Previous Article | Next Article 
Molecular and Cellular Biology, June 2001, p. 3714-3724, Vol. 21, No. 11
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.11.3714-3724.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Xbp1-Mediated Repression of CLB Gene Expression
Contributes to the Modifications of Yeast Cell Morphology and Cell
Cycle Seen during Nitrogen-Limited Growth
Chaouki
Miled,1,2
Carl
Mann,2,* and
Gérard
Faye1,*
Institut Curie d'Orsay, Centre
Universitaire, F-91405 Orsay,1 and
Service de Biochimie et de Génétique
Moléculaire, CEA/Saclay, F-91191
Gif-sur-Yvette,2 France
Received 9 December 2000/Returned for modification 2 February
2001/Accepted 19 March 2001
 |
ABSTRACT |
Yeast cells undergo morphological transformations in response to
diverse environmental signals. One such event, called pseudohyphal differentiation, occurs when diploid yeast cells are partially starved
for nitrogen on a solid agar medium. The nitrogen-starved cells
elongate, and a small fraction form filaments that penetrate the agar
surface. The molecular basis for the changes in cell morphology and
cell cycle in response to nitrogen limitation are poorly defined, in
part because the heterogeneous growth states of partially starved cells
on agar media are not amenable to biochemical analysis. In this work,
we used chemostat cultures to study the role of cell cycle regulators
with respect to yeast differentiation in response to nitrogen
limitation under controlled, homogeneous culture conditions. We found
that Clb1, Clb2, and Clb5 cyclin levels are reduced in nitrogen-limited
chemostat cultures compared to levels in rich-medium cultures, whereas
the Xbp1 transcriptional repressor is highly induced under these
conditions. Furthermore, the deletion of XBP1 prevents the
drop in Clb2 levels and inhibits cellular elongation in
nitrogen-limited chemostat cultures as well as inhibiting pseudohyphal
growth on nitrogen-limited agar media. Deletion of the CLB2
gene restores an elongated morphology and filamentation to the
xbp1
mutant in response to nitrogen limitation.
Transcriptional activation of the XBP1 gene and the subsequent repression of CLB gene expression are thus key
responses of yeast cells to nitrogen limitation.
 |
INTRODUCTION |
Many yeast cells in the wild undergo
morphological transitions in response to diverse environmental signals.
Transitions between yeast and filamentous forms have been implicated in
foraging for nutrients, in the avoidance of toxins, and in the
infection of plants and animals by fungal pathogens (33,
38). Most laboratory strains of Saccharomyces
cerevisiae respond poorly to such environmental stimuli,
apparently because early yeast geneticists selected mutants that
maintained stable yeast-form growth that were easier to cultivate in
the laboratory (26). Recent work suggests that more feral yeast strains show morphological differentiation in response to a rich
variety of signals. Diploid yeast cells undergo pseudohyphal differentiation in response to limited nitrogen starvation
(16), in the presence of alcohols (9, 31), or
in the presence of some types of sugars (14, 23, 46).
Haploid yeast cells can show invasive growth on a nitrogen-rich agar
medium in response to a depletion of fermentable carbon sources
(8, 41). The best studied of these morphological
transitions is that of diploid yeast cells subjected to a partial
nitrogen starvation, in which case the starved cells elongate and are
inhibited for entry into anaphase in mitosis (4, 22). On
agar media containing limiting nitrogen, a fraction of the cells form
pseudohyphal filaments that penetrate the agar surface.
Two major signal transduction pathways involving a mitogen-activated
protein (MAP) kinase cascade and the cyclic AMP (cAMP)-dependent protein kinase pathway have been implicated in pseudohyphal
differentiation (33, 37, 39). These pathways are thought
to activate key transcription factors, Ste12-Tec1 (32) and
Flo8 (26, 39, 42, 43), that control the expression of
genes required for pseudohyphal differentiation. Both transcription
factors contribute to the expression of FLO11, a gene
encoding a cell surface protein implicated in the adhesion of cells
that form pseudohyphal filaments (18, 23, 27, 28). Several
other transcription factors, including Phd1 (15), Ash1
(5), and Sok2 (47), also regulate pseudohyphal growth and contribute to the expression of
FLO11 (38). In addition, the related
transcription factors Fkh1 and Fkh2 may repress some aspects of
pseudohyphal growth by promoting the expression of a set of genes in S
phase (the CLB2 cluster) that includes the mitotic cyclin
gene CLB2 (19, 40, 48).
Cellular elongation is one of the most evident aspects of
nitrogen-limited growth of yeast cells. This elongation is due to a
prolonged period of polarized growth to the bud apex (24). Polarized bud growth is initiated at the Start of the cell cycle, when
Cdc28 is activated by the G1 cyclins Cln1 and Cln2
(25), and inactivation of Cln1 and Cln2 inhibits
pseudohyphal growth (29). Apical growth in yeast is
blocked by the appearance of the Cdc28-Clb1,2 mitotic kinases
(25), and it was suggested that an inhibition of this
kinase activity explains the hyperpolarized growth and a delay at the
metaphase-to-anaphase transition, seen in wild-type cells
overexpressing the PHD1 gene when they were spread on the
surface of synthetic low-ammonium dextrose (SLAD) agar plates
(22). The mechanism of this inhibition has not yet been
elucidated. In this work, we used chemostats to study the regulation of
Cdc28-Clb kinases in wild-type cells during nitrogen-limited growth.
 |
MATERIALS AND METHODS |
Yeast strains and low-ammonium agar media.
The yeast strains
used in this work are listed in Table 1.
PCR-based deletion of coding sequences with the KANMX4
cassette was performed as previously described (30) for
MATa and MAT
haploid strains of the
1278b
background. Homozygous diploid strains were then produced by mating.
The civ1-4 (45) and cdc28-6 mutant genes were introduced into the
1278b background by cloning the mutant genes into the pRS306 (URA3) integrative vector and
targeting the mutant genes to their corresponding chromosomal loci by
digesting with a restriction enzyme that cuts once within the promoter
region of the gene and transforming MATa ura3 and
MAT
ura3 haploid strains of the
1278b
background. Ura+ transformants were then streaked on
5-fluoro-orotic acid (5-FOA) plates at 24°C in order to select for
excision of the integrated plasmid (2). Ura
colonies growing on the 5-FOA plates were then replica plated on yeast
extract-peptone-dextrose (YPD) plates at 37°C to screen for those
excision events that retained the civ1-4 and
cdc28-6 thermosensitive mutations. The resulting haploid
strains were then mated to generate homozygous diploid strains.
Homozygous diploid civ1-4 ste20
and civ1-4
ste12
strains were constructed by integrating one copy of
pRS306-civ1-4 into CSY2067 and CSY2066, followed by
selection for plasmid excision on 5-FOA plates and, finally,
retransformation with pRS306-civ1-4 and a second round of
plasmid excision at 24°C on 5-FOA plates. The doubly transformed strains were then replica plated at 37°C to test for the replacement of both copies of the wild-type gene by the civ1-4 mutation.
SLAD agar medium was prepared as previously described
(
16). A low-ammonium glycerol medium (SLAYP) supported
pseudohyphal
growth of wild-type cells but not
xbp1 mutants
(see Fig.
