MCB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Miled, C.
Right arrow Articles by Faye, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Miled, C.
Right arrow Articles by Faye, G.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, June 2001, p. 3714-3724, Vol. 21, No. 11
0270-7306/01/$04.00+0   DOI: 10.1128/MCB.21.11.3714-3724.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

Xbp1-Mediated Repression of CLB Gene Expression Contributes to the Modifications of Yeast Cell Morphology and Cell Cycle Seen during Nitrogen-Limited Growth

Chaouki Miled,1,2 Carl Mann,2,* and Gérard Faye1,*

Institut Curie d'Orsay, Centre Universitaire, F-91405 Orsay,1 and Service de Biochimie et de Génétique Moléculaire, CEA/Saclay, F-91191 Gif-sur-Yvette,2 France

Received 9 December 2000/Returned for modification 2 February 2001/Accepted 19 March 2001


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Yeast cells undergo morphological transformations in response to diverse environmental signals. One such event, called pseudohyphal differentiation, occurs when diploid yeast cells are partially starved for nitrogen on a solid agar medium. The nitrogen-starved cells elongate, and a small fraction form filaments that penetrate the agar surface. The molecular basis for the changes in cell morphology and cell cycle in response to nitrogen limitation are poorly defined, in part because the heterogeneous growth states of partially starved cells on agar media are not amenable to biochemical analysis. In this work, we used chemostat cultures to study the role of cell cycle regulators with respect to yeast differentiation in response to nitrogen limitation under controlled, homogeneous culture conditions. We found that Clb1, Clb2, and Clb5 cyclin levels are reduced in nitrogen-limited chemostat cultures compared to levels in rich-medium cultures, whereas the Xbp1 transcriptional repressor is highly induced under these conditions. Furthermore, the deletion of XBP1 prevents the drop in Clb2 levels and inhibits cellular elongation in nitrogen-limited chemostat cultures as well as inhibiting pseudohyphal growth on nitrogen-limited agar media. Deletion of the CLB2 gene restores an elongated morphology and filamentation to the xbp1Delta mutant in response to nitrogen limitation. Transcriptional activation of the XBP1 gene and the subsequent repression of CLB gene expression are thus key responses of yeast cells to nitrogen limitation.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Many yeast cells in the wild undergo morphological transitions in response to diverse environmental signals. Transitions between yeast and filamentous forms have been implicated in foraging for nutrients, in the avoidance of toxins, and in the infection of plants and animals by fungal pathogens (33, 38). Most laboratory strains of Saccharomyces cerevisiae respond poorly to such environmental stimuli, apparently because early yeast geneticists selected mutants that maintained stable yeast-form growth that were easier to cultivate in the laboratory (26). Recent work suggests that more feral yeast strains show morphological differentiation in response to a rich variety of signals. Diploid yeast cells undergo pseudohyphal differentiation in response to limited nitrogen starvation (16), in the presence of alcohols (9, 31), or in the presence of some types of sugars (14, 23, 46). Haploid yeast cells can show invasive growth on a nitrogen-rich agar medium in response to a depletion of fermentable carbon sources (8, 41). The best studied of these morphological transitions is that of diploid yeast cells subjected to a partial nitrogen starvation, in which case the starved cells elongate and are inhibited for entry into anaphase in mitosis (4, 22). On agar media containing limiting nitrogen, a fraction of the cells form pseudohyphal filaments that penetrate the agar surface.

Two major signal transduction pathways involving a mitogen-activated protein (MAP) kinase cascade and the cyclic AMP (cAMP)-dependent protein kinase pathway have been implicated in pseudohyphal differentiation (33, 37, 39). These pathways are thought to activate key transcription factors, Ste12-Tec1 (32) and Flo8 (26, 39, 42, 43), that control the expression of genes required for pseudohyphal differentiation. Both transcription factors contribute to the expression of FLO11, a gene encoding a cell surface protein implicated in the adhesion of cells that form pseudohyphal filaments (18, 23, 27, 28). Several other transcription factors, including Phd1 (15), Ash1 (5), and Sok2 (47), also regulate pseudohyphal growth and contribute to the expression of FLO11 (38). In addition, the related transcription factors Fkh1 and Fkh2 may repress some aspects of pseudohyphal growth by promoting the expression of a set of genes in S phase (the CLB2 cluster) that includes the mitotic cyclin gene CLB2 (19, 40, 48).

Cellular elongation is one of the most evident aspects of nitrogen-limited growth of yeast cells. This elongation is due to a prolonged period of polarized growth to the bud apex (24). Polarized bud growth is initiated at the Start of the cell cycle, when Cdc28 is activated by the G1 cyclins Cln1 and Cln2 (25), and inactivation of Cln1 and Cln2 inhibits pseudohyphal growth (29). Apical growth in yeast is blocked by the appearance of the Cdc28-Clb1,2 mitotic kinases (25), and it was suggested that an inhibition of this kinase activity explains the hyperpolarized growth and a delay at the metaphase-to-anaphase transition, seen in wild-type cells overexpressing the PHD1 gene when they were spread on the surface of synthetic low-ammonium dextrose (SLAD) agar plates (22). The mechanism of this inhibition has not yet been elucidated. In this work, we used chemostats to study the regulation of Cdc28-Clb kinases in wild-type cells during nitrogen-limited growth.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Yeast strains and low-ammonium agar media. The yeast strains used in this work are listed in Table 1. PCR-based deletion of coding sequences with the KANMX4 cassette was performed as previously described (30) for MATa and MATalpha haploid strains of the Sigma 1278b background. Homozygous diploid strains were then produced by mating. The civ1-4 (45) and cdc28-6 mutant genes were introduced into the Sigma 1278b background by cloning the mutant genes into the pRS306 (URA3) integrative vector and targeting the mutant genes to their corresponding chromosomal loci by digesting with a restriction enzyme that cuts once within the promoter region of the gene and transforming MATa ura3 and MATalpha ura3 haploid strains of the Sigma 1278b background. Ura+ transformants were then streaked on 5-fluoro-orotic acid (5-FOA) plates at 24°C in order to select for excision of the integrated plasmid (2). Ura- colonies growing on the 5-FOA plates were then replica plated on yeast extract-peptone-dextrose (YPD) plates at 37°C to screen for those excision events that retained the civ1-4 and cdc28-6 thermosensitive mutations. The resulting haploid strains were then mated to generate homozygous diploid strains. Homozygous diploid civ1-4 ste20Delta and civ1-4 ste12Delta strains were constructed by integrating one copy of pRS306-civ1-4 into CSY2067 and CSY2066, followed by selection for plasmid excision on 5-FOA plates and, finally, retransformation with pRS306-civ1-4 and a second round of plasmid excision at 24°C on 5-FOA plates. The doubly transformed strains were then replica plated at 37°C to test for the replacement of both copies of the wild-type gene by the civ1-4 mutation.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Yeast strainsa

SLAD agar medium was prepared as previously described (16). A low-ammonium glycerol medium (SLAYP) supported pseudohyphal growth of wild-type cells but not xbp1 mutants (see Fig. 6). SLAYP was composed of 1.7 g of yeast nitrogen base (YNB) without amino acids and without ammonium sulfate (Difco) per liter, 50 mM sodium phthalate (pH 5), 25 mg of ammonium sulfate per liter, 3% glycerol, and 2% agar.

