Previous Article | Next Article 
Molecular and Cellular Biology, June 2001, p. 3789-3806, Vol. 21, No. 11
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.11.3789-3806.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
c-Myc Is a Critical Target for C/EBP
in
Granulopoiesis
Lisa M.
Johansen,1
Atsushi
Iwama,2
Tracey A.
Lodie,1
Koichi
Sasaki,3
Dean W.
Felsher,4
Todd R.
Golub,3 and
Daniel G.
Tenen1,*
Harvard Institutes of
Medicine1 and Dana-Farber Cancer
Institute,3 Harvard Medical School, Boston,
Massachusetts 02115; Department of Immunology, University of
Tsukuba, Tsukuba, Japan2; and
Stanford University School of Medicine, Stanford, California
04305-51154
Received 6 October 2000/Returned for modification 22 November
2000/Accepted 14 March 2001
 |
ABSTRACT |
CCAAT/enhancer binding protein
(C/EBP
) is an integral factor
in the granulocytic developmental pathway, as myeloblasts from
C/EBP
-null mice exhibit an early block in differentiation. Since
mice deficient for known C/EBP
target genes do not exhibit the same
block in granulocyte maturation, we sought to identify additional
C/EBP
target genes essential for myeloid cell development. To
identify such genes, we used both representational difference analysis
and oligonucleotide array analysis with RNA derived from a
C/EBP
-inducible myeloid cell line. From each of these independent screens, we identified c-Myc as a C/EBP
negatively regulated gene.
We mapped an E2F binding site in the c-Myc promoter as the cis-acting element critical for C/EBP
negative
regulation. The identification of c-Myc as a C/EBP
target gene is
intriguing, as it has been previously shown that down-regulation of
c-Myc can induce myeloid differentiation. Here we show that stable
expression of c-Myc from an exogenous promoter not responsive to
C/EBP
-mediated down-regulation forces myeloblasts to remain in an
undifferentiated state. Therefore, C/EBP
negative regulation of
c-Myc is critical for allowing early myeloid precursors to enter a
differentiation pathway. This is the first report to demonstrate that
C/EBP
directly affects the level of c-Myc expression and, thus, the
decision of myeloid blasts to enter into the granulocytic
differentiation pathway.
 |
INTRODUCTION |
Hematopoiesis is the process
through which mature blood cells of distinct lineages are produced from
pluripotent stem cells. Like many differentiation systems,
transcription factors that activate lineage-specific genes are
essential to the commitment and development of specific hematopoietic
lineages (57, 63). One such transcription factor essential
for commitment to and development of the granulocytic lineage is
CCAAT/enhancer binding protein
(C/EBP
).
C/EBP
is a basic leucine zipper protein (bZIP) that forms homodimers
or heterodimers with other C/EBP proteins to activate the transcription
of target genes (reviewed in references 34 and 63). In
addition to granulocytes, C/EBP
is highly expressed in many
differentiated cell types such as hepatocytes and adipocytes. A number
of reports indicate that C/EBP
has a crucial role in regulating the
balance between cell proliferation and differentiation, which is
crucial for lineage commitment of any cell type. First, C/EBP
has
been shown to cause growth arrest in adipocytes as well as in
hepatocytes (18, 64, 67, 68, 71). C/EBP
initiates
growth arrest through its ability to stabilize the expression of the
cyclin-activating kinase inhibitor (CAK), p21, as well as through
disruption of E2F transcriptional complexes during the
G1 phase of the cell cycle (64-67).
Additionally, expression of antisense C/EBP
RNA prevents both growth
arrest and terminal differentiation of 3T3 L1 adipocytes
(36). Finally, C/EBP
/
mice
exhibited improper development of lung and liver with increased hepatocyte proliferation, supporting the role of C/EBP
in the differentiation of these tissues (17). A striking feature
of the C/EBP
/
mice was the complete
absence of any mature neutrophils (73). This result
demonstrates the indispensability of C/EBP
for the granulocytic
differentiation pathway.
C/EBP
/
mice exhibit a block in
granulocytic differentiation that is early in the developmental
pathway. Fluorescence-activated cell sorter analysis of embryonic and
newborn animals demonstrated no detectable expression of the
granulocyte colony-stimulating factor (G-CSF) and interleukin-6 (IL-6)
receptors, and mRNA levels for both were drastically reduced (73,
74). Consequently, C/EBP
/
mice
exhibit a reduced response to those respective cytokines. These results
suggested that much of the C/EBP
/
phenotype could be attributed to the decrease in the levels of both the
G-CSF receptor and the IL-6 receptor and their respective signaling
pathways. However, neither G-CSF receptor
/
mice nor IL-6
/
mice exhibit serious defects
in granulocytic differentiation (39, 40). Therefore, it
was hypothesized that a cross between G-CSF
receptor
/
mice and
IL-6
/
mice would mimic the phenotype observed
with the C/EBP
/
mice alone. However, this
cross did not result in a severe defect in granulocytic
differentiation, which indicates that there must be additional C/EBP
target genes in myeloid progenitor cells necessary for mature
neutrophil development.
c-Myc is a basic helix-loop-helix (HLH) leucine zipper protein that
dimerizes with its partner Max to activate gene transcription through
consensus E-box elements located on the promoters of certain genes
(6, 7). Myc was discovered to be an oncogene causing leukemia in birds and inducing in vitro transformation of avian myeloid
cells (56). Dysregulated c-Myc expression has been
implicated in the development of lymphoid malignancies and other tumors
(13, 33), as well as in the induction of genomic
instability (15). This demonstrates the importance of
appropriate c-Myc regulation and the role of c-Myc for proper
maintenance of the cell cycle (46). c-Myc is expressed in
proliferating cells, and both c-Myc mRNA and protein levels are
virtually undetectable in terminally differentiated cells (21,
32, 72). These studies indicate that down-regulation of c-Myc is
a critical event for a cell to commit to a differentiation pathway
(12, 25). This is particularly true in differentiation of
myeloid cells (25), and treatment of myeloid cell lines
with antisense oligonucleotides that inhibit c-Myc expression induces
myeloid cell differentiation (26). Failure to
down-regulate c-Myc in transgenic mice can lead to myeloid leukemia, a
condition characterized by a block in differentiation (16).
As proliferation and differentiation are mutually exclusive, c-Myc, a
proliferative factor, and C/EBP
, a differentiation factor, act in
opposition to each other. First, c-Myc and C/EBP
act reciprocally
during adipogenesis (18). Overexpression of c-Myc blocks
the ability of adipoblasts to terminally differentiate, while the
introduction of C/EBP
overcomes this c-Myc-induced differentiation
block (37). Next, c-Myc can activate cyclin E complexes,
which results in increased active E2F transcription complexes. This
leads cells into the G1/S transition of the cell cycle. Moreover, expression of c-Myc can overcome growth arrest imposed
by the p21, p27, and p16 cyclin-dependent kinase (cdk) inhibitor
proteins (61). In contrast, C/EBP
achieves growth arrest through increased p21 CAK inhibitor protein, which ultimately results in decreased numbers of active E2F transcription complexes (65, 66). Most importantly for their opposing effects in
cells, c-Myc and C/EBP
can reciprocally regulate the expression of
their respective genes. c-Myc has previously been shown to negatively regulate C/EBP
expression and block C/EBP
transactivation
function (2, 35, 43). However, the effects of C/EBP
on
c-Myc regulation have not been investigated.
In order to identify C/EBP
targets in myeloid cells, we performed
both representational difference analysis (RDA) and oligonucleotide array screening. From both of these independent screens, we
identified c-Myc as a target gene of C/EBP
. We show that C/EBP
can directly down-regulate human c-Myc promoter activity. Moreover, we
have identified a consensus E2F site located between the P1 and P2 c-Myc promoter elements as being critical for C/EBP
negative regulation. This is the first investigation to show that C/EBP
directly affects c-Myc expression levels and thus further elucidates the mechanisms through which C/EBP
induces cellular differentiation.
 |
MATERIALS AND METHODS |
Cell culture conditions.
U937 cells stably transfected with
a zinc-inducible C/EBP
construct (U937
#2) or vector alone
[U937(vect)#1] have been described previously (52).
C/EBP
expression from the metallothionein promoter was induced by
adding 100 µM ZnSO4 to the culture medium. The
Tet-o-myc 1137 myeloblast cell line has been previously described (16). The addition of 20 ng of tetracycline/ml to the
culture medium turns off the expression of the human c-Myc transgene
which induces the cells to differentiate. 1137 cells stably transfected with a metallothionein-driven C/EBP
cDNA (1137/C/EBP
) or
metallothionein vector alone (1137/vector) were generated using
previously described methods (52). In these 1137 stably
transfected cells, the level of human c-Myc was titrated using the
indicated dilutions of tetracycline. C/EBP
expression was induced by
addition of ZnSO4 as previously described
(52). Differentiated 1137 cells were quantified by Wright-Giemsa staining and differential cell counts. Monkey kidney lines, CV-1 and COS7, as well as the Rb-Saos osteosarcoma cell line,
were maintained in Dulbecco modified Eagle medium (BioWhittaker, Walkersville, Md.) supplemented with 10% fetal bovine serum.
Plasmids and transient transfection.
A series of 5'
deletions were generated from an EcoRI/NaeI
genomic fragment of the human c-Myc gene (3) using
internal restriction sites EcoRI (
6.5 kb to +49 bp),
XmnI (
2,451 to +49 bp), PvuII (
511 to +49
bp), XbaI (
263 to +49 bp), and XhoI (
92 to
+49 bp) and subcloned into the pXP2 firefly luciferase reporter (45). The 0.14-kb mutant E2F reporter construct was
generated by PCR to produce a mutation in the consensus E2F binding
site sequence from GCGGGAAA to
GTTTCAAA. The 2.5-kb mutant E2F reporter construct was made by linearizing the pXP2 0.14-kb mutant E2F construct
with HindIII and XhoI. A
HindIII/XhoI fragment from the pXP2 2.5-kb
reporter construct was subsequently cloned into corresponding sites to
create the larger construct. The pcDNA3 C/EBP
construct was
generated by releasing a BamHI/EcoRI fragment of
rat C/EBP
cDNA from the pUC18 vector and ligating this fragment into
pcDNA3 (Invitrogen) prepared with BamHI and
EcoRI. 4HEP C/EBP
was a gift of Charles Vinson (National
