Previous Article | Next Article 
Molecular and Cellular Biology, May 2001, p. 3564-3575, Vol. 21, No. 10
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.10.3564-3575.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Localization of the Rsp5p Ubiquitin-Protein Ligase
at Multiple Sites within the Endocytic Pathway
Guangli
Wang,1,
J. Michael
McCaffery,2,3
Beverly
Wendland,3
Sophie
Dupré,4
Rosine
Haguenauer-Tsapis,4 and
Jon M.
Huibregtse1,*
Section of Molecular Genetics and
Microbiology and Institute for Cellular and Molecular Biology,
University of Texas at Austin, Austin, Texas
78712-10951; Integrated Imaging
Center2 and Department of
Biology,3 Johns Hopkins University,
Baltimore, Maryland 21218; and Institut Jacques Monod-CNRS,
Universites Paris VI and VII, 75251 Paris Cedex 05, France4
Received 12 December 2000/Returned for modification 24 January
2001/Accepted 20 February 2001
 |
ABSTRACT |
The Saccharomyces cerevisiae RSP5 gene encodes an
essential HECT E3 ubiquitin-protein ligase. Rsp5p contains an
N-terminal C2 domain, three WW domains in the central portion of the
molecule, and a C-terminal catalytic HECT domain. A diverse group of
substrates of Rsp5p and vertebrate C2 WW-domain-containing HECT E3s
have been identified, including both nuclear and membrane-associated proteins. We determined the intracellular localization of Rsp5p and the
determinants necessary for localization, in order to better understand
how Rsp5p activities are coordinated. Using both green fluorescent
protein fusions to Rsp5p and immunogold electron microscopy, we found
that Rsp5p was distributed in a punctate pattern at the plasma
membrane, corresponding to membrane invaginations that are likely sites
of endosome formation, as well as at perivacuolar sites. The latter
appeared to correspond to endocytic intermediates, as these structures
were not seen in a sla2/end4-1 mutant, and double-immunogold labeling demonstrated colocalization of Rsp5p with
the endosomal markers Pep12p and Vps32p. The C2 domain was an important
determinant of localization; however, mutations that disrupted HECT
domain function also caused mislocalization of Rsp5p, indicating that
enzymatic activity is linked to localization. Deletion of the C2 domain
partially stabilized Fur4p, a protein previously shown to undergo
Rsp5p- and ubiquitin-mediated endocytosis; however, Fur4p was still
ubiquitinated at the plasma membrane when the C2 domain was deleted
from the protein. Together, these results indicate that Rsp5p is
located at multiple sites within the endocytic pathway and suggest that
Rsp5p may function at multiple steps in the ubiquitin-mediated
endocytosis pathway.
 |
INTRODUCTION |
Eucaryotic cells internalize
extracellular materials and portions of the cell surface through the
process of endocytosis. This provides for the selective uptake of
nutrients as well as for down-regulation of membrane receptors,
permeases, and channel proteins (41, 51). In higher
eucaryotic cells, membrane proteins to be internalized are surrounded
by an area of plasma membrane that buds off inside the cell in a
process that is mediated by clathrin and many accessory factors
(58). The protein contents of endocytic vesicles are
subsequently sorted and trafficked to the vacuole or lysosome for
degradation, or, alternatively, recycled to the plasma membrane
(54, 75). An interesting link has emerged between the
lysosomal-vacuolar degradation pathway and the other major cellular
pathway for protein degradation, the ubiquitin proteolysis system. The
ubiquitin proteolysis system, in its most common form, consists of two
general steps: the covalent conjugation of ubiquitin to substrate
proteins and the recognition and degradation of the ubiquitinated
proteins by the 26S proteasome (25). It was therefore
surprising to find that the rapid degradation of several plasma
membrane proteins was dependent on ubiquitin conjugation and vacuolar
proteases, rather than on the 26S proteasome. This has led to the model
in which ubiquitination can serve as a degradation signal for membrane
proteins by serving as a signal for endocytosis (21, 22).
Ubiquitin-mediated endocytosis is emerging as a common pathway for
regulated clearance of proteins from the plasma membrane in both yeast
and mammalian cells; however, many aspects of this pathway remain
poorly understood.
An early indication that ubiquitination could serve as a signal for
vacuolar degradation came from studies with the yeast Ste6p
a-factor transporter (34). It was shown that
Ste6p accumulates in a ubiquitinated form in endocytosis mutants and that a ubc4,5 mutant exhibits delayed degradation of Ste6p
and accumulation of Ste6p at the cell surface. Studies with the Ste2p
-factor receptor definitively showed that ubiquitination was required for its ligand-stimulated endocytosis (23),
leading to the model that ubiquitination of membrane proteins can serve as a signal for endocytosis and degradation in the vacuole. Other proteins undergoing ubiquitin-mediated endocytosis in
Saccharomyces cerevisiae include the Ste3p
a-factor receptor (55, 56), the Fur4p uracil
permease (14, 15), the Gap1p general amino acid permease
(62), the Gal2p galactose permease (27), the Mal61p maltose permease (43), the multidrug
resistance-like transporter Pdr5p/Sts1p (9), and the Tat2p
tryptophan permease (5). In addition, examples of
ubiquitinated cell surface proteins targeted for lysosomal degradation
in mammalian cells include the amiloride-sensitive epithelial sodium
channel, colony-stimulating factor 1 receptor, the epidermal growth
factor receptor, and the growth hormone receptor (reference
21 and references therein). In some cases, phosphorylation
of the membrane proteins appears to be a prerequisite or a signal for
ubiquitination (24, 40).
Protein ubiquitination cascades begin with the E1 ubiquitin-activating
enzyme, which activates ubiquitin in an ATP-dependent reaction by
forming a thioester bond with the C terminus of ubiquitin. E1 then
transfers ubiquitin to the active-site cysteine of one of a number of
E2 ubiquitin-conjugating enzymes, maintaining a thioester linkage. E2
enzymes cooperate with a diverse set of E3 ubiquitin-protein ligases to
catalyze substrate ubiquitination, with E3 enzymes providing the direct
link to the substrate (20). In the case of the HECT family
of E3 proteins, the E2 transfers ubiquitin to an active-site cysteine
within the HECT domain, again in the form of a thioester, and the E3
then directly catalyzes substrate ubiquitination (57). In
the case of other types of E3 proteins (SCF E3s, APC-like E3s, VHL, and
Cb1/RING finger E3s), the E3 appears to act more as a docking protein
for both the E2 and substrate, with ubiquitination being catalyzed
directly by the E2 (36, 37, 42, 46, 74). E3s or E2-E3
complexes generally link multiple ubiquitin molecules to the substrate
in the form of polyubiquitin chains, with lysine side chains of
ubiquitin serving as acceptor sites for additional ubiquitin molecules. Polyubiquitin chains linked through Lys48 are required for
recognition by the proteasome (47); however,
ubiquitin-mediated endocytosis can in some cases be triggered by
monoubiquitination or by short ubiquitin chains linked through
Lys63 of ubiquitin (14, 60, 64, 68).
In yeast, the essential Rsp5p HECT E3 has been shown to be important
for ubiquitin-mediated endocytosis of several proteins, including Gap1p
(63), Fur4p (15, 18, 19), Mal61p
(43), the hexose transporter (Hxt6/7) (35),
and Tat2p (5). Deletion of the C2 domain of Rsp5p was
shown to result in ubiquitination without subsequent endocytosis of
Gap1p (63). This suggested that Rsp5p may play a broader
role in endocytosis, which is an idea that is further supported by the
localization results presented here. Rsp5p also has
non-membrane-associated substrates, including at least two nuclear
proteins, the largest subunit of RNA polymerase II (Rpb1p)
(31) and Rfa1p, a subunit of replication protein A
(10). Ubiquitination of Rpb1p is stimulated by UV
irradiation, suggesting that this may be part of the response to DNA
damage (3). Rsp5p also plays important roles in the
mitochondrion-cytoplasm distribution of Mod5p (a tRNA-modifying enzyme)
and in the inheritance of mitochondria to daughter cells (12,
79), although the direct substrate(s) of Rsp5p related to these
events is not known. Recent work has shown that the essential function
of Rsp5p is the ubiquitination of the Spt23p and Mga2p transcription
factors (26), which control transcription of the
OLE1 gene, which encodes an enzyme required for synthesis of
oleic and palmitoleic acid. This appears to be an example of
ubiquitination serving as a signal for proteolytic processing of the
substrate, which releases Spt23p from its endoplasmic reticulum tether
so that it is free to enter the nucleus and activate OLE1
transcription. This link of Rsp5p to unsaturated fatty acid synthesis
may also explain the effect of Rsp5p on mitochondrial distribution,
since ole1 mutants are also defective in this process (65).
Rsp5p is one of the smallest HECT E3s described (92 kDa), with the
largest HECT E3s being over 500 kDa. The HECT E3s have only a conserved
C-terminal 40-kDa catalytic domain in common (29). The
large and divergent N-terminal regions of these proteins have been
proposed to contain determinants for substrate recognition, based
largely on work with yeast Rsp5p and human E6AP (30, 73). Rsp5p contains a C2 domain at its extreme N terminus and three WW
domains between the C2 domain and the HECT domain. C2 domains mediate
interactions with membranes by binding to phospholipids, inositol
polyphosphates, and/or proteins, often in a Ca2+-dependent
manner (48, 52). WW domains are approximately
30-amino-acid protein-protein interaction modules that recognize
polyproline ligands (7), which are similar to but
distinct from SH3 ligands (45). Structure-function studies
demonstrated that the HECT domain and the region spanning the second
and third WW domains are sufficient for complementation of
rsp5-1 temperature sensitivity (73), while
Hoppe et al. showed that only the third WW domain and the HECT domain
are required for the essential function of Rsp5p at standard growth
temperatures (26).
