Previous Article | Next Article 
Molecular and Cellular Biology, June 2001, p. 3662-3670, Vol. 21, No. 11
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.11.3662-3670.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Embryonic but Not Postnatal Reexpression of
Hepatocyte Nuclear Factor 1
(HNF1
) Can Reactivate the Silent
Phenylalanine Hydroxylase Gene in HNF1
-Deficient
Hepatocytes
Benoît
Viollet,
Moshe
Yaniv,* and
Marco
Pontoglio*
Unité des Virus Oncogènes, CNRS
URA 1644, Département des Biotechnologies, Institut Pasteur,
75724 Paris cedex 15, France
Received 2 February 2001/Accepted 8 March 2001
 |
ABSTRACT |
The failure to transcribe the phenylalanine hydroxylase (PAH) gene
in the liver of hepatocyte nuclear factor 1
(HNF1
)-deficient mice
correlated with DNA hypermethylation and the presence of an inactive
chromatin structure (M. Pontoglio, D. M. Faust, A. Doyen, M. Yaniv, and M. C. Weiss, Mol. Cell. Biol. 17:4948-4956, 1997). To
evaluate the precise role played by HNF1
, DNA methylation, or
histone acetylation in PAH gene silencing, we examined conditions that
could restore PAH gene expression in HNF1
-deficient hepatocytes. We
show that reactivation of PAH transcription can be achieved by
reexpression of HNF1
in embryonic (i.e., embryonic day 12.5 [e12.5] to e13.5) hepatocytes but not in fetal (e17.5), newborn, and
adult HNF1
-deficient hepatocytes. This defines a temporal competence
window during which HNF1
can act to (re)program PAH gene
transcription. We also show that PAH gene silencing can be partially
relieved in HNF1
-deficient hepatocytes by treatment with the
demethylating agent 5-azacytidine, even in the absence of HNF1
.
Treatment using 5-azacytidine combined with trichostatin, a histone
deacetylase inhibitor, resulted in a synergistic reactivation of the
silenced PAH gene in adult hepatocytes, but this activity was not
further increased by HNF1
reexpression. These results suggest that
the HNF1
homeoprotein is involved in stage-specific developmental
control of the methylation state and chromatin remodeling of the PAH gene.
 |
INTRODUCTION |
During the process of development,
genes undergo selective activation, repression, and/or silencing. Some
genes are totally silenced, whereas others remain active or potentially
active. Failure to activate or repress genes appropriately during
development can compromise survival. Thus, correct regulation of gene
expression, i.e., tissue-specific expression at appropriate times or in
response to specific signals, is essential both to normal development
and to correct functioning of the adult organism. Tissue-specific and
developmental expression patterns are accompanied by distinct alterations in chromatin structure and DNA methylation status (37). DNA is packaged into either transcriptionally
competent euchromatin or repressive, transcriptionally silent
heterochromatin. This permits only a small portion of the genome to be
expressed in any given cell or tissue type. A strong correlation among
DNA methylation, transcriptional silencing, and tightly compacted chromatin structures has been established in many different systems (reviewed in reference 37). The transcriptional repression
associated with DNA methylation has been linked to alterations in local
chromatin structure leading to the formation of condensed chromatin
regions. DNA methyltransferases and methyl-CpG-binding proteins
influence local histone acetylation by recruiting histone deacetylase
complexes which close chromatin structure, rendering regulatory regions inaccessible to the transcriptional machinery (12, 19, 31, 40). This process prevents regulatory factors from accessing methylated sequences and allows the stable maintenance of gene silencing. Thus, DNA methylation may serve as a unique mechanism for
setting up local histone deacetylation, to maintain an epigenetic repressed chromosomal state.
The study of liver-specific gene expression has identified several
tissue-enriched transcription factors which act in concert with
ubiquitous transcription factors to regulate liver-specific promoters
(5). One of these factors is the homeoprotein hepatocyte nuclear factor 1
(HNF1
), whose expression is restricted to the liver, pancreas, kidneys, and digestive tract. Disruption of the murine
HNF1
gene results in a complex pattern of traits caused by liver,
renal, and pancreatic dysfunctions (33, 36).
Interestingly, HNF1
-deficient mice display
hyperphenylalaninemia caused by the lack of hepatic
expression of the phenylalanine hydroxylase (PAH) gene. In contrast to
PAH, the transcriptional activity of many other known HNF1
target
genes was only partially affected. Two DNase I-hypersensitive sites
(HSSII and HSSIII) containing binding sites for HNF1
were mapped in
the PAH transcriptional control region. However, mutation of these
sites had little effect on the basal transcriptional activity of the
PAH promoter-enhancer sequences linked to a reporter gene in
transient-transfection assays (11). The PAH
transcriptional defect in the livers of HNF1
-deficient animals was
correlated with the absence of an open chromatin configuration and was
accompanied by hypermethylation of the PAH promoter-enhancer regions
(34). Furthermore, the failure to activate this gene in
HNF1
-deficient mice with its-inducers glucocorticoids and cyclic AMP
suggested that an initial transcriptionally competent active state
created by HNF1
binding is a prerequisite step to allow PAH gene
modulation in the liver.
In the present study, we investigated the mechanisms by which a single
transcription factor is implicated in the formation of an open
chromatin configuration and the maintenance of unmethylated regulatory
sequences. We examined if and to what extent HNF1
reexpression, DNA
demethylation, or inhibition of histone deacetylation could restore PAH
expression in HNF1
-deficient hepatocytes. We show that HNF1
reexpression in embryonic (i.e., embryonic day 12.5 [e12.5] to e13.5)
HNF1
-deficient hepatocytes could partially restore PAH gene
transcription, whereas fetal (e17.5) newborn, and adult
HNF1
-deficient hepatocytes were refractory to HNF1
action.
Demethylation of the PAH gene locus by 5-azacytidine (5-AzaC) treatment
of newborn mice could also restore a low level of transcription. This
could be further stimulated by inhibition of histone deacetylation but
not by HNF1
reexpression. These data suggest that HNF1
plays an
important role in the onset of the PAH gene activation via the
maintenance of unmethylated status of promoter-enhancer regions during
liver development.
 |
MATERIALS AND METHODS |
Mouse hepatocyte isolation, cell culture, and transfection.