6). SLAYP
was composed of 1.7 g of yeast nitrogen base
(YNB) without amino
acids and without ammonium sulfate (Difco) per
liter, 50 mM sodium
phthalate (pH 5), 25 mg of ammonium sulfate per
liter, 3% glycerol,
and 2%
agar.
Plasmids.
A SacI-HindIII
XBP1 fragment (
1995 bp 5' of the ATG start codon and 187 bp downstream from the TAA stop codon) was prepared by PCR and inserted
into the corresponding sites of the pRS416 (CEN-URA3)
vector. A SacI-HindIII fragment beginning
with the ATG start codon of XBP1 and ending 187 bp
downstream of the TAA stop codon was prepared by PCR and cloned into
the corresponding sites of the pYES2 (2µm URA3-pGAL)
vector in order to place XBP1 under the control of the
GAL promoter in a multicopy vector. The CDC28-43244 gene was isolated from
pSF19-CDC28-43244 (7) by partial digestion with
XhoI and XbaI and inserted into the YEplac195 (2µm URA3) vector. The
pFG(TyA)::lacZ-LEU2 reporter construct was a gift
from Gerry Fink, the STE11-4 gene was a gift from George Sprague, and pGR103 (2µm URA3-PDE2) was a gift from
Georges Renault and Michel Jacquet.
Chemostat cultures.
Chemostat cultures were performed at
25°C in a simple, custom-made 1-liter glass vessel (see Fig. 3B) and
using general conditions that were outlined previously
(4). Fresh medium was delivered from the reservoir to the
culture vessel with a peristaltic pump at a flow rate of 100 ml/h. For
nitrogen limitation studies, cells were cultured in a
filter-sterilized, synthetic, low-ammonium phthalate medium (SLAP)
composed of 1.7 g of YNB per liter without ammonium sulfate and
without amino acids (Difco), 50 mM sodium phthalate (pH 5.0), 100 mg of
ammonium sulfate per liter, and 30 g of dextrose per liter. Sodium
phthalate is a nonmetabolizable pH buffer. Cells grown in rich-medium
chemostats were cultivated in SLAP containing 5 g of ammonium
sulfate per liter. Cells grown in glucose-limited chemostats were
cultivated in medium containing 6.7 g of YNB without amino acids
(Difco) per liter, 50 mM sodium phthalate (pH 5), and 0.5% glucose. In
order to ensure equilibrium conditions in the chemostat, cells were
cultivated for 40 to 45 h before harvesting for biochemical
analyses, although similar results were obtained when cells were
cultivated for as little as 20 h.
Electrophoretic separation of nonphosphorylated Cdc28 from
phospo-Thr-169 Cdc28.
Conditions allowing the electrophoretic
separation of Cdc28 phosphorylated on Thr-169 from unphosphorylated
Cdc28 were adopted from those of Espinoza et al. (13).
Cell extract (30 µg) was electrophoresed in thin (0.75-mm) 24-cm-long
Laemmli 12.5% polyacrylamide gels (acryl-bis, 30:0.8 or 29:1) for at
least 15 h at 15 mA and 200 V with constant amperage. Acrylamide
and bis-acrylamide were from Sigma, and ammonium persulfate and TEMED
(N,N,N',N'-tetramethylethylenediamine) were from Bio-Rad. After
electrophoretic transfer to 0.22-mm nitrocellulose membranes, Cdc28 was
detected with rabbit polyclonal antibodies or, in the case of
Cdc28-hemagglutinin, with mouse 12CA5 antihemagglutinin ascites fluid
as the primary antibody and alkaline phosphatase-coupled anti-rabbit or
anti-mouse antibodies as the secondary antibody. Bands were then
revealed with 5-bromo-4-chloro-3-indolyl-1-phosphate-nitroblue tetrazolium colorimetric reagents, leading to a purple precipitate directly on the transfer membrane. Colorimetric detection yields bands
that are finer than those obtained by chemiluminescence, although the
colorimetric detection is less sensitive. The Cdc28 signal can be
increased by immunoprecipitating from larger quantities of yeast
protein extract, although we did not need to do so for the Western blot
shown in Fig. 4.
Quantitative RT-PCR.
Quantitative reverse transcription PCR
(RT-PCR) was performed as described by Godon et al. (17).
cDNAs were synthesized from 1 µg of total RNA using primers specific
for each mRNA. PCR amplification with [32P]dCTP was
performed for 15 cycles for ACT1 mRNA and 25 cycles for the
remaining mRNAs using the following primers: CLB1
(CCAGTCTAGGACGTTAGCGAAGTT and AGTAATTGGCAAACGGGATA),
CLB2 (CAGTCTCGAACTCTTGCCAAATTC and AGCCCATTGGACGGAAATTATAGA), CLB3
(GAACGGCTTAGAATTTGAATTG and TAATGCTATCCACTTCGCTACGAT), CLB5 (CATCGCACAACTATTTACTCGACA and
ACATTGCCATTGCGCTTACGGTAG), XBP1
(AGAGGTGACAGCGTTTCCACTAGC and GTAAGACTGGCAAATAAGGTCCC),
and ACT1 (TTGGATTCCGGTGATGGTGTTACT and
TGAAGAAGATTGAGCAGCGGTTTG). 32P-labeled PCR
products were then separated by polyacrylamide gel electrophoresis and
quantified with a PhosphorImager (Molecular Dynamics).
Microscopy and flow cytometry.
Cells were visualized with a
Zeiss Axiophot microscope fitted with a charge-coupled device camera
for image acquisition. Cells were prepared for flow cytometry as
previously described (36) and analyzed on a Becton
Dickinson FACSCalibur.
 |
RESULTS |
Cak1 mutants show derepressed pseudohyphal growth.
The
molecular basis for yeast cell elongation and the inhibition of mitosis
during pseudohyphal growth on nitrogen-limited media is unknown
(22). We noticed that strains expressing mutations of the
yeast Cdk-activating kinase (cak1/civ1) such as
civ1-4 (45) show a derepressed pseudohyphal
growth at the permissive temperature of 25°C similar to that seen
with a clb2
mutant or with certain cdc28
mutants (Fig. 1) (1, 10).
This result indicates that partial inhibition of CAK activity can
stimulate pseudohyphal growth. Several regulatory pathways are required for pseudohyphal differentiation in the wild-type strain
(33). These include a MAP kinase and a cAMP kinase pathway
(37, 39, 43) and a transcription factor called Ash1
(5). Inactivation of the MAP kinase pathway with
ste20 or ste12 mutants or inactivation of the
cAMP pathway with a gpa2 mutant or through the
overexpression of the cAMP phosphodiesterase Pde2, or deletion of the
ASH1 gene, all eliminated or severely inhibited pseudohyphal
growth in the civ1-4 mutant (Fig.
2). The derepressed pseudohyphal growth
of the civ1-4 mutant thus depends on the normal regulatory
pathways that are required for pseudohyphal growth in the wild-type
strain.

View larger version (81K):
[in this window]
[in a new window]
|
FIG. 1.