The diverse set of functions and substrates of Rsp5p led us to explore
the intracellular localization of Rsp5p and the determinants responsible for its localization. We show here that Rsp5p is found primarily at sites consistent with its role in ubiquitin-mediated endocytosis. Both the C2 domain and an intact catalytic HECT domain are
critical for proper localization as well as for normal turnover of
Fur4, a membrane-associated substrate.
 |
MATERIALS AND METHODS |
Yeast strains and plasmids.
Yeast genetic manipulations and
media were according to standard methods (17). Generation
of haploid strain GW003 was described previously (73).
Other S. cerevisiae strains used in these studies are listed
in Table 1. The centromere-containing
plasmid pFL38gF (URA3 GAL-Fur4) (59) carries the Fur4 gene
(33) under the control of the GAL10 promoter
and was used in experiments that examined Fur4p protein levels and
activities. For these experiments, cells were grown at 30°C in
synthetic medium supplemented with 4% galactose and 0.05% glucose
plus appropriate nutrients, including Casamino Acids (0.2%) without
tryptophan.
Wild-type green fluorescent protein (GFP) under control of the
GAL1 promoter was cloned into the pRS414 vector (containing
a centromere and
TRP1-selectable marker),
generating pRS414galGFP.
The pRS414gal-GFP-RSP5, -rsp5-1, and
-RSP5

C2 plasmids were generated
by subcloning the
EcoRI/
NotI fragments of pYES2-RSP5,
rsp5-1,
and RSP5

C2 plasmids (
73) into
pRS414galGFP. These were transformed
into yeast strain GW003,
followed by counterselection with 5-fluoroorotic
acid, generating the
GW072, GW082, and GW073 strains. These were
maintained in rich
galactose-containing medium. For observation
with fluorescence
microscopy, cells were grown in trp- and leu-dropout
media with 2%
galactose supplemented with adenine (80 µg/ml, final
concentration).
The plasmid YEp96 (2µm
TRP1 UB) contains a synthetic yeast
ubiquitin gene under the control of the copper-inducible
CUP1 promoter
(
8). The multicopy plasmid
YEp96-fF (2µm
URA3 CUP1-Ub
FUR4)
was
constructed as follows. The
CUP1-UB gene (including
CYC1 terminator)
was amplified by PCR using YEp96 as a
template and the oligonucleotides
L1 (CGGGATCCCATTACCGACATTTC)
and L2 (AAGCTTGCAAATTAAAGCCTTCGAGCGCG).
The resulting
PCR fragment was digested with
BamHI and cloned
at the
unique
BamHI site of the plasmid YEp352fF (2µm
URA3
FUR4)
(
15).
Immunoblotting.
Yeast protein extracts for immunoblotting
(see Fig. 1) were made as described previously (73).
Primary antibodies were anti-GFP rabbit polyclonal antibody (Santa Cruz
Biotechnology) and anti-Rsp5p mouse monoclonal antibody
(31). Fur4p was detected using an antiserum to the last 10 residues of uracil permease.
Uracil uptake.
Uracil uptake was measured in exponentially
growing cells as previously described (72). One milliliter
of yeast culture was incubated with 5 µM [14C]uracil
(Amersham) for 20 s at 30°C and then quickly filtered through
Whatman GF/C filters which were washed twice with ice-cold water.
Uptake of [14C]uracil was quantitated by scintillation counting.
Fluorescence microscopy and EM.
GFP fluorescence was
observed in living yeast using an Olympus IX-70 microscope at either
×600 or ×1,000 magnification. The immunogold electron microscopy (EM)
on yeast cells was performed essentially as described previously
(50). Exponentially growing cells at 30°C were pelleted
at 300 × g for 5 min, resuspended in 4% formaldehyde
in 1× phosphate-buffered saline (PBS; pH 7.4), and allowed to fix for
1 h at room temperature followed by 18 to 24 h at 4°C. The
cells were then washed briefly in PBS and resuspended in 1%
low-melting-temperature agarose. After cooling, the agarose blocks were
trimmed into 1-mm3 pieces; cryoprotected by infiltration
with a mixture of 2.3 M sucrose-20% polyvinylpyrrolidone (10K) (pH
7.4) for 2 h; and mounted onto cryopins and rapidly frozen in
liquid nitrogen. Ultrathin cryosections were cut on a Leica UCT
ultramicrotome equipped with an FC-S cryoattachment and collected onto
formvar-carbon-coated nickel grids. The nickel grids were washed
through several drops of 1× PBS containing 5% fetal calf serum (FCS),
10 mM glycine (pH 7.4); blocked in 10% FCS for 30 min; and incubated
overnight in 20 µg of monoclonal antihemagglutinin (anti-HA) antibody
(Babco) per ml, anti-GFP monoclonal antibody (Santa Cruz
Biotechnology), anti-Vps32p rabbit polyclonal antibody (provided by
Markus Babst and Scott Emr), or anti-Pep12p rabbit polyclonal antibody
(provided by Chris Burd and Scott Emr). After washing, the grids were
incubated for 2 h in 5-nm-diameter Au-donkey anti-mouse antibody
conjugate or 10-nm-diameter Au-anti-rabbit antibody conjugate
(Jackson Immunoresearch Labs). The grids were then washed through
several drops of PBS, followed by several drops of double-distilled
H2O, and subsequently embedded in an aqueous solution
containing 3.2% polyvinyl alcohol (10K), 0.2% methyl cellulose (400 centiposes), and 0.1% uranyl acetate. The grids were observed and
photographed on a Philips 420 transmission electron microscope at 80 kV.
Fractionation by differential centrifugation.
GW047 and
GW050 cells expressing the HA-Rsp5p and HA-Rsp5
C2p proteins,
respectively, were grown to mid-log phase, spheroplasted, and
homogenized in lysis buffer (0.2 M sorbitol, 50 mM potassium acetate,
20 mM HEPES, 2 mM EDTA [pH 6.8], with protease inhibitors) with 10 strokes in a Thomas Dounce homogenizer (76). The lysate was subjected to differential centrifugations of 300 × g for 5 min, 13,000 × g for 10 min, and
100,000 × g for 1 h. For detergent solubilizations, the cells were lysed in the above buffer with 1%
Triton X-100 and held for 30 min on ice prior to centrifugation. The
supernatant and pellet fractions were precipitated on ice with 10%
trichloroacetic acid and washed twice with ice-cold acetone, and
protein pellets were solubilized in sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer.
Proteins were separated by SDS-10% PAGE and transferred to
nitrocellulose for Western blotting with antibodies against the HA
epitope to detect HA-Rsp5p, Pep12p, and glucose-6-phosphate
dehydrogenase (G6PDH) (Sigma, St. Louis, Mo.). Each fraction analyzed
represented protein from an equivalent number of cells.
Equilibrium density centrifugation.
Cell organelles were
fractionated on equilibrium density gradients essentially as described
previously (34, 53). Exponentially growing cultures
(A600, 40) were arrested by the addition of 10 mM sodium azide, washed once in 10 mM sodium azide, and broken by
vigorous agitation after the addition of 0.2 ml of glass beads and 0.2 ml of STET (10% [wt/wt] sucrose, 10 mM Tris-HCl [pH 7.6], 10 mM
EDTA plus protease inhibitors [Complete cocktail; Boehringer]). After low-speed centrifugation (1,000 × g, 3 min), 0.4 ml of the cleared extracts was layered on top of a 5-ml
20-to-60% linear sucrose gradient made up in 10 mM Tris-HCl (pH 7.6),
10 mM EDTA. Samples were centrifuged for 18 h at 100,000 × g in a SW50.1 rotor (Beckman). Fractions were collected from the
top of the gradient, and proteins were precipitated with 10%
trichloroacetic acid. After 30 min of incubation on ice, proteins were
pelleted by centrifugation and resuspended in 40 µl of 1 M Tris base
plus 80 µl of 2× sample buffer (100 mM Tris-HCl [pH 6.8], 4 mM
EDTA, 4% SDS, 20% glycerol, 0.002% bromophenol blue) containing 2%
2-mercaptoethanol and heated at 95°C for 4 min. Proteins in each
gradient fraction were analyzed by Western blotting. Monoclonal
antibodies against Pep12p, an integral membrane protein marker of late
endosome, and Vat2p, a vacuolar membrane protein, were obtained from
Molecular Probes (Eugene, Oreg.). Polyclonal antibodies against the
plasma membrane [H+] ATPase were a gift from C. Slayman,
and polyclonal antibodies against Sss1p, an integral membrane protein
of the endoplasmic reticulum (11), were a gift from F. Kepes.
In vivo Fur4p ubiquitination.
Induction of the
CUP1 promoter was for 1 h in the presence of 0.1 mM
CuSO4. Yeast cells (A600, 40) in the
exponential growth phase were harvested by centrifugation in the
presence of 10 mM sodium azide, washed once in distilled water plus 10 mM sodium azide, and used to prepare membrane-enriched fractions
(13,000 × g pellet; P13) as previously described
(15), except that lysis buffer (0.1 M Tris-HCl [pH 7.5],
0.15 M NaCl, 5 mM EDTA, plus a mixture of protease inhibitors
[Complete; Roche]) containing freshly prepared
N-ethylmaleimide (25 mM) in order to prevent deubiquitination.
 |
RESULTS |
Expression of GFP-Rsp5p proteins in yeast.
Plasmid constructs
were generated for expression of GFP-Rsp5p fusion proteins as shown in
Fig. 1A. The GFP open reading frame (ORF)
was fused in frame to the 5' end of the full-length RSP5 ORF, the RSP5-
C2 ORF (with amino acids 2 to 138 deleted),
and the rsp5-1 ORF, corresponding to a temperature-sensitive
allele. The fusion proteins were expressed from a TRP1-based
centromere-containing vector under control of the GAL1
promoter. Each plasmid was transformed into the rsp5
haploid strain (GW003), which harbored a complete deletion of the
chromosomal RSP5 gene (rsp5
) and a
URA3-based plasmid copy of wild-type RSP5, whose
expression was driven by the natural RSP5 promoter.