Plasmids. A SacI-HindIII XBP1 fragment (-1995 bp 5' of the ATG start codon and 187 bp downstream from the TAA stop codon) was prepared by PCR and inserted into the corresponding sites of the pRS416 (CEN-URA3) vector. A SacI-HindIII fragment beginning with the ATG start codon of XBP1 and ending 187 bp downstream of the TAA stop codon was prepared by PCR and cloned into the corresponding sites of the pYES2 (2µm URA3-pGAL) vector in order to place XBP1 under the control of the GAL promoter in a multicopy vector. The CDC28-43244 gene was isolated from pSF19-CDC28-43244 (7) by partial digestion with XhoI and XbaI and inserted into the YEplac195 (2µm URA3) vector. The pFG(TyA)::lacZ-LEU2 reporter construct was a gift from Gerry Fink, the STE11-4 gene was a gift from George Sprague, and pGR103 (2µm URA3-PDE2) was a gift from Georges Renault and Michel Jacquet.

Chemostat cultures. Chemostat cultures were performed at 25°C in a simple, custom-made 1-liter glass vessel (see Fig. 3B) and using general conditions that were outlined previously (4). Fresh medium was delivered from the reservoir to the culture vessel with a peristaltic pump at a flow rate of 100 ml/h. For nitrogen limitation studies, cells were cultured in a filter-sterilized, synthetic, low-ammonium phthalate medium (SLAP) composed of 1.7 g of YNB per liter without ammonium sulfate and without amino acids (Difco), 50 mM sodium phthalate (pH 5.0), 100 mg of ammonium sulfate per liter, and 30 g of dextrose per liter. Sodium phthalate is a nonmetabolizable pH buffer. Cells grown in rich-medium chemostats were cultivated in SLAP containing 5 g of ammonium sulfate per liter. Cells grown in glucose-limited chemostats were cultivated in medium containing 6.7 g of YNB without amino acids (Difco) per liter, 50 mM sodium phthalate (pH 5), and 0.5% glucose. In order to ensure equilibrium conditions in the chemostat, cells were cultivated for 40 to 45 h before harvesting for biochemical analyses, although similar results were obtained when cells were cultivated for as little as 20 h.

Electrophoretic separation of nonphosphorylated Cdc28 from phospo-Thr-169 Cdc28. Conditions allowing the electrophoretic separation of Cdc28 phosphorylated on Thr-169 from unphosphorylated Cdc28 were adopted from those of Espinoza et al. (13). Cell extract (30 µg) was electrophoresed in thin (0.75-mm) 24-cm-long Laemmli 12.5% polyacrylamide gels (acryl-bis, 30:0.8 or 29:1) for at least 15 h at 15 mA and 200 V with constant amperage. Acrylamide and bis-acrylamide were from Sigma, and ammonium persulfate and TEMED (N,N,N',N'-tetramethylethylenediamine) were from Bio-Rad. After electrophoretic transfer to 0.22-mm nitrocellulose membranes, Cdc28 was detected with rabbit polyclonal antibodies or, in the case of Cdc28-hemagglutinin, with mouse 12CA5 antihemagglutinin ascites fluid as the primary antibody and alkaline phosphatase-coupled anti-rabbit or anti-mouse antibodies as the secondary antibody. Bands were then revealed with 5-bromo-4-chloro-3-indolyl-1-phosphate-nitroblue tetrazolium colorimetric reagents, leading to a purple precipitate directly on the transfer membrane. Colorimetric detection yields bands that are finer than those obtained by chemiluminescence, although the colorimetric detection is less sensitive. The Cdc28 signal can be increased by immunoprecipitating from larger quantities of yeast protein extract, although we did not need to do so for the Western blot shown in Fig. 4.

Quantitative RT-PCR. Quantitative reverse transcription PCR (RT-PCR) was performed as described by Godon et al. (17). cDNAs were synthesized from 1 µg of total RNA using primers specific for each mRNA. PCR amplification with [32P]dCTP was performed for 15 cycles for ACT1 mRNA and 25 cycles for the remaining mRNAs using the following primers: CLB1 (CCAGTCTAGGACGTTAGCGAAGTT and AGTAATTGGCAAACGGGATA), CLB2 (CAGTCTCGAACTCTTGCCAAATTC and AGCCCATTGGACGGAAATTATAGA), CLB3 (GAACGGCTTAGAATTTGAATTG and TAATGCTATCCACTTCGCTACGAT), CLB5 (CATCGCACAACTATTTACTCGACA and ACATTGCCATTGCGCTTACGGTAG), XBP1 (AGAGGTGACAGCGTTTCCACTAGC and GTAAGACTGGCAAATAAGGTCCC), and ACT1 (TTGGATTCCGGTGATGGTGTTACT and TGAAGAAGATTGAGCAGCGGTTTG). 32P-labeled PCR products were then separated by polyacrylamide gel electrophoresis and quantified with a PhosphorImager (Molecular Dynamics).

Microscopy and flow cytometry. Cells were visualized with a Zeiss Axiophot microscope fitted with a charge-coupled device camera for image acquisition. Cells were prepared for flow cytometry as previously described (36) and analyzed on a Becton Dickinson FACSCalibur.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Cak1 mutants show derepressed pseudohyphal growth. The molecular basis for yeast cell elongation and the inhibition of mitosis during pseudohyphal growth on nitrogen-limited media is unknown (22). We noticed that strains expressing mutations of the yeast Cdk-activating kinase (cak1/civ1) such as civ1-4 (45) show a derepressed pseudohyphal growth at the permissive temperature of 25°C similar to that seen with a clb2Delta mutant or with certain cdc28 mutants (Fig. 1) (1, 10). This result indicates that partial inhibition of CAK activity can stimulate pseudohyphal growth. Several regulatory pathways are required for pseudohyphal differentiation in the wild-type strain (33). These include a MAP kinase and a cAMP kinase pathway (37, 39, 43) and a transcription factor called Ash1 (5). Inactivation of the MAP kinase pathway with ste20 or ste12 mutants or inactivation of the cAMP pathway with a gpa2 mutant or through the overexpression of the cAMP phosphodiesterase Pde2, or deletion of the ASH1 gene, all eliminated or severely inhibited pseudohyphal growth in the civ1-4 mutant (Fig. 2). The derepressed pseudohyphal growth of the civ1-4 mutant thus depends on the normal regulatory pathways that are required for pseudohyphal growth in the wild-type strain.