Partial inactivation of Cak1 stimulates pseudohyphal
growth, whereas expression of a Cak1-independent form of Cdc28
represses pseudohyphal growth. Wild-type (CSY2123), civ1-4
(CSY2003), cdc28-6 (CSY2126), and clb2
(CSY2127) strains containing the YEplac195 vector and wild-type and
civ1-4 strains containing YEplac195-CDC28-43244,
encoding a Cak1-independent form of Cdc28, were cultivated on SLAD
plates for 20 h or 3 days at 25°C. The colonies at 20 h are
shown at a higher magnification than the colonies photographed after 3 days of growth.
|
|

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 2.
The derepressed pseudohyphal growth of civ1-4
(CSY2003) mutants requires the function of the STE MAP
kinase pathway, the cAMP pathway, and the Ash1 transcription factor, as
for the pseudohyphal growth of wild-type cells. Cells with the 2µm
PDE2 construct overexpress the PDE2 gene on a
multicopy plasmid. Colonies are shown after 3 days of growth on SLAD
plates at 25°C. Colonies are shown at the same magnification.
|
|
Cak1 phosphorylates Cdc28 on Thr-169 (
12,
20,
45). This
phosphorylation is required for Cdc28 kinase activity. Partial
inactivation of Cak1 leads to reduced activating phosphorylation
of
Cdc28 and a decrease in Cdc28 protein kinase activity. Cross
and Levine
isolated multiply mutated forms of Cdc28 that no longer
require Cak1
phosphorylation for its activity (
6,
7). One
such mutant,
Cdc28-43244, was introduced into the wild type and
the
civ1-4 mutant on a multicopy plasmid in order to test its
effect on pseudohyphal growth. Strikingly, Cdc28-43244 strongly
inhibited pseudohyphal growth of both the wild type and the
civ1-4 mutant on a low-nitrogen (SLAD) agar medium (Fig.
1).
This result
suggested that dephosphorylation of Cdc28 might be required
for
pseudohyphal
growth.
Chemostat cultures provide homogeneous nitrogen-limited growth for
biochemical investigations.
Cells grown on nitrogen-limited agar
media are in heterogeneous physiological states; although most cells
are elongated relative to cells grown in rich media, only a small
percentage of cells form pseudohyphal filaments that penetrate the agar
surface (Fig. 1). Furthermore, cells that are at the interior of
colonies will be more starved than cells that are at the edge of the
colonies or that are in filaments projecting from the colonies. We
examined the DNA content of wild-type diploid yeast cells growing on
nitrogen-limited SLAD agar medium (Fig.
3A). Approximately 1,000 cells were
spread on the surfaces of SLAD plates and incubated for 19, 36, or
72 h at 25°C. Cells were then scraped from the surface, and
their DNA content was analyzed by flow cytometry. Cells grown for
19 h on SLAD plates were mainly budded with a 4N DNA content, but by 36 h of culture most cells accumulated in the unbudded state with a 2N DNA content. Infrequent filament formation became visible on
these plates after about 2 days of culture. The accumulation of
unbudded 2N cells after 36 h of growth on the SLAD plates can be
accounted for by the nitrogen starvation experienced by most of the
cells. The cycling cells that generate the pseudohyphal filaments
represent only a small percentage of the total number of cells on the
SLAD plates.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 3.
(A) The vast majority of wild-type cells accumulate with
a G1-phase 2N DNA content after 36 h of growth on SLAD
plates. (B) Schematic diagram of the chemostat used in this work. (C)
Morphology of cells grown in chemostats. Wild-type diploid cells
(CSY2123) in nitrogen-limited chemostats ( N) are elongated compared
to those in rich medium. Wild-type haploid (CSY1000) cells do not
elongate in response to the nitrogen limitation, and cellular
elongation is blocked in diploid cells by the expression of
Cdc28-43244, a Cak1-independent form of Cdc28. (D) Transcription of the
Ste12-Tec1 Ty1-lacZ reporter construct
[pFG(TyA)::lacZ-LEU2] is highly induced in
wild-type (wt) cells grown in nitrogen-limited chemostats compared to
that in rich medium. Ty1-lacZ transcription is also induced
at lower levels in civ1-4 (CSY2003), cdc28-6
(CSY2126), and clb2 (CSY2127) mutants grown in a rich
medium at 25°C. (E) Wild-type diploid cells (CSY2123) grown in
nitrogen-limited chemostats contain more cells with a 2N DNA content
(G1 phase) than do the same cells grown in a rich medium.
(F) Wild-type diploid cells (CSY2123) grown in nitrogen-limited
chemostats contain a higher proportion of pre-anaphase to post-anaphase
mitotic cells than do the same cells grown in a rich-medium
chemostat.
|
|
In order to overcome the problems inherent in the analysis of
heterogeneous cell populations on agar media, we chose to examine
chemostat cultures (Fig.
3B) as a source of nitrogen-limited cells
(
4). Cells growing in liquid chemostat cultures are in a
homogeneous
environment in which the degree of nitrogen starvation is
precisely
controlled, and it is easy to prepare large quantities of
biomass
for biochemical characterization. As observed for cells grown
on nitrogen-limited agar media, yeast cells grown in nitrogen-limited
chemostat cultures are elongated compared to cells grown in rich
media
(Fig.
3C). Extended filaments of cells were not found in
the
chemostats, but occasional clusters of three or four cells
were
observed. Cell elongation and pseudohyphal filamentation
on
nitrogen-limited SLAD plates requires the diploid cell state
(
16), and we found that haploid cells were not highly
elongated
during growth in nitrogen-limited chemostats (Fig.
3C).
Expression
of the Cak1-independent Cdc28-43244 mutant prevented
cellular
elongation of wild-type diploid cells in nitrogen-limited
chemostats
(Fig.
3C), as it did for cells on the surfaces of SLAD
plates
(Fig.
1 and data not shown). Finally, expression of a
Ty1-
lacZ reporter construct by the Ste12-Tec1 transcription
factor is increased
during pseudohyphal growth (
32), and
we found that there was
a strong 12-fold induction of
Ty1-
lacZ expression for cells grown
in nitrogen-limited
chemostat cultures compared to rich media
(Fig.
3D). These results show
that nitrogen-limited growth in
a chemostat shares many characteristics
of nitrogen-limited growth
on agar
media.
Flow cytometry and microscopic analysis showed that diploid cells grown
in nitrogen-limited chemostats had an increased proportion
of unbudded
cells with a 2N DNA content compared to cells grown
in rich media (Fig.
3E and F). This G
1-phase accumulation may
reflect an
inhibition of cell growth and the passage of Start
due to the partial
nitrogen starvation. We also compared the fraction
of budded cells
containing a single nucleus (pre-anaphase cells)
versus those
containing two nuclei (post-anaphase cells). Cells
grown in
nitrogen-limited chemostats had an increased proportion
of pre-anaphase
cells compared to those grown in rich media (Fig.
3F). This result
suggests that cells in nitrogen-limited chemostats
are delayed at the
metaphase-to-anaphase transition after having
accumulated sufficient
mass to pass Start and enter a new cell
cycle.
Cdc28 is not dephosphorylated during nitrogen-limited growth in
chemostats or on agar plates, but mitotic cyclin levels are
reduced.