Following transformation, loss of the URA3-based plasmid was
selected on galactose- and 5-fluoroorotic acid-containing plates.
Viable cells were obtained from all three transformants but not from a
transformant expressing only GFP, indicating that all three GFP-Rsp5p
proteins were capable of supporting the essential in vivo function of
Rsp5p (Fig. 1B). The GFP-rsp5-1 strain still displayed
temperature-sensitive growth like that of the original
rsp5-1 mutant. Immunoblotting with anti-Rsp5p antibody
confirmed that each transformant expressed the predicted full-length
GFP-Rsp5p fusion protein (Fig. 1C) and that this was the sole source of
Rsp5p in the cells. Thus, fusion of GFP to the N terminus of Rsp5p does
not interfere with the essential function of Rsp5p and, as shown below
(see Fig. 8), GFP-Rsp5p also fully supports normal turnover of a
membrane-associated substrate, Fur4p. The amounts of GFP-Rsp5p fusion
proteins expressed in the transformants were very similar, if not
slightly lower, than the amount of Rsp5p expressed in the parental
haploid strain expressing Rsp5p from its natural chromosomal position.
The only exception was GFP-Rsp5
C2, which was expressed two- to
threefold higher than Rsp5p. Similar expression levels were also seen
with GAL1 promoter-driven HA-tagged Rsp5p proteins, as shown
in Fig. 1C and as reported previously (73).

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 1.
GFP-Rsp5p fusion proteins are functional in yeast. (A)
Schematic representation of GFP fused to wild-type Rsp5p,
Rsp5 C2p, and the rsp5-1p temperature-sensitive mutant allele.
(B) Growth of haploid rsp5 cells expressing the indicated
plasmid-borne GFP fusion proteins. Cells expressing GFP alone were
inviable. (C) Western analysis to confirm the expression of full-length
GFP fusion proteins, by using anti-Rsp5p antibody. The first lane shows
Rsp5p expression in the undisrupted W303 strain; all other lanes are in
the rsp5 background expressing the indicated
plasmid-borne HA- or GFP-tagged Rsp5p proteins. The lower panel shows
levels of a control protein, Rfa1p.
|
|
The C2 domain is a determinant of Rsp5p localization.
Cells
expressing the GFP-Rsp5p fusion protein were examined by using
fluorescence and differential interference contrast (DIC) microscopy.
The GFP-RSP5 wild-type (wt) strain exhibited punctate fluorescence on the plasma membrane and at structures within the cytoplasm and adjacent to the vacuole (Fig. 2A and
B). DAPI (4',6'-diamidino-2-phenylindole) staining showed that GFP-Rsp5p was not detectably present in the nucleus, and 4-nitroquinoline oxide or UV irradiation did not induce
visible nuclear localization (data not shown), a possibility suggested
by the fact that UV irradiation stimulates ubiquitination of Rpb1p
(3). While the C2 domain of Rsp5p is not required for cell
viability (63, 73), deletion of the C2 domain
dramatically affected distribution of a GFP fusion protein, as
shown in Fig. 2C. GFP-Rsp5
C2p appeared to be distributed diffusely
throughout the cell, with loss of specific localization at the plasma
membrane and at internal structures.

View larger version (117K):
[in this window]
[in a new window]
|
FIG. 2.
Localization of GFP-Rsp5p and GFP-Rsp5p- C2. GW072
cells expressing GFP-Rsp5p were examined by fluorescence (A and B) and
DIC (A, right panel) microscopy. (C) Top panels show GW072 cells
(GFP-Rsp5p) and bottom panels show GW073 cells (GFP- Rsp5p- C2) as
seen with fluorescence (left panels) or DIC (right panels)
microscopy.
|
|
Cell fractionation experiments were done to further explore the effect
of C2 deletion on Rsp5p localization. Cell lysates
from strains
GW047 and GW050, expressing HA-tagged Rsp5p and Rsp5

C2p,
respectively, were subjected to differential centrifugation and
fractions were analyzed for Rsp5p by immunoblotting (Fig.
3A),
using G6PDH and Pep12p as markers
for soluble cytoplasmic and
endosomal proteins, respectively. Wild-type
Rsp5p was found in
both low-speed (300 ×
g) and
high-speed (100,000 ×
g) pellet fractions
(P3 and P100
fractions) and was not detected in the 100,000 ×
g
supernatant (S100), indicating that nearly all of the Rsp5p
is
associated with larger structures. Triton X-100 (1%) solubilized
a
large fraction of the Rsp5p in the low-speed pellet, suggesting
that
the Rsp5p in this fraction was peripherally associated with
membranes.
Pep12p was split evenly between low- and high-speed
pellet fractions,
and detergent solubilized the material in both
of these fractions,
consistent with previous reports for Pep12p
fractionation (
4,
16). The fractionation of Rsp5p with the
high-speed pellet was
therefore consistent with possible endosome
localization; however, the
Rsp5p present in this fraction was
not solubilized by 1% Triton X-100.
This suggests that Rsp5p is
linked to the P100 fraction by
protein-protein interactions and
therefore that Rsp5p in this fraction
probably does not reflect
endosome association. Rsp5p is a
multifunctional protein, having
both nuclear and endoplasmic
reticulum-associated substrates in
addition to plasma membrane
substrates, and it is possible that
Rsp5p present in the P100 fraction
reflects its role in another
process.

View larger version (86K):
[in this window]
[in a new window]
|
FIG. 3.
Fractionation of Rsp5p and Rsp5p- C2. (A) GW047 and
GW050 cells expressing HA-Rsp5p and HA-Rsp5 C2p were spheroplasted
and lysed, and lysates were incubated without (left panel) or with
(right panel) 1% Triton X-100 prior to sequential differential
centrifugation. Immunoblotting of fractions was performed with
antibodies against Rsp5p, G6PDH, and Pep12p. G6PDH and Pep12p
served as controls for soluble and vacuolar proteins,
respectively. Lanes 1 to 4 represent the 300 × g
pellet (lane 1), the 13,000 × g pellet (lane 2), the
100,000 × g supernatant (lane 3), and the
100,000 × g pellet (lane 4). Each lane represents
protein from an equivalent number of cells. (B) Cell lysates were
prepared from exponentially growing wild-type RSP5 cells
(W303) in yeast nitrogen base medium with glucose as a carbon source.
Lysate was fractionated on a 20-to-60% sucrose density gradient.
Aliquots of the various fractions were analyzed by immunoblotting for
Rsp5p, Pma1p (plasma membrane marker), Pep12p (late endosome marker),
Vat2p (vacuolar marker), and Sss1p (endoplasmic reticulum marker).
|
|
In contrast to the wild-type protein, a significant fraction of
Rsp5

C2p was found in the high-speed supernatant in the absence
of
detergent treatment. The protein remaining in the low-speed
pellet was,
like the wild-type protein, solubilized by 1% Triton
X-100, while the
high-speed pellet material was again resistant.
These results indicate
that Rsp5p is associated with membrane-containing
fractions that are
dependent in part on the C2 domain. Sedimentation
of Rsp5p was also
examined by sucrose gradient fractionation (Fig.
3B). These results
also indicated that Rsp5p is associated with
large structures. It was
distributed in fractions containing endosomes
(Pep12p-positive
fractions), although Golgi- and endoplasmic reticulum-containing
fractions (Sss1p positive) were not clearly resolved from endosomes
by
this technique. In addition, the broad distribution of Rsp5p
overlapped
with plasma membrane-containing fractions (Pma1p positive).
Deletion of
the C2 domain had essentially no effect on sucrose
gradient
sedimentation (results not
shown).
Rsp5p catalytic activity is a determinant of localization.
To
test whether Rsp5p catalytic activity was linked to its
localization, we observed cells expressing the
GFP-rsp5-1 temperature-sensitive allele. This allele
contains a Leu733Ser substitution within the HECT
domain that impairs ubiquitin-thioester formation in vitro (73). Based on analogy to the E6AP HECT domain crystal
structure (28), this alteration is likely to destabilize
the folded state of the hydrophobic core of the C lobe of the HECT
domain. At the permissive temperature (30°), GFP-rsp5-1p was
localized primarily at the plasma membrane; however, it was in a less
punctate distribution than that of GSP-Rsp5p (wt) and in larger patches
on the membrane (Fig. 4). In addition,
the strongly fluorescing structures adjacent to the vacuole were less
prominent. After shifting to the nonpermissive temperature (37°) for
4 h, the signal was observed almost exclusively at the plasma
membrane. The same temperature shift did not detectably affect
localization of wild-type GFP-Rsp5p. Therefore, the catalytic activity
of Rsp5p is a determinant of its localization. We also observed
RSP5 cells expressing GFP fusions to the active-site cys-to-ala mutant of Rsp5p or to a mutant lacking the last six amino
acids. Both of these proteins are catalytically inactive and
noncomplementing (73); however, their overall structure, based on the X-ray crystal structure of the HECT domain of E6AP (28), is unlikely to be affected by the mutations. Both of
these proteins were localized similarly to the rsp5-1p protein (data not shown), further indicating that the catalytic activity of Rsp5p is
linked to its localization.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 4.
Localization of temperature-sensitive GFP-rsp5-1p.
Fluorescence and phase-contrast microscopy of cells at 30 and 37°C
(top and bottom, respectively), expressing GFP-Rsp5p (GW072; left) or
GFP-Rsp5-1p (GW082; right).
|
|
Localization of Rsp5p is affected in a sla2/end4-1
mutant.