Primary hepatocytes were isolated from adult wild-type and
HNF1
-deficient mice by a two-step in situ collagenase perfusion procedure adapted to mouse livers (2). Hepatocytes from
e12.5, e13.5, and e17.5 embryos and newborns were obtained by
collagenase digestion of sliced liver, as described previously
(4). The enriched hepatocyte suspensions were then
purified through an isodensity percoll centrifugation procedure
(24). Cell viability was assessed by the trypan blue
exclusion test and was always higher than 90%. Hepatocytes were seeded
at a density of 105 cells/cm2 on rat tail
collagen type I-coated culture dishes and were cultivated in Williams'
E medium (Gibco/BRL) supplemented with penicillin (100 U/ml),
streptomycin (100 µg/ml), 20 mM HEPES, 2 g of bovine serum
albumin/liter, 10 µM dexamethasone, 1 µM hydrocortisone, 5 µg of
insulin/ml 5 µg of transferrin/ml, 5 ng of selenious acid/ml, 0.2 µg of glucagon/ml, 10 ng of epidermal growth factor/ml, and 2%
(vol/vol) dimethyl sulfoxide (DMSO). After 2 h of attachment, the
medium was changed and adult hepatocytes were transfected by the
lipofection method using the DOTAP transfection reagent (Roche
Molecular Biochemicals) according to the manufacturer's instructions.
Four micrograms of the reporter plasmid
283 containing multimerized HNF1 binding sites was used for each transfection. The
medium containing the liposome-DNA complex was replaced 16 h after
transfection with fresh medium, and hepatocytes were harvested 24 h later for chloramphenicol acetyltransferase (CAT) assay as described
previously (11).
Isolation of total RNA and Northern blot analysis.
Total RNA
from liver or cultured primary hepatocytes was isolated by the
guanidinium thiocyanate-acid phenol method as previously described
(6). For Northern blots, 15 µg of RNA was separated by
formaldehyde-agarose gel electrophoresis and transferred to a nylon
membrane (Hybond N; Amersham) as recommended by the manufacturer. Probes were labeled by random priming and corresponded to a fragment of
the murine PAH cDNA (kindly provided by Daniela Faust) and to a
fragment corresponding to the
-actin cDNA.
Infection with recombinant adenovirus.
Recombinant
adenovirus containing the cDNA for human HNF1
was obtained by the
method described previously (9). Briefly, the human
HNF1
cDNA under the control of the cytomegalovirus (CMV)
immediate-early promoter was integrated into the adenovirus backbone by
homologous recombination in Escherichia coli. Then, the
recombinant adenoviral construct was cleaved with PacI and transfected into the packaging cell line 293. The recombinant adenovirus expressing the green fluorescent protein (GFP) under the
control of the CMV promoter (Quantum Biotechnologies) was used as the
control. The adenoviruses were amplified in the 293 cells and purified
by cesium chloride density centrifugation; viral titers were estimated
optically by the absorbance at 260 nm. HNF1
-deficient hepatocytes
were infected by incubation with the virus in a minimal volume for
1 h at 37°C, with increasing multiplicity of infection varying
by 1 log before addition of extra medium. Nuclear extracts from
infected cells were prepared 36 h later and analyzed by Western
blotting (7) to define the multiplicity that restores the
HNF1
level found in cultured primary mouse hepatocytes.
In vivo 5-AzaC treatment of mice.
Mice weighing about
10 g were injected intraperitoneally with 5-AzaC twice (25 µg/injection) at days 11 and 14 and were sacrificed at day 25 after
birth (16). Control mice were injected with the same
volume of saline.
Acid extraction of proteins from TSA-treated hepatocytes.
Acid-soluble proteins were prepared from nuclei of primary cultured
hepatocytes treated for 48 h with increasing amounts of trichostatin
(TSA) (0, 100, and 300 ng/ml). The nuclear pellets were resuspended in
10 volumes of protein extraction buffer (50 mM Tris-HCl [pH 8], 50 mM
NaCl, 4 mM MgCl2, 10 mM sodium butyrate, 5 mM
2-mercaptoethanol, 0.34 M sucrose, 0.5% [vol/vol] Nonidet P-40, and
Complete protease inhibitor cocktail [Roche Molecular Biochemicals]). Sulfuric acid was added dropwise to a final
concentration of 0.25 M with gentle vortexing, and the nuclear lysate
was incubated on ice for 1 h, with vigorous vortexing every 10 min. The lysates were centrifuged at maximum speed, and the supernatant
fraction was used for analysis of histone acetylation level by Western blot analysis using anti-acetyl-lysine antibodies (Upstate Biotechnology).
RT-PCR analysis.
To eliminate genomic DNA contamination,
total RNA (5 µg) was treated with RNase-free DNase I (Roche Molecular
Biochemicals) and then was reverse transcribed into cDNAs using
Superscript reverse transcriptase (Gibco/BRL) in the presence of random
hexamers. PCR amplifications were performed in the presence of
[
-32P]dATP with the following forward and reverse
specific primers: for PAH, ACAGAGGAGGAGAGGAAGAC and
TCATAGCGAACGGAGAAG; for HNF4
, CTTCCTTCTTCATGCCAG
and ACACGTCCCCATCTGAAG; for HNF3
GCCTGAGCCGCGCTCGGGAC and GGTGCAGGGTCCAGAAGGAG;
for human HNF1
(hHNF1
), GCCTGGCCTCCACGCAGGCAC; and CTGCTTGGTGGGCGTGAGGCT; and for
glyceraldehyde-3-phosphate dehydrogenase (GAPDH),
CACCATCTTCCAGGAGCGAG, and ACAGCCTTGGCACCAGT. For
each RNA preparation, we carried out separate amplification products
using reverse transcription (RT)-positive and RT-negative reaction
mixtures as templates. For PCR amplification, all samples were heated
to 94°C for 5 min and then amplified for an optimized number of
cycles consisting of 94°C for 30 s, 57°C for 30 s, and 72°C for 1 min. All reaction mixtures were then incubated at 72°C for 10 min and cooled to 4°C. PCR products were resolved by 5% polyacrylamide gel electrophoresis and visualized by autoradiography. Signals were collected using a PhosphorImager and quantitated using
ImageQuant (Molecular Dynamics).
 |
RESULTS |
The mouse PAH gene is expressed in primary hepatocyte culture.