View larger version (81K):
[in this window]
[in a new window]
 
FIG. 1.   Partial inactivation of Cak1 stimulates pseudohyphal growth, whereas expression of a Cak1-independent form of Cdc28 represses pseudohyphal growth. Wild-type (CSY2123), civ1-4 (CSY2003), cdc28-6 (CSY2126), and clb2Delta (CSY2127) strains containing the YEplac195 vector and wild-type and civ1-4 strains containing YEplac195-CDC28-43244, encoding a Cak1-independent form of Cdc28, were cultivated on SLAD plates for 20 h or 3 days at 25°C. The colonies at 20 h are shown at a higher magnification than the colonies photographed after 3 days of growth.


View larger version (55K):
[in this window]
[in a new window]
 
FIG. 2.   The derepressed pseudohyphal growth of civ1-4 (CSY2003) mutants requires the function of the STE MAP kinase pathway, the cAMP pathway, and the Ash1 transcription factor, as for the pseudohyphal growth of wild-type cells. Cells with the 2µm PDE2 construct overexpress the PDE2 gene on a multicopy plasmid. Colonies are shown after 3 days of growth on SLAD plates at 25°C. Colonies are shown at the same magnification.

Cak1 phosphorylates Cdc28 on Thr-169 (12, 20, 45). This phosphorylation is required for Cdc28 kinase activity. Partial inactivation of Cak1 leads to reduced activating phosphorylation of Cdc28 and a decrease in Cdc28 protein kinase activity. Cross and Levine isolated multiply mutated forms of Cdc28 that no longer require Cak1 phosphorylation for its activity (6, 7). One such mutant, Cdc28-43244, was introduced into the wild type and the civ1-4 mutant on a multicopy plasmid in order to test its effect on pseudohyphal growth. Strikingly, Cdc28-43244 strongly inhibited pseudohyphal growth of both the wild type and the civ1-4 mutant on a low-nitrogen (SLAD) agar medium (Fig. 1). This result suggested that dephosphorylation of Cdc28 might be required for pseudohyphal growth.

Chemostat cultures provide homogeneous nitrogen-limited growth for biochemical investigations. Cells grown on nitrogen-limited agar media are in heterogeneous physiological states; although most cells are elongated relative to cells grown in rich media, only a small percentage of cells form pseudohyphal filaments that penetrate the agar surface (Fig. 1). Furthermore, cells that are at the interior of colonies will be more starved than cells that are at the edge of the colonies or that are in filaments projecting from the colonies. We examined the DNA content of wild-type diploid yeast cells growing on nitrogen-limited SLAD agar medium (Fig. 3A). Approximately 1,000 cells were spread on the surfaces of SLAD plates and incubated for 19, 36, or 72 h at 25°C. Cells were then scraped from the surface, and their DNA content was analyzed by flow cytometry. Cells grown for 19 h on SLAD plates were mainly budded with a 4N DNA content, but by 36 h of culture most cells accumulated in the unbudded state with a 2N DNA content. Infrequent filament formation became visible on these plates after about 2 days of culture. The accumulation of unbudded 2N cells after 36 h of growth on the SLAD plates can be accounted for by the nitrogen starvation experienced by most of the cells. The cycling cells that generate the pseudohyphal filaments represent only a small percentage of the total number of cells on the SLAD plates.


View larger version (35K):
[in this window]
[in a new window]
 
FIG. 3.   (A) The vast majority of wild-type cells accumulate with a G1-phase 2N DNA content after 36 h of growth on SLAD plates. (B) Schematic diagram of the chemostat used in this work. (C) Morphology of cells grown in chemostats. Wild-type diploid cells (CSY2123) in nitrogen-limited chemostats (-N) are elongated compared to those in rich medium. Wild-type haploid (CSY1000) cells do not elongate in response to the nitrogen limitation, and cellular elongation is blocked in diploid cells by the expression of Cdc28-43244, a Cak1-independent form of Cdc28. (D) Transcription of the Ste12-Tec1 Ty1-lacZ reporter construct [pFG(TyA)::lacZ-LEU2] is highly induced in wild-type (wt) cells grown in nitrogen-limited chemostats compared to that in rich medium. Ty1-lacZ transcription is also induced at lower levels in civ1-4 (CSY2003), cdc28-6 (CSY2126), and clb2Delta (CSY2127) mutants grown in a rich medium at 25°C. (E) Wild-type diploid cells (CSY2123) grown in nitrogen-limited chemostats contain more cells with a 2N DNA content (G1 phase) than do the same cells grown in a rich medium. (F) Wild-type diploid cells (CSY2123) grown in nitrogen-limited chemostats contain a higher proportion of pre-anaphase to post-anaphase mitotic cells than do the same cells grown in a rich-medium chemostat.

In order to overcome the problems inherent in the analysis of heterogeneous cell populations on agar media, we chose to examine chemostat cultures (Fig. 3B) as a source of nitrogen-limited cells (4). Cells growing in liquid chemostat cultures are in a homogeneous environment in which the degree of nitrogen starvation is precisely controlled, and it is easy to prepare large quantities of biomass for biochemical characterization. As observed for cells grown on nitrogen-limited agar media, yeast cells grown in nitrogen-limited chemostat cultures are elongated compared to cells grown in rich media (Fig. 3C). Extended filaments of cells were not found in the chemostats, but occasional clusters of three or four cells were observed. Cell elongation and pseudohyphal filamentation on nitrogen-limited SLAD plates requires the diploid cell state (16), and we found that haploid cells were not highly elongated during growth in nitrogen-limited chemostats (Fig. 3C). Expression of the Cak1-independent Cdc28-43244 mutant prevented cellular elongation of wild-type diploid cells in nitrogen-limited chemostats (Fig. 3C), as it did for cells on the surfaces of SLAD plates (Fig. 1 and data not shown). Finally, expression of a Ty1-lacZ reporter construct by the Ste12-Tec1 transcription factor is increased during pseudohyphal growth (32), and we found that there was a strong 12-fold induction of Ty1-lacZ expression for cells grown in nitrogen-limited chemostat cultures compared to rich media (Fig. 3D). These results show that nitrogen-limited growth in a chemostat shares many characteristics of nitrogen-limited growth on agar media.