The sla2/end4-1 mutant is defective in
the internalization step of endocytosis, and normal turnover of many
plasma membrane proteins is blocked in sla2/end4 mutants
(49). GFP-Rsp5p (wt) was expressed in the
sla2/end4-1 temperature-sensitive mutant to determine if the
cytoplasmic sites of GFP-Rsp5p localization might correspond to
endocytic compartments downstream of SLA2/END4 function. While GFP-Rsp5p was still localized at the plasma membrane in
the sla2/end4-1 mutant, virtually all localization to
internal structures was lost at both 30° and 37°C (Fig.
5). This suggests that the cytoplasmic
Rsp5p-containing perivacuolar structures may be intermediate or late
endocytic compartments, while the peripheral compartments do not
require SLA2/END4 function for Rsp5p localization.

View larger version (113K):
[in this window]
[in a new window]
|
FIG. 5.
Localization of GFP-Rsp5p in the sla2/end4-1
mutant. Plasmid pRS414gal-GFP-RSP5 was introduced into
sla2/end4-1 cells, and cells were grown in
dextrose-containing medium. Cells were switched into
galactose-containing medium for 4 h at 30 and 37°C,
respectively, and then examined by fluorescence and phase-contrast
microscopy.
|
|
Localization of Rsp5p by immunogold EM.
Immunogold EM was
performed to independently confirm the localization results based on
GFP fusion proteins. Strain GW047, expressing HA-tagged wild-type Rsp5p
from the RSP5 promoter as the sole source of Rsp5p, grows
identically to an isogenic RSP5 strain. Immunogold EM using
anti-HA antibody showed that HA-Rsp5p was localized to plasma membrane
invaginations that are likely to correspond to sites of endosome
formation (Fig. 6C and D) as well as at
membranous structures immediately adjacent to the vacuole (Fig. 6A and
B). As with the GFP fusion proteins, no specific signal was detected at
either the plasma membrane or adjacent to the vacuole for the HA-tagged
C2 deletion mutant (data not shown).

View larger version (143K):
[in this window]
[in a new window]
|
FIG. 6.
Localization of Rsp5p by immunogold EM. GW047 cells
harboring the plasmid expressing HA-Rsp5p were prepared for electron
microscopy and probed with anti-HA antibody. Labeling was in the
cytoplasm and adjacent to the vacuole (A and B) and at sites of
invaginations at the plasma membrane (C and D). V, vacuole; pm, plasma
membrane. Bar = 90 nm.
|
|
Double-immunogold labeling was also done on the GFP-RSP5p-expressing
strain (GW0072) with antibodies against GFP and either
Pep12p, a
t-SNARE component of endosomes, or Vps32/Snf7p, a class
E late
endosomal marker (
2). As shown in Fig.
7, GFP-Rsp5p
(5-nm-diameter gold
particles) was closely associated with both
Pep12p and Vps32p (10-nm
gold particles) at perivacuolar regions.
The peripheral plasma membrane
structures containing Rsp5p were
not double-labeled with these marker
proteins (data not shown).
Together, the EM results further support the
idea that Rsp5p is
localized at sites of early endosome formation at
the plasma membrane
as well at later endocytic intermediates adjacent
to the vacuole.

View larger version (135K):
[in this window]
[in a new window]
|
FIG. 7.
Double-label immunogold EM. GW072 (GFP-HA-Rsp5p) cells
were prepared for EM and probed with anti-GFP antibody to detect Rsp5p,
using a 5-nm-diameter Au bead-conjugated secondary antibody (small gold
particles), and either anti-Pep12p (A and B) or anti-Vps32p (C) with a
10-nm-diameter Au bead-conjugated secondary antibody. V, vacuole. Scale
bar = 85 nm.
|
|
Normal turnover of Fur4p is dependent on C2 domain of Rsp5p.
Since the C2 domain is the primary determinant of Rsp5p localization at
the plasma membrane in vivo (Fig. 2C), deletion of the C2 domain
might be predicted to affect the turnover of Fur4p, a
protein subject to Rsp5p-dependent ubiquitin-mediated endocytosis. The
decay rate of Fur4p was compared in RSP5 and
RSP5
C2 strains by cycloheximide treatment of log-phase
cells, followed by immunoblotting with anti-Fur4p antibody (Fig.
8A). The apparent half-life of Fur4p was
increased at least twofold in the RSP5
C2 strain, a difference equal to that shown previously for the rsp5/npi1
mutant, which expresses a much-reduced level of Rsp5p (15,
19). Uracil permease activity, a measure of cell surface
permease, was also tested after cycloheximide addition (Fig. 8B).
Permease activity decreased more rapidly in the RSP5 strain
than in the RSP5
C2 strain, indicating that deletion of
the C2 domain affected permease internalization. In addition, both
Fur4p protein and activity decay were similar in the RSP5
and GFP-RSP5 strains, indicating that GFP-Rsp5p is fully
functional in ubiquitin-mediated endocytosis of Fur4p.


View larger version (53K):
[in this window]
[in a new window]
|
FIG. 8.
Normal turnover of Fur4p, but not ubiquitination, is
dependent on C2 domain. Strains GW047 (RSP5), GW050
(RSP5- C2), and GW072 (GFP-RSP5) were
transformed with plasmid p38gF (GAL10-FUR4) and grown
as described in Materials and Methods. (A) Cycloheximide (CHX; 100 µg/ml) was added to log-phase cultures, and extracts were prepared at
the indicated times after CHX addition. Fur4p protein levels were
determined by immunoblotting. A control protein remained stable during
the experiment. (B) Uracil uptake was measured at the times indicated
after addition of CHX. Results are expressed as a percentage of the
activity at time zero. , GW047 (RSP5), , GW050
(RSP5- C2), , GW072 (GFP-RSP5). (C) Deletion
of C2 domain does not impair Fur4p ubiquitination. GWO47
(RSP5) and GW050 (RSP5 C2) cells transformed
with YEp96fF (2µm URA3 FUR4 CUP1-UB) were grown in yeast
nitrogen base medium plus glucose as carbon source, and ubiquitin
overexpression was induced for 1 h in the presence of CuSO4
(0.1 mM). Cells were collected during the exponential growth phase
(A600, 0.8) and used to prepare
membrane-enriched fractions (P13). Aliquots of the P13 pellets were
analyzed by Western immunoblotting for uracil permease. Longer exposure
of the blot revealed in both types of cells a small amount of
additional Ub-Fur4p species of higher molecular weight.
|
|
The decrease in Fur4p turnover and internalization after deletion of
the C2 domain of Rsp5p prompted us to check whether this
decrease
resulted from reduced ubiquitination of Fur4p, which
is required for
its internalization. Fur4p-ubiquitin conjugates
were examined in
membrane-enriched fractions prepared from cells
overexpressing
ubiquitin. It has been shown that ubiquitin overproduction
in wild-type
cells does not modify the rate of Fur4p internalization
or degradation
or the overall pattern of Fur4p ubiquitination
(
14,
15)
and that Fur4p is ubiquitinated on two target lysines
in the N-terminal
region of the protein, each of which accepts
one or two ubiquitin
molecules (
14,
39). Figure
8C shows that
both
RSP5 and
RSP5
C2 cells contained, in addition
to nonubiquitinated
Fur4p, at least three additional
higher-molecular-weight species
that correspond to Fur4p-ubiquitin
conjugates (
14,
15,
44).
These results indicate that
deletion of the C2 domain does not
impair Fur4p ubiquitination at the
plasma membrane or affect the
number of ubiquitin residues added per
target lysine. This result
is consistent with a previous report that
Gap1p was ubiquitinated
by a form of Rsp5p with C2 deleted
(
63). Similar to our results
described above for Fur4p,
Gap1p internalization was also impaired
in rsp5

C2p cells. Together,
these results suggest that Rsp5p
may have two separable functions at
the plasma membrane: direct
ubiquitination of substrates (independent
of the C2 domain) and
a C2-dependent function in the internalization
process.
 |
DISCUSSION |
It has been previously demonstrated that Rsp5p is involved in
down-regulation of several membrane-associated permeases, including Fur4p, Gap1p, Mal61p, and Tat2p (5, 15, 43, 62).
Rsp5p-dependent ubiquitination of these proteins has been proposed to
serve as a signal for endocytosis, resulting in transport to the
vacuole, where they are degraded. The localization results presented
here are consistent with the role of Rsp5p in ubiquitin-mediated
endocytosis of these proteins, and they further suggest that Rsp5p may
play a role at multiple steps in this pathway.
Rsp5p was localized by immunogold EM at peripheral compartments that
appear to correspond to plasma membrane invaginations, as well as at
perivacuolar structures where it colocalized with the t-SNARE protein
Pep12p and the class E endocytic protein Vps32/Snf7p. Perivacuolar
localization of GFP-Rsp5p was lost in both rsp5-1 and
sla2/end4-1 mutant cells. Sla2p/End4p is required for the internalization step of endocytosis, as well as in organization of the
actin network (49, 77). GFP-Rsp5p was still localized at
the plasma membrane in the sla2/end4-1 cells, consistent
with the perivacuolar structures being postinternalization endocytic compartments. Experiments with GFP-rsp5-1p (temperature sensitive) indicate that loss of Rsp5p catalytic activity alters localization at
both the peripheral and internal structures. The GFP-rsp5-1p mutant
protein was localized to the plasma membrane at the nonpermissive temperature; however, it was present in larger patches on the surface,
while localization at internal structures was lost nearly completely.
Together, these observations suggest that Rsp5p functions not only in
directly ubiquitinating membrane-associated substrates but also in
promoting both the internalization process and perhaps events further
downstream in the endocytic pathway. We imagine that this could be due
to Rsp5p-catalyzed ubiquitination of one or more protein components of
the endocytic pathway, although whether such a ubiquitination event
leads to protein degradation or serves an alternative function is
unknown. Consistent with a role for Rsp5p in the internalization step,
it has been noted that Rsp5p is also required for internalization of
proteins carrying non-ubiquitin-dependent signals (21).