Cancer Institute, Bethesda, Md.) and has been previously described
(49). pECE PU.1 was described previously
(30). The reporter construct pTK81G-CSFr contains four
consensus C/EBP
binding sites from the G-CSF receptor promoter linked in tandem and cloned into pTK81 luciferase (45,
60). Approximately 2 × 104 CV-1
cells (or Saos cells) were transfected by Lipofectamine according to
the manufacturer's instructions (Promega, Madison, Wis.) with 200 ng
of reporter gene, 20 ng of expression plasmid DNA, and 20 pg of
promoterless Renilla luciferase as an internal control.
Twenty-four hours later, firefly luciferase activities were determined
and normalized to Renilla luciferase (4).
Results are presented as the percentage of luciferase activity with
pcDNA3 vector alone set to 100% activity, except for transfections
with c-Myc reporter constructs containing a mutated E2F site, which are
given in actual relative light units. Results are given as the averages
of at least three independent experiments, and error bars represent the
standard errors of the means.
Identification of C/EBP
-regulated genes.
RDA was
performed as described previously (29) but with the
substitution of poly(A)+ mRNA derived from
U937
#2 cells stimulated with ZnSO4 for 8 and 12 h to derive the "tester" cDNA and unstimulated cells to
derive the "driver" cDNA. Nucleotide array analysis was performed
as described previously (62) but with the substitution of
RNA isolated from U937
#2 cells stimulated with
ZnSO4 for 8 and 24 h. A detailed protocol is available at http://waldo.wi.mit.edu/MPR or
http://www.genome.wi.mit.edu/MPR.
Northern analysis.
U937
#2 and U937(vect)#1 cells were
stimulated with ZnSO4, and total RNA was isolated
at the indicated time points as described previously (29).
Fifteen micrograms of each RNA sample was analyzed by Northern blotting
as described previously (29). Blots were hybridized to an
[
-32P]dCTP-labeled human c-Myc probe (a
305-bp XbaI/EcoRI cDNA fragment isolated from the
cDNA clone obtained from the RDA screen above), an
[
-32P]dCTP-labeled rat C/EBP
probe (a
300-bp HincII-BamHI cDNA fragment from the pcDNA3
C/EBP
plasmid described above), and an
[
-32P]dCTP-labeled
glyceraldehyde-3-phosphate dehydrogenase probe to control for RNA
loading and integrity. Northern blots were stripped between
hybridizations by incubation in 0.1× SSC (1× SSC is 0.15 M NaCl plus
0.015 M sodium citrate)-0.5% sodium dodecyl sulfate (SDS) at
100°C for 20 min.
Western analysis.
At the indicated time points following
treatment with ZnSO4 for U937 stable lines or
tetracycline for the 1137 cell line, cells were harvested for total
cell lysates with modified RIPA buffer (1% Triton X, 0.5% sodium
deoxycholate, 0.1% SDS, 150 mM NaCl2, 5 mM EDTA,
50 mM Tris, pH 8.0). Cell lysates were subsequently resolved on
SDS-10% polyacrylamide gels and transferred to nitrocellulose membranes (Bio-Rad). Western blots were incubated with c-Myc antisera (sc-764; Santa Cruz; 1:200 dilution), C/EBP
antisera (sc-61; Santa
Cruz; 1:250 dilution), or
-tubulin monoclonal antibody (catalog no.
1111 876; Boehringer Mannheim; 1:500 dilution) followed by a 1:5,000
dilution of an appropriate anti-mouse or anti-rabbit immunoglobulin G
antibody conjugated with horseradish peroxidase (Santa Cruz). Detection
of immune complexes was achieved by enhanced chemiluminescence (NEN
DuPont) and autoradiography. Western blots were stripped between
hybridizations by incubating blots at 65°C for 5 min in buffer
containing 62.5 mM Tris (pH 6.8), 0.02% SDS, and 10 mM
-mercaptoethanol.
In vitro protein-protein binding assays.
Glutathione
S-transferase-DP1 (GST-DP1) and GST-E2F1
were a gift of S. Chellappan and are described in reference
70. Other GST fusion proteins have previously been
described (51). GST fusion proteins were bound to a 1:1
slurry of glutathione-X-linked beads (Sigma) in GST binding buffer
(phosphate-buffered saline containing 20% glycerol, 0.1% NP-40, 1 mM
dithiothreitol [DTT], 1 mM EDTA, and 1 mM phenylmethylsulfonyl
fluoride [PMSF]). All proteins were quantitated by SDS-polyacrylamide
gel electrophoresis (PAGE) and Coomassie blue staining.
[35S] methionine-labeled rat C/EBP
and E2F1
proteins were prepared using 2 µg of pcDNA3 C/EBP
and pPS75 E2F1
(gift of William Kaelin), respectively, as template for coupled in
vitro transcription-translation (TNT kit; Promega). For the in vitro
binding assays, equal amounts of all GST proteins were incubated with 5 µl of 35S-labeled proteins. The bead volume of
all samples was adjusted to 50 µl with GST beads alone. The binding
reaction mixtures were then resuspended in a total volume of 250 µl
of protein binding buffer (10 mM Tris [pH 7.5], 150 mM
NaCl2, 1 mM DTT, and 1 mM PMSF). Bound proteins
were released by heating at 95°C in 2× SDS gel loading buffer and
resolved on SDS-10% polyacrylamide gels followed by exposure to X-ray
film for 24 h. The percentages of in vitro-translated protein
complexed with GST fusion proteins on beads were calculated with a phosphorimager.
Coimmunoprecipitation conditions.
Cytomegalovirus-E2F1 was a
gift from Jacqueline Lees (69). COS7 cells
(106) for each immunoprecipitation group were
either transfected with 20 µg of cytomegalovirus promoter-E2F1 and 5 µg of pcDNA3 C/EBP
(to yield equal protein expression) using
Lipofectamine (Gibco-BRL) according to the manufacturer's directions
or mock transfected (untransfected) by treatment with the same reagents
minus plasmid DNA. Cell lysates were harvested 24 h following
transfection by lysing cells in 200 µl of lysis buffer (50 mM
NaCl2, 150 mM Tris [pH 7.6], 0.1% NP-40, 1 mM
PMSF, and 10 µM aprotinin and leupeptin). One-thirtieth the
amounts of lysate from both untransfected and transfected cells were
used in Western analysis without immunoprecipitation as a control for
protein expression. For immunoprecipitations performed using the
U937
#2 cell line, approximately 107 cells per
experimental group were treated with ZnSO4 to
induce C/EBP
expression or left untreated. Cell lysates were
harvested at 12 h following ZnSO4 treatment
by lysing cells in 200 ml of lysis buffer. Supernatants were precleared
with 50 ml of a 1:1 slurry of protein A-agarose (Santa Cruz) in lysis
buffer with 6 µg of normal rabbit serum (NRS). The precleared
supernatants were recovered and incubated with 12 µg of either
C/EBP
antiserum or NRS antiserum (as a control) and 50 µl of a 1:1
slurry of protein A-agarose. The bound protein-protein A complexes were
washed once with lysis buffer and once with wash buffer (50 mM
NaCl2, 150 mM Tris [pH 7.6], 1 mM PMSF, and 10 µg of aprotinin and leupeptin/ml). Bound complexes were released by
being heated to 100°C for 5 min, resolved on SDS-10% polyacrylamide
gels, and analyzed by Western analysis as described above. To detect
immunoprecipitated E2F1, E2F2, or E2F4 protein, membranes were
hybridized with a 1:2,000 dilution of E2F1 antibody (sc-251x), E2F2
antiserum (sc-633x), or E2F4 antiserum (sc-1082x; Santa Cruz).
EMSAs.
Electrophoretic mobility shift assays (EMSAs) were
performed as described previously (41) using an E2F
binding site oligonucleotide (CTCAGAGGCTTGGCGGGAAAAAGAACGGAGGG) from the
human c-Myc promoter sequences located at bp
82 to
46 (GenBank
accession no. J00120) or the C/EBP
binding site oligonucleotide from
the G-CSF receptor promoter sequence extending from bp
57 to
38
(60). E2F binding reactions were performed in 20 mM Tris
(pH 7.5)-100 mM KCl-5 mM DTT-2 mM MgCl2-10%
glycerol-0.5 µg of double-stranded salmon sperm DNA with nuclear
extracts from COS7 cells transfected with E2F1 or C/EBP
plasmid.
C/EBP
binding was performed with in vitro-translated protein and
COS7 cells transfected with C/EBP
plasmid in 10 mM HEPES (pH
7.9)-50 mM KCl-5 mM MgCl2-1 mM DTT-1 mM
EDTA-1 µg of bovine serum albumin per µl-10% glycerol with 2 µg of poly(dI-dC). For specific competition, unlabeled competitor
oligonucleotide was added to the binding reaction mixtures at a
200-fold molar excess. In some competition reactions, a shorter E2F
double-stranded oligonucleotide
(GCTTGGCGGGAAAAAG) was used based on sequences located at bp
70 to
51 in the human c-Myc promoter. For supershift experiments, 3 µl of specific C/EBP
or E2F1 antiserum (200 µg/0.1 ml) (Santa Cruz) or NRS was added to the reactions. For
competition experiments with E2F1 and C/EBP
proteins, 16 µg of
nuclear extract from COS7 cells transfected with E2F1 was incubated
with increasing amounts of in vitro-translated C/EBP
. All binding
reactions were adjusted with control unprogrammed lysate to contain a
total of 25 µg of rabbit reticulocyte lysate. In competition
reactions using nuclear extract from COS7 cells cotransfected with E2F1 and C/EBP
expression plasmids, 10 mg of E2F1 was cotransfected along
with increasing amounts of C/EBP
or PU.1 for a control. Vector DNA
(pcDNA3) was added to all transfections to ensure that equal amounts of
total DNA were transfected.
 |
RESULTS |
Identification of c-Myc as a potential C/EBP
target.
Because mice devoid of the G-CSF and IL-6 signaling pathways did not
duplicate the dramatic phenotype demonstrated by the C/EBP
-targeted
mice (39), we hypothesized that there are additional C/EBP
-targeted genes required for appropriate granulocytic
differentiation. In order to identify these additional
C/EBP
-regulated genes, we performed RDA (27, 38), a
PCR-based subtractive hybridization technique using mRNA derived from a
U937 cell line stably transfected with a rat C/EBP
gene under the
control of the human metallothionein promoter, U937
#2
(52). From this RDA screen, we identified several
novel cDNAs, as well as previously identified cDNAs such as
inhibitor of differentiation 2H (Id-2H), ornithine decarboxylase, and
thyroid hormone binding protein. In addition, we identified the c-Myc
gene as a target for regulation by C/EBP
(Table
1). The discovery of c-Myc as a
C/EBP
-regulated gene is intriguing because it has been previously
shown that down-regulation of the c-Myc gene can induce myeloid
differentiation (16, 26). Additionally, c-Myc has been
shown to negatively regulate C/EBP
expression (2, 35,
43).
Although RDA is an effective technique to identify differentially
regulated genes, we have found that it has some limitations.
For
example, some differentially expressed genes can be lost during
repeated subtractive hybridization after increasing the stringency.
In
addition, RDA preferentially amplifies genes with significant
differences in expression and thus is not effective at identifying
genes with small differences in regulated expression (
29).
In
order to overcome these limitations, we performed an additional
screen for C/EBP

