAT
. This result agrees well with the prediction that
25% of
sir2 ORC5 progeny would be able to mate since
50% would have SUM1-1 and 50% of those would be
MAT
(SUM1-1 cannot suppress mating defects of
sir2 MATa strains). In contrast, none (0 of
31) of the
sir2 orc5-1 progeny could mate at 24°C. Since 25% of those progeny should also be MAT
SUM1-1, this result shows that suppression of the mating
defect of
sir2 strains by SUM1-1 requires the
silencing function of Orc5.
Strains lacking HMR-I are defective in
SUM1-1 silencing.
SUM1-1 has previously
been found to suppress the silencing defects of a strain containing a
synthetic silencer in which either the ORC binding site or the Rap1 and
Abf1 binding sites at HMR-E are deleted (19).
However, SUM1-1 is unable to restore repression to a strain
in which the entire E site is deleted (19). In the constructs described above, the HMR-I site was present.
Although HMR-I is dispensable for Sir-mediated silencing
when HMR-E is intact, its role in SUM1-1
silencing has not been tested. To address this, we created a
MAT
sir2 SUM1-1 strain in which the
HMR-I sequences were replaced with the kanMX6
casette. This strain mated very poorly (Fig.
5A), indicating that HMR-I is
very important for Sum1-1-mediated silencing. To make sure that these
manipulations did not affect regions important for silencing outside of
HMR-I, we transformed this strain with SIR2 on a
low-copy-number plasmid. SIR2 restored the mating ability of
the
hmr-I strain, confirming that the HMR-E
silencer was still functional (Fig. 5B). Thus, HMR-I is much
more important for silencing by Sum1-1 than for silencing by Sir2.
|
| |
DISCUSSION |
|---|
|
|
|---|
The results presented above demonstrate that Sum1-1-mediated
repression of HMR requires Hst1. This is consistent with the importance of Hst1 in Sum1-mediated repression of MSE-regulated genes.
We also show that the requirement for Hst1 by both Sum1 and Sum1-1 most
probably is a requirement for an NAD+-dependent protein
deacetylase activity. In addition, Sum1-1 interacts strongly with ORC,
and this strong interaction is dependent on HMR DNA.
Silencing of HMR by Sum1-1 is abolished by a mutation in a
component of ORC. Finally, silencing of HMR by Sum1-1
requires the HMR-I sequences as well as HMR-E.
The simplest model to explain the novel silencing function of the
Sum1-1 protein is depicted in Fig. 6. ORC
binds to autonomously replicating sequences found at both
HMR-E and HMR-I. ORC then recruits Sum1-1 to
these loci, and Sum1-1 in turn recruits Hst1. The Hst1 protein then
deacetylates lysines, either on histones or on histone-associated
proteins, to cause a condensed, silenced chromatin structure.
|
Co-IP analysis revealed that although both Sum1 and Sum1-1 interact
with ORC, the interaction of Sum1-1 is much stronger. We also found
that only when the cell contained extra copies of HMR DNA
could we easily detect co-IP between ORC and Sum1-1. This result
suggests either that an interaction between Sum1-1 and HMR
DNA is required for the Sum1-1-ORC interaction or that only when ORC is
in the context of HMR is it recognized by Sum1-1. The Sum1-1
interaction with ORC at HMR is further supported by results
of chromatin IP studies using HA epitope-tagged versions of Sum1-1 and
Sum1. These studies revealed that Sum1-1-HA binds to HMR-E
and HMR-I DNA and that it does so more efficiently than Sum1-HA. Unfortunately, the HA-tagged version of Sum1-1 does not suppress the mating defects of a
sir2 strain, and we have
been unable to obtain comparable chromatin IP results with the
functional Sum1-1-myc strain. Therefore, we have not included these
data here. The reason for the difference in behavior between the HA-and myc-tagged proteins is not clear; perhaps association of the functional Sum1-1-myc protein with HMR DNA is more transient and
therefore more difficult to detect by chromatin IP, than is association of the nonfunctional Sum1-1-HA protein with HMR DNA.
It is remarkable that changing one amino acid, T988, to I can change the properties of the Sum1-1 protein so profoundly that it now interacts much more strongly than Sum1 with ORC. Interestingly, a PatMatch search (see Materials and Methods) of the yeast genome database using a stretch of amino acids of Sum1-1 surrounding the mutant I988 residue revealed similarity to a highly conserved region of two proteins, Mcm4 and Mcm6. These proteins are part of the MCM complex, which binds replication origins near ORC and may interact, directly or indirectly, with ORC (13). The similarity to Mcm4 and Mcm6 is not detected using the Sum1 T988 sequence. Perhaps the T988-to-I change in Sum1-1 mimics this Mcm motif and allows Sum1-1 to interact more strongly than Sum1 either with DNA sequences near ORC at HMR or with ORC.