C2 domains are found in many proteins and mediate interactions with
membrane phospholipids and/or membrane proteins (48). Rsp5p was not found to be distributed evenly over the entire surface of
the plasma membrane, suggesting that C2-mediated localization is
specific for structures or proteins at the plasma membrane. Based on
immunogold EM, the punctate Rsp5-containing structures at the membrane
appear to mark sites of membrane invagination and early endosome
formation. Cell fractionation experiments showed nearly all Rsp5p
to be associated with large structures (both low-speed and
high-speed pellet fractions), and detergent solubilized only a portion
of the Rsp5p present in the low-speed pellet without affecting Rsp5p in
the high-speed pellet fraction. Deletion of the C2 domain released
about half of the low-speed pellet material into the soluble fraction,
and detergent solubilized the remaining material in this fraction but
again did not affect the high-speed pellet material. Together, these
findings suggest that there may be at least three distinct pools of
Rsp5p: (i) low-speed pellet, membrane associated; (ii) low-speed
pellet, non-membrane-associated; and (iii) high-speed pellet,
non-membrane-associated. The fact that the C2 domain can be
deleted while membrane association is maintained is consistent with the
finding that Fur4p and Gap1p can be ubiquitinated at the membrane (but
not internalized) by the protein with C2 deleted. The
non-detergent-soluble Rsp5p may be linked to multiprotein complexes in
both the low- and high-speed pellet fractions through protein-protein
interactions, perhaps mediated by the WW domain or the HECT domain.
While it is difficult to directly correlate the fractionation results
with the localization results, this may be a reflection of the multiple
substrates of Rsp5p that are located in diverse locales. In
addition, at least some HECT E3s have been shown to be associated with
the proteasome (78), and preliminary evidence indicates
that WW HECT E3s, including Rsp5p, are proteasome associated (C. Salvat
and J. M. Huibregtse, unpublished data). The fractionation results
may therefore be further complicated by sedimentation of Rsp5p with the
proteasome as well as fractionation of the proteasome with other
complexes in the cell.
An additional indication that Rsp5p may function at multiple steps in
endocytosis comes from its genetic interaction with PAN1
(76), which in turn has been linked genetically and
biochemically to a complex that includes clathrin, End3p, Ent1p, and
Sla1p (66, 67, 76). This complex of proteins has been
found to play essential roles in both the organization of the actin
cytoskeleton and endocytosis. Pan1p is similar to the mammalian EH
domain-containing protein Eps15, a component of clathrin-coated pits
and vesicles that plays a critical role in endocytosis at the plasma
membrane and endosomes (61, 70). Furthermore, it has
been suggested that, like Eps15, Pan1p protein complexes
participate in multiple steps in the endocytic pathway in concert with
Ent1p, acting at both the internalization and endosomal sorting steps
(76). Interestingly, Eps15 becomes monoubiquitinated in
response to stimulation with transforming growth factor
(71). Whether Pan1p or other components of the Pan1p
protein complex are ubiquitinated by Rsp5p is currently being investigated.
A finding that lends strong support to the idea that ubiquitin
metabolism plays an important role in the later stages of endocytosis is that mutations in genes encoding six different class E vacuolar protein-sorting factors, including Vps32p, were isolated as suppressors of the doa4-1 mutation (1). Doa4p is a
deubiquitinating enzyme that plays an important role in ubiquitin
recycling, and Doa4p itself was found at late endocytic structures
(1). This finding, together with the findings that Rsp5p
was localized by EM to Pep12p- and Vps32p-containing compartments and
that catalytic activity is linked to Rsp5p localization, suggests that
a dynamic ubiquitination-deubiquitination process may be linked to
endosome trafficking, either at the level of ubiquitination of the
endocytosed cargo or the endocytic machinery itself. Ubiquitination of
components of the machinery is suggested by Eps15 ubiquitination, as
noted above, and by the finding that the Drosophila Liquid
facets protein, an epsin, is a target of the Fat facets
deubiquitinating enzyme in photoreceptor organization (6).
An unresolved problem is how Rsp5p recognizes its integral membrane
protein substrates. Rsp5p WW domains may interact directly with
integral membrane protein substrates; however, this has not been
demonstrated in vitro, and Fur4p or Gap1p does not have an obvious
consensus WW domain binding site. In some cases, WW domains can also
recognize phosphorylated ligands (38), and phosphorylation of Fur4p at PEST-like sequences has been shown to be a prerequisite for
Rsp5p-dependent ubiquitination (40). Therefore, it
remains possible that recognition of Fur4p by Rsp5p is
direct and specific for the phosphorylated form of the substrate.
Alternatively, the recognition of membrane-associated substrates might
be indirect and possibly mediated by additional cellular factors.
Interestingly, ubiquitination of all Rsp5p substrates identified so
far
Rpb1p (RNA polymerase II large subunit), Spt23p, and the plasma
membrane substrates
requires WW domain function but not the C2 domain
(26, 73). The only function so far assigned to the C2
domain with respect to this set of substrates is the internalization of
the ubiquitinated integral membrane proteins.
Rsp5p has been shown to interact with and ubiquitinate Rpb1p in
response to UV irradiation (3). Rfa1p, a subunit of
replication protein A, also has been reported to be a nuclear substrate
of Rsp5p (10). Although we cannot rule out that a small
percentage of Rsp5p is nuclear, it was not detected in the nucleus by
either GFP fluorescence or immunogold EM. An intriguing possibility is that nuclear substrates might be exported to the cytoplasm prior to
their ubiquitination and degradation. This idea has precedent in the
case of ubiquitination of the mammalian p53 and p27Kip1
proteins (13, 69). We also did not see evidence of Rsp5p at the endoplasmic reticulum, which is the site of localization of the
Spt23p substrate (26), although it is again possible that
the amount of Rsp5p at this site is below the limits of detection or
that Rsp5p is never stably associated with the endoplasmic reticulum.
The results presented here indicate that the determinants for
appropriate localization of Rsp5p are important for its function in the
endocytic pathway, and they further suggest that Rsp5p may have
multiple functions at both early and late stages of endocytosis. A
large amount of data now indicate that the ubiquitination pathways are
involved in endocytosis, although ubiquitination has also been
implicated in other trafficking pathways that lead to the vacuole. For
instance, ubiquitination appears to be involved in delivery of mutant
yeast
-factor receptor from an intracellular site to the vacuole
(32). Ubiquitin-dependent endocytosis of the plasma
membrane-associated Tat2p (tryptophan permease) appears to be similar
to that of other permeases; however, Tat2p can also be diverted from
the secretory pathway to the vacuole (5). It will be
important to determine if Rsp5p plays a role in multiple trafficking
pathways that converge at late stages of the endocytic pathway.
 |
ACKNOWLEDGMENTS |
This work was supported by grants from the National Institutes of
Health to J.M.H. (CA72943) and B.W. (GM60979), a Burroughs Wellcome
Fund New Investigator Award to B.W., and a grant from the Association
pour la Recherche sur le Cancer (ARC grant 9773) to R.H.-T.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Section of
Molecular Genetics and Microbiology and Institute for Cellular and
Molecular Biology, University of Texas at Austin, 2500 Speedway,
Austin, TX 78712-1095. Phone: (512) 232-7700. Fax: (512)
232-3432. E-mail: huibreg{at}icmb.utexas.edu.
Present address: Department of Molecular Biology, Princeton
University, Princeton, NJ 08544-1014.
 |
REFERENCES |
| 1.
|
Americk, A. Y.,
J. Nowak,
S. Swaminathan, and M. Hochstrasser.
2000.
The Doa4 deubiquitinating enzyme is functionally linked to the vacuolar protein-sorting and endocytic pathways.
Mol. Biol. Cell
11:3365-3380[Abstract/Free Full Text].
|
| 2.
|
Babst, M.,
B. Wendland,
E. J. Estepa, and S. D. Emr.
1998.
The Vps4p AAA ATPase regulates membrane association of a Vps protein complex required for normal endosomal function.
EMBO J.
17:2982-2993[CrossRef][Medline].
|
| 3.
|
Beaudenon, S. L.,
M. R. Huacani,
G. Wang,
D. P. McDonnell, and J. M. Huibregtse.
1999.
Rsp5 ubiquitin-protein ligase mediates DNA damage-induced degradation of the large subunit of RNA polymerase II in Saccharomyces cerevisiae.
Mol. Cell. Biol.
19:6972-6979[Abstract/Free Full Text].
|
| 4.
|
Becherer, K. A.,
S. E. Rieder,
S. D. Emr, and E. W. Jones.
1996.
Novel syntaxin homologue, Pep12p, required for the sorting of lumenal hydrolases to the lysosome-like vacuole in yeast.
Mol. Biol. Cell
7:579-594[Abstract].
|
| 5.
|
Beck, T.,
A. Schmidt, and M. N. Hall.
1999.
Starvation induces vacuolar targeting and degradation of the tryptophan permease in yeast.
J. Cell Biol.
146:1227-1238[Abstract/Free Full Text].
|
| 6.
|
Cadavid, A. L.,
A. Ginzel, and J. A. Fischer.
2000.
The function of the Drosophila Fat facets deubiquitinating enzyme in limiting photoreceptor cell number is intimately associated with endocytosis.
Development
127:1727-1736[Abstract].
|
| 7.
|
Chen, H. I., and M. Sudol.
1995.
The WW domain of Yes-associated protein binds a proline-rich ligand that differs from the consensus established for Src homology 3-binding modules.
Proc. Natl. Acad. Sci. USA
92:7819-7823[Abstract/Free Full Text].
|
| 8.
|
Ecker, D. J.,
M. Ishaq Khan,
J. Marsh,
T. R. Butt, and S. T. Crooke.
1987.
Chemical synthesis and expression of a cassette adapted ubiquitin gene.