target genes using nucleotide array analysis
(
11,
20,
62). Recently developed array technologies allow
for the analysis of expression patterns of thousands of genes
during
cellular differentiation or in response to a particular
cellular
signal. For this screen, we again isolated mRNA from
the U937

#2 line
8 and 24 h following induction of C/EBP

expression
by treatment
with zinc. The c-Myc gene again was identified as
a gene regulated by
C/EBP

, confirming our RDA results (Table
2).
The endogenous c-Myc gene is negatively regulated by C/EBP
.
In order to confirm our screening results, we isolated RNA from both
the U937
#2 stable line and U937(vect)#1 (a U937 line stably
transfected with the metallothionein vector lacking the rat C/EBP
cDNA) (52) at various time points following treatment with
zinc to induce metallothionein promoter-C/EBP
gene expression and used this RNA in Northern analysis (Fig.
1A). Previously, we found the induced
level of C/EBP
protein to be threefold above the level of endogenous
C/EBP
in these cells. This is sufficient C/EBP
expression to
fully differentiate precursor cells along the granulocytic pathway
(52). Following induction of C/EBP
expression, the
level of endogenous c-Myc RNA dramatically decreased by 94% at 4 h following zinc treatment, corresponding to the threefold induction of
C/EBP
RNA. In contrast, the level of c-Myc mRNA remained the same in
the U937 vector cell line in which C/EBP
was not induced. These
results indicate that the level of endogenous c-Myc RNA is
substantially affected by the level of C/EBP
gene expression.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 1.
(A) The level of c-Myc RNA decreases following the
induction of C/EBP gene expression. U937 stable cell lines that
contain either a rat C/EBP cDNA under the control of the human
metallothionein promoter (U937 #2) or the empty metallothionein
expression vector alone were harvested for total RNA at the indicated
time points following the addition of ZnSO4 to the culture
medium. (Top) Northern hybridization with a c-Myc cDNA probe. (Middle)
Northern hybridization with a C/EBP cDNA probe. (Bottom) The
Northern blot was stripped and rehybridized with a
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA probe to control
for RNA loading and integrity. (B) The expression of c-Myc protein
decreases as the level of C/EBP protein increases. The U937 #2
stable line was harvested for cell lysates for Western analysis at the
indicated time points following incubation with ZnSO4.
(Top) Western blot hybridized with c-Myc antiserum. (Middle) The same
Western blot hybridized with C/EBP antiserum. (Bottom) The same
Western blot hybridized with -tubulin antibody to control for
protein loading and integrity.
|
|
In order to determine if the decrease in c-Myc mRNA corresponds to a
similar decrease in the level of c-Myc protein, we again
treated the
U937

#2 line with zinc and harvested cell lysates
for use in Western
blot analysis at the indicated time points
(Fig.
1B). Probing Western
blots with c-Myc antiserum demonstrated
that the level of c-Myc protein
dramatically decreased by 80%
at 4 h following treatment with
zinc. This decrease corresponds
to a 20-fold induction of C/EBP

protein expression at 4 h following
zinc treatment. The level of
c-Myc protein did not change in cell
lysates isolated from the
U937(vect)#1 cell line following treatment
with zinc (data not
shown).
C/EBP
negatively regulates the c-Myc promoter through an E2F
binding site.
In order to determine if C/EBP
could negatively
regulate the human c-Myc promoter itself, we utilized a human c-Myc
promoter construct cloned into the pXP2 reporter vector and performed
transfection assays to analyze c-Myc promoter activity. We
cotransfected CV-1 cells with the 6.5-kb c-Myc promoter luciferase
reporter gene along with increasing amounts of a C/EBP
expression
plasmid. The results show that C/EBP
was able to inhibit c-Myc
promoter reporter gene activity (Fig. 2)
in a dose-dependent manner, as increasing amounts of C/EBP
resulted
in a linear decrease in reporter gene activity (Fig. 2).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 2.
C/EBP down-regulates c-Myc promoter activity. (A) The
6.5-kb c-Myc promoter and indicated 5' deletions were cloned into the
pXP2 luciferase reporter vector. (B) CV-1 cells were cotransfected with
200 ng of the indicated reporter gene and increasing amounts of
C/EBP expression plasmid (nanograms). Control transfection
experiments indicated that C/EBP had no effect on the pXP2
luciferase reporter vector (data not shown). (C) As a positive control
for C/EBP transactivation, CV-1 cells were cotransfected with the
G-CSF receptor reporter gene containing four C/EBP binding sites
(pTK-G-CSFr). All transfection groups were normalized with a
Renilla luciferase vector as an internal control.
Results represent the percentages of luciferase activity with 0 ng of
C/EBP (vector alone) set to 100% activity. Results are given as the
averages of at least three independent experiments, and error bars
represent the standard errors of the means.
|
|
To identify the
cis-acting elements on the c-Myc promoter
that respond to C/EBP

, we generated 5' deletions of the 6.5-kb
promoter and cloned these deletions into the pXP2 luciferase reporter
gene (Fig.
2A). Most c-Myc promoter activity is derived from two
transcriptional start sites, P1 and P2, with 95% of transcription
initiated from the P2 promoter site (
3). We, accordingly,
based
our c-Myc promoter deletions relative to the P2 promoter.
Cotransfection
of CV-1 cells with increasing amounts of C/EBP

expression plasmid
and a series of truncated c-Myc P2 promoter reporter
genes resulted
in a linear decrease in reporter gene activity (Fig.
2B), localizing
the
cis-acting element within the smallest
c-Myc promoter construct
(see
below).
C/EBP

has previously been shown to up-regulate G-CSF receptor gene
expression as well as a construct consisting of four C/EBP
binding
sites derived from the G-CSF receptor upstream of a minimal
reporter
(pT81G-CSFr) (
60). Therefore, as a positive control
for
C/EBP

transactivation, we cotransfected CV-1 cells with the
C/EBP

expression vector and the G-CSF receptor reporter gene.
Luciferase
assays demonstrated that C/EBP

was able to transactivate
the G-CSF
receptor reporter gene, indicating that negative regulation
by C/EBP

is specific to the c-Myc promoter (Fig.
2C).
To show that C/EBP

is responsible for the negative regulation of
c-Myc, we utilized a dominant-negative C/EBP

expression
construct,
4HEP-C/EBP

(
31,
44,
49). 4HEP-C/EBP

contains
an
acidic extension that extends the coiled-coiled dimerization
interface
from the C/EBP

leucine zipper, allowing 4HEP-C/EBP
to form stable
dimers with C/EBP

without the presence of DNA.
Thus, 4HEP-C/EBP

functions as a dominant negative by preventing
the basic region of
C/EBP

from binding to DNA. 4HEP-C/EBP

was
not able to
transactivate the pT81G-CSFr reporter gene, while
wild-type C/EBP

can transactivate eightfold over vector alone
(data not shown).
Cotransfection of CV-1 cells with 4HEP-C/EBP
and c-Myc promoter
reporter genes resulted in no inhibition in
c-Myc reporter gene
activity (Fig.
3A). We cotransfected
wild-type
C/EBP

with increasing amounts of
4HEP-C/EBP

. Results showed
that 4HEP-C/EBP

was able to abolish
the ability of wild-type
C/EBP

to negatively regulate c-Myc (Fig.
3B). This indicates
that a functional C/EBP

protein is required for
negative regulation
of the c-Myc promoter. Additionally, these results
indicate that
the DNA binding and dimerization regions of C/EBP

are
necessary
for the negative c-Myc regulation. C/EBP

negative
regulation
of the c-Myc promoter is specific, as the level of c-Myc
reporter
activity was not affected by cotransfection with the Ets
transcription
factor, PU.1 (Fig.
3C).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 3.
(A) Dominant-negative C/EBP does not repress
c-Myc reporter activity. CV-1 cells were cotransfected with 200 ng of
the indicated c-Myc reporter construct along with wild-type C/EBP or
dominant-negative C/EBP (4HEP C/EBP ). (B) Dominant-negative
C/EBP interferes with wild-type C/EBP repression of c-Myc
reporter activity. CV-1 cells were cotransfected with wild-type
C/EBP along with increasing amounts of dominant-negative C/EBP
and either the 2.5-kb or 0.14-kb c-Myc reporter gene. All transfection
groups were cotransfected with a Renilla luciferase
vector as an internal control. Results represent the percentages of
luciferase activity with 0 ng of C/EBP (vector alone) set to 100%
activity. (C) Mutation of the E2F DNA binding site on c-Myc reporter
constructs abolishes C/EBP negative regulation. Wild-type and mutant
sequences of the E2F DNA binding site in the c-Myc promoter located at
residues 58 to 51 relative to the P2 promoter are shown at the top.
CV-1 cells were cotransfected with either the 2.5-kb or 0.14-kb c-Myc
reporter gene containing the wild-type or mutated E2F site along with
the C/EBP expression construct. As a control, CV-1 cells were
cotransfected with a PU.1 expression construct to demonstrate that
c-Myc promoter repression is specific to C/EBP . All transfection
groups were normalized with a Renilla luciferase vector
as an internal control. Results are presented as the averages of at
least three independent experiments, and error bars represent the
standard errors of the means.
|
|
All of our 5' c-Myc promoter deletions responded to C/EBP

regulation, and sequence analysis indicates that all c-Myc
promoter
constructs contain a consensus E2F binding site located
between
the P1 and P2 promoter elements (