To explore the basis for PAH gene regulation and determine the
conditions required to reactivate the silent PAH gene in the livers of
HNF1
-deficient mice, we developed an in vitro system based on
primary hepatocyte culture. It is known that freshly isolated
hepatocytes in culture exhibit a rapid decrease in the transcription of
liver-specific genes (8). In order to circumvent and
reduce this constraint, we made use of a culture system involving rat
tail collagen-coated plates and chemically defined medium supplemented
with 2% DMSO (17). It has been previously shown that the
expression of many liver-specific genes is maintained for several weeks
at 21 to 72% of their hepatic levels when rat hepatocytes are cultured
under such conditions (18). To assess the expression level
of the PAH gene in primary murine hepatocyte cultures, we performed
Northern blot analysis using total RNA extracted at different times
after the establishment in culture. As shown in Fig.
1, the level of PAH mRNA decreased
immediately after plating. However, the expression level increased at
later times, approaching 40% of the level observed at the time of
plating (Fig. 1).

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 1.
PAH mRNA levels in primary cultures of mouse
hepatocytes. (A) Primary hepatocytes isolated from adult mice were
cultured in supplemented serum-free medium containing 2% DMSO on
collagen plates for various lengths of time (0, 12, 24, 36, 48, 60, and
72 h). Total RNA was extracted, and the level of the PAH mRNA was
monitored by Northern blot analysis. -Actin mRNA hybridization of
the same blot was performed to verify loading of the samples. (B) Shown
are PAH mRNA levels normalized for the corresponding -actin
signal.
|
|
Reexpression of HNF1
in adult HNF1
-deficient hepatocytes
fails to activate PAH expression.
It has been previously shown
that disruption of the HNF1
gene resulted in hepatic silencing of
the PAH gene (33). Silencing was associated with a
modified chromatin structure and DNA methylation pattern
(34). The presence of several HNF1 binding sites in DNase
I-hypersensitive regions of the PAH promoter-enhancer sequences (11) prompted us to investigate the possibility of
reactivating this gene by HNF1
reexpression. To this end, we
reexpressed HNF1
in primary cultures of adult HNF1
-deficient
hepatocytes using a recombinant adenovirus expressing the hHNF1
protein (AdhHNF1
) under the control of the CMV promoter. As a
control, we used a recombinant adenovirus expressing GFP (AdGFP).
Infection of primary cultures of HNF1
-deficient hepatocytes with the
AdhHNF1
virus resulted in the synthesis of HNF1
at levels similar
to those found in primary hepatocytes (Fig.
2A). This protein was functionally active, since it activated transcription of a transfected reporter gene
containing three multimerized HNF1 binding sites (Fig. 2B). However, to
our surprise, HNF1
failed to activate the silent endogenous PAH gene
in adult HNF1
-deficient hepatocytes (Fig. 3). This result suggested that the closed
chromatin configuration of the PAH gene present in HNF1
-deficient
hepatocytes prevented HNF1
from reactivating the endogenous PAH
gene.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 2.
Adenoviral expression of HNF1 in HNF1 -deficient
hepatocytes. (A) Primary hepatocytes isolated from adult
HNF1 -deficient mice were infected with HNF1 - or GFP-expressing
adenoviruses at a multiplicity of infection of 10 PFU/cell for 1 h at
37°C. After 36 h of culture, HNF1 expression levels were
determined by Western blot analysis. Nuclear extracts prepared from
wild-type hepatocytes (lane 1) or from HNF1 -deficient hepatocytes
infected with either AdGFP (lane 2) or AdhHNF1 (lane 3) were
subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis,
transferred to a nylon membrane, and blotted with rabbit polyclonal
anti-HNF1 antibody. (B) Wild-type and HNF1 -deficient primary
hepatocytes were transfected with the reporter construct
283CAT, containing three HNF1 binding sites upstream of
the -fibrinogen minimal promoter. Twelve hours later,
HNF1 -deficient hepatocytes were infected with increasing amounts of
AdhHNF1 (relative multiplicities of infection of 1, 5, and 10 PFU/cell). Thirty hours later, extracts were prepared and analyzed for
HNF1 protein levels and for CAT activity. HNF1 expression levels
in infected HNF1 -deficient hepatocytes are presented in the middle
panel. A typical CAT assay is shown in the upper panel, and
quantification is presented in the lower panel.
|
|

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 3.
PAH mRNA expression in adult HNF1 -deficient
hepatocytes after infection with AdhHNF1 . (A) Primary hepatocytes
isolated from adult HNF1 -deficient mice were infected with increased
amounts of AdhHNF1 (relative multiplicities of infection of 1 and 10 PFU/cell). After 48 h of culture to allow full expression of the
adenovirus-transferred genes, total RNA was extracted and levels of PAH
and GAPDH mRNA were assayed by semiquantitative RT-PCR. (B) Efficiency
of adenoviral infection was monitored in infected HNF1 -deficient
hepatocytes by measuring AdhHNF1 mRNA expression by RT-PCR analysis
using primers specific for the hHNF1 cDNA and by revealing the
presence of the HNF1 protein by Western blot analysis.
|
|
Reexpression of HNF1
in embryonic HNF1
-deficient hepatocytes
is sufficient to activate PAH expression.
We figured that the
nonpermissive configuration might have been established during
embryonic development in the absence of HNF1
. Low levels of PAH mRNA
are detectable from day 11.5 of mouse development, and a major burst in
mRNA synthesis occurs just after birth (reference 34 and
data not shown). To verify whether earlier reintroduction of HNF1
could restore gene activity, we infected hepatocytes isolated from
newborn and e17.5 HNF1
-deficient mice. Again, we failed to
reactivate the PAH gene after infection by AdhHNF1
(data not shown).
To test if the PAH gene can be reactivated during earlier liver
developmental stages, we infected hepatocytes isolated from e12.5
HNF1
-deficient embryos. Remarkably, at this stage of liver
development, reintroduction of HNF1
was sufficient to induce PAH
gene transcription (Fig. 4A). The level
of PAH reactivation is almost 30% of the PAH expression level of
wild-type hepatocytes. To define the critical window for cellular
competence, we infected hepatocytes isolated from e13.5
HNF1
-deficient embryos. At this stage of development, embryonic
hepatocytes were still competent for PAH gene reactivation upon
addition of exogenous HNF1
(Fig. 4B). These results suggest that the
presence of HNF1
during early organogenesis is essential for PAH
gene activation and its maintenance in an active chromatin
configuration.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 4.