Flow cytometry and microscopic analysis showed that diploid cells grown in nitrogen-limited chemostats had an increased proportion of unbudded cells with a 2N DNA content compared to cells grown in rich media (Fig. 3E and F). This G1-phase accumulation may reflect an inhibition of cell growth and the passage of Start due to the partial nitrogen starvation. We also compared the fraction of budded cells containing a single nucleus (pre-anaphase cells) versus those containing two nuclei (post-anaphase cells). Cells grown in nitrogen-limited chemostats had an increased proportion of pre-anaphase cells compared to those grown in rich media (Fig. 3F). This result suggests that cells in nitrogen-limited chemostats are delayed at the metaphase-to-anaphase transition after having accumulated sufficient mass to pass Start and enter a new cell cycle.

Cdc28 is not dephosphorylated during nitrogen-limited growth in chemostats or on agar plates, but mitotic cyclin levels are reduced. Genetic results suggest that inhibition of Cdc28-cyclin B activity is responsible for the cell elongation and the pre-anaphase delay observed in cells growing in nitrogen-limited conditions (21, 22). Given our genetic results suggesting that partial dephosphorylation of Cdc28 might be required for filamentous growth, we examined whether phosphorylation of Cdc28 is altered during nitrogen-limited growth of wild-type cells. Under appropriate electrophoretic conditions, Cdc28 phosphorylated by Cak1 on Thr-169 migrates slightly faster than unmodified Cdc28 (13). Cdc28 was mainly phosphorylated on Thr-169 in wild-type cells growing in rich media, whereas it was mainly dephosphorylated in the civ1-4 mutant at the permissive temperature of 24°C and totally dephosphorylated in this mutant at the restrictive temperature of 37°C (Fig. 4A). We then examined the level of Cdc28 phosphorylation in cells growing at equilibrium in chemostats under nitrogen-limited or glucose-limited growth conditions, in cells on the surfaces of SLAD plates, and in cells in stationary phase in rich medium (YPD) batch cultures. A slight dephosphorylation of Cdc28 was observed in glucose-limited chemostat cultures, but Cdc28 was mainly in the Thr-169-phosphorylated form in cells grown in nitrogen-limited chemostats or on the surfaces of nitrogen-limited SLAD plates after 2 days of growth or in stationary-phase cells in batch cultures (Fig. 4A). Thus, growth in nitrogen-limited media and growth to stationary phase in rich media do not induce dephosphorylation of Cdc28 on Thr-169.


View larger version (18K):
[in this window]
[in a new window]
 
FIG. 4.   (A) Cdc28 is mainly phosphorylated on Thr-169 in cells grown under nitrogen limitation. Thr-169-phosphorylated and nonphosphorylated forms of Cdc28 were electrophoretically separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Protein extracts were prepared from the following strains: the wild type (CSY2123) in rich medium at 25°C (lane 1), the civ1-4 mutant (CSY2003) in rich medium at the restrictive temperature of 37°C (lane 2), the wild type in a nitrogen-limited chemostat at 25°C (lane 3), the civ1-4 mutant (CSY2003) in rich medium at 25°C (lane 4), the wild type (CSY2123) scraped from the surface of nitrogen-limited SLAD plates after 2 days of incubation at 25°C (lane 5), the wild type (CSY2123) grown in a glucose-limited chemostat at 25°C (lane 6), and the wild type (CSY2123) in stationary phase in YPD (lane 7). (B) Clb2 protein levels are significantly reduced in wild-type diploid cells (CSY2123), but not in STE11-4 diploid cells (CSY2128), grown in nitrogen-limited chemostats. Clb2 and hexokinase protein levels in whole-cell protein extracts were determined by immunoblotting for the following strains: the wild-type diploid (CSY2123) grown in a nitrogen-limited chemostat (lane 1), the wild-type diploid (CSY2123) grown in a rich medium (lane 2), a clb2Delta strain (CSY2127) grown in a rich medium (lane 3), a STE11-4 diploid (CSY2128) grown in a nitrogen-limited chemostat (lane 4), and a STE11-4 diploid (CSY2128) grown in a rich medium (lane 5). (C) The wild-type haploid strain (CSY1000) grown in a nitrogen-limited chemostat (lane 2) does not have reduced levels of Clb2p compared to the same strain grown in a rich medium (lane 1). Lane 3 contains a protein extract from a clb2Delta mutant (CSY2127) grown in a rich medium. (D) A homozygous diploid xbp1Delta mutant (CSY2124) has no less Clb2p when grown in a nitrogen-limited chemostat (lane 2) than when grown in a rich medium (lane 1).

Since activating phosphorylation of Cdc28 was not reduced during nitrogen limitation, we decided to examine the levels of Clb2 protein in wild-type diploid cells grown in nitrogen-limited chemostats and rich media. Clb2 protein levels were greatly reduced in extracts from diploid cells growing in nitrogen-limited chemostats, as determined by immunoblotting with anti-Clb2 antibodies (Fig. 4B). In striking contrast, Clb2 protein levels were not decreased in wild-type haploid cells growing in nitrogen-limited chemostats (Fig. 4C) or in diploid wild-type cells growing in glucose-limited chemostats (data not shown). These results show that the decrease in Clb2 levels is a diploid-specific developmental response to the partial nitrogen starvation and does not represent a nonspecific starvation response.

It was previously reported that Clb2 levels are not diminished in STE11-4 mutant cells grown in a rich medium compared to levels in wild-type cells (1). Ste11-4 is a constitutively active form of the MEK kinase that is thought to be turned on during pseudohyphal growth (41, 44). STE11-4 cells show a pseudohyphal phenotype even when they are grown in rich media, and these cells have been proposed as a model for studying filamentous growth in wild-type cells (1). We examined Clb2 levels in a STE11-4 mutant grown under nitrogen limitation in a chemostat. In striking contrast to the wild-type diploid cells, the STE11-4 mutant did not show reduced levels of Clb2 during nitrogen-limited growth (Fig. 4B). The STE11-4 mutation thus prevents a reduction of Clb2 levels that is observed in the wild-type diploid strain during continuous nitrogen-limited growth in a chemostat. We thus feel that the STE11-4 mutant does not accurately reflect the response of wild-type diploid cells to nitrogen limitation, although it may be a valid model for other types of filamentous growth (8, 9, 23, 31, 46).