65 to

58). Previous
investigations
have shown that c-Myc is positively regulated by E2F
proteins
at this site (
24,
28,
53). In order to determine
if C/EBP
negative regulation could act through this E2F binding
site, we
further deleted this site from the c-Myc promoter and
subsequently
cloned this truncated c-Myc promoter fragment (

57 to 49)
into
a luciferase reporter gene. Cotransfection of this c-Myc promoter
reporter gene with a C/EBP

expression plasmid resulted in no
decrease in c-Myc reporter gene activity, suggesting that
down-regulation
was mediated through this E2F site (data not
shown).
Because the minimal

57 to 49 region of the c-Myc promoter does not
possess as high a level of luciferase activity when transfected
into
cells, in order to demonstrate the importance of the E2F
site for
C/EBP

negative regulation, we mutated this E2F site
in the context
of our larger c-Myc promoter reporter genes (Fig.
3C). Mutation of the
E2F site in these c-Myc promoter constructs
abolished C/EBP

negative
regulation. Cotransfection of CV-1 cells
with either the 2.5- or the
0.14-kb c-Myc reporter gene containing
the mutated E2F binding site
along with a C/EBP

expression plasmid
resulted in no decrease in
reporter gene activity compared to
wild-type c-Myc promoter constructs
(Fig.
3C). These results demonstrate
that C/EBP

negative regulation
of the c-Myc promoter is mediated
through this E2F binding
site.
There are two possible mechanisms for how C/EBP

regulates c-Myc
through this E2F binding site. First, C/EBP

may regulate
c-Myc
through direct binding of C/EBP

to the E2F site. However,
this is
unlikely, as the E2F binding site nucleotide sequence
is distinct from
a consensus C/EBP

DNA binding site sequence
(
50). In
addition, we found that in vitro-translated C/EBP
protein did not
bind to an E2F consensus binding site in EMSAs
(Fig.
4A), while nuclear extracts from COS7
cells transfected
with an E2F1 expression vector demonstrated strong
binding to
this E2F site. In vitro-translated C/EBP

binds strongly
to a
consensus C/EBP binding site. The addition of E2F oligonucleotides
did not compete C/EBP

protein away from consensus C/EBP

binding
site oligonucleotides in EMSAs (Fig.
4B). In order to rule out
the
possibility that additional cellular factors may be required
for
C/EBP

binding to this E2F site, we transfected COS7 cells
with a
C/EBP

expression plasmid. Again, EMSA was performed using
nuclear
extracts harvested from these cells. Results showed that
no detectable
C/EBP

protein was complexed on this site (Fig.
4C) In contrast, EMSA
performed with a C/EBP

binding site detected
C/EBP

protein
complexes (Fig.
4D).

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 4.
C/EBP does not bind to the E2F DNA site in the c-Myc
promoter. EMSAs using 32P-labeled, double-stranded
oligonucleotides containing either an E2F site from the human c-Myc
promoter (A and C) or a C/EBP binding site from the G-CSF receptor
promoter (B and D) were performed with in vitro-translated C/EBP
protein (in vitro C/EBP ) or nuclear extracts prepared from COS7
cells overexpressing C/EBP (COS7/C/EBP ), COS7 cells
overexpressing E2F1 (COS7/E2F1) as a positive control for E2F binding,
or untransfected COS7 cells (UT). The migration of the free probe is
indicated along with the positions of E2F1 protein complexes binding to
the E2F DNA site and C/EBP binding to the C/EBP binding site. The
asterisks indicate the positions of supershifted bands following the
addition of either an E2F1 antibody or C/EBP antisera.
"competitor" refers to the 100× addition of unlabeled
double-stranded E2F or C/EBP DNA binding sites as indicated.
"NSB" refers to migration of nonspecific protein complexes binding
to the E2F DNA binding site. "Long" or "Short" E2F competitor
refers to a double-stranded E2F oligonucleotide that contains more or
less DNA sequence, respectively, flanking the E2F1 consensus site.
|
|
Since C/EBP

does not bind to the c-Myc promoter E2F site, C/EBP

may indirectly regulate c-Myc by disrupting E2F protein
complexes at
the E2F binding site. Recent reports have demonstrated
that C/EBP

can disrupt E2F protein complexes in hepatocyte and
adipocyte lines as
well as in NIH 3T3 cells (
59,
65,
66).
Initial
investigations of this c-Myc E2F site utilized the founding
member of
the E2F family, E2F1, since this was initially shown
to regulate c-Myc
(
24). To explore the possibility that C/EBP
directly
interacts with E2F1 to negatively affect its function,
we used in vitro
GST pull-down assays. In vitro-translated
[
35S]methionine-labeled C/EBP

protein was
incubated with various
bacterially expressed GST fusion proteins.
Results of pull-down
assays demonstrated that in vitro C/EBP

interacted with GST-C/EBP
and E2F1 (Fig.
5A). In
vitro-translated C/EBP

did not interact
with GST-DP1. In a
complementary experiment using in vitro-translated
[
35S]methionine-labeled E2F1 incubated with the
same set of GST fusion
proteins, we again detected an interaction
between GST-C/EBP
and E2F1 (Fig.
5B). In vitro-translated E2F1 also
interacted strongly
with its dimerization partner, GST-DP1, but not
with GST alone.
In order to demonstrate that the interaction between
E2F1 and
C/EBP

occurs in vivo, coimmunoprecipitation assays were
performed.
Because E2F1 is expressed at low levels in U937 cells (data
not
shown), COS7 cells were cotransfected with expression constructs
for both E2F1 and C/EBP

. Whole-cell extracts were immunoprecipitated
with antiserum for either C/EBP

or NRS, followed by Western analysis
with an antibody to E2F1. Results demonstrated that complexes
immunoprecipitated with C/EBP

antisera contained E2F1 protein
(Fig.
5C). The interaction between E2F1 and C/EBP

is strong,
as
quantitation with a phosphorimager indicated that 86% of the
transfected E2F1 protein is complexed with immunoprecipitated
C/EBP

protein.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 5.
C/EBP and E2F1 physically interact in vitro and
in vivo. (A) Binding of 35S-labeled in vitro-translated
C/EBP (input C/EBP ) to GST (negative control for binding),
GST-C/EBP (positive control for binding), GST-E2F1, and GST-DP1. (B)
Binding of 35S-labeled in vitro-translated E2F1 (input
E2F1) to the same GST fusion proteins. Percent input bound represents
the amount of in vitro-translated protein complexed with GST fusion
proteins as calculated using a phosphorimager (Molecular Dynamics). (C)
COS7 cells either untransfected (Unt) or transfected with E2F1 and
C/EBP expression vectors (E + C) were immunoprecipitated with
C/EBP antisera or control NRS followed by Western analysis with E2F1
antibody. As a control for E2F1 expression and migration, 1/30 of the
COS7 lysate used for immunoprecipitation was resolved by SDS-PAGE
(marked " " for immunoprecipitation antibody). The position of
E2F1 is indicated. (D) C/EBP interacts with endogenous E2F proteins
in myeloid cells. Uninduced ( ) or induced (+) U937 #2 cells were
immunoprecipitated (IP antibody) with C/EBP antisera or control NRS
followed by Western analysis with either E2F2 or E2F4 antibody. As a
control for E2F2 and E2F4 expression and migration, 1/30 of the lysate
used for immunoprecipitation was resolved by SDS-PAGE (marked " "
for immunoprecipitation antibody). The positions of E2F2 and E2F4 are
indicated.
|
|
There are five additional E2F family members (E2F2 to E2F6). As
evidenced by our EMSA, untransfected cells show significant
binding to
the c-Myc E2F site (Fig.
4C). We detected only a slight
supershift when
E2F1 antibody was added to our EMSA reactions
using nuclear extracts
from E2F1-transfected cells (Fig.
4A and
C), suggesting that other E2F
family members might bind to this
E2F site. In order to demonstrate
that C/EBP

interacts with other
endogenously expressed E2F proteins
in myeloid cells, we utilized
our U937

#2 cell line. Cells were
untreated or treated with ZnSO
4 to induce
C/EBP

expression. Whole-cell extracts were immunoprecipitated
with
antiserum against C/EBP

followed by Western analysis with
antiserum
to either E2F2 or E2F4. Results showed that, in lysates
in which
C/EBP

was induced, complexes containing E2F2 and E2F4
proteins were
immunoprecipitated (Fig.
5D). The results demonstrate
the
ability of C/EBP

and E2F proteins to form complexes in mammalian
cells. Taken together, our binding assays support a model in which
C/EBP

may disrupt E2F protein function by directly interacting
with
E2F family
members.
If the interaction with C/EBP

disrupts E2F protein binding, this
interaction could result in negative regulation of E2F-controlled
genes
such as c-Myc. In order to examine the ability of C/EBP
to disrupt
E2F1 DNA binding, we performed an EMSA using an E2F
oligonucleotide and
nuclear extracts prepared from COS7 cells
overexpressing E2F1. We then
mixed increasing amounts of in vitro-translated
C/EBP

protein into
the reactions. Results showed that increasing
amounts of C/EBP

protein had no effect on E2F1 binding to a consensus
E2F DNA binding
site (Fig.
6A). To evaluate the influence
of other
cellular factors on the interaction between E2F1 and C/EBP

,
COS7
cells were cotransfected with 10 mg of E2F1 plasmid and increasing
amounts of C/EBP

plasmid. Again, results showed that C/EBP

did
not interfere with E2F complex binding (Fig.
6B). Even though
C/EBP

may not affect E2F1 binding directly, our results indicate
that
C/EBP

strongly interacts with E2F proteins both in vitro
and in
vivo. It is possible that C/EBP

interacts with other proteins
that
complete the active E2F transcriptional complex, or alternatively,
C/EBP

may mask the E2F1 transcriptional activation domain, which
ultimately results in a loss of c-Myc expression without the direct
loss of E2F1 DNA binding function.

