This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Johansen, L. M.
Right arrow Articles by Tenen, D. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Johansen, L. M.
Right arrow Articles by Tenen, D. G.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, June 2001, p. 3789-3806, Vol. 21, No. 11
0270-7306/01/$04.00+0   DOI: 10.1128/MCB.21.11.3789-3806.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

c-Myc Is a Critical Target for C/EBPalpha in Granulopoiesis

Lisa M. Johansen,1 Atsushi Iwama,2 Tracey A. Lodie,1 Koichi Sasaki,3 Dean W. Felsher,4 Todd R. Golub,3 and Daniel G. Tenen1,*

Harvard Institutes of Medicine1 and Dana-Farber Cancer Institute,3 Harvard Medical School, Boston, Massachusetts 02115; Department of Immunology, University of Tsukuba, Tsukuba, Japan2; and Stanford University School of Medicine, Stanford, California 04305-51154

Received 6 October 2000/Returned for modification 22 November 2000/Accepted 14 March 2001


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

CCAAT/enhancer binding protein alpha  (C/EBPalpha ) is an integral factor in the granulocytic developmental pathway, as myeloblasts from C/EBPalpha -null mice exhibit an early block in differentiation. Since mice deficient for known C/EBPalpha target genes do not exhibit the same block in granulocyte maturation, we sought to identify additional C/EBPalpha target genes essential for myeloid cell development. To identify such genes, we used both representational difference analysis and oligonucleotide array analysis with RNA derived from a C/EBPalpha -inducible myeloid cell line. From each of these independent screens, we identified c-Myc as a C/EBPalpha negatively regulated gene. We mapped an E2F binding site in the c-Myc promoter as the cis-acting element critical for C/EBPalpha negative regulation. The identification of c-Myc as a C/EBPalpha target gene is intriguing, as it has been previously shown that down-regulation of c-Myc can induce myeloid differentiation. Here we show that stable expression of c-Myc from an exogenous promoter not responsive to C/EBPalpha -mediated down-regulation forces myeloblasts to remain in an undifferentiated state. Therefore, C/EBPalpha negative regulation of c-Myc is critical for allowing early myeloid precursors to enter a differentiation pathway. This is the first report to demonstrate that C/EBPalpha directly affects the level of c-Myc expression and, thus, the decision of myeloid blasts to enter into the granulocytic differentiation pathway.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Hematopoiesis is the process through which mature blood cells of distinct lineages are produced from pluripotent stem cells. Like many differentiation systems, transcription factors that activate lineage-specific genes are essential to the commitment and development of specific hematopoietic lineages (57, 63). One such transcription factor essential for commitment to and development of the granulocytic lineage is CCAAT/enhancer binding protein alpha  (C/EBPalpha ).

C/EBPalpha is a basic leucine zipper protein (bZIP) that forms homodimers or heterodimers with other C/EBP proteins to activate the transcription of target genes (reviewed in references 34 and 63). In addition to granulocytes, C/EBPalpha is highly expressed in many differentiated cell types such as hepatocytes and adipocytes. A number of reports indicate that C/EBPalpha has a crucial role in regulating the balance between cell proliferation and differentiation, which is crucial for lineage commitment of any cell type. First, C/EBPalpha has been shown to cause growth arrest in adipocytes as well as in hepatocytes (18, 64, 67, 68, 71). C/EBPalpha initiates growth arrest through its ability to stabilize the expression of the cyclin-activating kinase inhibitor (CAK), p21, as well as through disruption of E2F transcriptional complexes during the G1 phase of the cell cycle (64-67). Additionally, expression of antisense C/EBPalpha RNA prevents both growth arrest and terminal differentiation of 3T3 L1 adipocytes (36). Finally, C/EBPalpha -/- mice exhibited improper development of lung and liver with increased hepatocyte proliferation, supporting the role of C/EBPalpha in the differentiation of these tissues (17). A striking feature of the C/EBPalpha -/- mice was the complete absence of any mature neutrophils (73). This result demonstrates the indispensability of C/EBPalpha for the granulocytic differentiation pathway.

C/EBPalpha -/- mice exhibit a block in granulocytic differentiation that is early in the developmental pathway. Fluorescence-activated cell sorter analysis of embryonic and newborn animals demonstrated no detectable expression of the granulocyte colony-stimulating factor (G-CSF) and interleukin-6 (IL-6) receptors, and mRNA levels for both were drastically reduced (73, 74). Consequently, C/EBPalpha -/- mice exhibit a reduced response to those respective cytokines. These results suggested that much of the C/EBPalpha -/- phenotype could be attributed to the decrease in the levels of both the G-CSF receptor and the IL-6 receptor and their respective signaling pathways. However, neither G-CSF receptor-/- mice nor IL-6-/- mice exhibit serious defects in granulocytic differentiation (39, 40). Therefore, it was hypothesized that a cross between G-CSF receptor-/- mice and IL-6-/- mice would mimic the phenotype observed with the C/EBPalpha -/- mice alone. However, this cross did not result in a severe defect in granulocytic differentiation, which indicates that there must be additional C/EBPalpha target genes in myeloid progenitor cells necessary for mature neutrophil development.

c-Myc is a basic helix-loop-helix (HLH) leucine zipper protein that dimerizes with its partner Max to activate gene transcription through consensus E-box elements located on the promoters of certain genes (6, 7). Myc was discovered to be an oncogene causing leukemia in birds and inducing in vitro transformation of avian myeloid cells (56). Dysregulated c-Myc expression has been implicated in the development of lymphoid malignancies and other tumors (13, 33), as well as in the induction of genomic instability (15). This demonstrates the importance of appropriate c-Myc regulation and the role of c-Myc for proper maintenance of the cell cycle (46). c-Myc is expressed in proliferating cells, and both c-Myc mRNA and protein levels are virtually undetectable in terminally differentiated cells (21, 32, 72). These studies indicate that down-regulation of c-Myc is a critical event for a cell to commit to a differentiation pathway (12, 25). This is particularly true in differentiation of myeloid cells (25), and treatment of myeloid cell lines with antisense oligonucleotides that inhibit c-Myc expression induces myeloid cell differentiation (26). Failure to down-regulate c-Myc in transgenic mice can lead to myeloid leukemia, a condition characterized by a block in differentiation (16).

As proliferation and differentiation are mutually exclusive, c-Myc, a proliferative factor, and C/EBPalpha , a differentiation factor, act in opposition to each other. First, c-Myc and C/EBPalpha act reciprocally during adipogenesis (18). Overexpression of c-Myc blocks the ability of adipoblasts to terminally differentiate, while the introduction of C/EBPalpha overcomes this c-Myc-induced differentiation block (37). Next, c-Myc can activate cyclin E complexes, which results in increased active E2F transcription complexes. This leads cells into the G1/S transition of the cell cycle. Moreover, expression of c-Myc can overcome growth arrest imposed by the p21, p27, and p16 cyclin-dependent kinase (cdk) inhibitor proteins (61). In contrast, C/EBPalpha achieves growth arrest through increased p21 CAK inhibitor protein, which ultimately results in decreased numbers of active E2F transcription complexes (65, 66). Most importantly for their opposing effects in cells, c-Myc and C/EBPalpha can reciprocally regulate the expression of their respective genes. c-Myc has previously been shown to negatively regulate C/EBPalpha expression and block C/EBPalpha transactivation function (2, 35, 43). However, the effects of C/EBPalpha on c-Myc regulation have not been investigated.

In order to identify C/EBPalpha targets in myeloid cells, we performed both representational difference analysis (RDA) and oligonucleotide array screening. From both of these independent screens, we identified c-Myc as a target gene of C/EBPalpha . We show that C/EBPalpha can directly down-regulate human c-Myc promoter activity. Moreover, we have identified a consensus E2F site located between the P1 and P2 c-Myc promoter elements as being critical for C/EBPalpha negative regulation. This is the first investigation to show that C/EBPalpha directly affects c-Myc expression levels and thus further elucidates the mechanisms through which C/EBPalpha induces cellular differentiation.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Cell culture conditions. U937 cells stably transfected with a zinc-inducible C/EBPalpha construct (U937alpha #2) or vector alone [U937(vect)#1] have been described previously (52). C/EBPalpha expression from the metallothionein promoter was induced by adding 100 µM ZnSO4 to the culture medium. The Tet-o-myc 1137 myeloblast cell line has been previously described (16). The addition of 20 ng of tetracycline/ml to the culture medium turns off the expression of the human c-Myc transgene which induces the cells to differentiate. 1137 cells stably transfected with a metallothionein-driven C/EBPalpha cDNA (1137/C/EBPalpha ) or metallothionein vector alone (1137/vector) were generated using previously described methods (52). In these 1137 stably transfected cells, the level of human c-Myc was titrated using the indicated dilutions of tetracycline. C/EBPalpha expression was induced by addition of ZnSO4 as previously described (52). Differentiated 1137 cells were quantified by Wright-Giemsa staining and differential cell counts. Monkey kidney lines, CV-1 and COS7, as well as the Rb-Saos osteosarcoma cell line, were maintained in Dulbecco modified Eagle medium (BioWhittaker, Walkersville, Md.) supplemented with 10% fetal bovine serum.

Plasmids and transient transfection. A series of 5' deletions were generated from an EcoRI/NaeI genomic fragment of the human c-Myc gene (3) using internal restriction sites EcoRI (-6.5 kb to +49 bp), XmnI (-2,451 to +49 bp), PvuII (-511 to +49 bp), XbaI (-263 to +49 bp), and XhoI (-92 to +49 bp) and subcloned into the pXP2 firefly luciferase reporter (45). The 0.14-kb mutant E2F reporter construct was generated by PCR to produce a mutation in the consensus E2F binding site sequence from GCGGGAAA to GTTTCAAA. The 2.5-kb mutant E2F reporter construct was made by linearizing the pXP2 0.14-kb mutant E2F construct with HindIII and XhoI. A HindIII/XhoI fragment from the pXP2 2.5-kb reporter construct was subsequently cloned into corresponding sites to create the larger construct. The pcDNA3 C/EBPalpha construct was generated by releasing a BamHI/EcoRI fragment of rat C/EBPalpha cDNA from the pUC18 vector and ligating this fragment into pcDNA3 (Invitrogen) prepared with BamHI and EcoRI. 4HEP C/EBPalpha was a gift of Charles Vinson (National Cancer Institute, Bethesda, Md.) and has been previously described (49). pECE PU.1 was described previously (30). The reporter construct pTK81G-CSFr contains four consensus C/EBPalpha binding sites from the G-CSF receptor promoter linked in tandem and cloned into pTK81 luciferase (45, 60). Approximately 2 × 104 CV-1 cells (or Saos cells) were transfected by Lipofectamine according to the manufacturer's instructions (Promega, Madison, Wis.) with 200 ng of reporter gene, 20 ng of expression plasmid DNA, and 20 pg of promoterless Renilla luciferase as an internal control. Twenty-four hours later, firefly luciferase activities were determined and normalized to Renilla luciferase (4). Results are presented as the percentage of luciferase activity with pcDNA3 vector alone set to 100% activity, except for transfections with c-Myc reporter constructs containing a mutated E2F site, which are given in actual relative light units. Results are given as the averages of at least three independent experiments, and error bars represent the standard errors of the means.

Identification of C/EBPalpha -regulated genes. RDA was performed as described previously (29) but with the substitution of poly(A)+ mRNA derived from U937alpha #2 cells stimulated with ZnSO4 for 8 and 12 h to derive the "tester" cDNA and unstimulated cells to derive the "driver" cDNA. Nucleotide array analysis was performed as described previously (62) but with the substitution of RNA isolated from U937alpha #2 cells stimulated with ZnSO4 for 8 and 24 h. A detailed protocol is available at http://waldo.wi.mit.edu/MPR or http://www.genome.wi.mit.edu/MPR.

Northern analysis. U937alpha #2 and U937(vect)#1 cells were stimulated with ZnSO4, and total RNA was isolated at the indicated time points as described previously (29). Fifteen micrograms of each RNA sample was analyzed by Northern blotting as described previously (29). Blots were hybridized to an [alpha -32P]dCTP-labeled human c-Myc probe (a 305-bp XbaI/EcoRI cDNA fragment isolated from the cDNA clone obtained from the RDA screen above), an [alpha -32P]dCTP-labeled rat C/EBPalpha probe (a 300-bp HincII-BamHI cDNA fragment from the pcDNA3 C/EBPalpha plasmid described above), and an [alpha -32P]dCTP-labeled glyceraldehyde-3-phosphate dehydrogenase probe to control for RNA loading and integrity. Northern blots were stripped between hybridizations by incubation in 0.1× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-0.5% sodium dodecyl sulfate (SDS) at 100°C for 20 min.