J. Biol. Chem.
262:3524-3527[Abstract/Free Full Text].
|
| 9.
|
Egner, R., and K. Kuchler.
1996.
The yeast multidrug transporter Pdr5 of the plasma membrane is ubiquitinated prior to endocytosis and degradation in the vacuole.
FEBS Lett.
378:177-181[CrossRef][Medline].
|
| 10.
|
Erdeniz, N., and R. Rothstein.
2000.
Rsp5, a ubiquitin-protein ligase, is involved in degradation of the single-stranded DNA binding protein Rfa1 in Saccharomyces cerevisiae.
Mol. Cell. Biol.
20:224-232[Abstract/Free Full Text].
|
| 11.
|
Esnault, Y.,
D. Feldheim,
M. O. Blondel,
R. Schekman, and F. Kepes.
1993.
The yeast SSS1 gene is essential for secretory protein translocation and encodes a conserved protein of the endoplasmic reticulum.
EMBO J.
12:4083-4093[Medline].
|
| 12.
|
Fisk, H. A., and M. P. Yaffe.
1999.
A role for ubiquitination in mitochondrial inheritance in Saccharomyces cerevisiae.
J. Cell Biol.
145:1199-1208[Abstract/Free Full Text].
|
| 13.
|
Freedman, D. A., and A. J. Levine.
1998.
Nuclear export is required for degradation of endogenous p53 by MDM2 and human papillomavirus E6.
Mol. Cell. Biol.
18:7288-7293[Abstract/Free Full Text].
|
| 14.
|
Galan, J., and R. Haguenauer-Tsapis.
1997.
Ubiquitin lys63 is involved in ubiquitination of a yeast plasma membrane protein.
EMBO J.
16:5847-5854[CrossRef][Medline].
|
| 15.
|
Galan, J. M.,
V. Moreau,
B. Andre,
C. Volland, and R. Haguenauer-Tsapis.
1996.
Ubiquitination mediated by the Npi1p/Rsp5p ubiquitin-protein ligase is required for endocytosis of the yeast uracil permease.
J. Biol. Chem.
271:10946-10952[Abstract/Free Full Text].
|
| 16.
|
Gerrard, S. R.,
N. J. Bryant, and T. H. Stevens.
2000.
VPS21 controls entry of endocytosed and biosynthetic proteins into the yeast prevacuolar compartment.
Mol. Biol. Cell
11:613-626[Abstract/Free Full Text].
|
| 17.
|
Guthrie, C., and R. G. Fink (ed.).
1991.
Guide to yeast genetics and molecular biology, vol. 194.
Academic Press, Inc., San Diego, Calif.
|
| 18.
|
Hein, C., and B. Andre.
1997.
A C-terminal di-leucine motif and nearby sequences are required for NH4(+)-induced inactivation and degradation of the general amino acid permease, Gap1p, of Saccharomyces cerevisiae.
Mol. Microbiol.
24:607-616[CrossRef][Medline].
|
| 19.
|
Hein, C.,
J. Y. Springael,
C. Volland,
R. Haguenauer-Tsapis, and B. Andre.
1995.
NPl1, an essential yeast gene involved in induced degradation of Gap1 and Fur4 permeases, encodes the Rsp5 ubiquitin-protein ligase.
Mol. Microbiol.
18:77-87[CrossRef][Medline].
|
| 20.
|
Hershko, A., and A. Ciechanover.
1998.
The ubiquitin system.
Annu. Rev. Biochem.
67:425-479[CrossRef][Medline].
|
| 21.
|
Hicke, L.
1999.
Gettin' down with ubiquitin: turning off cell-surface receptors, transporters and channels.
Trends Cell Biol.
9:107-112[CrossRef][Medline].
|
| 22.
|
Hicke, L.
1997.
Ubiquitin-dependent internalization and down-regulation of plasma membrane proteins.
FASEB J.
11:1215-1226[Abstract].
|
| 23.
|
Hicke, L., and H. Riezman.
1996.
Ubiquitination of a yeast plasma membrane receptor signals its ligand-stimulated endocytosis.
Cell
84:277-287[CrossRef][Medline].
|
| 24.
|
Hicke, L.,
B. Zanolari, and H. Riezman.
1998.
Cytoplasmic tail phosphorylation of the alpha-factor receptor is required for its ubiquitination and internalization.
J. Cell Biol.
141:349-358[Abstract/Free Full Text].
|
| 25.
|
Hochstrasser, M.
1996.
Ubiquitin-dependent protein degradation.
Annu. Rev. Genet.
30:405-439[CrossRef][Medline].
|
| 26.
|
Hoppe, T.,
K. Matuschewski,
M. Rape,
S. Schlenker,
H. D. Ulrich, and S. Jentsch.
2000.
Activation of a membrane-bound transcription factor by regulated ubiquitin/proteasome-dependent processing.
Cell
102:577-586[CrossRef][Medline].
|
| 27.
|
Horak, J., and D. H. Wolf.
1997.
Catabolite inactivation of the galactose transporter in the yeast Saccharomyces cerevisiae: ubiquitination, endocytosis, and degradation in the vacuole.
J. Bacteriol.
179:1541-1549[Abstract/Free Full Text].
|
| 28.
|
Huang, L.,
E. Kinnucan,
G. Wang,
S. Beaudenon,
P. M. Howley,
J. M. Huibregtse, and N. P. Pavletich.
1999.
Structure of an E6AP-UbcH7 complex: insights into ubiquitination by the E2-E3 enzyme cascade.
Science
286:1321-1326[Abstract/Free Full Text].
|
| 29.
|
Huibregtse, J. M.,
M. Scheffner,
S. Beaudenon, and P. M. Howley.
1995.
A family of proteins structurally and functionally related to the E6-AP ubiquitin-protein ligase.
Proc. Natl. Acad. Sci. USA
92:2563-2567[Abstract/Free Full Text].
|
| 30.
|
Huibregtse, J. M.,
M. Scheffner, and P. M. Howley.
1993.
Localization of the E6-AP regions that direct human papillomavirus E6 binding, association with p53, and ubiquitination of associated proteins.
Mol. Cell. Biol.
13:4918-4927[Abstract/Free Full Text].
|
| 31.
|
Huibregtse, J. M.,
J. C. Yang, and S. L. Beaudenon.
1997.
The large subunit of RNA polymerase II is a substrate of the Rsp5 ubiquitin-protein ligase.
Proc. Natl. Acad. Sci. USA
94:3656-3661[Abstract/Free Full Text].
|
| 32.
|
Jenness, D. D.,
Y. Li,
C. Tipper, and P. Spatrick.
1997.
Elimination of defective -factor pheromone receptors.
Mol. Cell. Biol.
17:6236-6245[Abstract].
|
| 33.
|
Jund, R.,
E. Weber, and M. R. Chevallier.
1988.
Primary structure of the uracil transport protein of Saccharomyces cerevisiae.
Eur. J. Biochem.
171:417-424[Medline].
|
| 34.
|
Kolling, R., and C. P. Hollenberg.
1994.
The ABC-transporter Ste6 accumulates in the plasma membrane in a ubiquitinated form in endocytosis mutants.
EMBO J.
13:3261-3271[Medline].
|
| 35.
|
Krampe, S.,
O. Stamm,
C. P. Hollenberg, and E. Boles.
1998.
Catabolite inactivation of the high-affinity hexose transporters Hxt6 and Hxt7 of Saccharomyces cerevisiae occurs in the vacuole after internalization by endocytosis.
FEBS Lett.
441:343-347[CrossRef][Medline].
|
| 36.
|
Lisztwan, J.,
G. Imbert,
C. Wirbelauer,
M. Gstaiger, and W. Krek.
1999.
The von Hippel-Lindau tumor suppressor protein is a component of an E3 ubiquitin-protein ligase activity.
Genes Dev.
13:1822-1833[Abstract/Free Full Text].
|
| 37.
|
Lorick, K. L.,
J. P. Jensen,
S. Fang,
A. M. Ong,
S. Hatakeyama, and A. M. Weissman.
1999.
RING fingers mediate ubiquitin-conjugating enzyme (E2)-dependent ubiquitination.
Proc. Natl. Acad. Sci. USA
96:11364-11369[Abstract/Free Full Text].
|
| 38.
|
Lu, P.-J.,
X. Z. Zhou,
M. Shen, and K. P. Lu.
1999.
Function of WW domains as phosphoserine- or phosphothreonine-binding modules.
Science
283:1325-1328[Abstract/Free Full Text].
|
| 39.
|
Marchal, C.,
R. Haguenauer-Tsapis, and D. Urban-Grimal.
2000.
Casein kinase I-dependent phosphorylation within a PEST sequence and ubiquitination at nearby lysines signal endocytosis of yeast uracil permease.
J. Biol. Chem.
275:23608-23614[Abstract/Free Full Text].
|
| 40.
|
Marchal, C.,
R. Haguenauer-Tsapis, and D. Urban-Grimal.
1998.
A PEST-like sequence mediates phosphorylation and efficient ubiquitination of yeast uracil permease.
Mol. Cell. Biol.
18:314-321[Abstract/Free Full Text].
|
| 41.
|
Marsh, M., and H. T. McMahon.
1999.
The structural era of endocytosis.
Science
285:215-220[Abstract/Free Full Text].
|
| 42.
|
Martinez-Noel, G.,
R. Niedenthal,
T. Tamura, and K. Harbers.
1999.
A family of structurally related RING finger proteins interacts specifically with the ubiquitin-conjugating enzyme UbcM4.
FEBS Lett.
454:257-261[CrossRef][Medline].
|
| 43.
|
Medintz, I.,
H. Jiang, and C. A. Michels.
1998.
The role of ubiquitin conjugation in glucose-induced proteolysis of Saccharomyces maltose permease.