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 6.
C/EBP protein cannot disrupt the binding of E2F1
protein to DNA. (A) EMSAs using a 32P-labeled,
double-stranded oligonucleotide containing the E2F site from the human
c-Myc promoter were performed with nuclear extracts prepared from COS7
cells overexpressing E2F1 (COS7/E2F1). The addition of increasing
amounts of in vitro-translated C/EBP did not alter the amount of
E2F1 protein binding to the E2F DNA site. The migration of the free
probe is indicated along with the positions of E2F1 protein complexes.
The asterisk indicates the position of a supershifted band following
the addition of an E2F1 antibody. "self oligo" indicates the 100×
addition of unlabeled double-stranded E2F DNA binding site. "NSB"
indicates the migration of nonspecific protein complexes binding to the
E2F DNA binding site. "control" indicates binding reactions
performed with unprogrammed rabbit reticulocyte lysate, and
"Gata-1" indicates control binding reactions performed with in
vitro-translated GATA-1 protein. (B) EMSAs performed with the E2F site
from the c-Myc promoter and nuclear extracts from COS7 cells
cotransfected with 10 mg of E2F1 plasmid and indicated amounts of
C/EBP plasmid. For control reactions, COS7 cells were cotransfected
with PU.1 or left untransfected (UT). The migration of the free probe
is indicated along with the positions of the E2F1 protein complexes.
"self oligo" indicates the 100× addition of unlabeled
double-stranded E2F DNA binding site. "NSB" indicates the migration
of nonspecific protein binding complexes.
|
|
In order to investigate these hypotheses further, we cotransfected CV-1
cells with E2F1 to activate the 0.14-kb c-Myc reporter
(Fig.
7A). Cotransfection of increasing amounts
of C/EBP

led
to a progressive inhibition of the ability of E2F1 to
transactivate
c-Myc promoter activity (Fig.
7A). It has previously been
shown
that C/EBP

can interact with Rb (
8). Since E2F
proteins are
regulated through their association with Rb and this
association
results in repression of E2F-regulated genes, we
investigated
the possibility that C/EBP

inhibition of E2F
transactivation
activity is dependent on Rb. Therefore, we utilized the
Saos osteosarcoma
cell line, which does not express Rb. We
cotransfected E2F1 with
increasing amounts of C/EBP

, along
with the 0.14-kb c-Myc reporter
construct. Results showed that C/EBP

also was able to block E2F1
transcriptional activation domain activity
in these Rb-minus cells
(Fig.
7B). Thus, an increase in C/EBP

expression interferes with
E2F1 transcription activation activity in an
Rb-independent fashion,
and this results in repression of the c-Myc
promoter.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 7.
C/EBP interferes with E2F1 transactivation of the
c-Myc promoter. CV-1 cells or Saos (Rb ) cells were
cotransfected with 200 ng of the 0.14-kb c-Myc reporter gene (V), 20 ng
of C/EBP plasmid alone ( ), 10 ng of E2F1 plasmid alone, or
10 ng of E2F1 plasmid along with the indicated amounts of C/EBP
plasmid. All transfection groups were normalized with a
Renilla luciferase vector as an internal control.
Results represent the percentages of reporter gene or luciferase
activity with vector alone (V) set to 100% activity. Results are given
as the averages of at least three independent experiments, and error
bars represent the standard errors of the means.
|
|
c-Myc must be negatively regulated in order for myeloblasts to
differentiate into neutrophils.
To determine if c-Myc is an
important C/EBP
target gene, we investigated how Myc gene expression
affected myeloblast differentiation. Tet-o-myc 1137 is a myeloblast
cell line derived from a tumor from transgenic mice that express the
human c-Myc cDNA under the control of a tetracycline-responsive
promoter (16). Treatment with doxycycline or tetracycline
turns off c-Myc expression and drives the cells to differentiate into
neutrophils. We found that, in the absence of tetracycline, 85% of the
cells were myeloblasts, 10% were promyelocytes, and 5% were
metamyelocytes and neutrophils (Fig. 8A
and B). Following treatment with tetracycline for
24 h, which turns off c-Myc expression, the culture underwent
marked differentiation, with 28% myeloblasts, 38% promyelocytes, and 34% metamyelocytes and mature neutrophils (Fig. 8A and B).



View larger version (75K):
[in this window]
[in a new window]
|
FIG. 8.
Down-regulation of c-Myc is crucial to the granulocytic
differentiation pathway. The 1137 cell line was derived from murine
bone marrow of a transgenic line with a human c-Myc cDNA under the
control of a tetracycline-responsive promoter. The addition of
tetracycline to the culture medium turns off human c-Myc expression,
resulting in the differentiation of these myeloblasts to neutrophils.
(A) Wright-Giemsa-stained cells without (No Tet) or with (Plus Tet)
treatment with tetracycline. Cells treated with tetracycline
differentiated into myelocytes (M) and neutrophils (N). (B)
Differential analysis of Wright-Giemsa-stained slides following
treatment with tetracycline for 0, 24, and 48 h, respectively. (C)
1137 cells were harvested for cell lysates to use in Western blotting
at indicated time points following treatment with tetracycline. (Top)
Western blot hybridized with C/EBP antiserum shows that the level of
endogenous C/EBP protein increased 24 h following treatment
with tetracycline. This corresponds to the shift to mature cells seen
in panels A and B. (Middle) The same blot hybridized with c-Myc
antiserum, showing that c-Myc protein levels dramatically decreased
2 h following treatment with tetracycline. (Bottom) The same blot
hybridized with a -tubulin antibody to control for protein loading
and integrity. (D) Western analysis of 1137 stable lines with (+) and
without ( ) treatment with zinc.
"parental" indicates the 1137 parental line, "vector" indicates the 1137 stable line with
metallothionein vector, and "C/EBP " indicates the 1137 line
with metallothionein-driven C/EBP . (E) Western analysis of cell
lysates prepared from the 1137/C/EBP stable line with the indicated
treatment with tetracycline. The level of human c-Myc protein was
titrated by 100-fold dilutions of tetracycline. A 20-ng/ml
concentration turns off c-Myc expression, while a 2-ng/ml concentration
results in a low level of c-Myc expression. Lower concentrations of
tetracycline result in no decrease in c-Myc protein expression. (F)
Differential analysis of Wright-Giemsa-stained slides following
treatment of 1137 stable lines with tetracycline, zinc, or the
combination of tetracycline and zinc for 48 h.
|
|
When the 1137 cells were treated with tetracycline and harvested for
cell lysates for Western blot analysis at distinct time
points, we
determined that c-Myc protein expression was not detectable
by 2 h
following treatment with tetracycline (Fig.
8C). Moreover,
the level of
c-Myc protein remains depressed throughout the entire
experiment to the
48-h point. As the level of c-Myc protein decreased,
we observed an
increase in the level of endogenous C/EBP

protein,
especially at the
later time points (24 and 48 h), which correlated
with the shift
in 1137 cells from myeloblasts to more mature neutrophils
(Fig.
8C). In
order to further examine the role of negative regulation
of c-Myc by
C/EBP

in the differentiation process, we engineered
the 1137 myeloid
cells with either a metallothionein-driven C/EBP
cDNA or vector
alone (Fig.
8D). In this system, the levels of
C/EBP

and c-Myc could
be altered independently by adjusting levels
of zinc and tetracycline,
respectively. Because the level of c-Myc
protein in 1137 cells is
highly elevated without tetracycline,
we titrated the level of
tetracycline such that we would observe
a decrease in the level of
c-Myc protein but leave a level of
c-Myc high enough that cells would
not differentiate (Fig.
8E).
Results of Western analysis indicate that
a concentration of 2
ng of tetracycline/ml dramatically lowers the
level of c-Myc while
the majority of cells remain undifferentiated.
Treatment of 1137/C/EBP
cells with 2 ng of tetracycline/ml alone (to
lower c-Myc expression),
zinc alone (to turn on C/EBP

expression),
or both tetracycline
and zinc showed only a very slight increase in the
number of differentiated
cells compared to untreated cells (Fig.
8F).
Again, the maximum
amount of differentiation is observed with a higher
concentration
of tetracycline that essentially turns off c-Myc protein
expression
in the 1137 stable lines (Fig.
8F). The 1137/vector cells
remain
highly undifferentiated without the addition of the higher level
of tetracycline. Therefore, increased expression of C/EBP

in
1137 cells was not able to down-regulate c-Myc expression from
the
tetracycline-regulatable promoter and could not overcome the
block to
differentiation imposed by continued expression of exogenous
human
c-Myc. Taken together, these data demonstrate that c-Myc
protein
expression must be negatively regulated in order for myeloblasts
to
differentiate.
 |
DISCUSSION |
C/EBP
down-regulates c-Myc through an E2F site, suggesting that
other c-Myc and E2F target genes may lie downstream of C/EBP
.
In order to identify critical C/EBP
target genes involved in the
differentiation of granulocytic cells, we performed both RDA and
oligonucleotide array analysis (Tables 1 and 2). Both of these screens
independently identified the c-Myc gene as a target for regulation by
C/EBP
. This is the first report to demonstrate that C/EBP
is a
negative regulator of c-Myc gene expression. Using a stable
C/EBP
-inducible U937 cell line, we have shown that C/EBP
expression results in a significant decrease in the levels of
endogenous c-Myc mRNA and corresponding protein (Fig. 1). Quantitation
by phosphorimager indicates that the level of c-Myc RNA decreased only
30% by 2 h, compared with a dramatic decrease of 94% by 4 h
(Fig. 1). The level of C/EBP
protein was induced 5-fold by 2 h
and 20-fold by 4 h (Fig. 1). Therefore, the 20-fold increase in
C/EBP
protein at 4 h preceded the decrease seen in c-Myc RNA
and corresponding c-Myc protein levels. We have shown by luciferase
reporter assays that C/EBP
protein itself negatively regulates the
human c-Myc promoter (Fig. 2). Therefore, C/EBP
expression results
in a linear decrease in c-Myc reporter activity.
In addition to c-Myc, both our RDA and oligonucleotide array screens
identified several interesting C/EBP

candidate genes.
For example,
another down-regulated gene identified by the RDA
screen was Id-2H, a
basic HLH protein that antagonizes other basic
HLH proteins to inhibit
cellular differentiation and enhance cell
proliferation (
22,
42) (Table
1). Of the candidate genes
identified by the
oligonucleotide array screen (Table
2), c-Myb
is a transcription factor
expressed in hematopoietic cells whose
expression parallels that of
c-Myc, with high levels in immature
hematopoietic cells and with
expression decreasing during terminal
differentiation (
1,
5,
21,
25). As several studies have
shown that c-Myb can regulate c-Myc
gene expression (
9,
54,
75), the down-regulation of c-Myb
may contribute to the dramatic
decrease that we observed for c-Myc
expression in the presence
of C/EBP