PAH mRNA expression in e12.5 and e13.5 HNF1 -deficient
hepatocytes after infection with AdhHNF1 . Primary hepatocytes
isolated from e12.5 (A) or e13.5 (B) HNF1 -deficient hepatocytes were
infected with AdhHNF1 or AdGFP at a multiplicity of infection of 10 PFU/cell. Cells were harvested 48 h later, and PAH, HNF3 , and
HNF4 mRNA expression levels were determined by semiquantitative
RT-PCR analysis. (C) Efficiency of adenoviral infection was monitored
by measuring AdhHNF1 mRNA expression by RT-PCR analysis using
primers specific for the human HNF1 cDNA.
|
|
Effect of histone-hyperacetylating drugs.
It is possible that
the silent or closed chromatin structure of the PAH gene in fetal,
newborn, or adult HNF1
-deficient hepatocytes prevented the incoming
HNF1
from binding to its target sites. It is generally believed that
inactive chromatin contains nonacetylated histones and that gene
activation involves increased nucleosomal histone acetylation. We
therefore attempted to render the nucleosomal DNA more accessible to
transcription factors by treating the primary hepatocytes with TSA, an
inhibitor of histone deacetylases. Treatment of cells with TSA has been
shown to result in a genomewide increase in the level of histone
acetylation and to alter the expression of a number of genes.
Consequently, to test the hypothesis that the PAH gene can be
reactivated via changes in histone acetylation, HNF1
-deficient
hepatocytes were treated with increasing amounts of TSA (0, 100, and
300 ng/ml) and harvested for isolation of histones and RNA. No PAH mRNA
could be detected by RT-PCR, even after incubation with high doses of
TSA (Fig. 5A) at which a large increase
in the amount of acetylated histones can be detected (Fig. 5B). We
further tested if reintroducing HNF1
concomitantly with TSA
treatment could restore PAH transcription. As with TSA alone, we could
not detect any reactivation of PAH gene transcription under these
conditions (Fig. 5A).

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 5.
PAH mRNA expression in adult HNF1 -deficient
hepatocytes after TSA treatment. (A) Primary hepatocytes isolated from
adult HNF1 -deficient mice were treated with increasing amounts of
the histone deacetylase inhibitor TSA (0, 100, and 300 ng/ml) and
infected with AdhHNF1 at a multiplicity of infection of 10 PFU/cell.
After 48 h of culture, total RNA was extracted, and PAH and GAPDH
mRNA levels were monitored by semiquantitative RT-PCR analysis. (B)
Examination of histone acetylation levels in TSA-treated hepatocytes
was monitored by Western blot analysis. Histones were isolated by
acid-soluble nuclear protein preparation and probed with antibodies
recognizing acetylated lysines.
|
|
Effect of DNA demethylation.
DNA methylation has been shown to
play a dominant role in determining the transcriptional status of
genes. In order to examine the influence of methylation on PAH
silencing, we attempted to induce partial demethylation with the
nucleotide analogue 5-AzaC. We were unable to do so with primary
hepatocytes, since they failed to survive 5-AzaC treatment. Therefore,
we delivered the drug directly to 2-week-old animals by intraperitoneal
injections. Two weeks of treatment with 5-AzaC partially restored
transcription of the endogenous PAH gene, because a weak signal could
be detected by semiquantitative RT-PCR analysis of the livers of
5-AzaC-treated HNF1
-deficient mice (Fig.
6A). The PAH reexpression level reached close to 5% of the PAH expression level observed in the livers of
wild-type mice (Fig. 6B). This partial effect of 5-AzaC injection on
PAH activation was correlated with the low DNA demethylation pattern
observed at the PAH locus using the methylation-sensitive endonuclease
HpaII (data not shown). Furthermore, we verified that under
our experimental conditions, treatment with 5-AzaC did not result in
the activation of a low level of spurious transcription. We failed to
activate the transcription of another HNF1
-regulated target gene,
the kidney-specific Na+/glucose cotransporter SGLT2
(35), in wild-type or HNF1
-deficient hepatocytes (data
not shown).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 6.
Injection of 5-AzaC into adult HNF1 -deficient mice
leads to PAH gene reactivation. (A) Two-week-old mice were injected
twice at an interval of 3 days intraperitoneally with 5-AzaC (25 µg/injection). Ten days after the second injection, animals were
sacrificed, and hepatic PAH and GAPDH mRNA abundance was monitored by
semiquantitative RT-PCR analysis. (B) Quantification of the PAH
reexpression level after 5-AzaC treatment, expressed as a ratio of the
corresponding GAPDH signal. (C) The combined effect of 5-AzaC injection
with AdhHNF1 infection and TSA treatment on PAH gene reactivation
was monitored. Primary hepatocytes isolated from HNF1 -deficient and
5-AzaC-treated mice incubated in the absence or the presence of 300 ng
of TSA per ml were infected with increasing amounts of AdhHNF1
(relative multiplicities of infection of 1, 5, and 10 PFU/cell). After
a 48-h incubation period, total RNA was extracted and semiquantitative
RT-PCR analysis was performed to monitor the expression level of PAH
and GAPDH mRNAs. The graph shows the quantification of PAH RT-PCR
products expressed as a ratio of the corresponding GAPDH signal. The
RT-PCR data presented are representative of data obtained with three
different animals.
|
|
Combined effects of DNA demethylation, histone-hyperacetylating
drugs, and AdhHNF1
infection.
It is known that DNA methylation
and histone deacetylation play key roles in the silencing of genes.
Therefore, we tested whether a combined demethylation and histone
deacetylation inhibition could further increase the expression of PAH
in HNF1
-deficient hepatocytes. Indeed, when hepatocytes from
5-AzaC-treated animals were put in culture and treated with TSA, we
observed a further threefold increase in the level of PAH mRNA (Fig.