Western analysis. At the indicated time points following treatment with ZnSO4 for U937 stable lines or tetracycline for the 1137 cell line, cells were harvested for total cell lysates with modified RIPA buffer (1% Triton X, 0.5% sodium deoxycholate, 0.1% SDS, 150 mM NaCl2, 5 mM EDTA, 50 mM Tris, pH 8.0). Cell lysates were subsequently resolved on SDS-10% polyacrylamide gels and transferred to nitrocellulose membranes (Bio-Rad). Western blots were incubated with c-Myc antisera (sc-764; Santa Cruz; 1:200 dilution), C/EBPalpha antisera (sc-61; Santa Cruz; 1:250 dilution), or beta -tubulin monoclonal antibody (catalog no. 1111 876; Boehringer Mannheim; 1:500 dilution) followed by a 1:5,000 dilution of an appropriate anti-mouse or anti-rabbit immunoglobulin G antibody conjugated with horseradish peroxidase (Santa Cruz). Detection of immune complexes was achieved by enhanced chemiluminescence (NEN DuPont) and autoradiography. Western blots were stripped between hybridizations by incubating blots at 65°C for 5 min in buffer containing 62.5 mM Tris (pH 6.8), 0.02% SDS, and 10 mM beta -mercaptoethanol.

In vitro protein-protein binding assays. Glutathione S-transferase-DP1 (GST-DP1) and GST-E2F1 were a gift of S. Chellappan and are described in reference 70. Other GST fusion proteins have previously been described (51). GST fusion proteins were bound to a 1:1 slurry of glutathione-X-linked beads (Sigma) in GST binding buffer (phosphate-buffered saline containing 20% glycerol, 0.1% NP-40, 1 mM dithiothreitol [DTT], 1 mM EDTA, and 1 mM phenylmethylsulfonyl fluoride [PMSF]). All proteins were quantitated by SDS-polyacrylamide gel electrophoresis (PAGE) and Coomassie blue staining. [35S] methionine-labeled rat C/EBPalpha and E2F1 proteins were prepared using 2 µg of pcDNA3 C/EBPalpha and pPS75 E2F1 (gift of William Kaelin), respectively, as template for coupled in vitro transcription-translation (TNT kit; Promega). For the in vitro binding assays, equal amounts of all GST proteins were incubated with 5 µl of 35S-labeled proteins. The bead volume of all samples was adjusted to 50 µl with GST beads alone. The binding reaction mixtures were then resuspended in a total volume of 250 µl of protein binding buffer (10 mM Tris [pH 7.5], 150 mM NaCl2, 1 mM DTT, and 1 mM PMSF). Bound proteins were released by heating at 95°C in 2× SDS gel loading buffer and resolved on SDS-10% polyacrylamide gels followed by exposure to X-ray film for 24 h. The percentages of in vitro-translated protein complexed with GST fusion proteins on beads were calculated with a phosphorimager.

Coimmunoprecipitation conditions. Cytomegalovirus-E2F1 was a gift from Jacqueline Lees (69). COS7 cells (106) for each immunoprecipitation group were either transfected with 20 µg of cytomegalovirus promoter-E2F1 and 5 µg of pcDNA3 C/EBPalpha (to yield equal protein expression) using Lipofectamine (Gibco-BRL) according to the manufacturer's directions or mock transfected (untransfected) by treatment with the same reagents minus plasmid DNA. Cell lysates were harvested 24 h following transfection by lysing cells in 200 µl of lysis buffer (50 mM NaCl2, 150 mM Tris [pH 7.6], 0.1% NP-40, 1 mM PMSF, and 10 µM aprotinin and leupeptin). One-thirtieth the amounts of lysate from both untransfected and transfected cells were used in Western analysis without immunoprecipitation as a control for protein expression. For immunoprecipitations performed using the U937alpha #2 cell line, approximately 107 cells per experimental group were treated with ZnSO4 to induce C/EBPalpha expression or left untreated. Cell lysates were harvested at 12 h following ZnSO4 treatment by lysing cells in 200 ml of lysis buffer. Supernatants were precleared with 50 ml of a 1:1 slurry of protein A-agarose (Santa Cruz) in lysis buffer with 6 µg of normal rabbit serum (NRS). The precleared supernatants were recovered and incubated with 12 µg of either C/EBPalpha antiserum or NRS antiserum (as a control) and 50 µl of a 1:1 slurry of protein A-agarose. The bound protein-protein A complexes were washed once with lysis buffer and once with wash buffer (50 mM NaCl2, 150 mM Tris [pH 7.6], 1 mM PMSF, and 10 µg of aprotinin and leupeptin/ml). Bound complexes were released by being heated to 100°C for 5 min, resolved on SDS-10% polyacrylamide gels, and analyzed by Western analysis as described above. To detect immunoprecipitated E2F1, E2F2, or E2F4 protein, membranes were hybridized with a 1:2,000 dilution of E2F1 antibody (sc-251x), E2F2 antiserum (sc-633x), or E2F4 antiserum (sc-1082x; Santa Cruz).

EMSAs. Electrophoretic mobility shift assays (EMSAs) were performed as described previously (41) using an E2F binding site oligonucleotide (CTCAGAGGCTTGGCGGGAAAAAGAACGGAGGG) from the human c-Myc promoter sequences located at bp -82 to -46 (GenBank accession no. J00120) or the C/EBPalpha binding site oligonucleotide from the G-CSF receptor promoter sequence extending from bp -57 to -38 (60). E2F binding reactions were performed in 20 mM Tris (pH 7.5)-100 mM KCl-5 mM DTT-2 mM MgCl2-10% glycerol-0.5 µg of double-stranded salmon sperm DNA with nuclear extracts from COS7 cells transfected with E2F1 or C/EBPalpha plasmid. C/EBPalpha binding was performed with in vitro-translated protein and COS7 cells transfected with C/EBPalpha plasmid in 10 mM HEPES (pH 7.9)-50 mM KCl-5 mM MgCl2-1 mM DTT-1 mM EDTA-1 µg of bovine serum albumin per µl-10% glycerol with 2 µg of poly(dI-dC). For specific competition, unlabeled competitor oligonucleotide was added to the binding reaction mixtures at a 200-fold molar excess. In some competition reactions, a shorter E2F double-stranded oligonucleotide (GCTTGGCGGGAAAAAG) was used based on sequences located at bp -70 to -51 in the human c-Myc promoter. For supershift experiments, 3 µl of specific C/EBPalpha or E2F1 antiserum (200 µg/0.1 ml) (Santa Cruz) or NRS was added to the reactions. For competition experiments with E2F1 and C/EBPalpha proteins, 16 µg of nuclear extract from COS7 cells transfected with E2F1 was incubated with increasing amounts of in vitro-translated C/EBPalpha . All binding reactions were adjusted with control unprogrammed lysate to contain a total of 25 µg of rabbit reticulocyte lysate. In competition reactions using nuclear extract from COS7 cells cotransfected with E2F1 and C/EBPalpha expression plasmids, 10 mg of E2F1 was cotransfected along with increasing amounts of C/EBPalpha or PU.1 for a control. Vector DNA (pcDNA3) was added to all transfections to ensure that equal amounts of total DNA were transfected.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Identification of c-Myc as a potential C/EBPalpha target. Because mice devoid of the G-CSF and IL-6 signaling pathways did not duplicate the dramatic phenotype demonstrated by the C/EBPalpha -targeted mice (39), we hypothesized that there are additional C/EBPalpha -targeted genes required for appropriate granulocytic differentiation. In order to identify these additional C/EBPalpha -regulated genes, we performed RDA (27, 38), a PCR-based subtractive hybridization technique using mRNA derived from a U937 cell line stably transfected with a rat C/EBPalpha gene under the control of the human metallothionein promoter, U937alpha #2 (52). From this RDA screen, we identified several novel cDNAs, as well as previously identified cDNAs such as inhibitor of differentiation 2H (Id-2H), ornithine decarboxylase, and thyroid hormone binding protein. In addition, we identified the c-Myc gene as a target for regulation by C/EBPalpha (Table 1). The discovery of c-Myc as a C/EBPalpha -regulated gene is intriguing because it has been previously shown that down-regulation of the c-Myc gene can induce myeloid differentiation (16, 26). Additionally, c-Myc has been shown to negatively regulate C/EBPalpha expression (2, 35, 43).

                              
View this table:
[in this window]
[in a new window]
  		TABLE 1.   C/EBPalpha -regulated genes identified by RDAa

Although RDA is an effective technique to identify differentially regulated genes, we have found that it has some limitations. For example, some differentially expressed genes can be lost during repeated subtractive hybridization after increasing the stringency. In addition, RDA preferentially amplifies genes with significant differences in expression and thus is not effective at identifying genes with small differences in regulated expression (29). In order to overcome these limitations, we performed an additional screen for C/EBPalpha target genes using nucleotide array analysis (11, 20, 62). Recently developed array technologies allow for the analysis of expression patterns of thousands of genes during cellular differentiation or in response to a particular cellular signal. For this screen, we again isolated mRNA from the U937alpha #2 line 8 and 24 h following induction of C/EBPalpha expression by treatment with zinc. The c-Myc gene again was identified as a gene regulated by C/EBPalpha , confirming our RDA results (Table 2).

                              
View this table:
[in this window]
[in a new window]
  		TABLE 2.   C/EBPalpha -regulated genes identified by nucleotide arraya

The endogenous c-Myc gene is negatively regulated by C/EBPalpha . In order to confirm our screening results, we isolated RNA from both the U937alpha #2 stable line and U937(vect)#1 (a U937 line stably transfected with the metallothionein vector lacking the rat C/EBPalpha cDNA) (52) at various time points following treatment with zinc to induce metallothionein promoter-C/EBPalpha gene expression and used this RNA in Northern analysis (Fig. 1A). Previously, we found the induced level of C/EBPalpha protein to be threefold above the level of endogenous C/EBPalpha in these cells. This is sufficient C/EBPalpha expression to fully differentiate precursor cells along the granulocytic pathway (52). Following induction of C/EBPalpha expression, the level of endogenous c-Myc RNA dramatically decreased by 94% at 4 h following zinc treatment, corresponding to the threefold induction of C/EBPalpha RNA. In contrast, the level of c-Myc mRNA remained the same in the U937 vector cell line in which C/EBPalpha was not induced. These results indicate that the level of endogenous c-Myc RNA is substantially affected by the level of C/EBPalpha gene expression.


View larger version (49K):
[in this window]
[in a new window]
  		FIG. 1.   (A) The level of c-Myc RNA decreases following the induction of C/EBPalpha gene expression. U937 stable cell lines that contain either a rat C/EBPalpha cDNA under the control of the human metallothionein promoter (U937alpha #2) or the empty metallothionein expression vector alone were harvested for total RNA at the indicated time points following the addition of ZnSO4 to the culture medium. (Top) Northern hybridization with a c-Myc cDNA probe. (Middle) Northern hybridization with a C/EBPalpha cDNA probe. (Bottom) The Northern blot was stripped and rehybridized with a glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA probe to control for RNA loading and integrity. (B) The expression of c-Myc protein decreases as the level of C/EBPalpha protein increases. The U937alpha #2 stable line was harvested for cell lysates for Western analysis at the indicated time points following incubation with ZnSO4. (Top) Western blot hybridized with c-Myc antiserum. (Middle) The same Western blot hybridized with C/EBPalpha antiserum. (Bottom) The same Western blot hybridized with beta -tubulin antibody to control for protein loading and integrity.

In order to determine if the decrease in c-Myc mRNA corresponds to a similar decrease in the level of c-Myc protein, we again treated the U937alpha #2 line with zinc and harvested cell lysates for use in Western blot analysis at the indicated time points (Fig. 1B). Probing Western blots with c-Myc antiserum demonstrated that the level of c-Myc protein dramatically decreased by 80% at 4 h following treatment with zinc. This decrease corresponds to a 20-fold induction of C/EBPalpha protein expression at 4 h following zinc treatment. The level of c-Myc protein did not change in cell lysates isolated from the U937(vect)#1 cell line following treatment with zinc (data not shown).