Genetic results suggest that inhibition of Cdc28-cyclin B
activity is responsible for the cell elongation and the pre-anaphase delay observed in cells growing in nitrogen-limited conditions (21, 22). Given our genetic results suggesting that
partial dephosphorylation of Cdc28 might be required for filamentous
growth, we examined whether phosphorylation of Cdc28 is altered during nitrogen-limited growth of wild-type cells. Under appropriate electrophoretic conditions, Cdc28 phosphorylated by Cak1 on Thr-169 migrates slightly faster than unmodified Cdc28 (13). Cdc28
was mainly phosphorylated on Thr-169 in wild-type cells growing in rich
media, whereas it was mainly dephosphorylated in the civ1-4 mutant at the permissive temperature of 24°C and totally
dephosphorylated in this mutant at the restrictive temperature of
37°C (Fig. 4A). We then examined the
level of Cdc28 phosphorylation in cells growing at equilibrium in
chemostats under nitrogen-limited or glucose-limited growth conditions,
in cells on the surfaces of SLAD plates, and in cells in stationary
phase in rich medium (YPD) batch cultures. A slight dephosphorylation
of Cdc28 was observed in glucose-limited chemostat cultures, but
Cdc28 was mainly in the Thr-169-phosphorylated form in cells grown in
nitrogen-limited chemostats or on the surfaces of nitrogen-limited SLAD
plates after 2 days of growth or in stationary-phase cells in batch
cultures (Fig. 4A). Thus, growth in nitrogen-limited media and growth
to stationary phase in rich media do not induce dephosphorylation of
Cdc28 on Thr-169.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
(A) Cdc28 is mainly phosphorylated on Thr-169 in cells
grown under nitrogen limitation. Thr-169-phosphorylated and
nonphosphorylated forms of Cdc28 were electrophoretically separated by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Protein
extracts were prepared from the following strains: the wild type
(CSY2123) in rich medium at 25°C (lane 1), the civ1-4
mutant (CSY2003) in rich medium at the restrictive temperature of
37°C (lane 2), the wild type in a nitrogen-limited chemostat at
25°C (lane 3), the civ1-4 mutant (CSY2003) in rich medium
at 25°C (lane 4), the wild type (CSY2123) scraped from the surface of
nitrogen-limited SLAD plates after 2 days of incubation at 25°C (lane
5), the wild type (CSY2123) grown in a glucose-limited chemostat at
25°C (lane 6), and the wild type (CSY2123) in stationary phase in YPD
(lane 7). (B) Clb2 protein levels are significantly reduced in
wild-type diploid cells (CSY2123), but not in STE11-4
diploid cells (CSY2128), grown in nitrogen-limited chemostats. Clb2 and
hexokinase protein levels in whole-cell protein extracts were
determined by immunoblotting for the following strains: the wild-type
diploid (CSY2123) grown in a nitrogen-limited chemostat (lane 1), the
wild-type diploid (CSY2123) grown in a rich medium (lane 2), a
clb2 strain (CSY2127) grown in a rich medium (lane 3), a
STE11-4 diploid (CSY2128) grown in a nitrogen-limited
chemostat (lane 4), and a STE11-4 diploid (CSY2128) grown in
a rich medium (lane 5). (C) The wild-type haploid strain (CSY1000)
grown in a nitrogen-limited chemostat (lane 2) does not have reduced
levels of Clb2p compared to the same strain grown in a rich medium
(lane 1). Lane 3 contains a protein extract from a clb2
mutant (CSY2127) grown in a rich medium. (D) A homozygous diploid
xbp1 mutant (CSY2124) has no less Clb2p when grown in a
nitrogen-limited chemostat (lane 2) than when grown in a rich medium
(lane 1).
|
|
Since activating phosphorylation of Cdc28 was not reduced during
nitrogen limitation, we decided to examine the levels of
Clb2 protein
in wild-type diploid cells grown in nitrogen-limited
chemostats and
rich media. Clb2 protein levels were greatly reduced
in extracts from
diploid cells growing in nitrogen-limited chemostats,
as determined by
immunoblotting with anti-Clb2 antibodies (Fig.
4B). In striking
contrast, Clb2 protein levels were not decreased
in wild-type haploid
cells growing in nitrogen-limited chemostats
(Fig.
4C) or in diploid
wild-type cells growing in glucose-limited
chemostats (data not shown).
These results show that the decrease
in Clb2 levels is a
diploid-specific developmental response to
the partial nitrogen
starvation and does not represent a nonspecific
starvation
response.
It was previously reported that Clb2 levels are not diminished in
STE11-4 mutant cells grown in a rich medium compared to
levels in wild-type cells (
1). Ste11-4 is a constitutively
active form of the MEK kinase that is thought to be turned on
during
pseudohyphal growth (
41,
44).
STE11-4 cells
show a
pseudohyphal phenotype even when they are grown in rich media,
and these cells have been proposed as a model for studying filamentous
growth in wild-type cells (
1). We examined Clb2 levels in
a
STE11-4 mutant grown under nitrogen limitation in a
chemostat.
In striking contrast to the wild-type diploid cells, the
STE11-4 mutant did not show reduced levels of Clb2 during
nitrogen-limited
growth (Fig.
4B). The
STE11-4 mutation thus
prevents a reduction
of Clb2 levels that is observed in the wild-type
diploid strain
during continuous nitrogen-limited growth in a
chemostat. We thus
feel that the
STE11-4 mutant does not
accurately reflect the response
of wild-type diploid cells to nitrogen
limitation, although it
may be a valid model for other types of
filamentous growth (
8,
9,
23,
31,
46).
Modification of gene expression during nitrogen-limited growth in
chemostats.
We used quantitative RT-PCR to determine whether the
drop in Clb2 protein levels during nitrogen-limited growth was
correlated with a drop in CLB2 mRNA levels, and to monitor
the transcriptional response of a series of cyclin genes (Fig.
5). ACT1 mRNA levels were
unchanged in nitrogen-limited and rich-medium cultures, and they were
thus used as a normalization standard. CLB1, CLB2, and CLB5 mRNA levels were reduced five- to sevenfold in
wild-type cells grown in nitrogen-limited chemostats compared to
rich-medium chemostats, whereas CLB3 levels were unchanged.
We also examined the mRNA levels for the CLN1, CLN2, and
CLN3 G1 cyclin genes. The CLN1 and
CLN2 mRNA levels showed a modest decline during growth in
nitrogen-limited chemostats, whereas the CLN3 mRNA was
slightly increased (Fig. 5).

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 5.
Quantitative RT-PCR of CLB, CLN, XBP1, and
ACT1 mRNA levels in wild-type (wt) diploid cells (CSY2123)
grown in rich-medium and nitrogen-limited chemostats. CLB1,
CLB2, and CLB5 mRNA levels are decreased,
CLB3 and ACT1 mRNA levels are constant,
CLN1 and CLN2 mRNA levels are slightly decreased,
CLN3 mRNA levels are slightly increased, and XBP1
mRNA levels are increased eightfold in nitrogen-limited chemostats
compared to rich-medium chemostats. The decrease in CLB2
mRNA levels is blocked in a homozygous diploid xbp1 mutant
(CSY2124) grown in a nitrogen-limited chemostat.
|
|
XBP1 codes for a repressor of
CLN1 and
CLB2 expression during sporulation, and
XBP1
expression is induced by diverse stresses
(
34,
35). We
found that
XBP1 mRNA levels were increased eightfold
in
nitrogen-limited chemostats compared to rich-medium chemostats.