6C, compare bars 1 and 5), demonstrating a certain interaction of both
silencing mechanisms. Finally, to test if expression of HNF1
could
further increase the transcription of the PAH gene after partial
reactivation by 5-AzaC treatment, we infected 5-AzaC-treated
hepatocytes with increasing amounts of AdhHNF1
. We could not detect
any substantial additional increase in the expression of the endogenous
reactivated PAH gene under these conditions (Fig. 6C, bars 2 to 4).
Moreover, HNF1
reexpression in cells treated with both 5-AzaC and
TSA did not result in any further increase in PAH mRNA levels (Fig. 6C, bars 6 to 8).
 |
DISCUSSION |
It has been previously shown that HNF1
-deficient mice fail to
transcribe the hepatic PAH gene (33), probably because the PAH gene in these mice is hypermethylated and is incorporated into an
inactive chromatin conformation (34). These observations indicated that HNF1
must play a crucial role in controlling the expression of this gene. However, the precise role played by HNF1
in
this context has not been elucidated so far. We show here that reexpression of HNF1
, per se, is sufficient to reactivate
transcription from the endogenous PAH locus in embryonic (e12.5 to
e13.5) HNF1
-deficient hepatocytes. In contrast, we failed to restore
PAH gene transcription in fetal (e17.5), newborn, and adult
HNF1
-deficient hepatocytes. This failure illustrates the importance
of a developmental competence window for reprogramming
hepatocyte-specific expression patterns. Our results suggest that the
presence of HNF1
during early liver development is necessary to
promote and maintain the formation of a transcriptionally competent PAH
locus. This can be achieved by different mechanisms: DNA demethylation
and/or chromatin remodeling.
Several liver-enriched transcription factors have been identified whose
presence is required for transcription of early hepatic differentiation
genes. These factors help impart the competence of hepatic genes to be
activated at later stages of development. For example, the
transcription factor HNF3 has been implicated in the marking of serum
albumin and
-fetoprotein gene enhancers during gut endoderm
specification. HNF3 mediates the remodeling of chromatin structure of
these genes and thereby promotes the transition between silent and
competent chromatin prior to the actual onset of transcription
(13). Similarly, transcription factor binding to the
-globin locus control region contributes to developmental and
cell-specific gene expression via localized alterations in chromatin
structures (29). In contrast, in the context of the
chicken lysozyme locus, it appears that most chromatin pattern
formations are set during cellular differentiation prior to the binding
of transcriptional activators (23). These studies indicate
that a specific chromatin pattern must be established to permit later
gene activation.
DNA methylation is closely associated with several biological processes
during vertebrate development. The cause-and-effect relationship
between DNA methylation status and transcriptional activity has long
been debated. It has now been established that gene expression is
strongly correlated with the methylation status of DNA
(39). In the present study, we show that partial DNA demethylation can restore a low level of PAH transcription, even in the
absence of HNF1
. The observation that 5-AzaC treatment of
HNF1
-deficient mice only poorly reactivates PAH gene transcription can be explained by the mechanism of action of this drug on DNA demethylation. When 5-AzaC is incorporated into DNA upon replication, the modified nucleotide covalently traps DNA methyltransferases (20). In this way, the enzyme is depleted and DNA is then
demethylated upon the subsequent rounds of replication. Under normal
physiological conditions, most mature hepatocytes are quiescent in the
liver. Therefore, the low proliferative index protects most of the
hepatocytes from the in vivo effects of 5-AzaC treatment. Stable gene
silencing is generally associated with DNA hypermethylation and highly
condensed chromatin. It has been suggested that methylated inactive
genes contain hypoacetylated histones, whereas unmethylated active
genes are preferentially associated with acetylated histones. The link between these two processes was recently established by experiments that showed that DNA methylation can cause transcriptional silencing through local deacetylation of histones (10, 32).
Methyl-CpG binding proteins, which bind specifically to methylated DNA,
recruit histone deacetylases, which in turn mediate local chromatin
remodeling and initiate gene inactivation (19, 30). Hence,
one would expect histone deacetylase inhibitors to circumvent the
repressive state. However, our results clearly show that TSA, a potent
histone deacetylase inhibitor, did not reactivate the PAH gene by
itself. This failure may be explained by the level of methylation
density (14).
DNA methylation analysis using the HpaII
methylation-sensitive endonuclease has revealed that the PAH promoter
is heavily methylated in HNF1
-deficient mice (34). It
is known that TSA does not act as a demethylating agent (1,
10), and persisting methylated CpGs could trigger the assembly
of repressor complexes insensitive to histone deacetylase inhibitors
(38). In agreement with this hypothesis, a recent study on
the dynamic nature of DNA methylation and associated transcriptional
repression has established that repression observed with low-density
methylation is mediated by histone deacetylase activity, whereas the
silencing mechanism which acts on densely methylated templates appears
to be histone deacetylase independent (26). Moreover, the
observation that combined treatment with 5-AzaC and TSA resulted in a
further increase in the level of reexpression of the silenced PAH gene suggests that partial demethylation is necessary to establish the
TSA-responsive state. This indicates that DNA demethylation could act
as a dominant process over histone acetylation in determining silencing
at the PAH locus. Our observations are consistent with the results of
Cameron et al. (3), who have recently shown that
reactivation of methylated endogenous tumor suppressor genes could be
achieved only by treatment with 5-AzaC followed by TSA.
It has been postulated that DNA methylation affects transcription
either by directly altering the interaction of transcription factors
with their binding sites, by altering chromatin structure, or by the
combination of both mechanisms (21). The absence of CpG
dinucleotides in the consensus binding site for HNF1
suggests that
direct methylation-induced alteration of DNA binding is unlikely to be
the primary mechanism by which PAH gene transcription is prevented even
upon HNF1
reexpression. Therefore, DNA methylation may maintain the
silent PAH gene by organizing or stabilizing chromatin into a
conformation that prevents the accessibility of transcriptional
activators to transcription control sequences. In this context, HNF1
may be essential at early stages of hepatic differentiation to maintain
the unmethylated status of PAH promoter-enhancer regions or promote DNA
demethylation. It has been suggested that the establishment and
maintenance of "stable" DNA methylation patterns in somatic cells
result from a dynamic equilibrium between opposing reactions that
promote or inhibit methylation spreading from foci of methylated CpG
sites to more distal unmethylated sites. It can be speculated that
methylation spreading would occur by decreasing the protective effect
conferred by the HNF1
binding sites, resulting in rapid methylation
of the PAH promoter. If the DNA binding by transcription factors plays
a role in blocking the spread of methylation once promoter methylation
has occurred during differentiation, it should not be easily
reversible. The end result of this process would be an epigenetic gene
inactivation secondary to DNA methylation and the formation of closed
chromatin structures.