The mutation in SUM1-1 appears to also alter its function in MSE-regulated repression. In our experiments, SUM1-1 strains are somewhat defective in repression of a lacZ reporter construct under control of the SMK1 MSE, and in chromatin IP experiments, Sum1-1-myc bound much more poorly to the MSE site than did Sum1-myc (data not shown). Either Sum1-1 no longer recognizes the MSE sequence as well as Sum1 does, or it has lost some protein-protein interaction at the locus critical for DNA binding and function.
We have also shown that the HMR-I site is much more
important for Sum1-1 silencing than it is for Sir2 silencing. This may be because Sir2-mediated silencing is able to spread along the DNA from
the initiation point, by virtue of the formation of polymers of Sir2,
Sir3, and Sir4 along the chromatin (9). Sum1-1 silencing may be much more localized, and to achieve repression it may be necessary for Sum1-1 to bring Hst1 very close to the region of chromatin to be deacetylated. HMRa1
sequences, which must be repressed to allow mating of a
MAT
strain, are closer to HMR-I than to
HMR-E (Fig. 6). Consistent with this hypothesis, the
chromatin IP experiments described above using Sum1-1-HA also showed
that Sum1-1 binding does not extend throughout the HMR
locus, since no Sum1-1-specific precipitation of sequences between
HMR-E and HMR-I was observed. Alternatively, the
interaction of Sum1-1 with ORC at HMR-I may be stronger than
that at HMR-E, making Sum1-1 silencing more dependent on the
I site. Sum1-1 silencing has previously been shown to be independent of
the ORC binding site (A site) in a synthetic HMR-E silencer
(19). However, deletion of the entire natural
HMR-E silencer abolishes Sum1-1 silencing (19). HMR-E DNA is flanked on both sides by additional ORC binding
sites (24, 27); perhaps these sites are used for
recruitment of Sum1-1 to HMR-E when the A site is deleted.
Our data suggest that Sum1-1 binds to ORC at HMR, which then presumably leads to deacetylation by Hst1 and repression of neighboring genes. Does Sum1-1 bind to ORC at all origins and cause the repression of many genes in the cell? Although SUM1-1 strains have a slight growth defect, if the Sum1-1 protein was causing widespread repression, one might expect more significant phenotypes. Perhaps, as postulated above, interaction of Sum1-1 with ORC also requires recognition by Sum1-1 of specific DNA sequences, and those sequences are not present near most origins.
The results that we present help to explain the novel Sir-independent mechanism of silencing by Sum1-1 at HMR. This mechanism provides another of a growing number of cases where transcriptional repression is achieved by recruitment of a protein deacetylase to chromatin. Silencing of HMR by Sum1-1 may be mechanistically more similar to the Sum1-mediated transcriptional repression of MSE-regulated genes than to Sir-mediated silencing. However, it is interesting that in both types of silencing at HMR, ORC plays a critical role in recruitment of the silencing machinery. In Sir-dependent silencing, ORC functions to recruit Sir1, which leads to recruitment of Sir4 and subsequently Sir3 and the Sir2 deacetylase. In our model of Sum1-1-dependent silencing, ORC recruits Sum1-1, which then brings the Hst1 deacetylase to the locus.
| |
ACKNOWLEDGMENTS |
|---|
We thank J. Boeke, L. Pillus, D. Shore, and A. Vershon for plasmids and strains and B. Stillman for the anti-Orc3 antibody. We also thank A. Vershon for communicating results prior to publication.
This work was supported by National Institutes of Health grants GM28220 and GM55641 to R.S. and a Beckman Foundation Scholarship to J.C.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biochemistry and Cell Biology, State University of New York, Stony Brook, NY 11794-5215. Phone: (631) 632-8565. Fax: (631) 632-8575. E-mail: rolf{at}life.bio.sunysb.edu.
Permanent address: Institute of Biochemistry and Biophysics, Polish
Academy of Sciences, 02-106 Warsaw, Poland.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Bartel, P. L., C. Chien, R. Sternglanz, and S. Fields. 1993. Using the two-hybrid system to detect protein-protein interactions, p. 153-179. In D. A. Hartley (ed.), Cellular interactions in development: a practical approach. IRL Press, Oxford, United Kingdom. |
| 2. |
Brachmann, C. B.,
J. M. Sherman,
S. E. Devine,
E. E. Cameron,
L. Pillus, and J. D. Boeke.
1995.