Xbp1 is
required for some of the transcriptional modifications
observed during
nitrogen-limited growth in chemostats, since the
decreases in
CLB2 mRNA (Fig.
5) and Clb2 protein (Fig.
4D) were
abolished
in an
xbp1
mutant grown in a nitrogen-limited chemostat.
The absence of significant
CLN1 repression in the presence
of
eightfold-elevated
XBP1 mRNA is not exceptional; a
similar result
was reported for cells treated with diamide
(
35). Reduced
CLB1,2 expression will limit
Cdc28-Clb1,2 kinase activity, which in turn
could explain the elongated
cell morphology of cells grown in
nitrogen-limited media. Furthermore,
we found that Ty1-
lacZ activity
was increased threefold in
clb2
, civ1-4, and
cdc28-6 mutants
grown in
rich medium compared to the wild-type strain (Fig.
3D).
This
stimulation of the expression of a Ste12-Tec1 reporter gene
correlates
well with the enhanced pseudohyphal growth shown by
these mutants (Fig.
1) and suggests that Cdc28-Clb2 can inhibit
the Ste12-Tec1
transcriptional activation
complex.
XBP1 is required for pseudohyphal growth.
We made
an xbp1
homozygous diploid strain and found that it was
inhibited for pseudohyphal filament formation on low-ammonium dextrose
(SLAD) and glycerol (SLAYP) agar media (Fig.
6C through F). Moreover, individual
xbp1
cells did not show the characteristic elongated cell
shape exhibited by wild-type diploid cells on nitrogen-limited media
(Fig. 6A through D). Finally, overexpression of XBP1 from the GAL promoter stimulated pseudohyphal growth (Fig. 6G and
H). Thus, XBP1 is required for normal pseudohyphal
differentiation. We next deleted the CLB2 gene in an
xbp1
mutant in order to test the importance of
CLB2 as a target of Xbp1-mediated repression during
nitrogen-limited growth. Deletion of CLB2 largely restored elongated cell growth and filamentation to an xbp1
mutant
on a nitrogen-limited SLAD agar medium (Fig. 6I, compare with Fig. 6C
and J). clb2
was thus largely epistatic to
xbp1
. These results suggest that CLB2 is an
important repression target of Xbp1 during nitrogen-limited growth.

View larger version (104K):
[in this window]
[in a new window]
|
FIG. 6.
Homozygous diploid xbp1 mutant cells
(CSY2124) are inhibited for cellular elongation in nitrogen-limited
chemostats (A and B) or after 20 h of growth on SLAD plates (C and
D). Deletion of XBP1 completely blocks filament formation of
the wild-type strain (CSY2123) on SLAYP plates, even after 5 days of
growth at 30°C (E and F). Overexpression of XBP1 from the
GAL promoter stimulates filamentation on plates containing
synthetic low-ammonium medium with 2% galactose compared to the same
strain expressing XBP1 from its normal promoter on a
centromeric plasmid (G and H). Cells in panels A and B are shown at a
higher magnification than cells in panels C through H. (I through P)
Colonies of cells of the indicated genotypes after growth for 3 days
(I, J, M, N, O, and P) or 7 days (K and L) on SLAD plates at 30°C.
|
|
We also attempted to place
XBP1 action with regard to the
MAP kinase pathway regulating pseudohyphal growth by genetic epistasis
experiments. Constitutive activation of the MAP kinase pathway
through
the expression of
STE11-4 restored filamentous growth
to the
xbp1
mutant on nitrogen-limited SLAD plates (Fig.
6K and
L). In contrast,
XBP1 overexpression from the
GAL
promoter did
not suppress the filamentation defect of
ste12
and
tec1
mutants
(Fig.
6M through P).
These results show that constitutive activation
of the MAP kinase
cascade by the
STE11-4 mutation can bypass the
requirement
for Xbp1 in pseudohyphal growth, but overexpression
of
XBP1
cannot bypass the requirement for the Ste12 and Tec1 transcription
factors. These results thus place
XBP1 function upstream of
or
in parallel to the MAP kinase cascade and Ste12-Tec1 transcription
factor
function.
 |
DISCUSSION |
Xbp1-mediated repression of CLB2 expression can explain
the elongated phenotype of wild-type yeast cells under nitrogen-limited
growth conditions.
Cellular elongation is one of the most evident
phenotypes associated with the growth of wild-type diploid yeast cells
in nitrogen-limited media (4, 16, 21, 22). This phenotype
can be explained by a delayed or inefficient repression of polarized
growth to the bud tip by Cdc28-Clb1,2 protein kinases (24,
25). There are four known mechanisms that could potentially
account for Cdc28-Clb1,2 protein kinase inhibition: Swe1 inhibitory
phosphorylation of Cdc28 Tyr-19 (3), inhibition of
Cdk-Clb1,2 activity by a Cdk inhibitor such as Sic1 (1), a
decrease in Clb1,2 protein levels, and a decrease in Cak1 activating
phosphorylation of Cdc28. Although Swe1 inhibition of Cdc28 may
contribute to filamentous growth in certain circumstances
(10), it is not required for cellular elongation during
nitrogen-limited growth (1, 22), and no clear evidence has
yet been found for the role of a Cdk inhibitor in filamentous growth.
In contrast, overexpression of CLB2 (1, 10, 22)
and expression of a Cak1-independent form of Cdc28 (this paper) both
block cellular elongation and pseudohyphal growth in response to a
nitrogen starvation. Moreover, deletion of CLB2 or partial
inactivation of Cak1 stimulates cellular elongation and pseudohyphal
growth. Thus, the genetic analyses suggest that reduced Clb2 levels or
reduced activating phosphorylation of Cdc28 could be responsible for
inhibition of Cdc28-Clb2 kinase activity during nitrogen-limited
growth. Unfortunately, the genetic analyses do not indicate which of
these pathways are actually used by wild-type diploid yeast cells
during pseudohyphal growth. Thus, direct biochemical analysis of
wild-type cells during pseudohyphal growth is required to determine
which regulatory pathways are really employed during this growth state.
However, the heterogeneous physiological states of wild-type cells
undergoing pseudohyphal differentiation on nitrogen-limited agar media
are an obstacle to their biochemical analysis. Filament formation is
observed for only a small fraction of wild-type cells growing on
nitrogen-limited agar media. Furthermore, cells within colonies are
likely to be highly starved for nitrogen, whereas cells on the outer
edges of colonies and in penetrating filaments will experience
different degrees of starvation. It is thus impossible to prepare
physiologically homogeneous populations of wild-type cells from
nitrogen-limited agar plates on which pseudohyphal growth is typically
studied. We therefore used chemostat cultures to determine whether
either of these two regulatory pathways could be implicated in cellular
elongation during nitrogen-limited growth of wild-type diploid yeast
cells. Chemostats provide a simple means of preparing large quantities
of homogeneous cultures in which cells are grown under continuous,
precisely defined conditions of nutrient limitation for biochemical
analysis. It was previously shown that wild-type diploid cells are
elongated when they are grown in nitrogen-limited, but not
glucose-limited, chemostats (4). We show here that as for
growth on nitrogen-limited agar media, this elongation response is
specific for diploid cells (Fig. 3), is partially dependent on Ste20
and Ste12 (data not shown), and is accompanied by the transcriptional
induction of a Ste12-Tec1 reporter construct (Fig. 3). On the other
hand, we saw little or no indication of filament formation in our
nitrogen-limited chemostats, and we observed low levels of expression
of FLO11 (data not shown), which encodes a cell surface
adhesion protein implicated in filament formation on agar plates
(23, 27, 39, 43). The weak FLO11 expression in
our nitrogen-limited glucose-rich chemostats may be due to glucose
repression of FLO11 transcription (14). We
observed frequent chains of cells and increased expression of
FLO11 in nitrogen-limited chemostat cultures containing 3% galactose instead of 3% glucose, although the individual cells in the
chains were less elongated then when cells were cultivated in glucose
(data not shown). Altogether, these results suggest that our
nitrogen-limited chemostat cultures reproduce many, but not all,
aspects of nitrogen-limited pseudohyphal growth on solid agar media.