A possible molecular link between DNA demethylation processes and
transcription factor DNA binding has been postulated recently. It is
possible that sequence-specific DNA binding factors might prevent
access of the maintenance DNA methyltransferase to these sites, leading
to the progressive demethylation of DNA in a locus-specific manner.
Such a role has been described for the transcription factor Sp1, which
enhances DNA demethylation and prevents de novo methylation of flanking
sequences of the adenine phosphoribosyltransferase gene
(27). Similarly, the transcription factor NF-
B has been implicated in a B-cell-specific demethylation process
(22). It has been reported that upon transcription factor
DNA binding, replication of the target DNA is a prerequisite for
efficient demethylation in Xenopus embryos (28)
and at the replication origin of Epstein-Barr virus (15).
Finally, it seems that the affinity of binding of transcription factors
to replicating DNA plays a determinant role in the formation of
specific DNA demethylation patterns, as was recently demonstrated in
the lac repressor-operator system (25). Once
HNF1
binds to the PAH promoter-enhancer regions during early liver
development, it could contribute to the maintenance of the unmethylated
status of the promoter-enhancer PAH gene. Thus, during embryogenesis,
the appearance of specific transcription factors and sustained genomic
replication could represent a parsimonious mechanism to allow massive
promoter-specific demethylation or maintenance of unmethylated
tissue-restricted gene status.
Many pathological conditions are associated with altered gene
expression patterns. Mutations in transcription factors have profound
effects on the onset of diseases. It is critical to determine the
molecular mechanisms that allow silent genes to be selectively reactivated, leading toward therapeutic approaches. The potential for
gene therapy using transcription factors is enormous and spans many
genetic diseases. Advances in prenatal diagnosis and gene transfer
technology have allowed consideration of prenatal gene therapy for
inborn diseases. A compelling argument can be made for this strategy in
treating childhood genetic diseases that are fatal in the prenatal
period. In other diseases, the fetal environment may offer unique
biological advantages that favor a prenatal gene therapy strategy over
treatment after birth. Early therapeutic gene applications may allow
targeting of still expanding stem cell populations of organs or cell
systems inaccessible later in adulthood. Nevertheless, effective
treatment of inborn disorders involving transcription factors is likely
to be very complex. As pointed out in this study, the design of
rational prenatal therapy cannot neglect the potential problem
concerning the competence window of specific transcription factors to
reprogram gene expression during development.
 |
ACKNOWLEDGMENTS |
B.V. was supported by a postdoctoral fellowship from the
Association pour la Recherche contre le Cancer (ARC).
We are grateful to T. Bordet, J. E. Guidotti, and A. Mignon for
advice on adenovirus production and preparation of mouse hepatocyte primary cultures. We thank D. Faust, M. C. Weiss, C. Cheret, A. Doyen,
L. Gresh, and P. Marianneau for fruitful discussions and advice. We
also thank J. Weitzman for critical reading of the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Unité des
Virus Oncogènes, CNRS URA 1644, Département des
Biotechnologies, Institut Pasteur, 25 rue du Dr. Roux, 75724 Paris
cedex 15, France. Phone: 33 (1) 45 68 85 12. Fax: 33 (1) 40 61 30 33. E-mail: yaniv{at}pasteur.fr or marcop{at}pasteur.fr.
Present address: Institute Cochin de Génétique
Moléculaire, INSERM Unité 129, CHU Cochin Porte
Royal, 75014 Paris, France.
 |
REFERENCES |
| 1.
|
Ammerpohl, A.,
A. Schmitz,
L. Steinmuller, and R. Renkawitz.
1998.
Repression of the mouse M-lysozyme gene involves both hindrance of enhancer factor binding to the methylated enhancer and histone deacetylation.
Nucleic Acids Res.
26:5256-5260[Abstract/Free Full Text].
|
| 2.
|
Berry, M. N., and D. S. Friend.
1969.
High-yield preparation of isolated rat liver parenchymal cells: a biochemical and fine structural study.
J. Cell Biol.
43:506-520[Abstract/Free Full Text].
|
| 3.
|
Cameron, E. E.,
K. E. Bachman,
S. Myöhanen,
J. G. Herman, and S. B. Baylin.
1999.
Synergy of demethylation and histone acetylase inhibition in the re-expression of genes silenced in cancer.
Nat. Genet.
21:103-107[CrossRef][Medline].
|
| 4.
|
Carpenter, S. P.,
J. M. Lasker, and J. L. Raucy.
1996.
Expression, induction, and catalytic activity of the ethanol-inducible cytochrome P450 (CYP2E1) in human fetal liver and hepatocytes.
Mol. Pharmacol.
49:260-268[Abstract].
|
| 5.
|
Cereghini, S.
1996.
Liver-enriched transcription factors and hepatocyte differentiation.
FASEB J.
10:267-282[Abstract].
|
| 6.
|
Chomczynski, P., and N. Sacchi.
1987.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:156-159[Medline].
|
| 7.
|
Chouard, T.,
O. Jeannequin,
J. Rey-Campos,
M. Yaniv, and F. Traincard.
1997.
A set of polyclonal and monoclonal antibodies reveals major differences in post-translational modification of the rat HNF1 and vHNF1 homeoproteins.
Biochimie
79:707-715[Medline].
|
| 8.
|
Clayton, D. F., and J. E. Darnell, Jr.
1983.
Changes in liver-specific compared to common gene transcription during primary culture of mouse hepatocytes.
Mol. Cell. Biol.
3:1552-1561[Abstract/Free Full Text].
|
| 9.
|
Crouzet, J.,
L. Naudin,
C. Orsini,
E. Vigne,
L. Ferrero,
A. Le Roux,
P. Benoit,
M. Latta,
C. Torrent,
D. Branellec,
P. Denèfle,
J. F. Mayaux,
M. Perricaudet, and P. Yeh.
1997.