The SIR2 gene family, conserved from bacteria to humans, functions in silencing, cell cycle progression, and chromosome stability.
Genes Dev.
9:2888-2902 |
| 3. |
Braunstein, M.,
A. B. Rose,
S. G. Holmes,
C. D. Allis, and J. R. Broach.
1993.
Transcriptional silencing in yeast is associated with reduced nucleosome acetylation.
Genes Dev.
7:592-604 |
| 4. | Chi, M. H., and D. Shore. 1996. SUM1-1, a dominant suppressor of SIR mutations in Saccharomyces cerevisiae, increases transcriptional silencing at telomeres and HM mating-type loci and decreases chromosome stability. Mol. Cell. Biol. 16:4281-4294[Abstract]. |
| 5. |
Chu, S.,
J. DeRisi,
M. Eisen,
J. Mulholland,
D. Botstein,
P. O. Brown, and I. Herskowitz.
1998.
The transcriptional program of sporulation in budding yeast.
Science
282:699-705 |
| 6. | Derbyshire, M. K., K. G. Weinstock, and J. N. Strathern. 1996. HST1, a new member of the SIR2 family of genes. Yeast 12:631-640[CrossRef][Medline]. |
| 7. |
Foss, M.,
F. J. McNally,
P. Laurenson, and J. Rine.
1993.
Origin recognition complex (ORC) in transcriptional silencing and DNA replication in S. cerevisiae.
Science
262:1838-1844 |
| 8. | Gottschling, D. E. 2000. Gene silencing: two faces of SIR2. Curr. Biol. 10:R708-711[CrossRef][Medline]. |
| 9. | Grunstein, M. 1998. Yeast heterochromatin: regulation of its assembly and inheritance by histones. Cell 93:325-328[CrossRef][Medline]. |
| 10. | Holaway, B. L., G. Kao, M. C. Finn, and M. J. Clancy. 1987. Transcriptional regulation of sporulation genes in yeast. Mol. Gen. Genet. 210:449-459[CrossRef][Medline]. |
| 11. | Hollenberg, S. M., R. Sternglanz, P. F. Cheng, and H. Weintraub. 1995. Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system. Mol. Cell. Biol. 15:3813-3822[Abstract]. |
| 12. | Imai, S., C. M. Armstrong, M. Kaeberlein, and L. Guarente. 2000. Transcriptional silencing and longevity protein Sir2 is an NAD- dependent histone deacetylase. Nature 403:795-800[CrossRef][Medline]. |
| 13. |
Izumi, M.,
K. Yanagi,
T. Mizuno,
M. Yokoi,
Y. Kawasaki,
K. Y. Moon,
J. Hurwitz,
F. Yatagai, and F. Hanaoka.
2000.
The human homolog of Saccharomyces cerevisiae Mcm10 interacts with replication factors and dissociates from nuclease-resistant nuclear structures in G(2) phase.
Nucleic Acids Res.
28:4769-4777 |
| 14. | James, P., J. Halladay, and E. A. Craig. 1996. Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics 144:1425-1436[Abstract]. |
| 15. | Kaiser, C., S. Michaelis, and A. Mitchell. 1994. Methods in yeast genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 16. |
Klar, A. J.,
S. N. Kakar,
J. M. Ivy,
J. B. Hicks,
G. P. Livi, and L. M. Miglio.
1985.
SUM1, an apparent positive regulator of the cryptic mating-type loci in Saccharomyces cerevisiae.
Genetics
111:745-758 |
| 17. | Landry, J., J. T. Slama, and R. Sternglanz. 2000. Role of NAD(+) in the deacetylase activity of the SIR2-like proteins. Biochem. Biophys. Res. Commun. 278:685-690[CrossRef][Medline]. |
| 18. |
Landry, J.,
A. Sutton,
S. T. Tafrov,
R. C. Heller,
J. Stebbins,
L. Pillus, and R. Sternglanz.
2000.
The silencing protein SIR2 and its homologs are NAD-dependent protein deacetylases.
Proc. Natl. Acad. Sci. USA
97:5807-5811 |
| 19. | Laurenson, P., and J. Rine. 1991. SUM1-1: a suppressor of silencing defects in Saccharomyces cerevisiae. Genetics 129:685-696[Abstract]. |
| 20. |
Liang, C., and B. Stillman.
1997.