C/EBPalpha negatively regulates the c-Myc promoter through an E2F binding site. In order to determine if C/EBPalpha could negatively regulate the human c-Myc promoter itself, we utilized a human c-Myc promoter construct cloned into the pXP2 reporter vector and performed transfection assays to analyze c-Myc promoter activity. We cotransfected CV-1 cells with the 6.5-kb c-Myc promoter luciferase reporter gene along with increasing amounts of a C/EBPalpha expression plasmid. The results show that C/EBPalpha was able to inhibit c-Myc promoter reporter gene activity (Fig. 2) in a dose-dependent manner, as increasing amounts of C/EBPalpha resulted in a linear decrease in reporter gene activity (Fig. 2).


View larger version (20K):
[in this window]
[in a new window]
  		FIG. 2.   C/EBPalpha down-regulates c-Myc promoter activity. (A) The 6.5-kb c-Myc promoter and indicated 5' deletions were cloned into the pXP2 luciferase reporter vector. (B) CV-1 cells were cotransfected with 200 ng of the indicated reporter gene and increasing amounts of C/EBPalpha expression plasmid (nanograms). Control transfection experiments indicated that C/EBPalpha had no effect on the pXP2 luciferase reporter vector (data not shown). (C) As a positive control for C/EBPalpha transactivation, CV-1 cells were cotransfected with the G-CSF receptor reporter gene containing four C/EBPalpha binding sites (pTK-G-CSFr). All transfection groups were normalized with a Renilla luciferase vector as an internal control. Results represent the percentages of luciferase activity with 0 ng of C/EBPalpha (vector alone) set to 100% activity. Results are given as the averages of at least three independent experiments, and error bars represent the standard errors of the means.

To identify the cis-acting elements on the c-Myc promoter that respond to C/EBPalpha , we generated 5' deletions of the 6.5-kb promoter and cloned these deletions into the pXP2 luciferase reporter gene (Fig. 2A). Most c-Myc promoter activity is derived from two transcriptional start sites, P1 and P2, with 95% of transcription initiated from the P2 promoter site (3). We, accordingly, based our c-Myc promoter deletions relative to the P2 promoter. Cotransfection of CV-1 cells with increasing amounts of C/EBPalpha expression plasmid and a series of truncated c-Myc P2 promoter reporter genes resulted in a linear decrease in reporter gene activity (Fig. 2B), localizing the cis-acting element within the smallest c-Myc promoter construct (see below).

C/EBPalpha has previously been shown to up-regulate G-CSF receptor gene expression as well as a construct consisting of four C/EBPalpha binding sites derived from the G-CSF receptor upstream of a minimal reporter (pT81G-CSFr) (60). Therefore, as a positive control for C/EBPalpha transactivation, we cotransfected CV-1 cells with the C/EBPalpha expression vector and the G-CSF receptor reporter gene. Luciferase assays demonstrated that C/EBPalpha was able to transactivate the G-CSF receptor reporter gene, indicating that negative regulation by C/EBPalpha is specific to the c-Myc promoter (Fig. 2C).

To show that C/EBPalpha is responsible for the negative regulation of c-Myc, we utilized a dominant-negative C/EBPalpha expression construct, 4HEP-C/EBPalpha (31, 44, 49). 4HEP-C/EBPalpha contains an acidic extension that extends the coiled-coiled dimerization interface from the C/EBPalpha leucine zipper, allowing 4HEP-C/EBPalpha to form stable dimers with C/EBPalpha without the presence of DNA. Thus, 4HEP-C/EBPalpha functions as a dominant negative by preventing the basic region of C/EBPalpha from binding to DNA. 4HEP-C/EBPalpha was not able to transactivate the pT81G-CSFr reporter gene, while wild-type C/EBPalpha can transactivate eightfold over vector alone (data not shown). Cotransfection of CV-1 cells with 4HEP-C/EBPalpha and c-Myc promoter reporter genes resulted in no inhibition in c-Myc reporter gene activity (Fig. 3A). We cotransfected wild-type C/EBPalpha with increasing amounts of 4HEP-C/EBPalpha . Results showed that 4HEP-C/EBPalpha was able to abolish the ability of wild-type C/EBPalpha to negatively regulate c-Myc (Fig. 3B). This indicates that a functional C/EBPalpha protein is required for negative regulation of the c-Myc promoter. Additionally, these results indicate that the DNA binding and dimerization regions of C/EBPalpha are necessary for the negative c-Myc regulation. C/EBPalpha negative regulation of the c-Myc promoter is specific, as the level of c-Myc reporter activity was not affected by cotransfection with the Ets transcription factor, PU.1 (Fig. 3C).


View larger version (28K):
[in this window]
[in a new window]
  		FIG. 3.   (A) Dominant-negative C/EBPalpha does not repress c-Myc reporter activity. CV-1 cells were cotransfected with 200 ng of the indicated c-Myc reporter construct along with wild-type C/EBPalpha or dominant-negative C/EBPalpha (4HEP C/EBPalpha ). (B) Dominant-negative C/EBPalpha interferes with wild-type C/EBPalpha repression of c-Myc reporter activity. CV-1 cells were cotransfected with wild-type C/EBPalpha along with increasing amounts of dominant-negative C/EBPalpha and either the 2.5-kb or 0.14-kb c-Myc reporter gene. All transfection groups were cotransfected with a Renilla luciferase vector as an internal control. Results represent the percentages of luciferase activity with 0 ng of C/EBPalpha (vector alone) set to 100% activity. (C) Mutation of the E2F DNA binding site on c-Myc reporter constructs abolishes C/EBPalpha negative regulation. Wild-type and mutant sequences of the E2F DNA binding site in the c-Myc promoter located at residues -58 to -51 relative to the P2 promoter are shown at the top. CV-1 cells were cotransfected with either the 2.5-kb or 0.14-kb c-Myc reporter gene containing the wild-type or mutated E2F site along with the C/EBPalpha expression construct. As a control, CV-1 cells were cotransfected with a PU.1 expression construct to demonstrate that c-Myc promoter repression is specific to C/EBPalpha . All transfection groups were normalized with a Renilla luciferase vector as an internal control. Results are presented as the averages of at least three independent experiments, and error bars represent the standard errors of the means.

All of our 5' c-Myc promoter deletions responded to C/EBPalpha regulation, and sequence analysis indicates that all c-Myc promoter constructs contain a consensus E2F binding site located between the P1 and P2 promoter elements (-65 to -58). Previous investigations have shown that c-Myc is positively regulated by E2F proteins at this site (24, 28, 53). In order to determine if C/EBPalpha negative regulation could act through this E2F binding site, we further deleted this site from the c-Myc promoter and subsequently cloned this truncated c-Myc promoter fragment (-57 to 49) into a luciferase reporter gene. Cotransfection of this c-Myc promoter reporter gene with a C/EBPalpha expression plasmid resulted in no decrease in c-Myc reporter gene activity, suggesting that down-regulation was mediated through this E2F site (data not shown).

Because the minimal -57 to 49 region of the c-Myc promoter does not possess as high a level of luciferase activity when transfected into cells, in order to demonstrate the importance of the E2F site for C/EBPalpha negative regulation, we mutated this E2F site in the context of our larger c-Myc promoter reporter genes (Fig. 3C). Mutation of the E2F site in these c-Myc promoter constructs abolished C/EBPalpha negative regulation. Cotransfection of CV-1 cells with either the 2.5- or the 0.14-kb c-Myc reporter gene containing the mutated E2F binding site along with a C/EBPalpha expression plasmid resulted in no decrease in reporter gene activity compared to wild-type c-Myc promoter constructs (Fig. 3C). These results demonstrate that C/EBPalpha negative regulation of the c-Myc promoter is mediated through this E2F binding site.

There are two possible mechanisms for how C/EBPalpha regulates c-Myc through this E2F binding site. First, C/EBPalpha may regulate c-Myc through direct binding of C/EBPalpha to the E2F site. However, this is unlikely, as the E2F binding site nucleotide sequence is distinct from a consensus C/EBPalpha DNA binding site sequence (50). In addition, we found that in vitro-translated C/EBPalpha protein did not bind to an E2F consensus binding site in EMSAs (Fig. 4A), while nuclear extracts from COS7 cells transfected with an E2F1 expression vector demonstrated strong binding to this E2F site. In vitro-translated C/EBPalpha binds strongly to a consensus C/EBP binding site. The addition of E2F oligonucleotides did not compete C/EBPalpha protein away from consensus C/EBPalpha binding site oligonucleotides in EMSAs (Fig. 4B). In order to rule out the possibility that additional cellular factors may be required for C/EBPalpha binding to this E2F site, we transfected COS7 cells with a C/EBPalpha expression plasmid. Again, EMSA was performed using nuclear extracts harvested from these cells. Results showed that no detectable C/EBPalpha protein was complexed on this site (Fig. 4C) In contrast, EMSA performed with a C/EBPalpha binding site detected C/EBPalpha protein complexes (Fig. 4D).


View larger version (71K):
[in this window]
[in a new window]
  		FIG. 4.   C/EBPalpha does not bind to the E2F DNA site in the c-Myc promoter. EMSAs using 32P-labeled, double-stranded oligonucleotides containing either an E2F site from the human c-Myc promoter (A and C) or a C/EBPalpha binding site from the G-CSF receptor promoter (B and D) were performed with in vitro-translated C/EBPalpha protein (in vitro C/EBPalpha ) or nuclear extracts prepared from COS7 cells overexpressing C/EBPalpha (COS7/C/EBPalpha ), COS7 cells overexpressing E2F1 (COS7/E2F1) as a positive control for E2F binding, or untransfected COS7 cells (UT). The migration of the free probe is indicated along with the positions of E2F1 protein complexes binding to the E2F DNA site and C/EBPalpha binding to the C/EBPalpha binding site. The asterisks indicate the positions of supershifted bands following the addition of either an E2F1 antibody or C/EBPalpha antisera. "competitor" refers to the 100× addition of unlabeled double-stranded E2F or C/EBPalpha DNA binding sites as indicated. "NSB" refers to migration of nonspecific protein complexes binding to the E2F DNA binding site. "Long" or "Short" E2F competitor refers to a double-stranded E2F oligonucleotide that contains more or less DNA sequence, respectively, flanking the E2F1 consensus site.

Since C/EBPalpha does not bind to the c-Myc promoter E2F site, C/EBPalpha may indirectly regulate c-Myc by disrupting E2F protein complexes at the E2F binding site. Recent reports have demonstrated that C/EBPalpha can disrupt E2F protein complexes in hepatocyte and adipocyte lines as well as in NIH 3T3 cells (59, 65, 66). Initial investigations of this c-Myc E2F site utilized the founding member of the E2F family, E2F1, since this was initially shown to regulate c-Myc (24). To explore the possibility that C/EBPalpha directly interacts with E2F1 to negatively affect its function, we used in vitro GST pull-down assays. In vitro-translated [35S]methionine-labeled C/EBPalpha protein was incubated with various bacterially expressed GST fusion proteins. Results of pull-down assays demonstrated that in vitro C/EBPalpha interacted with GST-C/EBPalpha and E2F1 (Fig. 5A). In vitro-translated C/EBPalpha did not interact with GST-DP1. In a complementary experiment using in vitro-translated [35S]methionine-labeled E2F1 incubated with the same set of GST fusion proteins, we again detected an interaction between GST-C/EBPalpha and E2F1 (Fig. 5B). In vitro-translated E2F1 also interacted strongly with its dimerization partner, GST-DP1, but not with GST alone. In order to demonstrate that the interaction between E2F1 and C/EBPalpha occurs in vivo, coimmunoprecipitation assays were performed. Because E2F1 is expressed at low levels in U937 cells (data not shown), COS7 cells were cotransfected with expression constructs for both E2F1 and C/EBPalpha . Whole-cell extracts were immunoprecipitated with antiserum for either C/EBPalpha or NRS, followed by Western analysis with an antibody to E2F1. Results demonstrated that complexes immunoprecipitated with C/EBPalpha antisera contained E2F1 protein (Fig. 5C). The interaction between E2F1 and C/EBPalpha is strong, as quantitation with a phosphorimager indicated that 86% of the transfected E2F1 protein is complexed with immunoprecipitated C/EBPalpha protein.