Modification of gene expression during nitrogen-limited growth in chemostats. We used quantitative RT-PCR to determine whether the drop in Clb2 protein levels during nitrogen-limited growth was correlated with a drop in CLB2 mRNA levels, and to monitor the transcriptional response of a series of cyclin genes (Fig. 5). ACT1 mRNA levels were unchanged in nitrogen-limited and rich-medium cultures, and they were thus used as a normalization standard. CLB1, CLB2, and CLB5 mRNA levels were reduced five- to sevenfold in wild-type cells grown in nitrogen-limited chemostats compared to rich-medium chemostats, whereas CLB3 levels were unchanged. We also examined the mRNA levels for the CLN1, CLN2, and CLN3 G1 cyclin genes. The CLN1 and CLN2 mRNA levels showed a modest decline during growth in nitrogen-limited chemostats, whereas the CLN3 mRNA was slightly increased (Fig. 5).


View larger version (41K):
[in this window]
[in a new window]
 
FIG. 5.   Quantitative RT-PCR of CLB, CLN, XBP1, and ACT1 mRNA levels in wild-type (wt) diploid cells (CSY2123) grown in rich-medium and nitrogen-limited chemostats. CLB1, CLB2, and CLB5 mRNA levels are decreased, CLB3 and ACT1 mRNA levels are constant, CLN1 and CLN2 mRNA levels are slightly decreased, CLN3 mRNA levels are slightly increased, and XBP1 mRNA levels are increased eightfold in nitrogen-limited chemostats compared to rich-medium chemostats. The decrease in CLB2 mRNA levels is blocked in a homozygous diploid xbp1 mutant (CSY2124) grown in a nitrogen-limited chemostat.

XBP1 codes for a repressor of CLN1 and CLB2 expression during sporulation, and XBP1 expression is induced by diverse stresses (34, 35). We found that XBP1 mRNA levels were increased eightfold in nitrogen-limited chemostats compared to rich-medium chemostats. Xbp1 is required for some of the transcriptional modifications observed during nitrogen-limited growth in chemostats, since the decreases in CLB2 mRNA (Fig. 5) and Clb2 protein (Fig. 4D) were abolished in an xbp1Delta mutant grown in a nitrogen-limited chemostat. The absence of significant CLN1 repression in the presence of eightfold-elevated XBP1 mRNA is not exceptional; a similar result was reported for cells treated with diamide (35). Reduced CLB1,2 expression will limit Cdc28-Clb1,2 kinase activity, which in turn could explain the elongated cell morphology of cells grown in nitrogen-limited media. Furthermore, we found that Ty1-lacZ activity was increased threefold in clb2Delta , civ1-4, and cdc28-6 mutants grown in rich medium compared to the wild-type strain (Fig. 3D). This stimulation of the expression of a Ste12-Tec1 reporter gene correlates well with the enhanced pseudohyphal growth shown by these mutants (Fig. 1) and suggests that Cdc28-Clb2 can inhibit the Ste12-Tec1 transcriptional activation complex.

XBP1 is required for pseudohyphal growth. We made an xbp1Delta homozygous diploid strain and found that it was inhibited for pseudohyphal filament formation on low-ammonium dextrose (SLAD) and glycerol (SLAYP) agar media (Fig. 6C through F). Moreover, individual xbp1Delta cells did not show the characteristic elongated cell shape exhibited by wild-type diploid cells on nitrogen-limited media (Fig. 6A through D). Finally, overexpression of XBP1 from the GAL promoter stimulated pseudohyphal growth (Fig. 6G and H). Thus, XBP1 is required for normal pseudohyphal differentiation. We next deleted the CLB2 gene in an xbp1Delta mutant in order to test the importance of CLB2 as a target of Xbp1-mediated repression during nitrogen-limited growth. Deletion of CLB2 largely restored elongated cell growth and filamentation to an xbp1Delta mutant on a nitrogen-limited SLAD agar medium (Fig. 6I, compare with Fig. 6C and J). clb2Delta was thus largely epistatic to xbp1Delta . These results suggest that CLB2 is an important repression target of Xbp1 during nitrogen-limited growth.


View larger version (104K):
[in this window]
[in a new window]
 
FIG. 6.   Homozygous diploid xbp1 mutant cells (CSY2124) are inhibited for cellular elongation in nitrogen-limited chemostats (A and B) or after 20 h of growth on SLAD plates (C and D). Deletion of XBP1 completely blocks filament formation of the wild-type strain (CSY2123) on SLAYP plates, even after 5 days of growth at 30°C (E and F). Overexpression of XBP1 from the GAL promoter stimulates filamentation on plates containing synthetic low-ammonium medium with 2% galactose compared to the same strain expressing XBP1 from its normal promoter on a centromeric plasmid (G and H). Cells in panels A and B are shown at a higher magnification than cells in panels C through H. (I through P) Colonies of cells of the indicated genotypes after growth for 3 days (I, J, M, N, O, and P) or 7 days (K and L) on SLAD plates at 30°C.