. Whether down-regulation of
c-Myb is a direct effect
or a secondary effect of C/EBP

expression
remains to be
determined.
Of the C/EBP

target genes identified to date, c-Myc may be the most
critical target of C/EBP

, allowing myeloblasts to exit
from a
proliferative state and enter into a differentiation pathway.
Upon
further examination of our nucleotide array screen, we identified
several c-Myc target genes as being regulated by C/EBP

(Table
2).
Among the c-Myc target genes identified by our C/EBP

array
screen
are

-prothymosin, E1F4A, E1F5A, and (2'-5') oligo(A) synthetase
E,
some of which were identified in Myc microarray screens (
11,
47). c-Myc has been shown previously to up-regulate

-prothymosin,
E1F4A, and E1F5A (
10,
11,
14). In
contrast, our C/EBP

screen
demonstrated these c-Myc-dependent genes
to be down-regulated
(data not shown). As C/EBP

negatively regulates
c-Myc expression,
a secondary consequence is that c-Myc target genes
normally activated
are now down-regulated and vice versa. Additionally,
following
a search of the nucleotide database for consensus E-box
promoter
elements, we identified several additional genes potentially
regulated
by c-Myc. Hence, C/EBP

disruption of c-Myc expression
results
in a global effect on the expression of c-Myc-regulated genes
required for cells to continue in a proliferative
state.
The human c-Myc promoter contains no consensus C/EBP

DNA binding
sites. Instead, C/EBP

regulates c-Myc promoter activity
through an
E2F binding site (

57 to 49) relative to the P2 promoter
element (Fig.
3C). C/EBP

can regulate the expression of other
genes through E2F
DNA binding sites (
59). However, upon searching
the target
genes identified through our nucleotide array screen
(Table
2), we
identified only one additional candidate gene for
regulation by E2F,
ARHG, which, like c-Myc, was negatively regulated
(data not shown). To
determine whether C/EBP

can indeed regulate
transcription of many
genes through E2F DNA elements, future studies
will be needed to
address the ability of C/EBP

to negatively
regulate the promoter
activity of other known E2F-regulated genes
such as thymidine kinase;
dihydrofolate reductase; or cyclin E,
b-Myb, or E2F2 (
19,
23,
48,
55).
Mechanism of c-Myc down-regulation through the E2F site.
As
noted above, C/EBP
represses c-Myc gene expression through the
consensus E2F binding site located between the P1 and P2 promoter
elements (Fig. 3). However, C/EBP
protein does not bind to this site
directly (Fig. 4). Whether the mechanism for C/EBP
negative
regulation through this E2F site is direct or indirect through
protein-protein interactions remains to be determined. We have shown
that C/EBP
can physically interact with E2F1 and other E2F family
members (Fig. 5), and so we hypothesized that C/EBP
might disrupt
E2F protein complexes binding to this DNA site. EMSA results
demonstrated that C/EBP
protein could not directly displace E2F1
binding to the c-Myc promoter E2F site (Fig. 6).
Alternatively, C/EBP

may down-regulate the c-Myc gene by masking the
E2F transcriptional activation domain or through protein-protein
interactions which stabilize a repressive complex at the E2F site.
The
E2F family of transcription factors consists of six E2F members
(E2F1
to E2F6) that form heterodimers with two DP family members
(DP1 and
DP2). E2F transcription factors are regulated by association
with the
Rb protein and related p107 and p130 proteins. The interaction
between
Rb and E2F factors is controlled by cdk's that hyperphosphorylate
Rb
during the transition from G
1 to the S phase of
the cell cycle.
Phosphorylation of Rb hinders its interaction with E2F,
which
allows E2F protein complexes to activate transcription of
E2F-regulated
genes (
58). We explored the possibility that
C/EBP

, through
its interaction with E2F proteins, masks the E2F
transcriptional
activation domain, thus resulting in down-regulation of
the c-Myc
promoter. CV-1 cells were cotransfected with E2F1, which
activates
c-Myc reporter activity, and C/EBP

. Our results indicate
that
C/EBP

can interfere with the E2F1 transactivation of c-Myc
(Fig.
7). It has previously been shown that C/EBP

can interact with
Rb (
8). As Rb and other pocket proteins (p107 and p130)
form
a repressive complex with DP-E2F dimers, it is possible that
C/EBP
acts as a type of adapter molecule, linking DP-E2F complexes
to
Rb to form a repressive transcriptional complex. In order to
investigate
this hypothesis, we replicated the above cotransfection
experiment
in a cell line negative for Rb expression. We obtained the
same
result, indicating that the block to E2F1 transactivation by
C/EBP
is independent of Rb and that C/EBP

is not an adapter
between
E2F proteins and Rb. However, we have not ruled out the
possibility
that C/EBP

interferes with the E2F complex formation of
other
proteins, such as DP1 or pocket proteins p107 and
p130.
Recently, Timchenko et al. showed that C/EBP

can cause growth arrest
in fetal liver cells as well as adipocytes through disruption
of E2F
protein complexes (
65,
66). These results indicate
that
C/EBP

interacts with p107 in fetal liver cells. DP-E2F-p107
complexes prevail in dividing cells, and thus, C/EBP

disruption
of
these complexes has a negative effect on proliferation. Moreover,
overexpression of C/EBP

in a preadipocyte cell line caused an
increase in repressive DP-E2F-p130 complexes via an increase in
the p21
protein which interferes with cdk activity (
66). It
is possible that C/EBP

disrupts DP-E2F-p107 and DP-E2F-p130
complexes
during myeloid differentiation. In contrast to our results,
Timchenko
et al. did not detect any interaction between E2F proteins
and
C/EBP

in adipocytes. Further support of our findings that
C/EBP
interacts with the E2F1 transcription complex comes from the
findings
of a second group, which also detected an interaction between
C/EBP

and E2F in NIH 3T3 cells (
59). Moreover, these
investigators
show that this interaction interferes with the S-phase
transcription
of E2F-regulated genes E2F1 and dihydrofolate reductase.
Therefore,
the studies of both these groups along with our own results
support
a role for C/EBP

gene regulation through E2F consensus
binding
sites. We will further explore the significance of this
interaction
between E2F proteins and C/EBP

and disruption of
interactions
with pocket proteins p107 and p130 during myeloid
differentiation
in future
studies.
C/EBP

interacts with E2F proteins but does not directly bind to the
E2F DNA site itself. When cells were cotransfected with
a
dominant-negative C/EBP

construct that forms stable dimers
with
C/EBP proteins, the ability of C/EBP

to inhibit c-Myc promoter
activity was abolished (Fig.
3B). This dominant negative contains
an
acidic extension after the zipper region of the protein and
can form
strong dimers with C/EBP

without stabilizing DNA. In
fact, this
dominant negative was designed to stoichiometrically
displace C/EBP

from DNA (
31). Since the dominant-negative C/EBP
dimerizes with wild-type C/EBP

through the bZIP region, this
implies
that the bZIP region of C/EBP

is necessary for the interference
with
E2F transcriptional activation domain activity. Since we
have shown
that C/EBP

cannot bind to the c-Myc E2F DNA site (Fig.
4), the
dominant-negative C/EBP

does not act by inhibiting C/EBP
from
binding to the c-Myc promoter. Instead, the bZIP region of
C/EBP

is
required for the interaction between C/EBP

and E2F
proteins. Future
investigations will map the interaction domains
of C/EBP

and
E2F1.
Biological consequences of c-Myc down-regulation: role in normal
myelopoiesis and leukemia.
Our previously published studies
(16) and the results shown in Fig. 8 indicate that
down-regulation of c-Myc expression allows myeloid cells to
differentiate into mature granulocytes. Here, we provide a possible
mechanism mediated through C/EBP
. The exogenous expression of c-Myc
in 1137 myeloblast cells under the control of a promoter which is not
responsive to C/EBP
-mediated down-regulation forces these cells to
remain undifferentiated. Induced expression of C/EBP
in these 1137 cells was unable to overcome this c-Myc-mediated block to
differentiation. Maintenance of c-Myc expression forces cells to remain
in a proliferative state, preventing cell cycle arrest. To counteract
c-Myc, C/EBP
must negatively regulate c-Myc gene expression to
impose cellular growth arrest and allow cells to differentiate.
In addition to playing an important role in normal granulopoiesis, the
reciprocal regulation of C/EBP

and c-Myc expression
is likely to be
an important factor in acute myeloid leukemia,
a condition
resulting from a block in myeloid maturation. In mice,
maintenance of
c-Myc expression using a regulatable promoter can
induce myeloid
leukemia (
16). In humans, certain subtypes of
myeloid
leukemias in which C/EBP

expression is specifically down-regulated
demonstrate a concomitant increase in c-Myc expression (T. L.
Pabst and D. G. Tenen, unpublished results). Therefore,
elucidating
the mechanism of how C/EBP