View larger version (20K):
[in this window]
[in a new window]
  		FIG. 5.   C/EBPalpha and E2F1 physically interact in vitro and in vivo. (A) Binding of 35S-labeled in vitro-translated C/EBPalpha (input C/EBPalpha ) to GST (negative control for binding), GST-C/EBPalpha (positive control for binding), GST-E2F1, and GST-DP1. (B) Binding of 35S-labeled in vitro-translated E2F1 (input E2F1) to the same GST fusion proteins. Percent input bound represents the amount of in vitro-translated protein complexed with GST fusion proteins as calculated using a phosphorimager (Molecular Dynamics). (C) COS7 cells either untransfected (Unt) or transfected with E2F1 and C/EBPalpha expression vectors (E + C) were immunoprecipitated with C/EBPalpha antisera or control NRS followed by Western analysis with E2F1 antibody. As a control for E2F1 expression and migration, 1/30 of the COS7 lysate used for immunoprecipitation was resolved by SDS-PAGE (marked "-" for immunoprecipitation antibody). The position of E2F1 is indicated. (D) C/EBPalpha interacts with endogenous E2F proteins in myeloid cells. Uninduced (-) or induced (+) U937alpha #2 cells were immunoprecipitated (IP antibody) with C/EBPalpha antisera or control NRS followed by Western analysis with either E2F2 or E2F4 antibody. As a control for E2F2 and E2F4 expression and migration, 1/30 of the lysate used for immunoprecipitation was resolved by SDS-PAGE (marked "-" for immunoprecipitation antibody). The positions of E2F2 and E2F4 are indicated.

There are five additional E2F family members (E2F2 to E2F6). As evidenced by our EMSA, untransfected cells show significant binding to the c-Myc E2F site (Fig. 4C). We detected only a slight supershift when E2F1 antibody was added to our EMSA reactions using nuclear extracts from E2F1-transfected cells (Fig. 4A and C), suggesting that other E2F family members might bind to this E2F site. In order to demonstrate that C/EBPalpha interacts with other endogenously expressed E2F proteins in myeloid cells, we utilized our U937alpha #2 cell line. Cells were untreated or treated with ZnSO4 to induce C/EBPalpha expression. Whole-cell extracts were immunoprecipitated with antiserum against C/EBPalpha followed by Western analysis with antiserum to either E2F2 or E2F4. Results showed that, in lysates in which C/EBPalpha was induced, complexes containing E2F2 and E2F4 proteins were immunoprecipitated (Fig. 5D). The results demonstrate the ability of C/EBPalpha and E2F proteins to form complexes in mammalian cells. Taken together, our binding assays support a model in which C/EBPalpha may disrupt E2F protein function by directly interacting with E2F family members.

If the interaction with C/EBPalpha disrupts E2F protein binding, this interaction could result in negative regulation of E2F-controlled genes such as c-Myc. In order to examine the ability of C/EBPalpha to disrupt E2F1 DNA binding, we performed an EMSA using an E2F oligonucleotide and nuclear extracts prepared from COS7 cells overexpressing E2F1. We then mixed increasing amounts of in vitro-translated C/EBPalpha protein into the reactions. Results showed that increasing amounts of C/EBPalpha protein had no effect on E2F1 binding to a consensus E2F DNA binding site (Fig. 6A). To evaluate the influence of other cellular factors on the interaction between E2F1 and C/EBPalpha , COS7 cells were cotransfected with 10 mg of E2F1 plasmid and increasing amounts of C/EBPalpha plasmid. Again, results showed that C/EBPalpha did not interfere with E2F complex binding (Fig. 6B). Even though C/EBPalpha may not affect E2F1 binding directly, our results indicate that C/EBPalpha strongly interacts with E2F proteins both in vitro and in vivo. It is possible that C/EBPalpha interacts with other proteins that complete the active E2F transcriptional complex, or alternatively, C/EBPalpha may mask the E2F1 transcriptional activation domain, which ultimately results in a loss of c-Myc expression without the direct loss of E2F1 DNA binding function.


View larger version (71K):
[in this window]
[in a new window]
  		FIG. 6.   C/EBPalpha protein cannot disrupt the binding of E2F1 protein to DNA. (A) EMSAs using a 32P-labeled, double-stranded oligonucleotide containing the E2F site from the human c-Myc promoter were performed with nuclear extracts prepared from COS7 cells overexpressing E2F1 (COS7/E2F1). The addition of increasing amounts of in vitro-translated C/EBPalpha did not alter the amount of E2F1 protein binding to the E2F DNA site. The migration of the free probe is indicated along with the positions of E2F1 protein complexes. The asterisk indicates the position of a supershifted band following the addition of an E2F1 antibody. "self oligo" indicates the 100× addition of unlabeled double-stranded E2F DNA binding site. "NSB" indicates the migration of nonspecific protein complexes binding to the E2F DNA binding site. "control" indicates binding reactions performed with unprogrammed rabbit reticulocyte lysate, and "Gata-1" indicates control binding reactions performed with in vitro-translated GATA-1 protein. (B) EMSAs performed with the E2F site from the c-Myc promoter and nuclear extracts from COS7 cells cotransfected with 10 mg of E2F1 plasmid and indicated amounts of C/EBPalpha plasmid. For control reactions, COS7 cells were cotransfected with PU.1 or left untransfected (UT). The migration of the free probe is indicated along with the positions of the E2F1 protein complexes. "self oligo" indicates the 100× addition of unlabeled double-stranded E2F DNA binding site. "NSB" indicates the migration of nonspecific protein binding complexes.

In order to investigate these hypotheses further, we cotransfected CV-1 cells with E2F1 to activate the 0.14-kb c-Myc reporter (Fig. 7A). Cotransfection of increasing amounts of C/EBPalpha led to a progressive inhibition of the ability of E2F1 to transactivate c-Myc promoter activity (Fig. 7A). It has previously been shown that C/EBPalpha can interact with Rb (8). Since E2F proteins are regulated through their association with Rb and this association results in repression of E2F-regulated genes, we investigated the possibility that C/EBPalpha inhibition of E2F transactivation activity is dependent on Rb. Therefore, we utilized the Saos osteosarcoma cell line, which does not express Rb. We cotransfected E2F1 with increasing amounts of C/EBPalpha , along with the 0.14-kb c-Myc reporter construct. Results showed that C/EBPalpha also was able to block E2F1 transcriptional activation domain activity in these Rb-minus cells (Fig. 7B). Thus, an increase in C/EBPalpha expression interferes with E2F1 transcription activation activity in an Rb-independent fashion, and this results in repression of the c-Myc promoter.


View larger version (17K):
[in this window]
[in a new window]
  		FIG. 7.   C/EBPalpha interferes with E2F1 transactivation of the c-Myc promoter. CV-1 cells or Saos (Rb-) cells were cotransfected with 200 ng of the 0.14-kb c-Myc reporter gene (V), 20 ng of C/EBPalpha plasmid alone (alpha ), 10 ng of E2F1 plasmid alone, or 10 ng of E2F1 plasmid along with the indicated amounts of C/EBPalpha plasmid. All transfection groups were normalized with a Renilla luciferase vector as an internal control. Results represent the percentages of reporter gene or luciferase activity with vector alone (V) set to 100% activity. Results are given as the averages of at least three independent experiments, and error bars represent the standard errors of the means.

c-Myc must be negatively regulated in order for myeloblasts to differentiate into neutrophils. To determine if c-Myc is an important C/EBPalpha target gene, we investigated how Myc gene expression affected myeloblast differentiation. Tet-o-myc 1137 is a myeloblast cell line derived from a tumor from transgenic mice that express the human c-Myc cDNA under the control of a tetracycline-responsive promoter (16). Treatment with doxycycline or tetracycline turns off c-Myc expression and drives the cells to differentiate into neutrophils. We found that, in the absence of tetracycline, 85% of the cells were myeloblasts, 10% were promyelocytes, and 5% were metamyelocytes and neutrophils (Fig. 8A and B). Following treatment with tetracycline for 24 h, which turns off c-Myc expression, the culture underwent marked differentiation, with 28% myeloblasts, 38% promyelocytes, and 34% metamyelocytes and mature neutrophils (Fig. 8A and B).




View larger version (75K):
[in this window]
[in a new window]
  		FIG. 8.   Down-regulation of c-Myc is crucial to the granulocytic differentiation pathway. The 1137 cell line was derived from murine bone marrow of a transgenic line with a human c-Myc cDNA under the control of a tetracycline-responsive promoter. The addition of tetracycline to the culture medium turns off human c-Myc expression, resulting in the differentiation of these myeloblasts to neutrophils. (A) Wright-Giemsa-stained cells without (No Tet) or with (Plus Tet) treatment with tetracycline. Cells treated with tetracycline differentiated into myelocytes (M) and neutrophils (N). (B) Differential analysis of Wright-Giemsa-stained slides following treatment with tetracycline for 0, 24, and 48 h, respectively. (C) 1137 cells were harvested for cell lysates to use in Western blotting at indicated time points following treatment with tetracycline. (Top) Western blot hybridized with C/EBPalpha antiserum shows that the level of endogenous C/EBPalpha protein increased 24 h following treatment with tetracycline. This corresponds to the shift to mature cells seen in panels A and B. (Middle) The same blot hybridized with c-Myc antiserum, showing that c-Myc protein levels dramatically decreased 2 h following treatment with tetracycline. (Bottom) The same blot hybridized with a beta -tubulin antibody to control for protein loading and integrity. (D) Western analysis of 1137 stable lines with (+) and without (-) treatment with zinc. "parental" indicates the 1137 parental line, "vector" indicates the 1137 stable line with metallothionein vector, and "C/EBPalpha " indicates the 1137 line with metallothionein-driven C/EBPalpha . (E) Western analysis of cell lysates prepared from the 1137/C/EBPalpha stable line with the indicated treatment with tetracycline. The level of human c-Myc protein was titrated by 100-fold dilutions of tetracycline. A 20-ng/ml concentration turns off c-Myc expression, while a 2-ng/ml concentration results in a low level of c-Myc expression. Lower concentrations of tetracycline result in no decrease in c-Myc protein expression. (F) Differential analysis of Wright-Giemsa-stained slides following treatment of 1137 stable lines with tetracycline, zinc, or the combination of tetracycline and zinc for 48 h.

When the 1137 cells were treated with tetracycline and harvested for cell lysates for Western blot analysis at distinct time points, we determined that c-Myc protein expression was not detectable by 2 h following treatment with tetracycline (Fig. 8C). Moreover, the level of c-Myc protein remains depressed throughout the entire experiment to the 48-h point. As the level of c-Myc protein decreased, we observed an increase in the level of endogenous C/EBPalpha protein, especially at the later time points (24 and 48 h), which correlated with the shift in 1137 cells from myeloblasts to more mature neutrophils (Fig. 8C). In order to further examine the role of negative regulation of c-Myc by C/EBPalpha in the differentiation process, we engineered the 1137 myeloid cells with either a metallothionein-driven C/EBPalpha cDNA or vector alone (Fig. 8D). In this system, the levels of C/EBPalpha and c-Myc could be altered independently by adjusting levels of zinc and tetracycline, respectively. Because the level of c-Myc protein in 1137 cells is highly elevated without tetracycline, we titrated the level of tetracycline such that we would observe a decrease in the level of c-Myc protein but leave a level of c-Myc high enough that cells would not differentiate (Fig. 8E). Results of Western analysis indicate that a concentration of 2 ng of tetracycline/ml dramatically lowers the level of c-Myc while the majority of cells remain undifferentiated. Treatment of 1137/C/EBPalpha cells with 2 ng of tetracycline/ml alone (to lower c-Myc expression), zinc alone (to turn on C/EBPalpha expression), or both tetracycline and zinc showed only a very slight increase in the number of differentiated cells compared to untreated cells (Fig. 8F). Again, the maximum amount of differentiation is observed with a higher concentration of tetracycline that essentially turns off c-Myc protein expression in the 1137 stable lines (Fig. 8F). The 1137/vector cells remain highly undifferentiated without the addition of the higher level of tetracycline. Therefore, increased expression of C/EBPalpha in 1137 cells was not able to down-regulate c-Myc expression from the tetracycline-regulatable promoter and could not overcome the block to differentiation imposed by continued expression of exogenous human c-Myc. Taken together, these data demonstrate that c-Myc protein expression must be negatively regulated in order for myeloblasts to differentiate.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

C/EBPalpha down-regulates c-Myc through an E2F site, suggesting that other c-Myc and E2F target genes may lie downstream of C/EBPalpha . In order to identify critical C/EBPalpha target genes involved in the differentiation of granulocytic cells, we performed both RDA and oligonucleotide array analysis (Tables 1 and 2). Both of these screens independently identified the c-Myc gene as a target for regulation by C/EBPalpha . This is the first report to demonstrate that C/EBPalpha is a negative regulator of c-Myc gene expression. Using a stable C/EBPalpha -inducible U937 cell line, we have shown that C/EBPalpha expression results in a significant decrease in the levels of endogenous c-Myc mRNA and corresponding protein (Fig. 1). Quantitation by phosphorimager indicates that the level of c-Myc RNA decreased only 30% by 2 h, compared with a dramatic decrease of 94% by 4 h (Fig. 1). The level of C/EBPalpha protein was induced 5-fold by 2 h and 20-fold by 4 h (Fig. 1). Therefore, the 20-fold increase in C/EBPalpha protein at 4 h preceded the decrease seen in c-Myc RNA and corresponding c-Myc protein levels. We have shown by luciferase reporter assays that C/EBPalpha protein itself negatively regulates the human c-Myc promoter (Fig. 2). Therefore, C/EBPalpha expression results in a linear decrease in c-Myc reporter activity.