Recombinational construction in Escherichia coli of infectious adenoviral genomes.
Proc. Natl. Acad. Sci. USA
94:1414-1419[Abstract/Free Full Text].
|
| 10.
|
Eden, S.,
T. Hashimshony,
I. Keshet,
H. Cedar, and A. W. Thorne.
1998.
DNA methylation models histone acetylation.
Nature
394:842[CrossRef][Medline].
|
| 11.
|
Faust, D. M.,
A.-M. Catherin,
S. Barbaux,
L. Belkadi,
T. Imaizumi-Scherrer, and M. C. Weiss.
1996.
The activity of the highly inducible mouse phenylalanine hydroxylase gene promoter is dependent upon a tissue-specific, hormone-inducible enhancer.
Mol. Cell. Biol.
16:3125-3137[Abstract].
|
| 12.
|
Fuks, F.,
W. A. Burgers,
A. Brehm,
L. Hughes-Davies, and T. Kouzarides.
2000.
DNA methyltransferase Dnmt1 associates with histone deacetylase activity.
Nat. Genet.
24:88-91[CrossRef][Medline].
|
| 13.
|
Gualdi, R.,
P. Bossard,
M. Zheng,
Y. Hamada,
J. R. Coleman, and K. S. Zaret.
1996.
Hepatic specification of the gut endoderm in vitro: cell signaling and transcriptional control.
Genes Dev.
10:1670-1682[Abstract/Free Full Text].
|
| 14.
|
Hsieh, C.-L.
1994.
Dependence of transcriptional repression on CpG methylation density.
Mol. Cell. Biol.
14:5487-5494[Abstract/Free Full Text].
|
| 15.
|
Hsieh, C.-L.
1999.
Evidence that protein binding specifies sites of DNA demethylation.
Mol. Cell. Biol.
19:46-56[Abstract/Free Full Text].
|
| 16.
|
Hu, J. F.,
P. H. Nguyen,
N. V. Pham,
T. H. Vu, and A. R. Hoffman.
1997.
Modulation of Igf2 genomic imprinting in mice induced by 5-azacytidine, an inhibitor of DNA methylation.
Mol. Endocrinol.
11:1891-1898[Abstract/Free Full Text].
|
| 17.
|
Isom, H. C.,
T. Secott,
I. Georgoff,
C. Woodworth, and J. Mummaw.
1985.
Maintenance of differentiated rat hepatocytes in primary culture.
Proc. Natl. Acad. Sci. USA
82:3252-3256[Abstract/Free Full Text].
|
| 18.
|
Isom, I.,
I. Georgoff,
M. Salditt-Georgieff, and J. E. Darnell.
1987.
Persistence of liver-specific messenger RNA in cultured hepatocytes: different regulatory events for different genes.
J. Cell Biol.
105:2877-2885[Abstract/Free Full Text].
|
| 19.
|
Jones, P. L.,
G. J. C. Veenstra,
P. A. Wade,
D. Vermaak,
S. U. Kass,
N. Landsberger,
J. Strouboulis, and A. P. Wolffe.
1998.
Methylated DNA and MeCP2 recruit histone deacetylase to repress transcription.
Nat. Genet.
19:187-191[CrossRef][Medline].
|
| 20.
|
Juttermann, R.,
E. Li, and R. Jaenisch.
1994.
Toxicity of 5-aza-2'-deoxycytidine to mammalian cells is mediated primarily by covalent trapping of DNA methyltransferase rather than DNA demethylation.
Proc. Natl. Acad. Sci. USA
91:11797-11801[Abstract/Free Full Text].
|
| 21.
|
Kass, S. U.,
D. Pruss, and A. P. Wolffe.
1997.
How does DNA methylation repress transcription?
Trends Genet.
13:444-449[CrossRef][Medline].
|
| 22.
|
Kirillov, A.,
B. Kistler,
R. Mostoslavsky,
H. Cedar,
T. Wirth, and Y. Bergman.
1996.
A role for nuclear NF- B in B-cell-specific demethylation of the IgK locus.
Nat. Genet.
13:435-441[CrossRef][Medline].
|
| 23.
|
Kontaraki, J.,
H. Chen,
A. Riggs, and C. Bonifer.
2000.
Chromatin fine structure profiles for a developmentally regulated gene: reorganization of the lysozyme locus before trans-activator binding and gene expression.
Genes Dev.
14:2106-2122[Abstract/Free Full Text].
|
| 24.
|
Kreamer, B. L.,
J. L. Staeker,
N. Sawada,
G. L. Sattler,
M. T. S. Hsia, and H. C. Pitot.
1986.
Use of low speed, iso-density percoll centrifugation method to increase the viability of isolated rat hepatocyte preparations.
In Vitro Cell. Dev. Biol.
22:201-211[Medline].
|
| 25.
|
Lin, I. G.,
T. J. Tomzynski,
Q. Ou, and C.-L. Hsieh.
2000.
Modulation of DNA binding protein affinity directly affects target site demethylation.
Mol. Cell. Biol.
20:2343-2349[Abstract/Free Full Text].
|
| 26.
|
Lorincz, M. C.,
D. Schübeler,
S. C. Goeke,
M. Walters,
M. Groudine, and D. I. K. Martin.
2000.
Dynamic analysis of proviral induction and de novo methylation: implications for a histone deacetylase-independent, methylation density-dependent mechanism of transcriptional repression.
Mol. Cell. Biol.
20:842-850[Abstract/Free Full Text].
|
| 27.
|
Macleod, D.,
J. Charlton,
J. Mullins, and A. P. Bird.
1994.
Sp1 sites in the mouse aprt gene promoter are required to prevent methylation of the CpG island.
Genes Dev.
8:2282-2292[Abstract/Free Full Text].
|
| 28.
|
Matsuo, K.,
J. Silke,
O. Georgiev,
P. Marti,
N. Giovannini, and D. Rungger.
1998.
An embryonic demethylation mechanism involving binding of transcription factors to replicating DNA.
EMBO J.