We also attempted to place XBP1 action with regard to the MAP kinase pathway regulating pseudohyphal growth by genetic epistasis experiments. Constitutive activation of the MAP kinase pathway through the expression of STE11-4 restored filamentous growth to the xbp1Delta mutant on nitrogen-limited SLAD plates (Fig. 6K and L). In contrast, XBP1 overexpression from the GAL promoter did not suppress the filamentation defect of ste12Delta and tec1Delta mutants (Fig. 6M through P). These results show that constitutive activation of the MAP kinase cascade by the STE11-4 mutation can bypass the requirement for Xbp1 in pseudohyphal growth, but overexpression of XBP1 cannot bypass the requirement for the Ste12 and Tec1 transcription factors. These results thus place XBP1 function upstream of or in parallel to the MAP kinase cascade and Ste12-Tec1 transcription factor function.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Xbp1-mediated repression of CLB2 expression can explain the elongated phenotype of wild-type yeast cells under nitrogen-limited growth conditions. Cellular elongation is one of the most evident phenotypes associated with the growth of wild-type diploid yeast cells in nitrogen-limited media (4, 16, 21, 22). This phenotype can be explained by a delayed or inefficient repression of polarized growth to the bud tip by Cdc28-Clb1,2 protein kinases (24, 25). There are four known mechanisms that could potentially account for Cdc28-Clb1,2 protein kinase inhibition: Swe1 inhibitory phosphorylation of Cdc28 Tyr-19 (3), inhibition of Cdk-Clb1,2 activity by a Cdk inhibitor such as Sic1 (1), a decrease in Clb1,2 protein levels, and a decrease in Cak1 activating phosphorylation of Cdc28. Although Swe1 inhibition of Cdc28 may contribute to filamentous growth in certain circumstances (10), it is not required for cellular elongation during nitrogen-limited growth (1, 22), and no clear evidence has yet been found for the role of a Cdk inhibitor in filamentous growth. In contrast, overexpression of CLB2 (1, 10, 22) and expression of a Cak1-independent form of Cdc28 (this paper) both block cellular elongation and pseudohyphal growth in response to a nitrogen starvation. Moreover, deletion of CLB2 or partial inactivation of Cak1 stimulates cellular elongation and pseudohyphal growth. Thus, the genetic analyses suggest that reduced Clb2 levels or reduced activating phosphorylation of Cdc28 could be responsible for inhibition of Cdc28-Clb2 kinase activity during nitrogen-limited growth. Unfortunately, the genetic analyses do not indicate which of these pathways are actually used by wild-type diploid yeast cells during pseudohyphal growth. Thus, direct biochemical analysis of wild-type cells during pseudohyphal growth is required to determine which regulatory pathways are really employed during this growth state. However, the heterogeneous physiological states of wild-type cells undergoing pseudohyphal differentiation on nitrogen-limited agar media are an obstacle to their biochemical analysis. Filament formation is observed for only a small fraction of wild-type cells growing on nitrogen-limited agar media. Furthermore, cells within colonies are likely to be highly starved for nitrogen, whereas cells on the outer edges of colonies and in penetrating filaments will experience different degrees of starvation. It is thus impossible to prepare physiologically homogeneous populations of wild-type cells from nitrogen-limited agar plates on which pseudohyphal growth is typically studied. We therefore used chemostat cultures to determine whether either of these two regulatory pathways could be implicated in cellular elongation during nitrogen-limited growth of wild-type diploid yeast cells. Chemostats provide a simple means of preparing large quantities of homogeneous cultures in which cells are grown under continuous, precisely defined conditions of nutrient limitation for biochemical analysis. It was previously shown that wild-type diploid cells are elongated when they are grown in nitrogen-limited, but not glucose-limited, chemostats (4). We show here that as for growth on nitrogen-limited agar media, this elongation response is specific for diploid cells (Fig. 3), is partially dependent on Ste20 and Ste12 (data not shown), and is accompanied by the transcriptional induction of a Ste12-Tec1 reporter construct (Fig. 3). On the other hand, we saw little or no indication of filament formation in our nitrogen-limited chemostats, and we observed low levels of expression of FLO11 (data not shown), which encodes a cell surface adhesion protein implicated in filament formation on agar plates (23, 27, 39, 43). The weak FLO11 expression in our nitrogen-limited glucose-rich chemostats may be due to glucose repression of FLO11 transcription (14). We observed frequent chains of cells and increased expression of FLO11 in nitrogen-limited chemostat cultures containing 3% galactose instead of 3% glucose, although the individual cells in the chains were less elongated then when cells were cultivated in glucose (data not shown). Altogether, these results suggest that our nitrogen-limited chemostat cultures reproduce many, but not all, aspects of nitrogen-limited pseudohyphal growth on solid agar media.

We found no evidence for a decrease in the level of Cdc28-activating phosphorylation during nitrogen-limited growth (Fig. 4) despite strong genetic data suggesting that a decrease in activating phosphorylation was required for pseudohyphal growth. How can this apparent contradiction be resolved? It is possible that partial inactivation of Cak1 mimics an event, such as inhibition of Cdc28-Clb1,2 activity, that normally occurs by a distinct mechanism in wild-type cells during nitrogen-limited growth, and it remains possible that Cdc28-activating phosphorylation is regulated during other conditions that lead to filamentous growth (8, 9, 23, 31, 46). However, it is less clear how the Cak1-independent Cdc28-43244 mutant is so effective in blocking pseudohyphal growth (Fig. 1) and cellular elongation (Fig. 3C) in response to nitrogen starvation. Possibly, this inhibition may be related to the weak kinase activity associated with Cdc28-43244-Cln2 in vitro (7). The Cln1 and Cln2 G1 cyclins are required for pseudohyphal growth (29), so the weak in vitro kinase activity of Cdc28-43244-Cln2 could mean that this mutant, although active in the absence of Cak1, may not sustain sufficient G1 cyclin kinase activity in vivo to support pseudohyphal growth.

Although we did not observe decreased activating phosphorylation of Cdc28, we did observe significant decreases in CLB1, CLB2, and CLB5 gene expression during nitrogen-limited growth. Xbp1 is synthesized in response to diverse types of stress and it is required for repression of CLN1 and CLB2 transcription during sporulation (34, 35). We showed that XBP1 is highly expressed during growth of wild-type yeast cells in nitrogen-limited chemostats (Fig. 5). Deletion of XBP1 prevents the fall in Clb2 levels normally observed in wild-type cells grown under nitrogen limitation, as well as inhibiting cellular elongation in nitrogen-limited chemostats and cellular elongation and pseudohyphal filament formation on nitrogen-limited agar media (Fig. 6). CLB2 overexpression also inhibits cellular elongation and filament formation (1, 10). Furthermore, CLB2 deletion restored cellular elongation and pseudohyphal growth to an xbp1Delta mutant (Fig. 6). These combined results strongly suggest that transcriptional induction of the XBP1 gene and subsequent repression of CLB2 gene expression is a key response to nitrogen limitation leading to modifications of the yeast cell cycle and cell morphology. Further work is necessary to determine the functional significance of the CLB5 transcriptional repression, to specify the mechanism of action of Xbp1 with regard to CLB gene repression, and to order the action of Xbp1 and Clb1,2 with regard to the different signal transduction pathways implicated in pseudohyphal growth. Finally, many genes involved in filamentation in S. cerevisiae have apparent orthologs in Candida albicans that have been implicated in morphogenetic pathways contributing to the virulence of this pathogenic yeast (11). A sequence coding for a protein with low but significant similarity to Xbp1 is found in the C. albicans genome (http://www-sequence.stanford.edu/group/candida), and it will be interesting to determine whether it also contributes to morphogenesis and virulence in Candida.


    ACKNOWLEDGMENTS

We thank Gerry Fink, George Sprague, Georges Renault, Michel Jacquet, and Anne Dranginis for the gifts of strains and plasmids and Jean-Marie Buhler for advice on quantitative PCR. We are grateful to David Morgan, Sue Jasperson, and Herman Espinoza for teaching C. Miled how to electrophoretically separate phospho-Thr-169 Cdc28 from the nonphosphorylated form. We thank Samia BenHassine for assistance and we are grateful to Céline Facca for technical help with the experiments involving XBP1.

The doctoral work of C. Miled was financed with funds provided by Hoechst-Marion-Roussel (currently Aventis), the Association pour la Recherche sur le Cancer (ARC), and the Fondation pour la Recherche Médicale (FRM).