down-regulates c-Myc not only
will
be important in understanding normal cell differentiation but
may
also lead to the development of novel and specific strategies
for the
treatment of malignancies such as myeloid leukemias that
result from a
block in myeloid
maturation.
 |
ACKNOWLEDGMENTS |
We thank members of the Tenen lab and especially H. Radomska for
suggestions; N. Timchenko for advice on E2F gel shifts; and J. Lees, S. Chellappan, J. Nevins, C. Vinson, and W. Kaelin for generous gifts of plasmids.
This work was supported by NIH postdoctoral fellowship
F32DK09892 to L.M.J. and NIH grant HL56745 (to D.G.T.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Harvard
Institutes of Medicine, Room 954, 77 Ave. Louis Pasteur, Boston, MA
02115. Phone: (617) 667-5561. Fax: (617) 667-3299. E-mail:
dtenen{at}caregroup.harvard.edu.
 |
REFERENCES |
| 1.
|
Anfossi, G.,
A. M. Gewirtz, and B. Calabretta.
1989.
An oligomer complementary to c-myb-encoded mRNA inhibits proliferation of human myeloid leukemia cell lines.
Proc. Natl. Acad. Sci. USA
86:3379-3383[Abstract/Free Full Text].
|
| 2.
|
Antonson, P.,
M. G. Pray,
A. Jacobsson, and K. G. Xanthopoulos.
1995.
Myc inhibits CCAAT/enhancer-binding protein alpha-gene expression in HIB-1B hibernoma cells through interactions with the core promoter region.
Eur. J. Biochem.
232:397-403[Medline].
|
| 3.
|
Battey, J.,
C. Moulding,
R. Taub,
W. Murphy,
T. Stewart,
H. Potter,
G. Lenoir, and P. Leder.
1983.
The human c-myc oncogene: structural consequences of translocation into the IgH locus in Burkitt lymphoma.
Cell
34:779-787[CrossRef][Medline].
|
| 4.
|
Behre, G.,
L. T. Smith, and D. G. Tenen.
1999.
Use of a promoterless Renilla luciferase vector as an internal control plasmid for transient co-transfection assays of Ras-mediated transcription activation.
BioTechniques
26:24-28[Medline].
|
| 5.
|
Bellon, T.,
D. Perrotti, and B. Calabretta.
1997.
Granulocytic differentiation of normal hematopoietic precursor cells induced by transcription factor PU.1 correlates with negative regulation of the c-myb promoter.
Blood
90:1828-1839[Abstract/Free Full Text].
|
| 6.
|
Blackwell, T. K.,
L. Kretzner,
E. M. Blackwood,
R. N. Eisenman, and H. Weintraub.
1990.
Sequence-specific DNA binding by the c-Myc protein.
Science
250:1149-1151[Abstract/Free Full Text].
|
| 7.
|
Blackwood, E. M., and R. N. Eisenman.
1991.
Max: a helix-loop-helix zipper protein that forms a sequence-specific DNA-binding complex with Myc.
Science
251:1211-1217[Abstract/Free Full Text].
|
| 8.
|
Chen, P. L.,
D. J. Riley,
Y. M. Chen, and W. H. Lee.
1996.
Retinoblastoma protein positively regulates terminal adipocyte differentiation through direct interaction with C/EBPs.
Genes Dev.
10:2794-2804[Abstract/Free Full Text].
|
| 9.
|
Cogswell, J. P.,
P. C. Cogswell,
W. M. Kuehl,
A. M. Cuddihy,
T. M. Bender,
U. Engelke,
K. B. Marcu, and J. P. Y. Ting.
1993.
Mechanism of c-myc regulation by c-Myb in different cell lineages.
Mol. Cell. Biol.
13:2858-2869[Abstract/Free Full Text].
|
| 10.
|
Cole, M. D., and S. B. McMahon.
1999.
The Myc oncoprotein: a critical evaluation of transactivation and target gene regulation.
Oncogene
18:2916-2924[CrossRef][Medline].
|
| 11.
|
Coller, H. A.,
C. Grandori,
P. Tamayo,
T. Colbert,
E. S. Lander,
R. N. Eisenman, and T. R. Golub.
2000.
Expression analysis with oligonucleotide microarrays reveals that MYC regulates genes involved in growth, cell cycle, signaling, and adhesion.
Proc. Natl. Acad. Sci. USA
97:3260-3265[Abstract/Free Full Text].
|
| 12.
|
Coppola, J. A., and M. D. Cole.
1986.
Constitutive c-myc oncogene expression blocks mouse erythroleukaemia cell differentiation but not commitment.
Nature
320:760-763[CrossRef][Medline].
|
| 13.
|
Dalla-Favera, R.,
S. Martinotti,
R. C. Gallo,
J. Erikson, and C. M. Croce.
1983.
Translocation and rearrangements of the c-myc oncogene locus in human undifferentiated B-cell lymphomas.
Science
219:963-967[Abstract/Free Full Text].
|
| 14.
|
Dang, C. V.
1999.
c-Myc target genes involved in cell growth, apoptosis, and metabolism.
Mol. Cell. Biol.
19:1-11[Free Full Text].
|
| 15.
|
Felsher, D. W., and J. M. Bishop.
1999.
Transient excess of MYC activity can elicit genomic instability and tumorigenesis.
Proc. Natl. Acad. Sci. USA
96:3940-3944[Abstract/Free Full Text].
|
| 16.
|
Felsher, D. W., and J. M. Bishop.
1999.
Reversible tumorigenesis by MYC in hematopoietic lineages.
Mol. Cell
4:199-207[CrossRef][Medline].
|
| 17.
|
Flodby, P.,
C. Barlow,
H. Kylefjord,
L. Ahrlund-Richter, and K. G. Xanthopoulos.
1996.
Increased hepatic cell proliferation and lung abnormalities in mice deficient in CCAAT/enhancer binding protein .
J. Biol. Chem.
271:24753-24760[Abstract/Free Full Text].
|
| 18.
|
Freytag, S. O., and T. J. Geddes.
1992.
Reciprocal regulation of adipogenesis by Myc and C/EBP alpha.
Science
256:379-382[Abstract/Free Full Text].
|
| 19.
|
Fry, C. J.,
J. E. Slansky, and P. J. Farnham.
1997.
Position-dependent transcriptional regulation of the murine dihydrofolate reductase promoter by the E2F transactivation domain.
Mol. Cell. Biol.
17:1966-1976[Abstract].
|
| 20.
|
Golub, T. R.,
D. K. Slonim,
P. Tamayo,
C. Huard,
M. Gaasenbeek,
J. P. Mesirov,
H. Coller,
M. L. Loh,
J. R. Downing,
M. A. Caligiuri,
C. D. Bloomfield, and E. S. Lander.
1999.
Molecular classification of cancer: class discovery and class prediction by gene expression monitoring.
Science
286:531-537[Abstract/Free Full Text].
|
| 21.
|
Gonda, T. J., and D. Metcalf.
1984.
Expression of myb, myc and fos proto-oncogenes during the differentiation of a murine myeloid leukaemia.
Nature
310:249-251[CrossRef][Medline].
|
| 22.
|
Hara, E.,
T. Yamaguchi,
H. Nojima,
T. Ide,
J. Campisi,
H. Okayama, and K. Oda.
1994.
Id-related genes encoding helix-loop-helix proteins are required for G1 progression and are repressed in senescent human fibroblasts.
J. Biol. Chem.
269:2139-2145[Abstract/Free Full Text].
|
| 23.
|
Hengstschlager, M.,
E. Hengstschlager-Ottnad,
O. Pusch, and E. Wawra.
1996.
The role of p16 in the E2F-dependent thymidine kinase regulation.
Oncogene
12:1635-1643[Medline].
|
| 24.
|
Hiebert, S. W.,
M. Lipp, and J. R. Nevins.
1989.
E1A-dependent trans-activation of the human MYC promoter is mediated by the E2F factor.
Proc. Natl. Acad. Sci. USA
86:3594-3598[Abstract/Free Full Text].
|
| 25.
|
Hoffman-Liebermann, B., and D. A. Liebermann.
1991.
Suppression of c-myc and c-myb is tightly linked to terminal differentiation induced by IL6 or LIF and not growth inhibition in myeloid leukemia cells.
Oncogene
6:903-909[Medline].
|
| 26.
|
Holt, J. T.,
R. L. Redner, and A. W. Nienhuis.
1988.
An oligomer complementary to c-myc mRNA inhibits proliferation of HL-60 promyelocytic cells and induces differentiation.
Mol. Cell. Biol.
8:963-973[Abstract/Free Full Text].
|
| 27.
|
Hubank, M., and D. G. Schatz.
1994.
Identifying differences in mRNA expression by representational difference analysis of cDNA.
Nucleic Acids Res.
22:5640-5648[Abstract/Free Full Text].
|
| 28.
|
Ishida, S.,
K. Shudo,
S. Takada, and K. Koike.
1995.
A direct role of transcription factor E2F in c-myc gene expression during granulocytic and macrophage-like differentiation of HL60 cells.
Cell Growth Differ.
6:229-237[Abstract].
|
| 29.
|
Iwama, A.,
P. Zhang,
G. J. Darlington,
S. R. McKercher,
R. A. Maki, and D. G. Tenen.
1998.
Use of RDA analysis of knockout mice to identify myeloid genes regulated in vivo by PU.1 and C/EBP .
Nucleic Acids Res.
26:3034-3043[Abstract/Free Full Text].
|
| 30.
|
Klemsz, J. M.,
S. R. McKercher,
A. Celada,
C. Van Beveren, and R. A. Maki.
1990.
The macrophage and B cell-specific transcription factor PU.1 is related to the ets oncogene.
Cell
61:113-124[CrossRef][Medline].
|
| 31.
|
Krylov, D.,
M. Olive, and C. Vinson.
1995.
Extending dimerization interfaces: the bZIP basic region can form a coiled coil.
EMBO J.
14:5329-5337[Medline].
|
| 32.
|
Larsson, L. G.,
M. Pettersson,
F. Oberg,
K. Nilsson, and B. Luscher.
1994.
Expression of mad, mxi1, max and c-myc during induced differentiation of hematopoietic cells opposite regulation of mad and c-myc.
Oncogene
9:1247-1252[Medline].
|
| 33.
|
Leder, A.,
P. K. Pattengale,
A. Kuo,
T. A. Stewart, and P. Leder.
1986.
Consequences of widespread deregulation of the c-myc gene in transgenic mice: multiple neoplasms and normal development.
Cell
45:485-495[CrossRef][Medline].
|
| 34.
|
Lekstrom-Himes, J., and K. G. Xanthopoulos.
1998.
Biological role of the CCAAT/enhancer-binding protein family of transcription factors.
J. Biol. Chem.
273:28545-28548[Abstract/Free Full Text].
|
| 35.
|
Li, L. H.,
C. Nerlov,
G. Prendergast,