In addition to c-Myc, both our RDA and oligonucleotide array screens identified several interesting C/EBPalpha candidate genes. For example, another down-regulated gene identified by the RDA screen was Id-2H, a basic HLH protein that antagonizes other basic HLH proteins to inhibit cellular differentiation and enhance cell proliferation (22, 42) (Table 1). Of the candidate genes identified by the oligonucleotide array screen (Table 2), c-Myb is a transcription factor expressed in hematopoietic cells whose expression parallels that of c-Myc, with high levels in immature hematopoietic cells and with expression decreasing during terminal differentiation (1, 5, 21, 25). As several studies have shown that c-Myb can regulate c-Myc gene expression (9, 54, 75), the down-regulation of c-Myb may contribute to the dramatic decrease that we observed for c-Myc expression in the presence of C/EBPalpha . Whether down-regulation of c-Myb is a direct effect or a secondary effect of C/EBPalpha expression remains to be determined.

Of the C/EBPalpha target genes identified to date, c-Myc may be the most critical target of C/EBPalpha , allowing myeloblasts to exit from a proliferative state and enter into a differentiation pathway. Upon further examination of our nucleotide array screen, we identified several c-Myc target genes as being regulated by C/EBPalpha (Table 2). Among the c-Myc target genes identified by our C/EBPalpha array screen are alpha -prothymosin, E1F4A, E1F5A, and (2'-5') oligo(A) synthetase E, some of which were identified in Myc microarray screens (11, 47). c-Myc has been shown previously to up-regulate alpha -prothymosin, E1F4A, and E1F5A (10, 11, 14). In contrast, our C/EBPalpha screen demonstrated these c-Myc-dependent genes to be down-regulated (data not shown). As C/EBPalpha negatively regulates c-Myc expression, a secondary consequence is that c-Myc target genes normally activated are now down-regulated and vice versa. Additionally, following a search of the nucleotide database for consensus E-box promoter elements, we identified several additional genes potentially regulated by c-Myc. Hence, C/EBPalpha disruption of c-Myc expression results in a global effect on the expression of c-Myc-regulated genes required for cells to continue in a proliferative state.

The human c-Myc promoter contains no consensus C/EBPalpha DNA binding sites. Instead, C/EBPalpha regulates c-Myc promoter activity through an E2F binding site (-57 to 49) relative to the P2 promoter element (Fig. 3C). C/EBPalpha can regulate the expression of other genes through E2F DNA binding sites (59). However, upon searching the target genes identified through our nucleotide array screen (Table 2), we identified only one additional candidate gene for regulation by E2F, ARHG, which, like c-Myc, was negatively regulated (data not shown). To determine whether C/EBPalpha can indeed regulate transcription of many genes through E2F DNA elements, future studies will be needed to address the ability of C/EBPalpha to negatively regulate the promoter activity of other known E2F-regulated genes such as thymidine kinase; dihydrofolate reductase; or cyclin E, b-Myb, or E2F2 (19, 23, 48, 55).

Mechanism of c-Myc down-regulation through the E2F site. As noted above, C/EBPalpha represses c-Myc gene expression through the consensus E2F binding site located between the P1 and P2 promoter elements (Fig. 3). However, C/EBPalpha protein does not bind to this site directly (Fig. 4). Whether the mechanism for C/EBPalpha negative regulation through this E2F site is direct or indirect through protein-protein interactions remains to be determined. We have shown that C/EBPalpha can physically interact with E2F1 and other E2F family members (Fig. 5), and so we hypothesized that C/EBPalpha might disrupt E2F protein complexes binding to this DNA site. EMSA results demonstrated that C/EBPalpha protein could not directly displace E2F1 binding to the c-Myc promoter E2F site (Fig. 6).

Alternatively, C/EBPalpha may down-regulate the c-Myc gene by masking the E2F transcriptional activation domain or through protein-protein interactions which stabilize a repressive complex at the E2F site. The E2F family of transcription factors consists of six E2F members (E2F1 to E2F6) that form heterodimers with two DP family members (DP1 and DP2). E2F transcription factors are regulated by association with the Rb protein and related p107 and p130 proteins. The interaction between Rb and E2F factors is controlled by cdk's that hyperphosphorylate Rb during the transition from G1 to the S phase of the cell cycle. Phosphorylation of Rb hinders its interaction with E2F, which allows E2F protein complexes to activate transcription of E2F-regulated genes (58). We explored the possibility that C/EBPalpha , through its interaction with E2F proteins, masks the E2F transcriptional activation domain, thus resulting in down-regulation of the c-Myc promoter. CV-1 cells were cotransfected with E2F1, which activates c-Myc reporter activity, and C/EBPalpha . Our results indicate that C/EBPalpha can interfere with the E2F1 transactivation of c-Myc (Fig. 7). It has previously been shown that C/EBPalpha can interact with Rb (8). As Rb and other pocket proteins (p107 and p130) form a repressive complex with DP-E2F dimers, it is possible that C/EBPalpha acts as a type of adapter molecule, linking DP-E2F complexes to Rb to form a repressive transcriptional complex. In order to investigate this hypothesis, we replicated the above cotransfection experiment in a cell line negative for Rb expression. We obtained the same result, indicating that the block to E2F1 transactivation by C/EBPalpha is independent of Rb and that C/EBPalpha is not an adapter between E2F proteins and Rb. However, we have not ruled out the possibility that C/EBPalpha interferes with the E2F complex formation of other proteins, such as DP1 or pocket proteins p107 and p130.

Recently, Timchenko et al. showed that C/EBPalpha can cause growth arrest in fetal liver cells as well as adipocytes through disruption of E2F protein complexes (65, 66). These results indicate that C/EBPalpha interacts with p107 in fetal liver cells. DP-E2F-p107 complexes prevail in dividing cells, and thus, C/EBPalpha disruption of these complexes has a negative effect on proliferation. Moreover, overexpression of C/EBPalpha in a preadipocyte cell line caused an increase in repressive DP-E2F-p130 complexes via an increase in the p21 protein which interferes with cdk activity (66). It is possible that C/EBPalpha disrupts DP-E2F-p107 and DP-E2F-p130 complexes during myeloid differentiation. In contrast to our results, Timchenko et al. did not detect any interaction between E2F proteins and C/EBPalpha in adipocytes. Further support of our findings that C/EBPalpha interacts with the E2F1 transcription complex comes from the findings of a second group, which also detected an interaction between C/EBPalpha and E2F in NIH 3T3 cells (59). Moreover, these investigators show that this interaction interferes with the S-phase transcription of E2F-regulated genes E2F1 and dihydrofolate reductase. Therefore, the studies of both these groups along with our own results support a role for C/EBPalpha gene regulation through E2F consensus binding sites. We will further explore the significance of this interaction between E2F proteins and C/EBPalpha and disruption of interactions with pocket proteins p107 and p130 during myeloid differentiation in future studies.

C/EBPalpha interacts with E2F proteins but does not directly bind to the E2F DNA site itself. When cells were cotransfected with a dominant-negative C/EBPalpha construct that forms stable dimers with C/EBP proteins, the ability of C/EBPalpha to inhibit c-Myc promoter activity was abolished (Fig. 3B). This dominant negative contains an acidic extension after the zipper region of the protein and can form strong dimers with C/EBPalpha without stabilizing DNA. In fact, this dominant negative was designed to stoichiometrically displace C/EBPalpha from DNA (31). Since the dominant-negative C/EBPalpha dimerizes with wild-type C/EBPalpha through the bZIP region, this implies that the bZIP region of C/EBPalpha is necessary for the interference with E2F transcriptional activation domain activity. Since we have shown that C/EBPalpha cannot bind to the c-Myc E2F DNA site (Fig. 4), the dominant-negative C/EBPalpha does not act by inhibiting C/EBPalpha from binding to the c-Myc promoter. Instead, the bZIP region of C/EBPalpha is required for the interaction between C/EBPalpha and E2F proteins. Future investigations will map the interaction domains of C/EBPalpha and E2F1.

Biological consequences of c-Myc down-regulation: role in normal myelopoiesis and leukemia. Our previously published studies (16) and the results shown in Fig. 8 indicate that down-regulation of c-Myc expression allows myeloid cells to differentiate into mature granulocytes. Here, we provide a possible mechanism mediated through C/EBPalpha . The exogenous expression of c-Myc in 1137 myeloblast cells under the control of a promoter which is not responsive to C/EBPalpha -mediated down-regulation forces these cells to remain undifferentiated. Induced expression of C/EBPalpha in these 1137 cells was unable to overcome this c-Myc-mediated block to differentiation. Maintenance of c-Myc expression forces cells to remain in a proliferative state, preventing cell cycle arrest. To counteract c-Myc, C/EBPalpha must negatively regulate c-Myc gene expression to impose cellular growth arrest and allow cells to differentiate.

In addition to playing an important role in normal granulopoiesis, the reciprocal regulation of C/EBPalpha and c-Myc expression is likely to be an important factor in acute myeloid leukemia, a condition resulting from a block in myeloid maturation. In mice, maintenance of c-Myc expression using a regulatable promoter can induce myeloid leukemia (16). In humans, certain subtypes of myeloid leukemias in which C/EBPalpha expression is specifically down-regulated demonstrate a concomitant increase in c-Myc expression (T. L. Pabst and D. G. Tenen, unpublished results). Therefore, elucidating the mechanism of how C/EBPalpha down-regulates c-Myc not only will be important in understanding normal cell differentiation but may also lead to the development of novel and specific strategies for the treatment of malignancies such as myeloid leukemias that result from a block in myeloid maturation.


    ACKNOWLEDGMENTS

We thank members of the Tenen lab and especially H. Radomska for suggestions; N. Timchenko for advice on E2F gel shifts; and J. Lees, S. Chellappan, J. Nevins, C. Vinson, and W. Kaelin for generous gifts of plasmids.

This work was supported by NIH postdoctoral fellowship F32DK09892 to L.M.J. and NIH grant HL56745 (to D.G.T.).