We found no evidence for a decrease in the level of Cdc28-activating
phosphorylation during nitrogen-limited growth (Fig.
4) despite strong
genetic data suggesting that a decrease in activating
phosphorylation
was required for pseudohyphal growth. How can
this apparent
contradiction be resolved? It is possible that partial
inactivation of
Cak1 mimics an event, such as inhibition of Cdc28-Clb1,2
activity, that
normally occurs by a distinct mechanism in wild-type
cells during
nitrogen-limited growth, and it remains possible
that Cdc28-activating
phosphorylation is regulated during other
conditions that lead to
filamentous growth (
8,
9,
23,
31,
46). However, it is less
clear how the Cak1-independent
Cdc28-43244 mutant is so effective in
blocking pseudohyphal growth
(Fig.
1) and cellular elongation (Fig.
3C)
in response to nitrogen
starvation. Possibly, this inhibition may be
related to the weak
kinase activity associated with Cdc28-43244-Cln2
in vitro (
7).
The Cln1 and Cln2 G
1 cyclins are
required for pseudohyphal growth
(
29), so the weak in
vitro kinase activity of Cdc28-43244-Cln2
could mean that this mutant,
although active in the absence of
Cak1, may not sustain sufficient
G
1 cyclin kinase activity in
vivo to support pseudohyphal
growth.
Although we did not observe decreased activating phosphorylation of
Cdc28, we did observe significant decreases in
CLB1, CLB2,
and
CLB5 gene expression during nitrogen-limited growth.
Xbp1
is synthesized in response to diverse types of stress and it is
required for repression of
CLN1 and
CLB2
transcription during
sporulation (
34,
35). We showed that
XBP1 is highly expressed
during growth of wild-type yeast
cells in nitrogen-limited chemostats
(Fig.
5). Deletion of
XBP1 prevents the fall in Clb2 levels normally
observed in
wild-type cells grown under nitrogen limitation, as
well as inhibiting
cellular elongation in nitrogen-limited chemostats
and cellular
elongation and pseudohyphal filament formation on
nitrogen-limited agar
media (Fig.
6).
CLB2 overexpression also
inhibits cellular
elongation and filament formation (
1,
10).
Furthermore,
CLB2 deletion restored cellular elongation and pseudohyphal
growth to an
xbp1
mutant (Fig.
6). These combined results
strongly
suggest that transcriptional induction of the
XBP1
gene and subsequent
repression of
CLB2 gene expression is a
key response to nitrogen
limitation leading to modifications of the
yeast cell cycle and
cell morphology. Further work is necessary to
determine the functional
significance of the
CLB5
transcriptional repression, to specify
the mechanism of action of Xbp1
with regard to
CLB gene repression,
and to order the action
of Xbp1 and Clb1,2 with regard to the
different signal transduction
pathways implicated in pseudohyphal
growth. Finally, many genes
involved in filamentation in
S. cerevisiae have apparent
orthologs in
Candida albicans that have been implicated
in
morphogenetic pathways contributing to the virulence of this
pathogenic
yeast (
11). A sequence coding for a protein with
low but
significant similarity to Xbp1 is found in the
C. albicans genome (
http://www-sequence.stanford.edu/group/candida), and it
will be
interesting to determine whether it also contributes to
morphogenesis
and virulence in
Candida.
 |
ACKNOWLEDGMENTS |
We thank Gerry Fink, George Sprague, Georges Renault, Michel
Jacquet, and Anne Dranginis for the gifts of strains and plasmids and
Jean-Marie Buhler for advice on quantitative PCR. We are grateful to
David Morgan, Sue Jasperson, and Herman Espinoza for teaching C. Miled
how to electrophoretically separate phospho-Thr-169 Cdc28 from the
nonphosphorylated form. We thank Samia BenHassine for assistance and we
are grateful to Céline Facca for technical help with the
experiments involving XBP1.
The doctoral work of C. Miled was financed with funds provided by
Hoechst-Marion-Roussel (currently Aventis), the Association pour la
Recherche sur le Cancer (ARC), and the Fondation pour la Recherche
Médicale (FRM).
 |
FOOTNOTES |
*
Corresponding author. Mailing address for Carl Mann:
SBGM-Bât. 142, CEA/Saclay, F-91191 Gif-sur-Yvette Cedex, France.
Phone: 33-1 69 08 34 32. Fax: 33-1 69 08 47 12. E-mail:
mann{at}jonas.saclay.cea.fr. Mailing address for
Gérard Faye: Institut Curie d'Orsay, Centre Universitaire-Bât. 110, F-91405 Orsay, France. Phone: 33-1 69 86 30 29. Fax: 33-1 69 86 94 29. E-mail:
faye{at}curie.u-psud.fr.
 |
REFERENCES |
| 1.
|
Ahn, S. H.,
A. Acurio, and S. J. Kron.
1999.
Regulation of G2/M progression by the STE mitogen-activated protein kinase pathway in budding yeast filamentous growth.
Mol. Biol. Cell
10:3301-3316[Abstract/Free Full Text].
|
| 2.
|
Boeke, J. D.,
F. LaCroute, and G. R. Fink.
1984.
A positive selection for mutants lacking orotidine-5'-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance.
Mol. Gen. Genet.
197:345-346[CrossRef][Medline].
|
| 3.
|
Booher, R. N.,
R. J. Deshaies, and M. W. Kirschner.
1993.
Properties of Saccharomyces cerevisiae wee1 and its differential regulation of p34CDC28 in response to G1 and G2 cyclins.
EMBO J.
12:3417-3426[Medline].
|
| 4.
|
Brown, C. M., and J. S. Hough.
1965.
Elongation of yeast cells in continuous culture.
Nature
206:676-678[CrossRef][Medline].
|
| 5.
|
Chandarlapaty, S., and B. Errede.
1998.
Ash1, a daughter cell-specific protein, is required for pseudohyphal growth of Saccharomyces cerevisiae.
Mol. Cell. Biol.
18:2884-2891[Abstract/Free Full Text].
|
| 6.
|
Cross, F. R., and K. Levine.
2000.
Genetic analysis of the relationship between activation loop phosphorylation and cyclin binding in the activation of the Saccharomyces cerevisiae Cdc28p cyclin-dependent kinase.
Genetics
154:1549-1559[Abstract/Free Full Text].
|
| 7.
|
Cross, F. R., and K. Levine.
1998.
Molecular evolution allows bypass of the requirement for activation loop phosphorylation of the Cdc28 cyclin-dependent kinase.