    FOOTNOTES

* Corresponding author. Mailing address for Carl Mann: SBGM-Bât. 142, CEA/Saclay, F-91191 Gif-sur-Yvette Cedex, France. Phone: 33-1 69 08 34 32. Fax: 33-1 69 08 47 12. E-mail: mann{at}jonas.saclay.cea.fr. Mailing address for Gérard Faye: Institut Curie d'Orsay, Centre Universitaire-Bât. 110, F-91405 Orsay, France. Phone: 33-1 69 86 30 29. Fax: 33-1 69 86 94 29. E-mail: faye{at}curie.u-psud.fr.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Ahn, S. H., A. Acurio, and S. J. Kron. 1999. Regulation of G2/M progression by the STE mitogen-activated protein kinase pathway in budding yeast filamentous growth. Mol. Biol. Cell 10:3301-3316[Abstract/Free Full Text].
2. Boeke, J. D., F. LaCroute, and G. R. Fink. 1984. A positive selection for mutants lacking orotidine-5'-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance. Mol. Gen. Genet. 197:345-346[CrossRef][Medline].
3. Booher, R. N., R. J. Deshaies, and M. W. Kirschner. 1993. Properties of Saccharomyces cerevisiae wee1 and its differential regulation of p34CDC28 in response to G1 and G2 cyclins. EMBO J. 12:3417-3426[Medline].
4. Brown, C. M., and J. S. Hough. 1965. Elongation of yeast cells in continuous culture. Nature 206:676-678[CrossRef][Medline].
5. Chandarlapaty, S., and B. Errede. 1998. Ash1, a daughter cell-specific protein, is required for pseudohyphal growth of Saccharomyces cerevisiae. Mol. Cell. Biol. 18:2884-2891[Abstract/Free Full Text].
6. Cross, F. R., and K. Levine. 2000. Genetic analysis of the relationship between activation loop phosphorylation and cyclin binding in the activation of the Saccharomyces cerevisiae Cdc28p cyclin-dependent kinase. Genetics 154:1549-1559[Abstract/Free Full Text].
7. Cross, F. R., and K. Levine. 1998. Molecular evolution allows bypass of the requirement for activation loop phosphorylation of the Cdc28 cyclin-dependent kinase. Mol. Cell. Biol. 18:2923-2931[Abstract/Free Full Text].
8. Cullen, P. J., and G. F. Sprague, Jr. 2000. Glucose depletion causes haploid invasive growth in yeast. Proc. Natl. Acad. Sci. USA 97:13619-13624[Abstract/Free Full Text].
9. Dickinson, J. R. 1996. `Fusel' alcohols induce hyphal-like extensions and pseudohyphal formation in yeasts. Microbiology 142:1391-1397[Abstract].
10. Edgington, N. P., M. J. Blacketer, T. A. Bierwagen, and A. M. Myers. 1999. Control of Saccharomyces cerevisiae filamentous growth by cyclin-dependent kinase Cdc28. Mol. Cell. Biol. 19:1369-1380[Abstract/Free Full Text].
11. Ernst, J. F. 2000. Transcription factors in Candida albicans---environmental control of morphogenesis. Microbiology 146:1763-1774[Free Full Text].
12. Espinoza, F. H., A. Farrell, H. Erdjument-Bromage, P. Tempst, and D. O. Morgan. 1996. A cyclin-dependent kinase-activating kinase (CAK) in budding yeast unrelated to vertebrate CAK. Science 273:1714-1717[Abstract/Free Full Text].
13. Espinoza, F. H., A. Farrell, J. L. Nourse, H. M. Chamberlin, O. Gileadi, and D. O. Morgan. 1998. Cak1 is required for Kin28 phosphorylation and activation in vivo. Mol. Cell. Biol. 18:6365-6373[Abstract/Free Full Text]. (Erratum, 20:1898, 2000.)
14. Gagiano, M., D. van Dyk, F. F. Bauer, M. G. Lambrechts, and I. S. Pretorius. 1999. Msn1p/Mss10p, Mss11p and Muc1p/Flo11p are part of a signal transduction pathway downstream of Mep2p regulating invasive growth and pseudohyphal differentiation in Saccharomyces cerevisiae. Mol. Microbiol. 31:103-116[CrossRef][Medline].
15. Gimeno, C. J., and G. R. Fink. 1994. Induction of pseudohyphal growth by overexpression of PHD1, a Saccharomyces cerevisiae gene related to transcriptional regulators of fungal development. Mol. Cell. Biol. 14:2100-2112[Abstract/Free Full Text].
16. Gimeno, C. J., P. O. Ljungdahl, C. A. Styles, and G. R. Fink. 1992. Unipolar cell divisions in the yeast S. cerevisiae lead to filamentous growth: regulation by starvation and RAS. Cell 68:1077-1090[CrossRef][Medline].
17. Godon, C., G. Lagniel, J. Lee, J. M. Buhler, S. Kieffer, M. Perrot, H. Boucherie, M. B. Toledano, and J. Labarre. 1998. The H2O2 stimulon in Saccharomyces cerevisiae. J. Biol. Chem. 273:22480-22489[Abstract/Free Full Text].
18. Guo, B., C. A. Styles, Q. Feng, and G. R. Fink. 2000. A Saccharomyces gene family involved in invasive growth, cell-cell adhesion, and mating. Proc. Natl. Acad. Sci. USA 97:12158-12163[Abstract/Free Full Text].
19. Hollenhorst, P. C., M. E. Bose, M. R. Mielke, U. Muller, and C. A. Fox. 2000. Forkhead genes in transcriptional silencing, cell morphology and the cell cycle. Overlapping and distinct functions for FKH1 and FKH2 in Saccharomyces cerevisiae. Genetics 154:1533-1548[Abstract/Free Full Text].
20. Kaldis, P., A. Sutton, and M. J. Solomon. 1996. The Cdk-activating kinase (CAK) from budding yeast. Cell 86:553-564[CrossRef][Medline].
21. Kron, S. J., and N. A. Gow. 1995. Budding yeast morphogenesis: signalling, cytoskeleton and cell cycle. Curr. Opin. Cell Biol. 7:845-855[CrossRef][Medline].
22. Kron, S. J., C. A. Styles, and G. R. Fink. 1994. Symmetric cell division in pseudohyphae of the yeast Saccharomyces cerevisiae. Mol. Biol. Cell. 5:1003-1022[Abstract].
23. Lambrechts, M. G., F. F. Bauer, J. Marmur, and I. S. Pretorius. 1996. Muc1, a mucin-like protein that is regulated by Mss10, is critical for pseudohyphal differentiation in yeast. Proc. Natl. Acad. Sci. USA 93:8419-8424[Abstract/Free Full Text].
24. Lew, D. J., and S. I. Reed. 1995. Cell cycle control of morphogenesis in budding yeast. Curr. Opin. Genet. Dev. 5:17-23[CrossRef][Medline].