    FOOTNOTES

* Corresponding author. Mailing address: Harvard Institutes of Medicine, Room 954, 77 Ave. Louis Pasteur, Boston, MA 02115. Phone: (617) 667-5561. Fax: (617) 667-3299. E-mail: dtenen{at}caregroup.harvard.edu.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Anfossi, G., A. M. Gewirtz, and B. Calabretta. 1989. An oligomer complementary to c-myb-encoded mRNA inhibits proliferation of human myeloid leukemia cell lines. Proc. Natl. Acad. Sci. USA 86:3379-3383[Abstract/Free Full Text].
2. Antonson, P., M. G. Pray, A. Jacobsson, and K. G. Xanthopoulos. 1995. Myc inhibits CCAAT/enhancer-binding protein alpha-gene expression in HIB-1B hibernoma cells through interactions with the core promoter region. Eur. J. Biochem. 232:397-403[Medline].
3. Battey, J., C. Moulding, R. Taub, W. Murphy, T. Stewart, H. Potter, G. Lenoir, and P. Leder. 1983. The human c-myc oncogene: structural consequences of translocation into the IgH locus in Burkitt lymphoma. Cell 34:779-787[CrossRef][Medline].
4. Behre, G., L. T. Smith, and D. G. Tenen. 1999. Use of a promoterless Renilla luciferase vector as an internal control plasmid for transient co-transfection assays of Ras-mediated transcription activation. BioTechniques 26:24-28[Medline].
5. Bellon, T., D. Perrotti, and B. Calabretta. 1997. Granulocytic differentiation of normal hematopoietic precursor cells induced by transcription factor PU.1 correlates with negative regulation of the c-myb promoter. Blood 90:1828-1839[Abstract/Free Full Text].
6. Blackwell, T. K., L. Kretzner, E. M. Blackwood, R. N. Eisenman, and H. Weintraub. 1990. Sequence-specific DNA binding by the c-Myc protein. Science 250:1149-1151[Abstract/Free Full Text].
7. Blackwood, E. M., and R. N. Eisenman. 1991. Max: a helix-loop-helix zipper protein that forms a sequence-specific DNA-binding complex with Myc. Science 251:1211-1217[Abstract/Free Full Text].
8. Chen, P. L., D. J. Riley, Y. M. Chen, and W. H. Lee. 1996. Retinoblastoma protein positively regulates terminal adipocyte differentiation through direct interaction with C/EBPs. Genes Dev. 10:2794-2804[Abstract/Free Full Text].
9. Cogswell, J. P., P. C. Cogswell, W. M. Kuehl, A. M. Cuddihy, T. M. Bender, U. Engelke, K. B. Marcu, and J. P. Y. Ting. 1993. Mechanism of c-myc regulation by c-Myb in different cell lineages. Mol. Cell. Biol. 13:2858-2869[Abstract/Free Full Text].
10. Cole, M. D., and S. B. McMahon. 1999. The Myc oncoprotein: a critical evaluation of transactivation and target gene regulation. Oncogene 18:2916-2924[CrossRef][Medline].
11. Coller, H. A., C. Grandori, P. Tamayo, T. Colbert, E. S. Lander, R. N. Eisenman, and T. R. Golub. 2000. Expression analysis with oligonucleotide microarrays reveals that MYC regulates genes involved in growth, cell cycle, signaling, and adhesion. Proc. Natl. Acad. Sci. USA 97:3260-3265[Abstract/Free Full Text].
12. Coppola, J. A., and M. D. Cole. 1986. Constitutive c-myc oncogene expression blocks mouse erythroleukaemia cell differentiation but not commitment. Nature 320:760-763[CrossRef][Medline].
13. Dalla-Favera, R., S. Martinotti, R. C. Gallo, J. Erikson, and C. M. Croce. 1983. Translocation and rearrangements of the c-myc oncogene locus in human undifferentiated B-cell lymphomas. Science 219:963-967[Abstract/Free Full Text].
14. Dang, C. V. 1999. c-Myc target genes involved in cell growth, apoptosis, and metabolism. Mol. Cell. Biol. 19:1-11[Free Full Text].
15. Felsher, D. W., and J. M. Bishop. 1999. Transient excess of MYC activity can elicit genomic instability and tumorigenesis. Proc. Natl. Acad. Sci. USA 96:3940-3944[Abstract/Free Full Text].
16. Felsher, D. W., and J. M. Bishop. 1999. Reversible tumorigenesis by MYC in hematopoietic lineages. Mol. Cell 4:199-207[CrossRef][Medline].
17. Flodby, P., C. Barlow, H. Kylefjord, L. Ahrlund-Richter, and K. G. Xanthopoulos. 1996. Increased hepatic cell proliferation and lung abnormalities in mice deficient in CCAAT/enhancer binding protein alpha . J. Biol. Chem. 271:24753-24760[Abstract/Free Full Text].
18. Freytag, S. O., and T. J. Geddes. 1992. Reciprocal regulation of adipogenesis by Myc and C/EBP alpha. Science 256:379-382[Abstract/Free Full Text].
19. Fry, C. J., J. E. Slansky, and P. J. Farnham. 1997. Position-dependent transcriptional regulation of the murine dihydrofolate reductase promoter by the E2F transactivation domain. Mol. Cell. Biol. 17:1966-1976[Abstract].
20. Golub, T. R., D. K. Slonim, P. Tamayo, C. Huard, M. Gaasenbeek, J. P. Mesirov, H. Coller, M. L. Loh, J. R. Downing, M. A. Caligiuri, C. D. Bloomfield, and E. S. Lander. 1999. Molecular classification of cancer: class discovery and class prediction by gene expression monitoring. Science 286:531-537[Abstract/Free Full Text].
21. Gonda, T. J., and D. Metcalf. 1984. Expression of myb, myc and fos proto-oncogenes during the differentiation of a murine myeloid leukaemia. Nature 310:249-251[CrossRef][Medline].
22. Hara, E., T. Yamaguchi, H. Nojima, T. Ide, J. Campisi, H. Okayama, and K. Oda. 1994. Id-related genes encoding helix-loop-helix proteins are required for G1 progression and are repressed in senescent human fibroblasts. J. Biol. Chem. 269:2139-2145[Abstract/Free Full Text].
23. Hengstschlager, M., E. Hengstschlager-Ottnad, O. Pusch, and E. Wawra. 1996. The role of p16 in the E2F-dependent thymidine kinase regulation. Oncogene 12:1635-1643[Medline].
24. Hiebert, S. W., M. Lipp, and J. R. Nevins. 1989. E1A-dependent trans-activation of the human MYC promoter is mediated by the E2F factor. Proc. Natl. Acad. Sci. USA 86:3594-3598[Abstract/Free Full Text].
25. Hoffman-Liebermann, B., and D. A. Liebermann. 1991. Suppression of c-myc and c-myb is tightly linked to terminal differentiation induced by IL6 or LIF and not growth inhibition in myeloid leukemia cells. Oncogene 6:903-909[Medline].
26. Holt, J. T., R. L. Redner, and A. W. Nienhuis. 1988. An oligomer complementary to c-myc mRNA inhibits proliferation of HL-60 promyelocytic cells and induces differentiation. Mol. Cell. Biol. 8:963-973[Abstract/Free Full Text].
27. Hubank, M., and D. G. Schatz. 1994. Identifying differences in mRNA expression by representational difference analysis of cDNA. Nucleic Acids Res. 22:5640-5648[Abstract/Free Full Text].
28. Ishida, S., K. Shudo, S. Takada, and K. Koike. 1995. A direct role of transcription factor E2F in c-myc gene expression during granulocytic and macrophage-like differentiation of HL60 cells. Cell Growth Differ. 6:229-237[Abstract].
29. Iwama, A., P. Zhang, G. J. Darlington, S. R. McKercher, R. A. Maki, and D. G. Tenen. 1998. Use of RDA analysis of knockout mice to identify myeloid genes regulated in vivo by PU.1 and C/EBPalpha . Nucleic Acids Res. 26:3034-3043[Abstract/Free Full Text].
30. Klemsz, J. M., S. R. McKercher, A. Celada, C. Van Beveren, and R. A. Maki. 1990. The macrophage and B cell-specific transcription factor PU.1 is related to the ets oncogene. Cell 61:113-124[CrossRef][Medline].
31. Krylov, D., M. Olive, and C. Vinson. 1995. Extending dimerization interfaces: the bZIP basic region can form a coiled coil. EMBO J. 14:5329-5337[Medline].
32. Larsson, L. G., M. Pettersson, F. Oberg, K. Nilsson, and B. Luscher. 1994. Expression of mad, mxi1, max and c-myc during induced differentiation of hematopoietic cells---opposite regulation of mad and c-myc. Oncogene 9:1247-1252[Medline].
33. Leder, A., P. K. Pattengale, A. Kuo, T. A. Stewart, and P. Leder. 1986. Consequences of widespread deregulation of the c-myc gene in transgenic mice: multiple neoplasms and normal development. Cell 45:485-495[CrossRef][Medline].
34. Lekstrom-Himes, J., and K. G. Xanthopoulos. 1998. Biological role of the CCAAT/enhancer-binding protein family of transcription factors. J. Biol. Chem. 273:28545-28548[Abstract/Free Full Text].
35. Li, L. H., C. Nerlov, G. Prendergast, D. MacGregor, and E. B. Ziff. 1994. c-Myc represses transcription in vivo by a novel mechanism dependent on the initiator element and Myc box II. EMBO J. 13:4070-4079[Medline].
36. Lin, F. T., and M. D. Lane. 1992. Antisense CCAAT/enhancer-binding protein RNA suppresses coordinate gene expression and triglyceride accumulation during differentiation of 3T3-L1 preadipocytes. Genes Dev. 6:533-544[Abstract/Free Full Text].
37. Lin, F. T., and M. D. Lane. 1994. CCAAT/enhancer binding protein alpha  is sufficient to initiate the 3T3-L1 adipocyte differentiation program. Proc. Natl. Acad. Sci. USA 91:8757-8761[Abstract/Free Full Text].
38. Lisitsyn, N., and M. Wigler. 1993. Cloning the differences between two complex genomes. Science 259:946-951[Abstract].