J. Biol. Chem.
273:34454-34462[Abstract/Free Full Text].
|
| 44.
|
Moreau, V.,
J.-M. Galan,
G. Devilliers,
R. Haguenauer-Tsapis, and B. Winsor.
1997.
The yeast actin-related protein Arp2p is required for the internalization step of endocytosis.
Mol. Biol. Cell
8:1361-1375[Abstract].
|
| 45.
|
Nguyen, J. T.,
C. W. Turck,
F. E. Cohen,
R. N. Zuckermann, and W. A. Lim.
1998.
Exploiting the basis of proline recognition by SH3 and WW domains: design of N-substituted inhibitors.
Science
282:2088-2092[Abstract/Free Full Text].
|
| 46.
|
Peters, J. M.
1998.
SCF and APC: the Yin and Yang of cell cycle regulated proteolysis.
Curr. Opin. Cell Biol.
10:759-768[CrossRef][Medline].
|
| 47.
|
Pickart, C. M.
1997.
Targeting of substrates to the 26S proteasome.
FASEB J.
11:1055-1066[Abstract].
|
| 48.
|
Plant, P. J.,
H. Yeger,
O. Staub,
P. Howard, and D. Rotin.
1997.
The C2 domain of the ubiquitin protein ligase Nedd4 mediates Ca2+-dependent plasma membrane localization.
J. Biol. Chem.
272:32329-32336[Abstract/Free Full Text].
|
| 49.
|
Raths, S.,
J. Rohrer,
F. Crausaz, and H. Riezman.
1993.
end3 and end4: two mutants defective in receptor-mediated and fluid-phase endocytosis in Saccharomyces cerevisiae.
J. Cell Biol.
120:55-65[Abstract/Free Full Text].
|
| 50.
|
Rieder, S. E.,
L. M. Banta,
K. Kohrer,
J. M. McCaffery, and S. D. Emr.
1996.
Multilamellar endosome-like compartment accumulates in the yeast vps28 vacuolar protein sorting mutant.
Mol. Biol. Cell
7:985-999[Abstract].
|
| 51.
|
Riezman, H.
1997.
The ins and outs of protein translocation.
Science
278:1728-1729[Free Full Text].
|
| 52.
|
Rizo, J., and T. C. Sudhof.
1998.
C2-domains, structure and function of a universal Ca2+-binding domain.
J. Biol. Chem.
273:15879-15882[Free Full Text].
|
| 53.
|
Roberg, K. J.,
N. Rowley, and C. A. Kaiser.
1997.
Physiological regulation of membrane protein sorting late in the secretory pathway of Saccharomyces cerevisiae.
J. Cell Biol.
137:1469-1482[Abstract/Free Full Text].
|
| 54.
|
Robinson, M. S.,
C. Watts, and M. Zerial.
1996.
Membrane dynamics in endocytosis.
Cell
84:13-21[CrossRef][Medline].
|
| 55.
|
Roth, A. F., and N. G. Davis.
1996.
Ubiquitination of the yeast a-factor receptor.
J. Cell Biol.
134:661-674[Abstract/Free Full Text].
|
| 56.
|
Roth, A. F.,
D. M. Sullivan, and N. G. Davis.
1998.
A large PEST-like sequence directs the ubiquitination, endocytosis, and vacuolar degradation of the yeast a-factor receptor.
J. Cell Biol.
142:949-961[Abstract/Free Full Text].
|
| 57.
|
Scheffner, M.,
U. Nuber, and J. M. Huibregtse.
1995.
Protein ubiquitination involving an E1-E2-E3 enzyme ubiquitin thioester cascade.
Nature
373:81-83[CrossRef][Medline].
|
| 58.
|
Schmid, S. L.
1997.
Clathrin-coated vesicle formation and protein sorting: an integrated process.
Annu. Rev. Biochem.
66:511-548[CrossRef][Medline].
|
| 59.
|
Seron, K.,
M. O. Blondel,
R. Haguenauer-Tsapis, and C. Volland.
1999.
Uracil-induced down-regulation of the yeast uracil permease.
J. Bacteriol.
181:1793-1800[Abstract/Free Full Text].
|
| 60.
|
Shih, S. C.,
K. E. Sloper-Mould, and L. Hicke.
2000.
Monoubiquitin carries a novel internalization signal that is appended to activated receptors.
EMBO J.
19:187-198[CrossRef][Medline].
|
| 61.
|
Sorkina, T.,
A. Bild,
F. Tebar, and A. Sorkin.
1999.
Clathrin, adaptors and eps15 in endosomes containing activated epidermal growth factor receptors.
J. Cell Sci.
112:317-327[Abstract].
|
| 62.
|
Springael, J. Y., and B. Andre.
1998.
Nitrogen-regulated ubiquitination of the gap1 permease of Saccharomyces cerevisiae.
Mol. Biol. Cell
9:1253-1263[Abstract/Free Full Text].
|
| 63.
|
Springael, J. Y.,
J. O. De Craene, and B. Andre.
1999.
The yeast Npi1/Rsp5 ubiquitin ligase lacking its N-terminal C2 domain is competent for ubiquitination but not for subsequent endocytosis of the gap1 permease.
Biochem. Biophys. Res. Commun.
257:561-566[CrossRef][Medline].
|
| 64.
|
Springael, J. Y.,
J. M. Galan,
R. Haguenauer-Tsapis, and B. Andre.
1999.
NH4+-induced down-regulation of the Saccharomyces cerevisiae Gap1p permease involves its ubiquitination with lysine-63-linked chains.
J. Cell Sci.
112:1375-1383[Abstract].
|
| 65.
|
Stewart, L. C., and M. P. Yaffe.
1991.
A role for unsaturated fatty acids in mitochondrial movement and inheritance.
J. Cell Biol.
115:1249-1257[Abstract/Free Full Text].
|
| 66.
|
Tang, H. Y.,
A. Munn, and M. Cai.
1997.
EH domain proteins Pan1p and End3p are components of a complex that plays a dual role in organization of the cortical actin cytoskeleton and endocytosis in Saccharomyces cerevisiae.
Mol. Cell. Biol.
17:4294-4304[Abstract].
|
| 67.
|
Tang, H. Y.,
J. Xu, and M. Cai.
2000.
Pan1p, End3p, and Sla1p, three yeast proteins required for normal cortical actin cytoskeleton organization, associate with each other and play essential roles in cell wall morphogenesis.
Mol. Cell. Biol.
20:12-25[Abstract/Free Full Text].
|
| 68.
|
Terrell, J.,
S. Shih,
R. Dunn, and L. Hicke.
1998.
A function for monoubiquitination in the internalization of a G protein-coupled receptor.
Mol. Cell
1:193-202[CrossRef][Medline].
|
| 69.
|
Tomoda, K.,
Y. Kubota, and J. Kato.
1999.
Degradation of the cyclin-dependent kinase inhibitor p27kip1 is instigated by Jab1.
Nature
398:160-165[CrossRef][Medline].
|
| 70.
|
Torrisi, M. R.,
L. V. Lotti,
F. Belleudi,
R. Gradini,
A. E. Salcini,
S. Confalonieri,
P. G. Pelicci, and P. P. Di Fiore.
1999.
Eps15 is recruited to the plasma membrane upon epidermal growth factor receptor activation and localizes to components of the endocytic pathway during receptor internalization.
Mol. Biol. Cell
10:417-434[Abstract/Free Full Text].
|
| 71.
|
van Delft, S.,
R. Govers,
G. J. Strous,
A. J. Verkleij, and P. M. van Bergen en Henegouwen.
1997.
Epidermal growth factor induces ubiquitination of Eps15.
J. Biol. Chem.
272:14013-14016[Abstract/Free Full Text].
|
| 72.
|
Volland, C.,
C. Garnier, and R. Haguenauer-Tsapis.
1992.
In vivo phosphorylation of the yeast uracil permease.
J. Biol. Chem.
267:23767-23771[Abstract/Free Full Text].
|
| 73.
|
Wang, G.,
J. Yang, and J. M. Huibregtse.
1999.
Functional domains of the Rsp5 ubiquitin-protein ligase.
Mol. Cell. Biol.
19:342-352[Abstract/Free Full Text].
|
| 74.
|
Waterman, H.,
G. Levkowitz,
I. Alroy, and Y. Yarden.
1999.
The RING finger of c-Cb1 mediates desensitization of the epidermal growth factor receptor.
J. Biol. Chem.
274:22151-22154[Abstract/Free Full Text].
|
| 75.
|
Wendland, B.,
S. D. Emr, and H. Riezman.
1998.
Protein traffic in the yeast endocytic and vacuolar protein sorting pathways.
Curr. Opin. Cell Biol.
10:513-522[CrossRef][Medline].
|
| 76.
|
Wendland, B.,
K. E. Steece, and S. D. Emr.
1999.
Yeast epsins contain an essential N-terminal ENTH domain, bind clathrin and are required for endocytosis.
EMBO J.
18:4383-4393[CrossRef][Medline].
|
| 77.
|
Wesp, A.,
L. Hicke,
J. Palecek,
R. Lombardi,
T. Aust,
A. L. Munn, and H. Riezman.
1997.
End4p/Sla2p interacts with actin-associated proteins for endocytosis in Saccharomyces cerevisiae.
Mol. Biol. Cell
8:2291-2306[Abstract/Free Full Text].
|
| 78.
|
Xie, Y., and A. Varshavsky.
2000.
Physical association of ubiquitin ligases and the 26S proteasome.
Proc. Natl. Acad. Sci. USA
14:2497-2502.
|
| 79.
|
Zoladek, T.,
A. Tobiasz,
G. Vaduva,
M. Boguta,
N. C. Martin, and A. K. Hopper.
1997.
MDP1, a Saccharomyces cerevisiae gene involved in mitochondrial/cytoplasmic protein distribution, is identical to the ubiquitin-protein ligase gene RSP5.