25. Lew, D. J., and S. I. Reed. 1993. Morphogenesis in the yeast cell cycle: regulation by Cdc28 and cyclins. J. Cell Biol. 120:1305-1320[Abstract/Free Full Text].
26. Liu, H., C. A. Styles, and G. R. Fink. 1996. Saccharomyces cerevisiae S288C has a mutation in FLO8, a gene required for filamentous growth. Genetics 144:967-978[Abstract].
27. Lo, W. S., and A. M. Dranginis. 1998. The cell surface flocculin Flo11 is required for pseudohyphae formation and invasion by Saccharomyces cerevisiae Mol. Biol. Cell 9:161-171.
28. Lo, W. S., and A. M. Dranginis. 1996. FLO11, a yeast gene related to the STA genes, encodes a novel cell surface flocculin. J. Bacteriol. 178:7144-7151[Abstract/Free Full Text].
29. Loeb, J. D., T. A. Kerentseva, T. Pan, M. Sepulveda-Becerra, and H. Liu. 1999. Saccharomyces cerevisiae G1 cyclins are differentially involved in invasive and pseudohyphal growth independent of the filamentation mitogen-activated protein kinase pathway. Genetics 153:1535-1546[Abstract/Free Full Text].
30. Longtine, M. S., A. McKenzie III, D. J. Demarini, N. G. Shah, A. Wach, A. Brachat, P. Philippsen, and J. R. Pringle. 1998. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14:953-961[CrossRef][Medline].
31. Lorenz, M. C., N. S. Cutler, and J. Heitman. 2000. Characterization of alcohol-induced filamentous growth in Saccharomyces cerevisiae. Mol. Biol. Cell 11:183-199[Abstract/Free Full Text].
32. Madhani, H. D., and G. R. Fink. 1997. Combinatorial control required for the specificity of yeast MAPK signaling. Science 275:1314-1317[Abstract/Free Full Text].
33. Madhani, H. D., and G. R. Fink. 1998. The control of filamentous differentiation and virulence in fungi. Trends Cell Biol. 8:348-353[CrossRef][Medline].
34. Mai, B., and L. Breeden. 2000. CLN1 and its repression by Xbp1 are important for efficient sporulation in budding yeast. Mol. Cell. Biol. 20:478-487[Abstract/Free Full Text].
35. Mai, B., and L. Breeden. 1997. Xbp1, a stress-induced transcriptional repressor of the Saccharomyces cerevisiae Swi4/Mbp1 family. Mol. Cell. Biol. 17:6491-6501[Abstract].
36. Mann, C., J. Y. Micouin, N. Chiannilkulchai, I. Treich, J. M. Buhler, and A. Sentenac. 1992. RPC53 encodes a subunit of Saccharomyces cerevisiae RNA polymerase C (III) whose inactivation leads to a predominantly G1 arrest. Mol. Cell. Biol. 12:4314-4326[Abstract/Free Full Text].
37. Mosch, H. U., E. Kubler, S. Krappmann, G. R. Fink, and G. H. Braus. 1999. Crosstalk between the Ras2p-controlled mitogen-activated protein kinase and cAMP pathways during invasive growth of Saccharomyces cerevisiae. Mol. Biol. Cell 10:1325-1335[Abstract/Free Full Text].
38. Pan, X., T. Harashima, and J. Heitman. 2000. Signal transduction cascades regulating pseudohyphal differentiation of Saccharomyces cerevisiae. Curr. Opin. Microbiol. 3:567-572[CrossRef][Medline].
39. Pan, X., and J. Heitman. 1999. Cyclic AMP-dependent protein kinase regulates pseudohyphal differentiation in Saccharomyces cerevisiae. Mol. Cell. Biol. 19:4874-4887[Abstract/Free Full Text].
40. Pic, A., F. L. Lim, S. J. Ross, E. A. Veal, A. L. Johnson, M. R. Sultan, A. G. West, L. H. Johnston, A. D. Sharrocks, and B. A. Morgan. 2000. The forkhead protein Fkh2 is a component of the yeast cell cycle transcription factor SFF. EMBO J. 19:3750-3761[CrossRef][Medline].
41. Roberts, R. L., and G. R. Fink. 1994. Elements of a single MAP kinase cascade in Saccharomyces cerevisiae mediate two developmental programs in the same cell type: mating and invasive growth. Genes Dev. 8:2974-2985[Abstract/Free Full Text].
42. Robertson, L. S., and G. R. Fink. 1998. The three yeast A kinases have specific signaling functions in pseudohyphal growth. Proc. Natl. Acad. Sci. USA 95:13783-13787[Abstract/Free Full Text].
43. Rupp, S., E. Summers, H. J. Lo, H. Madhani, and G. Fink. 1999. MAP kinase and cAMP filamentation signaling pathways converge on the unusually large promoter of the yeast FLO11 gene. EMBO J. 18:1257-1269[CrossRef][Medline].
44. Stevenson, B. J., N. Rhodes, B. Errede, and G. F. Sprague, Jr. 1992. Constitutive mutants of the protein kinase STE11 activate the yeast pheromone response pathway in the absence of the G protein. Genes Dev. 6:1293-1304[Abstract/Free Full Text].
45. Thuret, J. Y., J. G. Valay, G. Faye, and C. Mann. 1996. Civ1 (CAK in vivo), a novel Cdk-activating kinase. Cell 86:565-576[CrossRef][Medline].
46. Vivier, M. A., M. G. Lambrechts, and I. S. Pretorius. 1997. Coregulation of starch degradation and dimorphism in the yeast Saccharomyces cerevisiae. Crit. Rev. Biochem. Mol. Biol. 32:405-435[Medline].
47. Ward, M. P., C. J. Gimeno, G. R. Fink, and S. Garrett. 1995. SOK2 may regulate cyclic AMP-dependent protein kinase-stimulated growth and pseudohyphal development by repressing transcription. Mol. Cell. Biol. 15:6854-6863[Abstract].
48. Zhu, G., P. T. Spellman, T. Volpe, P. O. Brown, D. Botstein, T. N. Davis, and B. Futcher. 2000. Two yeast forkhead genes regulate the cell cycle and pseudohyphal growth. Nature 406:90-94[CrossRef][Medline].


Molecular and Cellular Biology, June 2001, p. 3714-3724, Vol. 21, No. 11
0270-7306/01/$04.00+0   DOI: 10.1128/MCB.21.11.3714-3724.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Miled, C.
Right arrow Articles by Faye, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Miled, C.
Right arrow Articles by Faye, G.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. J. Virol. Eukaryot. Cell
Microbiol. Mol. Biol. Rev. Clin. Vaccine Immunol. All ASM Journals