17:1446-1453[CrossRef][Medline].
|
| 29.
|
McMorrow, T.,
A. van Den Wijngaard,
A. Wollenschlaeger,
M. van De Corput,
K. Monkhorst,
T. Trimborn,
P. Fraser,
M. van Lohuizen,
T. Jenuwein,
M. Djabali,
S. Philipsen,
F. Grosveld, and E. Milot.
2000.
Activation of the beta globin locus by transcription factors and chromatin modifiers.
EMBO J.
19:4989-4996.
|
| 30.
|
Nan, X.,
H.-H. Ng,
C. A. Johnson,
C. D. Laherty,
B. M. Turner,
R. N. Eisenman, and A. Bird.
1998.
Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex.
Nature
393:386-389[CrossRef][Medline].
|
| 31.
|
Ng, H. H.,
Y. Zhang,
B. Hendrich,
C. A. Johnson,
B. M. Turner,
H. Erdjument-Bromage,
P. Tempst,
D. Reinberg, and A. Bird.
1999.
MBD2 is a transcriptional repressor belonging to the MeCP1 histone deacetylase complex.
Nat. Genet.
23:58-61[Medline].
|
| 32.
|
Pikaart, M. J.,
F. Recillas-Targa, and G. Felsenfeld.
1998.
Loss of transcriptional activity of a transgene is accompanied by DNA methylation and histone deacetylation and is prevented by insulators.
Genes Dev.
12:2852-2862[Abstract/Free Full Text].
|
| 33.
|
Pontoglio, M.,
J. Barra,
M. Hadchouel,
A. Doyen,
C. Kress,
J. Poggi Bach,
C. Babinet, and M. Yaniv.
1996.
Hepatocyte nuclear factor 1 inactivation results in hepatic dysfunction, phenylketonuria, and renal Fanconi syndrome.
Cell
84:575-585[CrossRef][Medline].
|
| 34.
|
Pontoglio, M.,
D. M. Faust,
A. Doyen,
M. Yaniv, and M. C. Weiss.
1997.
Hepatocyte nuclear factor 1 gene inactivation impairs chromatin remodeling and demethylation of the phenylalanine hydroxylase gene.
Mol. Cell. Biol.
17:4948-4956[Abstract].
|
| 35.
|
Pontoglio, M.,
D. Prie,
C. Cheret,
A. Doyen,
C. Leroy,
P. Froguel,
G. Velho,
M. Yaniv, and G. Friedlander.
2000.
HNF1 controls renal glucose reabsorption in mouse and man.
EMBO Rep.
1:359-365[CrossRef][Medline].
|
| 36.
|
Pontoglio, M.,
S. Sreenan,
M. Roe,
W. Pugh,
D. Ostrega,
A. Doyen,
A. J. Pick,
A. Baldwin,
G. Velho,
P. Froguel,
M. Levisetti,
S. Bonner-Weir,
G. I. Bell,
M. Yaniv, and K. S. Polonsky.
1998.
Defective insulin secretion in hepatocyte nuclear factor 1 alpha-deficient mice.
J. Clin. Investig.
101:2215-2222[Medline].
|
| 37.
|
Razin, A.
1998.
CpG methylation, chromatin structure and gene silencing a three-way connection.
EMBO J.
17:4905-4908[CrossRef][Medline].
|
| 38.
|
Schübeler, D.,
M. C. Lorincz,
D. M. Cimbora,
A. Telling,
Y.-Q. Feng,
E. E. Bouhassira, and M. Groudine.
2000.
Genomic targeting of methylated DNA: influence of methylation on transcription, replication, chromatin structure, and histone acetylation.
Mol. Cell. Biol.
20:9103-9112[Abstract/Free Full Text].
|
| 39.
|
Siegfried, Z.,
S. Eden,
M. Mendelsohn,
X. Feng,
B. Z. Tsuberi, and H. Cedar.
1999.
DNA methylation represses transcription in vivo.
Nat. Genet.
22:203-206[CrossRef][Medline].
|
| 40.
|
Wade, P. A.,
A. Gegonne,
P. L. Jones,
E. Ballestar,
F. Aubry, and A. P. Wolffe.
1999.
Mi-2 complex couples DNA methylation to chromatin remodelling and histone deacetylation.
Nat. Genet.
23:62-66[Medline].
|
Molecular and Cellular Biology, June 2001, p. 3662-3670, Vol. 21, No. 11
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.11.3662-3670.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Bosse, T., Fialkovich, J. J., Piaseckyj, C. M., Beuling, E., Broekman, H., Grand, R. J., Montgomery, R. K., Krasinski, S. D.
(2007). Gata4 and Hnf1{alpha} are partially required for the expression of specific intestinal genes during development. Am. J. Physiol. Gastrointest. Liver Physiol.
292: G1302-G1314
[Abstract]
[Full Text]
-
Luco, R. F., Maestro, M. A., del Pozo, N., Philbrick, W. M., de la Ossa, P. P., Ferrer, J.
(2006). A Conditional Model Reveals That Induction of Hepatocyte Nuclear Factor-1{alpha} in Hnf1{alpha}-Null Mutant {beta}-Cells Can Activate Silenced Genes Postnatally, Whereas Overexpression Is Deleterious.. Diabetes
55: 2202-2211
[Abstract]
[Full Text]
-
Bosse, T., van Wering, H. M., Gielen, M., Dowling, L. N., Fialkovich, J. J., Piaseckyj, C. M., Gonzalez, F. J., Akiyama, T. E., Montgomery, R. K., Grand, R. J., Krasinski, S. D.
(2006). Hepatocyte nuclear factor-1{alpha} is required for expression but dispensable for histone acetylation of the lactase-phlorizin hydrolase gene in vivo. Am. J. Physiol. Gastrointest. Liver Physiol.
290: G1016-G1024
[Abstract]
[Full Text]
-
Kwon, Y. H., Jovanovic, A., Serfas, M. S., Kiyokawa, H., Tyner, A. L.
(2002). p21 Functions to Maintain Quiescence of p27-deficient Hepatocytes. J. Biol. Chem.
277: 41417-41422
[Abstract]
[Full Text]
-
Pontoglio, M., Pausa, M., Doyen, A., Viollet, B., Yaniv, M., Tedesco, F.
(2001). Hepatocyte Nuclear Factor 1{alpha} Controls the Expression of Terminal Complement Genes. JEM
194: 1683-1690
[Abstract]
[Full Text]