Mol. Cell. Biol.
18:2923-2931[Abstract/Free Full Text].
|
| 8.
|
Cullen, P. J., and G. F. Sprague, Jr.
2000.
Glucose depletion causes haploid invasive growth in yeast.
Proc. Natl. Acad. Sci. USA
97:13619-13624[Abstract/Free Full Text].
|
| 9.
|
Dickinson, J. R.
1996.
`Fusel' alcohols induce hyphal-like extensions and pseudohyphal formation in yeasts.
Microbiology
142:1391-1397[Abstract/Free Full Text].
|
| 10.
|
Edgington, N. P.,
M. J. Blacketer,
T. A. Bierwagen, and A. M. Myers.
1999.
Control of Saccharomyces cerevisiae filamentous growth by cyclin-dependent kinase Cdc28.
Mol. Cell. Biol.
19:1369-1380[Abstract/Free Full Text].
|
| 11.
|
Ernst, J. F.
2000.
Transcription factors in Candida albicans environmental control of morphogenesis.
Microbiology
146:1763-1774[Free Full Text].
|
| 12.
|
Espinoza, F. H.,
A. Farrell,
H. Erdjument-Bromage,
P. Tempst, and D. O. Morgan.
1996.
A cyclin-dependent kinase-activating kinase (CAK) in budding yeast unrelated to vertebrate CAK.
Science
273:1714-1717[Abstract/Free Full Text].
|
| 13.
|
Espinoza, F. H.,
A. Farrell,
J. L. Nourse,
H. M. Chamberlin,
O. Gileadi, and D. O. Morgan.
1998.
Cak1 is required for Kin28 phosphorylation and activation in vivo.
Mol. Cell. Biol.
18:6365-6373[Abstract/Free Full Text]. (Erratum, 20:1898, 2000.)
|
| 14.
|
Gagiano, M.,
D. van Dyk,
F. F. Bauer,
M. G. Lambrechts, and I. S. Pretorius.
1999.
Msn1p/Mss10p, Mss11p and Muc1p/Flo11p are part of a signal transduction pathway downstream of Mep2p regulating invasive growth and pseudohyphal differentiation in Saccharomyces cerevisiae.
Mol. Microbiol.
31:103-116[CrossRef][Medline].
|
| 15.
|
Gimeno, C. J., and G. R. Fink.
1994.
Induction of pseudohyphal growth by overexpression of PHD1, a Saccharomyces cerevisiae gene related to transcriptional regulators of fungal development.
Mol. Cell. Biol.
14:2100-2112[Abstract/Free Full Text].
|
| 16.
|
Gimeno, C. J.,
P. O. Ljungdahl,
C. A. Styles, and G. R. Fink.
1992.
Unipolar cell divisions in the yeast S. cerevisiae lead to filamentous growth: regulation by starvation and RAS.
Cell
68:1077-1090[CrossRef][Medline].
|
| 17.
|
Godon, C.,
G. Lagniel,
J. Lee,
J. M. Buhler,
S. Kieffer,
M. Perrot,
H. Boucherie,
M. B. Toledano, and J. Labarre.
1998.
The H2O2 stimulon in Saccharomyces cerevisiae.
J. Biol. Chem.
273:22480-22489[Abstract/Free Full Text].
|
| 18.
|
Guo, B.,
C. A. Styles,
Q. Feng, and G. R. Fink.
2000.
A Saccharomyces gene family involved in invasive growth, cell-cell adhesion, and mating.
Proc. Natl. Acad. Sci. USA
97:12158-12163[Abstract/Free Full Text].
|
| 19.
|
Hollenhorst, P. C.,
M. E. Bose,
M. R. Mielke,
U. Muller, and C. A. Fox.
2000.
Forkhead genes in transcriptional silencing, cell morphology and the cell cycle. Overlapping and distinct functions for FKH1 and FKH2 in Saccharomyces cerevisiae.
Genetics
154:1533-1548[Abstract/Free Full Text].
|
| 20.
|
Kaldis, P.,
A. Sutton, and M. J. Solomon.
1996.
The Cdk-activating kinase (CAK) from budding yeast.
Cell
86:553-564[CrossRef][Medline].
|
| 21.
|
Kron, S. J., and N. A. Gow.
1995.
Budding yeast morphogenesis: signalling, cytoskeleton and cell cycle.
Curr. Opin. Cell Biol.
7:845-855[CrossRef][Medline].
|
| 22.
|
Kron, S. J.,
C. A. Styles, and G. R. Fink.
1994.
Symmetric cell division in pseudohyphae of the yeast Saccharomyces cerevisiae.
Mol. Biol. Cell.
5:1003-1022[Abstract].
|
| 23.
|
Lambrechts, M. G.,
F. F. Bauer,
J. Marmur, and I. S. Pretorius.
1996.
Muc1, a mucin-like protein that is regulated by Mss10, is critical for pseudohyphal differentiation in yeast.
Proc. Natl. Acad. Sci. USA
93:8419-8424[Abstract/Free Full Text].
|
| 24.
|
Lew, D. J., and S. I. Reed.
1995.
Cell cycle control of morphogenesis in budding yeast.
Curr. Opin. Genet. Dev.
5:17-23[CrossRef][Medline].
|
| 25.
|
Lew, D. J., and S. I. Reed.
1993.
Morphogenesis in the yeast cell cycle: regulation by Cdc28 and cyclins.
J. Cell Biol.
120:1305-1320[Abstract/Free Full Text].
|
| 26.
|
Liu, H.,
C. A. Styles, and G. R. Fink.
1996.
Saccharomyces cerevisiae S288C has a mutation in FLO8, a gene required for filamentous growth.
Genetics
144:967-978[Abstract].
|
| 27.
|
Lo, W. S., and A. M. Dranginis.
1998.
The cell surface flocculin Flo11 is required for pseudohyphae formation and invasion by Saccharomyces cerevisiae Mol.
Biol. Cell
9:161-171.
|
| 28.
|
Lo, W. S., and A. M. Dranginis.
1996.
FLO11, a yeast gene related to the STA genes, encodes a novel cell surface flocculin.
J. Bacteriol.
178:7144-7151[Abstract/Free Full Text].
|
| 29.
|
Loeb, J. D.,
T. A. Kerentseva,
T. Pan,
M. Sepulveda-Becerra, and H. Liu.
1999.
Saccharomyces cerevisiae G1 cyclins are differentially involved in invasive and pseudohyphal growth independent of the filamentation mitogen-activated protein kinase pathway.
Genetics
153:1535-1546[Abstract/Free Full Text].
|
| 30.
|
Longtine, M. S.,
A. McKenzie III,
D. J. Demarini,
N. G. Shah,
A. Wach,
A. Brachat,
P. Philippsen, and J. R. Pringle.
1998.
Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae.
Yeast
14:953-961[CrossRef][Medline].
|
| 31.
|
Lorenz, M. C.,
N. S. Cutler, and J. Heitman.
2000.
Characterization of alcohol-induced filamentous growth in Saccharomyces cerevisiae.
Mol. Biol. Cell
11:183-199[Abstract/Free Full Text].
|
| 32.
|
Madhani, H. D., and G. R. Fink.
1997.
Combinatorial control required for the specificity of yeast MAPK signaling.