39. Liu, F., J. Poursine-Laurent, H. Y. Wu, and D. C. Link. 1997. Interleukin-6 and the granulocyte colony stimulating factor receptor are major independent regulators of granulopoiesis in vivo but are not required for lineage commitment or terminal differentiation. Blood 90:2583-2590[Abstract/Free Full Text].
40. Liu, F., H. Y. Wu, R. L. Wesselschmidt, T. Kornaga, and D. C. Link. 1996. Impaired production and increased apoptosis of neutrophils in granulocyte colony-stimulating factor receptor-deficient mice. Immunity 5:491-501[CrossRef][Medline].
41. Lodie, T. A., M. Reiner, S. Coniglio, G. Viglianti, and M. J. Fenton. 1998. Both PU.1 and nuclear factor-kappa B mediate lipopolysaccharide-induced HIV-1 long terminal repeat transcription in macrophages. J. Immunol. 161:268-276[Abstract/Free Full Text].
42. Maruyama, H., J. Kleeff, S. Wildi, H. Friess, M. W. Buchler, M. A. Israel, and M. Korc. 1999. Id-1 and Id-2 are overexpressed in pancreatic cancer and in dysplastic lesions in chronic pancreatitis. Am. J. Pathol. 155:815-822[Abstract/Free Full Text].
43. Mink, S., B. Mutschler, R. Weiskirchen, K. Bister, and K. H. Klempnauer. 1996. A novel function for myc: inhibition of C/EBP-dependent gene activation. Proc. Natl. Acad. Sci. USA 93:6635-6640[Abstract/Free Full Text].
44. Moitra, J., M. M. Mason, M. Olive, D. Krylov, O. Gavrilova, B. Marcus-Samuels, L. Feigenbaum, E. Lee, T. Aoyama, M. Eckhaus, M. L. Reitman, and C. Vinson. 1998. Life without white fat: a transgenic mouse. Genes Dev. 12:3168-3181[Abstract/Free Full Text].
45. Nordeen, S. K. 1988. Luciferase reporter gene vectors for analysis of promoters and enhancers. BioTechniques 6:454-458[Medline].
46. Obaya, A. J., M. K. Mateyak, and J. M. Sedivy. 1999. Mysterious liaisons: the relationship between c-Myc and the cell cycle. Oncogene 18:2934-2941[CrossRef][Medline].
47. O'Hagan, R. C., N. Schreiber-Agus, K. Chen, G. David, J. A. Engleman, R. Schwab, L. Alland, C. Thomson, D. R. Ronning, J. C. Sacchettini, P. Meltzer, and R. A. DePinho. 2000. Gene-target recognition among members of the MYC superfamily and implications for oncogenesis. Nat. Genet. 24:113-119[CrossRef][Medline].
48. Ohtani, K., J. DeGregori, and J. R. Nevins. 1995. Regulation of the cyclin E gene by transcription factor E2F1. Proc. Natl. Acad. Sci. USA 92:12146-12150[Abstract/Free Full Text].
49. Olive, M., D. Krylov, D. R. Echlin, K. Gardner, E. Taparowsky, and C. Vinson. 1997. A dominant negative to activation protein-1 (AP1) that abolishes DNA binding and inhibits oncogenesis. J. Biol. Chem. 272:18586-18594[Abstract/Free Full Text].
50. Osada, S., H. Yamamoto, T. Nishihara, and M. Imagawa. 1996. DNA binding specificity of the CCAAT/enhancer-binding protein transcription factor family. J. Biol. Chem. 271:3891-3896[Abstract/Free Full Text].
51. Petrovick, S. M., S. W. Hiebert, A. D. Friedman, C. J. Hetherington, D. G. Tenen, and D.-E. Zhang. 1998. Multiple functional domains of AML1: PU.1 and C/EBPalpha cooperate with different regions of AML1. Mol. Cell. Biol. 18:3915-3925[Abstract/Free Full Text].
52. Radomska, H. S., C. S. Huettner, P. Zhang, T. Cheng, D. T. Scadden, and D. G. Tenen. 1998. CCAAT/enhancer binding protein alpha  is a regulatory switch sufficient for induction of granulocytic development from bipotential myeloid progenitors. Mol. Cell. Biol. 18:4301-4314[Abstract/Free Full Text].
53. Roussel, F. M., J. N. Davis, J. L. Cleveland, J. Ghysdael, and S. W. Hiebert. 1994. Dual control of myc expression through a single DNA binding site targeted by ets family proteins and E2F-1. Oncogene 9:405-415[Medline].
54. Schmidt, M., V. Nazarov, L. Stevens, R. Watson, and L. Wolff. 2000. Regulation of the resident chromosomal copy of c-myc by c-Myb is involved in myeloid leukemogenesis. Mol. Cell. Biol. 20:1970-1981[Abstract/Free Full Text].
55. Sears, R., K. Ohtani, and J. R. Nevins. 1997. Identification of positively and negatively acting elements regulating expression of the E2F2 gene in response to cell growth signals. Mol. Cell. Biol. 17:5227-5235[Abstract].
56. Sheiness, D., L. Fanshier, and J. M. Bishop. 1978. Identification of nucleotide sequences which may encode the oncogenic capacity of avian retrovirus MC29. J. Virol. 28:600-610[Abstract/Free Full Text].
57. Shivdasani, R. A., and S. H. Orkin. 1996. The transcriptional control of hematopoiesis. Blood 87:4025-4039[Free Full Text].
58. Slansky, J. E., and P. J. Farnham. 1996. Introduction to the E2F family: protein structure and gene regulation. Curr. Top. Microbiol. Immunol. 208:1-30[Medline].
59. Slomiany, B. A., K. L. D'Arigo, M. M. Kelly, and D. T. Kurtz. 2000. C/EBPalpha inhibits cell growth via direct repression of E2F-DP-mediated transcription. Mol. Cell. Biol. 20:5986-5997[Abstract/Free Full Text].
60. Smith, L. T., S. Hohaus, D. A. Gonzalez, S. E. Dziennis, and D. G. Tenen. 1996. PU.1 (Spi-1) and C/EBPalpha regulate the granulocyte colony-stimulating factor receptor promoter in myeloid cells. Blood 88:1234-1247[Abstract/Free Full Text].
61. Spencer, C. A., and M. Groudine. 1991. Control of c-myc regulation in normal and neoplastic cells. Adv. Cancer Res. 56:1-48[Medline].
62. Tamayo, P., D. Slonim, J. Mesirov, Q. Zhu, E. Dmitrovsky, E. S. Lander, and T. R. Golub. 1999. Interpreting gene expression with self-organizing maps: methods and application to hematopoietic differentiation. Proc. Natl. Acad. Sci. USA 96:2907-2912[Abstract/Free Full Text].
63. Tenen, D. G., R. Hromas, J. D. Licht, and D.-E. Zhang. 1997. Transcription factors, normal myeloid development, and leukemia. Blood 90:489-519[Free Full Text].
64. Timchenko, N. A., T. E. Harris, M. Wilde, T. A. Bilyeu, B. L. Burgess-Beusse, M. J. Finegold, and G. J. Darlington. 1997. CCAAT/enhancer binding protein alpha  regulates p21 protein and hepatocyte proliferation in newborn mice. Mol. Cell. Biol. 17:7353-7361[Abstract].
65. Timchenko, N. A., M. Wilde, and G. J. Darlington. 1999. C/EBPalpha regulates formation of S-phase-specific E2F-p107 complexes in livers of newborn mice. Mol. Cell. Biol. 19:2936-2945[Abstract/Free Full Text].
66. Timchenko, N. A., M. Wilde, P. Iakova, J. H. Albrecht, and G. J. Darlington. 1999. E2F/p107 and E2F/p130 complexes are regulated by C/EBPalpha in 3T3-L1 adipocytes. Nucleic Acids Res. 27:3621-3630[Abstract/Free Full Text].
67. Timchenko, N. A., M. Wilde, M. Nakanishi, J. R. Smith, and G. J. Darlington. 1996. CCAAT/enhancer-binding protein alpha  (C/EBPalpha ) inhibits cell proliferation though the p21 (WAF-1/CIP-1/SDI-1) protein. Genes Dev. 10:804-815[Abstract/Free Full Text].
68. Umek, R. M., A. D. Friedman, and S. L. McKnight. 1991. CCAAT-enhancer binding protein: a component of a differentiation switch. Science 251:288-292[Abstract/Free Full Text].
69. Verona, R., K. Moberg, S. Estes, M. Starz, J. P. Vernon, and J. A. Lees. 1997. E2F activity is regulated by cell cycle-dependent changes in subcellular localization. Mol. Cell. Biol. 17:7268-7282[Abstract].
70. Wang, S., N. Nath, A. Minden, and S. Chellappan. 1999. Regulation of Rb and E2F by signal transduction cascades: divergent effects of JNK1 and p38 kinases. EMBO J. 18:1559-1570[CrossRef][Medline].
71. Watkins, P. J., J. P. Condreay, B. E. Huber, S. J. Jacobs, and D. J. Adams. 1996. Impaired proliferation and tumorigenicity induced by CCAAT/enhancer-binding protein. Cancer Res. 56:1063-1067[Abstract/Free Full Text].
72. Westin, E. H., R. C. Gallo, S. K. Arya, A. Eva, L. M. Souza, M. A. Baluda, S. A. Aaronson, and F. Wong-Staal. 1982. Differential expression of the amv gene in human hematopoietic cells. Proc. Natl. Acad. Sci. USA 79:2194-2198[Abstract/Free Full Text].
73. Zhang, D.-E., P. Zhang, N. D. Wang, C. J. Hetherington, G. J. Darlington, and D. G. Tenen. 1997. Absence of granulocyte colony-stimulating factor signaling and neutrophil development in CCAAT enhancer binding protein alpha -deficient mice. Proc. Natl. Acad. Sci. USA 94:569-574[Abstract/Free Full Text].
74. Zhang, P., A. Iwama, M. W. Datta, G. J. Darlington, D. C. Link, and D. G. Tenen. 1998. Upregulation of interleukin 6 and granulocyte colony-stimulating factor receptors by transcription factor CCAAT enhancer binding protein alpha  (C/EBPalpha ) is critical for granulopoiesis. J. Exp. Med. 188:1173-1184[Abstract/Free Full Text].
75. Zobel, A., F. Kalkbrenner, S. Guehmann, M. Nawrath, G. Vorbrueggen, and K. Moelling. 1991. Interaction of the v- and c-Myb proteins with regulatory sequences of the human c-myc gene. Oncogene 6:1397-1407[Medline].