Genetics
145:595-603[Abstract].
|
Molecular and Cellular Biology, May 2001, p. 3564-3575, Vol. 21, No. 10
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.10.3564-3575.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Strochlic, T. I., Schmiedekamp, B. C., Lee, J., Katzmann, D. J., Burd, C. G.
(2008). Opposing Activities of the Snx3-Retromer Complex and ESCRT Proteins Mediate Regulated Cargo Sorting at a Common Endosome. Mol. Biol. Cell
19: 4694-4706
[Abstract]
[Full Text]
-
Leon, S., Erpapazoglou, Z., Haguenauer-Tsapis, R.
(2008). Ear1p and Ssh4p Are New Adaptors of the Ubiquitin Ligase Rsp5p for Cargo Ubiquitylation and Sorting at Multivesicular Bodies. Mol. Biol. Cell
19: 2379-2388
[Abstract]
[Full Text]
-
Estrella, L. A., Krishnamurthy, S., Timme, C. R., Hampsey, M.
(2008). The Rsp5 E3 Ligase Mediates Turnover of Low Affinity Phosphate Transporters in Saccharomyces cerevisiae. J. Biol. Chem.
283: 5327-5334
[Abstract]
[Full Text]
-
Nikko, E., Andre, B.
(2007). Split-Ubiquitin Two-Hybrid Assay To Analyze Protein-Protein Interactions at the Endosome: Application to Saccharomyces cerevisiae Bro1 Interacting with ESCRT Complexes, the Doa4 Ubiquitin Hydrolase, and the Rsp5 Ubiquitin Ligase. Eukaryot Cell
6: 1266-1277
[Abstract]
[Full Text]
-
Watson, H., Bonifacino, J. S.
(2007). Direct Binding to Rsp5p Regulates Ubiquitination-independent Vacuolar Transport of Sna3p. Mol. Biol. Cell
18: 1781-1789
[Abstract]
[Full Text]
-
McNatt, M. W., McKittrick, I., West, M., Odorizzi, G.
(2007). Direct Binding to Rsp5 Mediates Ubiquitin-independent Sorting of Sna3 via the Multivesicular Body Pathway. Mol. Biol. Cell
18: 697-706
[Abstract]
[Full Text]
-
Ing, B., Shteiman-Kotler, A., Castelli, M., Henry, P., Pak, Y., Stewart, B., Boulianne, G. L., Rotin, D.
(2007). Regulation of Commissureless by the Ubiquitin Ligase DNedd4 Is Required for Neuromuscular Synaptogenesis in Drosophila melanogaster. Mol. Cell. Biol.
27: 481-496
[Abstract]
[Full Text]
-
Ren, J., Kee, Y., Huibregtse, J. M., Piper, R. C.
(2007). Hse1, a Component of the Yeast Hrs-STAM Ubiquitin-sorting Complex, Associates with Ubiquitin Peptidases and a Ligase to Control Sorting Efficiency into Multivesicular Bodies. Mol. Biol. Cell
18: 324-335
[Abstract]
[Full Text]
-
Staub, O., Rotin, D.
(2006). Role of Ubiquitylation in Cellular Membrane Transport. Physiol. Rev.
86: 669-707
[Abstract]
[Full Text]
-
Arnason, T. G., Pisclevich, M. G., Dash, M. D., Davies, G. F., Harkness, T. A. A.
(2005). Novel Interaction between Apc5p and Rsp5p in an Intracellular Signaling Pathway in Saccharomyces cerevisiae. Eukaryot Cell
4: 134-146
[Abstract]
[Full Text]
-
Heidecker, G., Lloyd, P. A., Fox, K., Nagashima, K., Derse, D.
(2004). Late Assembly Motifs of Human T-Cell Leukemia Virus Type 1 and Their Relative Roles in Particle Release. J. Virol.
78: 6636-6648
[Abstract]
[Full Text]
-
Dunn, R., Klos, D. A., Adler, A. S., Hicke, L.
(2004). The C2 domain of the Rsp5 ubiquitin ligase binds membrane phosphoinositides and directs ubiquitination of endosomal cargo. JCB
165: 135-144
[Abstract]
[Full Text]
-
Murray, R. Z., Jolly, L. A., Wood, S. A.
(2004). The FAM Deubiquitylating Enzyme Localizes to Multiple Points of Protein Trafficking in Epithelia, where It Associates with E-cadherin and {beta}-catenin. Mol. Biol. Cell
15: 1591-1599
[Abstract]
[Full Text]
-
Angers, A., Ramjaun, A. R., McPherson, P. S.
(2004). The HECT Domain Ligase Itch Ubiquitinates Endophilin and Localizes to the trans-Golgi Network and Endosomal System. J. Biol. Chem.
279: 11471-11479
[Abstract]
[Full Text]
-
Care, A., Vousden, K. A., Binley, K. M., Radcliffe, P., Trevethick, J., Mannazzu, I., Sudbery, P. E.
(2004). A Synthetic Lethal Screen Identifies a Role for the Cortical Actin Patch/Endocytosis Complex in the Response to Nutrient Deprivation in Saccharomyces cerevisiae. Genetics
166: 707-719
[Abstract]
[Full Text]
-
Katzmann, D. J., Sarkar, S., Chu, T., Audhya, A., Emr, S. D.
(2004). Multivesicular Body Sorting: Ubiquitin Ligase Rsp5 Is Required for the Modification and Sorting of Carboxypeptidase S. Mol. Biol. Cell
15: 468-480
[Abstract]
[Full Text]
-
Blondel, M.-O., Morvan, J., Dupre, S., Urban-Grimal, D., Haguenauer-Tsapis, R., Volland, C.
(2004). Direct Sorting of the Yeast Uracil Permease to the Endosomal System Is Controlled by Uracil Binding and Rsp5p-dependent Ubiquitylation. Mol. Biol. Cell
15: 883-895
[Abstract]
[Full Text]
-
Bouamr, F., Melillo, J. A., Wang, M. Q., Nagashima, K., de Los Santos, M., Rein, A., Goff, S. P.
(2003). PPPYEPTAP Motif Is the Late Domain of Human T-Cell Leukemia Virus Type 1 Gag and Mediates Its Functional Interaction with Cellular Proteins Nedd4 and Tsg101. J. Virol.
77: 11882-11895
[Abstract]
[Full Text]
-
Meriin, A. B., Zhang, X., Miliaras, N. B., Kazantsev, A., Chernoff, Y. O., McCaffery, J. M., Wendland, B., Sherman, M. Y.
(2003). Aggregation of Expanded Polyglutamine Domain in Yeast Leads to Defects in Endocytosis. Mol. Cell. Biol.
23: 7554-7565
[Abstract]
[Full Text]
-
Abe, F., Iida, H.
(2003). Pressure-Induced Differential Regulation of the Two Tryptophan Permeases Tat1 and Tat2 by Ubiquitin Ligase Rsp5 and Its Binding Proteins, Bul1 and Bul2. Mol. Cell. Biol.
23: 7566-7584
[Abstract]
[Full Text]
-
Umebayashi, K., Nakano, A.
(2003). Ergosterol is required for targeting of tryptophan permease to the yeast plasma membrane. JCB
161: 1117-1131
[Abstract]
[Full Text]
-
Davies, B. A., Topp, J. D., Sfeir, A. J., Katzmann, D. J., Carney, D. S., Tall, G. G., Friedberg, A. S., Deng, L., Chen, Z., Horazdovsky, B. F.
(2003). Vps9p CUE Domain Ubiquitin Binding Is Required for Efficient Endocytic Protein Traffic. J. Biol. Chem.
278: 19826-19833
[Abstract]
[Full Text]
-
Wedaman, K. P., Reinke, A., Anderson, S., Yates, J. III, McCaffery, J. M., Powers, T.
(2003). Tor Kinases Are in Distinct Membrane-associated Protein Complexes in Saccharomyces cerevisiae. Mol. Biol. Cell
14: 1204-1220
[Abstract]
[Full Text]
-
Kaminska, J., Gajewska, B., Hopper, A. K., Zoladek, T.
(2002). Rsp5p, a New Link between the Actin Cytoskeleton and Endocytosis in the Yeast Saccharomyces cerevisiae. Mol. Cell. Biol.
22: 6946-6948
[Abstract]
[Full Text]
-
Harkness, T. A. A., Davies, G. F., Ramaswamy, V., Arnason, T. G.
(2002). The Ubiquitin-Dependent Targeting Pathway in Saccharomyces cerevisiae Plays a Critical Role in Multiple Chromatin Assembly Regulatory Steps. Genetics
162: 615-632
[Abstract]
[Full Text]
-
Shcherbik, N., Kumar, S., Haines, D. S.
(2002). Substrate proteolysis is inhibited by dominant-negative Nedd4 and Rsp5 mutants harboring alterations in WW domain 1. J. Cell Sci.
115: 1041-1048
[Abstract]
[Full Text]
-
Harty, R. N., Brown, M. E., McGettigan, J. P., Wang, G., Jayakar, H. R., Huibregtse, J. M., Whitt, M. A., Schnell, M. J.
(2001). Rhabdoviruses and the Cellular Ubiquitin-Proteasome System: a Budding Interaction. J. Virol.
75: 10623-10629
[Abstract]
[Full Text]
-
Dupre, S., Haguenauer-Tsapis, R.
(2001). Deubiquitination Step in the Endocytic Pathway of Yeast Plasma Membrane Proteins: Crucial Role of Doa4p Ubiquitin Isopeptidase. Mol. Cell. Biol.
21: 4482-4494
[Abstract]
[Full Text]
-
Dunn, R., Hicke, L.
(2001). Multiple Roles for Rsp5p-dependent Ubiquitination at the Internalization Step of Endocytosis. J. Biol. Chem.
276: 25974-25981
[Abstract]
[Full Text]