Science
275:1314-1317[Abstract/Free Full Text].
|
| 33.
|
Madhani, H. D., and G. R. Fink.
1998.
The control of filamentous differentiation and virulence in fungi.
Trends Cell Biol.
8:348-353[CrossRef][Medline].
|
| 34.
|
Mai, B., and L. Breeden.
2000.
CLN1 and its repression by Xbp1 are important for efficient sporulation in budding yeast.
Mol. Cell. Biol.
20:478-487[Abstract/Free Full Text].
|
| 35.
|
Mai, B., and L. Breeden.
1997.
Xbp1, a stress-induced transcriptional repressor of the Saccharomyces cerevisiae Swi4/Mbp1 family.
Mol. Cell. Biol.
17:6491-6501[Abstract].
|
| 36.
|
Mann, C.,
J. Y. Micouin,
N. Chiannilkulchai,
I. Treich,
J. M. Buhler, and A. Sentenac.
1992.
RPC53 encodes a subunit of Saccharomyces cerevisiae RNA polymerase C (III) whose inactivation leads to a predominantly G1 arrest.
Mol. Cell. Biol.
12:4314-4326[Abstract/Free Full Text].
|
| 37.
|
Mosch, H. U.,
E. Kubler,
S. Krappmann,
G. R. Fink, and G. H. Braus.
1999.
Crosstalk between the Ras2p-controlled mitogen-activated protein kinase and cAMP pathways during invasive growth of Saccharomyces cerevisiae.
Mol. Biol. Cell
10:1325-1335[Abstract/Free Full Text].
|
| 38.
|
Pan, X.,
T. Harashima, and J. Heitman.
2000.
Signal transduction cascades regulating pseudohyphal differentiation of Saccharomyces cerevisiae.
Curr. Opin. Microbiol.
3:567-572[CrossRef][Medline].
|
| 39.
|
Pan, X., and J. Heitman.
1999.
Cyclic AMP-dependent protein kinase regulates pseudohyphal differentiation in Saccharomyces cerevisiae.
Mol. Cell. Biol.
19:4874-4887[Abstract/Free Full Text].
|
| 40.
|
Pic, A.,
F. L. Lim,
S. J. Ross,
E. A. Veal,
A. L. Johnson,
M. R. Sultan,
A. G. West,
L. H. Johnston,
A. D. Sharrocks, and B. A. Morgan.
2000.
The forkhead protein Fkh2 is a component of the yeast cell cycle transcription factor SFF.
EMBO J.
19:3750-3761[CrossRef][Medline].
|
| 41.
|
Roberts, R. L., and G. R. Fink.
1994.
Elements of a single MAP kinase cascade in Saccharomyces cerevisiae mediate two developmental programs in the same cell type: mating and invasive growth.
Genes Dev.
8:2974-2985[Abstract/Free Full Text].
|
| 42.
|
Robertson, L. S., and G. R. Fink.
1998.
The three yeast A kinases have specific signaling functions in pseudohyphal growth.
Proc. Natl. Acad. Sci. USA
95:13783-13787[Abstract/Free Full Text].
|
| 43.
|
Rupp, S.,
E. Summers,
H. J. Lo,
H. Madhani, and G. Fink.
1999.
MAP kinase and cAMP filamentation signaling pathways converge on the unusually large promoter of the yeast FLO11 gene.
EMBO J.
18:1257-1269[CrossRef][Medline].
|
| 44.
|
Stevenson, B. J.,
N. Rhodes,
B. Errede, and G. F. Sprague, Jr.
1992.
Constitutive mutants of the protein kinase STE11 activate the yeast pheromone response pathway in the absence of the G protein.
Genes Dev.
6:1293-1304[Abstract/Free Full Text].
|
| 45.
|
Thuret, J. Y.,
J. G. Valay,
G. Faye, and C. Mann.
1996.
Civ1 (CAK in vivo), a novel Cdk-activating kinase.
Cell
86:565-576[CrossRef][Medline].
|
| 46.
|
Vivier, M. A.,
M. G. Lambrechts, and I. S. Pretorius.
1997.
Coregulation of starch degradation and dimorphism in the yeast Saccharomyces cerevisiae.
Crit. Rev. Biochem. Mol. Biol.
32:405-435[Medline].
|
| 47.
|
Ward, M. P.,
C. J. Gimeno,
G. R. Fink, and S. Garrett.
1995.
SOK2 may regulate cyclic AMP-dependent protein kinase-stimulated growth and pseudohyphal development by repressing transcription.
Mol. Cell. Biol.
15:6854-6863[Abstract].
|
| 48.
|
Zhu, G.,
P. T. Spellman,
T. Volpe,
P. O. Brown,
D. Botstein,
T. N. Davis, and B. Futcher.
2000.
Two yeast forkhead genes regulate the cell cycle and pseudohyphal growth.
Nature
406:90-94[CrossRef][Medline].
|
Molecular and Cellular Biology, June 2001, p. 3714-3724, Vol. 21, No. 11
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.11.3714-3724.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Bharucha, N., Ma, J., Dobry, C. J., Lawson, S. K., Yang, Z., Kumar, A.
(2008). Analysis of the Yeast Kinome Reveals a Network of Regulated Protein Localization during Filamentous Growth. Mol. Biol. Cell
19: 2708-2717
[Abstract]
[Full Text]
-
Jin, R., Dobry, C. J., McCown, P. J., Kumar, A.
(2008). Large-Scale Analysis of Yeast Filamentous Growth by Systematic Gene Disruption and Overexpression. Mol. Biol. Cell
19: 284-296
[Abstract]
[Full Text]
-
Mendes-Ferreira, A., del Olmo, M., Garcia-Martinez, J., Jimenez-Marti, E., Leao, C., Mendes-Faia, A., Perez-Ortin, J. E.
(2007). Saccharomyces cerevisiae Signature Genes for Predicting Nitrogen Deficiency during Alcoholic Fermentation. Appl. Environ. Microbiol.
73: 5363-5369
[Abstract]
[Full Text]
-
Tanay, A.
(2006). Extensive low-affinity transcriptional interactions in the yeast genome. Genome Res
16: 962-972
[Abstract]
[Full Text]
-
Vyas, V. K., Berkey, C. D., Miyao, T., Carlson, M.
(2005). Repressors Nrg1 and Nrg2 Regulate a Set of Stress-Responsive Genes in Saccharomyces cerevisiae. Eukaryot Cell
4: 1882-1891
[Abstract]
[Full Text]
-
Bensen, E. S., Clemente-Blanco, A., Finley, K. R., Correa-Bordes, J., Berman, J.
(2005). The Mitotic Cyclins Clb2p and Clb4p Affect Morphogenesis in Candida albicans. Mol. Biol. Cell
16: 3387-3400
[Abstract]
[Full Text]
-
Van Slyke, C., Grayhack, E. J.
(2003). The essential transcription factor Reb1p interacts with the CLB2 UAS outside of the G2/M control region. Nucleic Acids Res
31: 4597-4607
[Abstract]
[Full Text]
-
Palecek, S. P., Parikh, A. S., Kron, S. J.
(2002). Sensing, signalling and integrating physical processes during Saccharomyces cerevisiae invasive and filamentous growth. Microbiology
148: 893-907
[Full Text]