Persistent initiation of DNA replication and chromatin-bound MCM proteins during the cell cycle in cdc6 mutants.
Genes Dev.
11:3375-3386 |
| 21. |
Livi, G. P.,
J. B. Hicks, and A. J. Klar.
1990.
The sum1-1 mutation affects silent mating-type gene transcription in Saccharomyces cerevisiae.
Mol. Cell. Biol.
10:409-412 |
| 22. | Longtine, M. S., A. McKenzie III, D. J. Demarini, N. G. Shah, A. Wach, A. Brachat, P. Philippsen, and J. R. Pringle. 1998. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14:953-961[CrossRef][Medline]. |
| 23. | Loo, S., C. A. Fox, J. Rine, R. Kobayashi, B. Stillman, and S. Bell. 1995. The origin recognition complex in silencing, cell cycle progression, and DNA replication. Mol. Biol. Cell 6:741-756[Abstract]. |
| 24. | Loo, S., and J. Rine. 1995. Silencing and heritable domains of gene expression. Annu. Rev. Cell Dev. Biol. 11:519-548[CrossRef][Medline]. |
| 25. | Lustig, A. J. 1998. Mechanisms of silencing in Saccharomyces cerevisiae. Curr. Opin. Genet. Dev. 8:233-239[CrossRef][Medline]. |
| 26. |
Moretti, P.,
K. Freeman,
L. Coodly, and D. Shore.
1994.
Evidence that a complex of SIR proteins interacts with the silencer and telomere-binding protein RAP1.
Genes Dev.
8:2257-2269 |
| 27. | Palacios DeBeer, M. A., and C. A. Fox. 1999. A role for a replicator dominance mechanism in silencing. EMBO J. 18:3808-3819[CrossRef][Medline]. |
| 28. |
Sherman, J. M.,
E. M. Stone,
L. L. Freeman-Cook,
C. B. Brachmann,
J. D. Boeke, and L. Pillus.
1999.
The conserved core of a human SIR2 homologue functions in yeast silencing.
Mol. Biol. Cell
10:3045-3059 |
| 29. | Shore, D. 1994. RAP1: a protean regulator in yeast. Trends Genet. 10:408-412[CrossRef][Medline]. |
| 30. |
Smith, J. S.,
C. B. Brachmann,
I. Celic,
M. A. Kenna,
S. Muhammad,
V. J. Starai,
J. L. Avalos,
J. C. Escalante-Semerena,
C. Grubmeyer,
C. Wolberger, and J. D. Boeke.
2000.
A phylogenetically conserved NAD+-dependent protein deacetylase activity in the Sir2 protein family.
Proc. Natl. Acad. Sci. USA
97:6658-6663 |
| 31. | Spector, M. S., A. Raff, H. DeSilva, K. Lee, and M. A. Osley. 1997. Hir1p and Hir2p function as transcriptional corepressors to regulate histone gene transcription in the Saccharomyces cerevisiae cell cycle. Mol. Cell. Biol. 17:545-552[Abstract]. |
| 32. |
Strahl-Bolsinger, S.,
A. Hecht,
K. Luo, and M. Grunstein.
1997.
SIR2 and SIR4 interactions differ in core and extended telomeric heterochromatin in yeast.
Genes Dev.
11:83-93 |
| 33. |
Sutton, A.,
D. Immanuel, and K. T. Arndt.
1991.
The SIT4 protein phosphatase functions in late G1 for progression into S phase.
Mol. Cell. Biol.
11:2133-2148 |
| 34. |
Tanner, K. G.,
J. Landry,
R. Sternglanz, and J. M. Denu.
2000.
Silent information regulator 2 family of NAD-dependent histone/protein deacetylases generates a unique product, 1-O-acetyl-ADP-ribose.
Proc. Natl. Acad. Sci. USA
97:14178-14182 |
| 35. | Triolo, T., and R. Sternglanz. 1996. Role of interactions between the origin recognition complex and SIR1 in transcriptional silencing. Nature 381:251-253[CrossRef][Medline]. |
| 36. |
Vinitsky, A., and C. Grubmeyer.
1993.
A new paradigm for biochemical energy coupling. Salmonella typhimurium nicotinate phosphoribosyltransferase.
J. Biol. Chem.
268:26004-26010 |
| 37. | Xie, J., M. Pierce, V. Gailus-Durner, M. Wagner, E. Winter, and A. K. Vershon. 1999. Sum1 and Hst1 repress middle sporulation-specific gene expression during mitosis in Saccharomyces cerevisiae. EMBO J. 18:6448-6454[CrossRef][Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||