Molecular and Cellular Biology, June 2001, p. 3789-3806, Vol. 21, No. 11
0270-7306/01/$04.00+0   DOI: 10.1128/MCB.21.11.3789-3806.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.


This article has been cited by other articles:

  • Doulatov, S., Notta, F., Rice, K. L., Howell, L., Zelent, A., Licht, J. D., Dick, J. E. (2009). PLZF is a regulator of homeostatic and cytokine-induced myeloid development. Genes Dev. 23: 2076-2087 [Abstract] [Full Text]  
  • Ho, P. A., Alonzo, T. A., Gerbing, R. B., Pollard, J., Stirewalt, D. L., Hurwitz, C., Heerema, N. A., Hirsch, B., Raimondi, S. C., Lange, B., Franklin, J. L., Radich, J. P., Meshinchi, S. (2009). Prevalence and prognostic implications of CEBPA mutations in pediatric acute myeloid leukemia (AML): a report from the Children's Oncology Group. Blood 113: 6558-6566 [Abstract] [Full Text]  
  • Koschmieder, S., Halmos, B., Levantini, E., Tenen, D. G. (2009). Dysregulation of the C/EBP{alpha} Differentiation Pathway in Human Cancer. JCO 27: 619-628 [Abstract] [Full Text]  
  • Soliera, A. R., Lidonnici, M. R., Ferrari-Amorotti, G., Prisco, M., Zhang, Y., Martinez, R. V., Donato, N. J., Calabretta, B. (2008). Transcriptional repression of c-Myb and GATA-2 is involved in the biologic effects of C/EBP{alpha} in p210BCR/ABL-expressing cells. Blood 112: 1942-1950 [Abstract] [Full Text]  
  • Koschmieder, S., D'Alo, F., Radomska, H., Schoneich, C., Chang, J. S., Konopleva, M., Kobayashi, S., Levantini, E., Suh, N., Di Ruscio, A., Voso, M. T., Watt, J. C., Santhanam, R., Sargin, B., Kantarjian, H., Andreeff, M., Sporn, M. B., Perrotti, D., Berdel, W. E., Muller-Tidow, C., Serve, H., Tenen, D. G. (2007). CDDO induces granulocytic differentiation of myeloid leukemic blasts through translational up-regulation of p42 CCAAT enhancer binding protein alpha. Blood 110: 3695-3705 [Abstract] [Full Text]  
  • Chen-Goodspeed, M., Cheng Chi Lee, (2007). Tumor Suppression and Circadian Function. J Biol Rhythms 22: 291-298 [Abstract]  
  • Chang, J. S., Santhanam, R., Trotta, R., Neviani, P., Eiring, A. M., Briercheck, E., Ronchetti, M., Roy, D. C., Calabretta, B., Caligiuri, M. A., Perrotti, D. (2007). High levels of the BCR/ABL oncoprotein are required for the MAPK-hnRNP-E2 dependent suppression of C/EBP{alpha}-driven myeloid differentiation. Blood 110: 994-1003 [Abstract] [Full Text]  
  • Lee, Y.-J., Jones, L. C., Timchenko, N. A., Perrotti, D., Tenen, D. G., Kogan, S. C. (2006). CCAAT/enhancer binding proteins alpha and epsilon cooperate with all-trans retinoic acid in therapy but differ in their antileukemic activities. Blood 108: 2416-2419 [Abstract] [Full Text]  
  • Sato, Y., Miyake, K., Kaneoka, H., Iijima, S. (2006). Sumoylation of CCAAT/Enhancer-binding Protein {alpha} and Its Functional Roles in Hepatocyte Differentiation. J. Biol. Chem. 281: 21629-21639 [Abstract] [Full Text]  
  • Yin, H., Glass, J. (2006). In Prostate Cancer Cells the Interaction of C/EBP{alpha} with Ku70, Ku80, and Poly(ADP-ribose) Polymerase-1 Increases Sensitivity to DNA Damage. J. Biol. Chem. 281: 11496-11505 [Abstract] [Full Text]  
  • Berberich-Siebelt, F., Berberich, I., Andrulis, M., Santner-Nanan, B., Jha, M. K., Klein-Hessling, S., Schimpl, A., Serfling, E. (2006). SUMOylation Interferes with CCAAT/Enhancer-Binding Protein beta-Mediated c-myc Repression, but Not IL-4 Activation in T Cells.. J. Immunol. 176: 4843-4851 [Abstract] [Full Text]  
  • Radomska, H. S., Basseres, D. S., Zheng, R., Zhang, P., Dayaram, T., Yamamoto, Y., Sternberg, D. W., Lokker, N., Giese, N. A., Bohlander, S. K., Schnittger, S., Delmotte, M.-H., Davis, R. J., Small, D., Hiddemann, W., Gilliland, D. G., Tenen, D. G. (2006). Block of C/EBP{alpha} function by phosphorylation in acute myeloid leukemia with FLT3 activating mutations. JEM 203: 371-381 [Abstract] [Full Text]  
  • Porse, B. T., Pedersen, T. A., Hasemann, M. S., Schuster, M. B., Kirstetter, P., Luedde, T., Damgaard, I., Kurz, E., Schjerling, C. K., Nerlov, C. (2006). The Proline-Histidine-Rich CDK2/CDK4 Interaction Region of C/EBP{alpha} Is Dispensable for C/EBP{alpha}-Mediated Growth Regulation In Vivo. Mol. Cell. Biol. 26: 1028-1037 [Abstract] [Full Text]  
  • Basseres, D. S., Levantini, E., Ji, H., Monti, S., Elf, S., Dayaram, T., Fenyus, M., Kocher, O., Golub, T., Wong, K.-k., Halmos, B., Tenen, D. G. (2006). Respiratory Failure Due to Differentiation Arrest and Expansion of Alveolar Cells following Lung-Specific Loss of the Transcription Factor C/EBP{alpha} in Mice. Mol. Cell. Biol. 26: 1109-1123 [Abstract] [Full Text]  
  • Gery, S., Gombart, A. F., Yi, W. S., Koeffler, C., Hofmann, W.-K., Koeffler, H. P. (2005). Transcription profiling of C/EBP targets identifies Per2 as a gene implicated in myeloid leukemia. Blood 106: 2827-2836 [Abstract] [Full Text]  
  • Porse, B. T., Bryder, D., Theilgaard-Monch, K., Hasemann, M. S., Anderson, K., Damgaard, I., Jacobsen, S. E. W., Nerlov, C. (2005). Loss of C/EBP{alpha} cell cycle control increases myeloid progenitor proliferation and transforms the neutrophil granulocyte lineage. JEM 202: 85-96 [Abstract] [Full Text]  
  • Johnson, P. F. (2005). Molecular stop signs: regulation of cell-cycle arrest by C/EBP transcription factors. J. Cell Sci. 118: 2545-2555 [Abstract] [Full Text]  
  • Gery, S., Tanosaki, S., Bose, S., Bose, N., Vadgama, J., Koeffler, H. P. (2005). Down-Regulation and Growth Inhibitory Role of C/EBP{alpha} in Breast Cancer. Clin. Cancer Res. 11: 3184-3190 [Abstract] [Full Text]  
  • Prisco, M., Maiorana, A., Guerzoni, C., Calin, G., Calabretta, B., Voit, R., Grummt, I., Baserga, R. (2004). Role of Pescadillo and Upstream Binding Factor in the Proliferation and Differentiation of Murine Myeloid Cells. Mol. Cell. Biol. 24: 5421-5433 [Abstract] [Full Text]  
  • Halmos, B., Basseres, D. S., Monti, S., D'Alo, F., Dayaram, T., Ferenczi, K., Wouters, B. J., Huettner, C. S., Golub, T. R., Tenen, D. G. (2004). A Transcriptional Profiling Study of CCAAT/Enhancer Binding Protein Targets Identifies Hepatocyte Nuclear Factor 3{beta} as a Novel Tumor Suppressor in Lung Cancer. Cancer Res. 64: 4137-4147 [Abstract] [Full Text]  
  • Wang, G.-L., Iakova, P., Wilde, M., Awad, S., Timchenko, N. A. (2004). Liver tumors escape negative control of proliferation via PI3K/Akt-mediated block of C/EBP{alpha} growth inhibitory activity. Genes Dev. 18: 912-925 [Abstract] [Full Text]  
  • Muller-Tidow, C., Steffen, B., Cauvet, T., Tickenbrock, L., Ji, P., Diederichs, S., Sargin, B., Kohler, G., Stelljes, M., Puccetti, E., Ruthardt, M., deVos, S., Hiebert, S. W., Koeffler, H. P., Berdel, W. E., Serve, H. (2004). Translocation Products in Acute Myeloid Leukemia Activate the Wnt Signaling Pathway in Hematopoietic Cells. Mol. Cell. Biol. 24: 2890-2904 [Abstract] [Full Text]  
  • Schwieger, M., Lohler, J., Fischer, M., Herwig, U., Tenen, D. G., Stocking, C. (2004). A dominant-negative mutant of C/EBP{alpha}, associated with acute myeloid leukemias, inhibits differentiation of myeloid and erythroid progenitors of man but not mouse. Blood 103: 2744-2752 [Abstract] [Full Text]  
  • Muller, C., Calkhoven, C. F., Sha, X., Leutz, A. (2004). The CCAAT Enhancer-binding Protein {alpha} (C/EBP{alpha}) Requires a SWI/SNF Complex for Proliferation Arrest. J. Biol. Chem. 279: 7353-7358 [Abstract] [Full Text]  
  • Perrotti, D., Marcucci, G., Caligiuri, M. A. (2004). Loss of C/EBP{alpha} and Favorable Prognosis of Acute Myeloid Leukemias: A Biological Paradox. JCO 22: 582-584 [Full Text]  
  • Gery, S., Gombart, A. F., Fung, Y. K., Koeffler, H. P. (2004). C/EBP{epsilon} interacts with retinoblastoma and E2F1 during granulopoiesis. Blood 103: 828-835 [Abstract] [Full Text]  
  • Ross, S. E., Radomska, H. S., Wu, B., Zhang, P., Winnay, J. N., Bajnok, L., Wright, W. S., Schaufele, F., Tenen, D. G., MacDougald, O. A. (2004). Phosphorylation of C/EBP{alpha} Inhibits Granulopoiesis. Mol. Cell. Biol. 24: 675-686 [Abstract] [Full Text]  
  • Tavor, S., Park, D. J., Gery, S., Vuong, P. T., Gombart, A. F., Koeffler, H. P. (2003). Restoration of C/EBP{alpha} Expression in a BCR-ABL+ Cell Line Induces Terminal Granulocytic Differentiation. J. Biol. Chem. 278: 52651-52659 [Abstract] [Full Text]  
  • McConnell, M. J., Chevallier, N., Berkofsky-Fessler, W., Giltnane, J. M., Malani, R. B., Staudt, L. M., Licht, J. D. (2003). Growth Suppression by Acute Promyelocytic Leukemia-Associated Protein PLZF Is Mediated by Repression of c-myc Expression. Mol. Cell. Biol. 23: 9375-9388 [Abstract] [Full Text]  
  • Marabese, M., Vikhanskaya, F., Rainelli, C., Sakai, T., Broggini, M. (2003). DNA damage induces transcriptional activation of p73 by removing C-EBP{alpha} repression on E2F1. Nucleic Acids Res 31: 6624-6632 [Abstract] [Full Text]  
  • D'Alo', F., Johansen, L. M., Nelson, E. A., Radomska, H. S., Evans, E. K., Zhang, P., Nerlov, C., Tenen, D. G. (2003). The amino terminal and E2F interaction domains are critical for C/EBP{alpha}-mediated induction of granulopoietic development of hematopoietic cells. Blood 102: 3163-3171 [Abstract] [Full Text]  
  • Wang, S. E., Wu, F. Y., Yu, Y., Hayward, G. S. (2003). CCAAT/Enhancer-Binding Protein-{alpha} Is Induced during the Early Stages of Kaposi's Sarcoma-Associated Herpesvirus (KSHV) Lytic Cycle Reactivation and Together with the KSHV Replication and Transcription Activator (RTA) Cooperatively Stimulates the Viral RTA, MTA, and PAN Promoters. J. Virol. 77: 9590-9612 [Abstract] [Full Text]  
  • Keeshan, K., Santilli, G., Corradini, F., Perrotti, D., Calabretta, B. (2003). Transcription activation function of C/EBP{alpha} is required for induction of granulocytic differentiation. Blood 102: 1267-1275 [Abstract] [Full Text]  
  • Rylski, M., Welch, J. J., Chen, Y.-Y., Letting, D. L., Diehl, J. A., Chodosh, L. A., Blobel, G. A., Weiss, M. J. (2003). GATA-1-Mediated Proliferation Arrest during Erythroid Maturation. Mol. Cell. Biol. 23: 5031-5042 [Abstract] [Full Text]  
  • Weber, M., Sydlik, C., Quirling, M., Nothdurfter, C., Zwergal, A., Heiss, P., Bell, S., Neumeier, D., Ziegler-Heitbrock, H. W. L., Brand, K. (2003). Transcriptional Inhibition of Interleukin-8 Expression in Tumor Necrosis Factor-tolerant Cells: EVIDENCE FOR INVOLVEMENT OF C/EBP{beta}. J. Biol. Chem. 278: 23586-23593 [Abstract] [Full Text]  
  • Miller, M., Shuman, J. D., Sebastian, T., Dauter, Z., Johnson, P. F. (2003). Structural Basis for DNA Recognition by the Basic Region Leucine Zipper Transcription Factor CCAAT/Enhancer-binding Protein alpha. J. Biol. Chem. 278: 15178-15184 [Abstract] [Full Text]  
  • Mizuki, M., Schwable, J., Steur, C., Choudhary, C., Agrawal, S., Sargin, B., Steffen, B., Matsumura, I., Kanakura, Y., Bohmer, F. D., Muller-Tidow, C., Berdel, W. E., Serve, H. (2003). Suppression of myeloid transcription factors and induction of STAT response genes by AML-specific Flt3 mutations. Blood 101: 3164-3173 [Abstract] [Full Text]  
  • Cammenga, J., Mulloy, J. C., Berguido, F. J., MacGrogan, D., Viale, A., Nimer, S. D. (2003). Induction of C/EBPalpha activity alters gene expression and differentiation of human CD34+ cells. Blood 101: 2206-2214 [Abstract] [Full Text]  
  • Li, B., Yang, F.-C., Clapp, D. W., Chun, K. T. (2003). Enforced expression of CUL-4A interferes with granulocytic differentiation and exit from the cell cycle. Blood 101: 1769-1776 [Abstract] [Full Text]  
  • Truong, B.-T. H., Lee, Y.-J., Lodie, T. A., Park, D. J., Perrotti, D., Watanabe, N., Koeffler, H. P., Nakajima, H., Tenen, D. G., Kogan, S. C. (2003). CCAAT/Enhancer binding proteins repress the leukemic phenotype of acute myeloid leukemia. Blood 101: 1141-1148 [Abstract] [Full Text]  
  • Strieder, V., Lutz, W. (2003). E2F Proteins Regulate MYCN Expression in Neuroblastomas. J. Biol. Chem. 278: 2983-2989 [Abstract] [Full Text]  
  • Schuster, C., Forster, K., Dierks, H., Elsasser, A., Behre, G., Simon, N., Danhauser-Riedl, S., Hallek, M., Warmuth, M. (2003). The effects of Bcr-Abl on C/EBP transcription-factor regulation and neutrophilic differentiation are reversed by the Abl kinase inhibitor imatinib mesylate. Blood 101: 655-663 [Abstract] [Full Text]  
  • Preudhomme, C., Sagot, C., Boissel, N., Cayuela, J.-M., Tigaud, I., de Botton, S., Thomas, X., Raffoux, E., Lamandin, C., Castaigne, S., Fenaux, P., Dombret, H. (2002). Favorable prognostic significance of CEBPA mutations in patients with de novo acute myeloid leukemia: a study from the Acute Leukemia French Association (ALFA). Blood 100: 2717-2723 [Abstract] [Full Text]  
  • Mueller, B. U., Pabst, T., Osato, M., Asou, N., Johansen, L. M., Minden, M. D., Behre, G., Hiddemann, W., Ito, Y., Tenen, D. G. (2002). Heterozygous PU.1 mutations are associated with acute myeloid leukemia. Blood 100: 998-1007 [Abstract] [Full Text]  
  • Wang, Q.-f., Friedman, A. D. (2002). CCAAT/enhancer-binding proteins are required for granulopoiesis independent of their induction of the granulocyte colony-stimulating factor receptor. Blood 99: 2776-2785 [Abstract] [Full Text]  
  • Wells, J., Graveel, C. R., Bartley, S. M., Madore, S. J., Farnham, P. J. (2002). The identification of E2F1-specific target genes. Proc. Natl. Acad. Sci. USA 99: 3890-3895 [Abstract] [Full Text]  
  • Gombart, A. F., Hofmann, W.-K., Kawano, S., Takeuchi, S., Krug, U., Kwok, S. H., Larsen, R. J., Asou, H., Miller, C. W., Hoelzer, D., Koeffler, H. P. (2002). Mutations in the gene encoding the transcription factor CCAAT/enhancer binding protein alpha in myelodysplastic syndromes and acute myeloid leukemias. Blood 99: 1332-1340 [Abstract] [Full Text]  
  • Halmos, B., Huettner, C. S., Kocher, O., Ferenczi, K., Karp, D. D., Tenen, D. G. (2002). Down-Regulation and Antiproliferative Role of C/EBP{alpha} in Lung Cancer. Cancer Res. 62: 528-534 [Abstract] [Full Text]  
  • Weinmann, A. S., Bartley, S. M., Zhang, T., Zhang, M. Q., Farnham, P. J. (2001). Use of Chromatin Immunoprecipitation To Clone Novel E2F Target Promoters. Mol. Cell. Biol. 21: 6820-6832 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Johansen, L. M.
Right arrow Articles by Tenen, D. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Johansen, L. M.
Right arrow Articles by Tenen, D. G.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»