D. MacGregor, and E. B. Ziff.
1994.
c-Myc represses transcription in vivo by a novel mechanism dependent on the initiator element and Myc box II.
EMBO J.
13:4070-4079[Medline].
|
| 36.
|
Lin, F. T., and M. D. Lane.
1992.
Antisense CCAAT/enhancer-binding protein RNA suppresses coordinate gene expression and triglyceride accumulation during differentiation of 3T3-L1 preadipocytes.
Genes Dev.
6:533-544[Abstract/Free Full Text].
|
| 37.
|
Lin, F. T., and M. D. Lane.
1994.
CCAAT/enhancer binding protein is sufficient to initiate the 3T3-L1 adipocyte differentiation program.
Proc. Natl. Acad. Sci. USA
91:8757-8761[Abstract/Free Full Text].
|
| 38.
|
Lisitsyn, N., and M. Wigler.
1993.
Cloning the differences between two complex genomes.
Science
259:946-951[Abstract].
|
| 39.
|
Liu, F.,
J. Poursine-Laurent,
H. Y. Wu, and D. C. Link.
1997.
Interleukin-6 and the granulocyte colony stimulating factor receptor are major independent regulators of granulopoiesis in vivo but are not required for lineage commitment or terminal differentiation.
Blood
90:2583-2590[Abstract/Free Full Text].
|
| 40.
|
Liu, F.,
H. Y. Wu,
R. L. Wesselschmidt,
T. Kornaga, and D. C. Link.
1996.
Impaired production and increased apoptosis of neutrophils in granulocyte colony-stimulating factor receptor-deficient mice.
Immunity
5:491-501[CrossRef][Medline].
|
| 41.
|
Lodie, T. A.,
M. Reiner,
S. Coniglio,
G. Viglianti, and M. J. Fenton.
1998.
Both PU.1 and nuclear factor-kappa B mediate lipopolysaccharide-induced HIV-1 long terminal repeat transcription in macrophages.
J. Immunol.
161:268-276[Abstract/Free Full Text].
|
| 42.
|
Maruyama, H.,
J. Kleeff,
S. Wildi,
H. Friess,
M. W. Buchler,
M. A. Israel, and M. Korc.
1999.
Id-1 and Id-2 are overexpressed in pancreatic cancer and in dysplastic lesions in chronic pancreatitis.
Am. J. Pathol.
155:815-822[Abstract/Free Full Text].
|
| 43.
|
Mink, S.,
B. Mutschler,
R. Weiskirchen,
K. Bister, and K. H. Klempnauer.
1996.
A novel function for myc: inhibition of C/EBP-dependent gene activation.
Proc. Natl. Acad. Sci. USA
93:6635-6640[Abstract/Free Full Text].
|
| 44.
|
Moitra, J.,
M. M. Mason,
M. Olive,
D. Krylov,
O. Gavrilova,
B. Marcus-Samuels,
L. Feigenbaum,
E. Lee,
T. Aoyama,
M. Eckhaus,
M. L. Reitman, and C. Vinson.
1998.
Life without white fat: a transgenic mouse.
Genes Dev.
12:3168-3181[Abstract/Free Full Text].
|
| 45.
|
Nordeen, S. K.
1988.
Luciferase reporter gene vectors for analysis of promoters and enhancers.
BioTechniques
6:454-458[Medline].
|
| 46.
|
Obaya, A. J.,
M. K. Mateyak, and J. M. Sedivy.
1999.
Mysterious liaisons: the relationship between c-Myc and the cell cycle.
Oncogene
18:2934-2941[CrossRef][Medline].
|
| 47.
|
O'Hagan, R. C.,
N. Schreiber-Agus,
K. Chen,
G. David,
J. A. Engleman,
R. Schwab,
L. Alland,
C. Thomson,
D. R. Ronning,
J. C. Sacchettini,
P. Meltzer, and R. A. DePinho.
2000.
Gene-target recognition among members of the MYC superfamily and implications for oncogenesis.
Nat. Genet.
24:113-119[CrossRef][Medline].
|
| 48.
|
Ohtani, K.,
J. DeGregori, and J. R. Nevins.
1995.
Regulation of the cyclin E gene by transcription factor E2F1.
Proc. Natl. Acad. Sci. USA
92:12146-12150[Abstract/Free Full Text].
|
| 49.
|
Olive, M.,
D. Krylov,
D. R. Echlin,
K. Gardner,
E. Taparowsky, and C. Vinson.
1997.
A dominant negative to activation protein-1 (AP1) that abolishes DNA binding and inhibits oncogenesis.
J. Biol. Chem.
272:18586-18594[Abstract/Free Full Text].
|
| 50.
|
Osada, S.,
H. Yamamoto,
T. Nishihara, and M. Imagawa.
1996.
DNA binding specificity of the CCAAT/enhancer-binding protein transcription factor family.
J. Biol. Chem.
271:3891-3896[Abstract/Free Full Text].
|
| 51.
|
Petrovick, S. M.,
S. W. Hiebert,
A. D. Friedman,
C. J. Hetherington,
D. G. Tenen, and D.-E. Zhang.
1998.
Multiple functional domains of AML1: PU.1 and C/EBP cooperate with different regions of AML1.
Mol. Cell. Biol.
18:3915-3925[Abstract/Free Full Text].
|
| 52.
|
Radomska, H. S.,
C. S. Huettner,
P. Zhang,
T. Cheng,
D. T. Scadden, and D. G. Tenen.
1998.
CCAAT/enhancer binding protein is a regulatory switch sufficient for induction of granulocytic development from bipotential myeloid progenitors.
Mol. Cell. Biol.
18:4301-4314[Abstract/Free Full Text].
|
| 53.
|
Roussel, F. M.,
J. N. Davis,
J. L. Cleveland,
J. Ghysdael, and S. W. Hiebert.
1994.
Dual control of myc expression through a single DNA binding site targeted by ets family proteins and E2F-1.
Oncogene
9:405-415[Medline].
|
| 54.
|
Schmidt, M.,
V. Nazarov,
L. Stevens,
R. Watson, and L. Wolff.
2000.
Regulation of the resident chromosomal copy of c-myc by c-Myb is involved in myeloid leukemogenesis.
Mol. Cell. Biol.
20:1970-1981[Abstract/Free Full Text].
|
| 55.
|
Sears, R.,
K. Ohtani, and J. R. Nevins.
1997.
Identification of positively and negatively acting elements regulating expression of the E2F2 gene in response to cell growth signals.
Mol. Cell. Biol.
17:5227-5235[Abstract].
|
| 56.
|
Sheiness, D.,
L. Fanshier, and J. M. Bishop.
1978.
Identification of nucleotide sequences which may encode the oncogenic capacity of avian retrovirus MC29.
J. Virol.
28:600-610[Abstract/Free Full Text].
|
| 57.
|
Shivdasani, R. A., and S. H. Orkin.
1996.
The transcriptional control of hematopoiesis.
Blood
87:4025-4039[Free Full Text].
|
| 58.
|
Slansky, J. E., and P. J. Farnham.
1996.
Introduction to the E2F family: protein structure and gene regulation.
Curr. Top. Microbiol. Immunol.
208:1-30[Medline].
|
| 59.
|
Slomiany, B. A.,
K. L. D'Arigo,
M. M. Kelly, and D. T. Kurtz.
2000.
C/EBP inhibits cell growth via direct repression of E2F-DP-mediated transcription.
Mol. Cell. Biol.
20:5986-5997[Abstract/Free Full Text].
|
| 60.
|
Smith, L. T.,
S. Hohaus,
D. A. Gonzalez,
S. E. Dziennis, and D. G. Tenen.
1996.
PU.1 (Spi-1) and C/EBP regulate the granulocyte colony-stimulating factor receptor promoter in myeloid cells.
Blood
88:1234-1247[Abstract/Free Full Text].
|
| 61.
|
Spencer, C. A., and M. Groudine.
1991.
Control of c-myc regulation in normal and neoplastic cells.
Adv. Cancer Res.
56:1-48[Medline].
|
| 62.
|
Tamayo, P.,
D. Slonim,
J. Mesirov,
Q. Zhu,
E. Dmitrovsky,
E. S. Lander, and T. R. Golub.
1999.
Interpreting gene expression with self-organizing maps: methods and application to hematopoietic differentiation.
Proc. Natl. Acad. Sci. USA
96:2907-2912[Abstract/Free Full Text].
|
| 63.
|
Tenen, D. G.,
R. Hromas,
J. D. Licht, and D.-E. Zhang.
1997.
Transcription factors, normal myeloid development, and leukemia.
Blood
90:489-519[Free Full Text].
|
| 64.
|
Timchenko, N. A.,
T. E. Harris,
M. Wilde,
T. A. Bilyeu,
B. L. Burgess-Beusse,
M. J. Finegold, and G. J. Darlington.
1997.
CCAAT/enhancer binding protein regulates p21 protein and hepatocyte proliferation in newborn mice.
Mol. Cell. Biol.
17:7353-7361[Abstract].
|
| 65.
|
Timchenko, N. A.,
M. Wilde, and G. J. Darlington.
1999.
C/EBP regulates formation of S-phase-specific E2F-p107 complexes in livers of newborn mice.
Mol. Cell. Biol.
19:2936-2945[Abstract/Free Full Text].
|
| 66.
|
Timchenko, N. A.,
M. Wilde,
P. Iakova,
J. H. Albrecht, and G. J. Darlington.
1999.
E2F/p107 and E2F/p130 complexes are regulated by C/EBP in 3T3-L1 adipocytes.
Nucleic Acids Res.
27:3621-3630[Abstract/Free Full Text].
|
| 67.
|
Timchenko, N. A.,
M. Wilde,
M. Nakanishi,
J. R. Smith, and G. J. Darlington.
1996.
CCAAT/enhancer-binding protein (C/EBP ) inhibits cell proliferation though the p21 (WAF-1/CIP-1/SDI-1) protein.
Genes Dev.
10:804-815[Abstract/Free Full Text].
|
| 68.
|
Umek, R. M.,
A. D. Friedman, and S. L. McKnight.
1991.
CCAAT-enhancer binding protein: a component of a differentiation switch.
Science
251:288-292[Abstract/Free Full Text].
|
| 69.
|
Verona, R.,
K. Moberg,
S. Estes,
M. Starz,
J. P. Vernon, and J. A. Lees.
1997.
E2F activity is regulated by cell cycle-dependent changes in subcellular localization.
Mol. Cell. Biol.
17:7268-7282[Abstract].
|
| 70.
|
Wang, S.,
N. Nath,
A. Minden, and S. Chellappan.
1999.
Regulation of Rb and E2F by signal transduction cascades: divergent effects of JNK1 and p38 kinases.
EMBO J.
18:1559-1570[CrossRef][Medline].
|
| 71.
|
Watkins, P. J.,
J. P. Condreay,
B. E. Huber,
S. J. Jacobs, and D. J. Adams.
1996.
Impaired proliferation and tumorigenicity induced by CCAAT/enhancer-binding protein.
Cancer Res.
56:1063-1067[Abstract/Free Full Text].
|
| 72.
|
Westin, E. H.,
R. C. Gallo,
S. K. Arya,
A. Eva,
L. M. Souza,
M. A. Baluda,
S. A. Aaronson, and F. Wong-Staal.
1982.
Differential expression of the amv gene in human hematopoietic cells.
Proc. Natl. Acad. Sci. USA
79:2194-2198[Abstract/Free Full Text].
|
| 73.
|
Zhang, D.-E.,
P. Zhang,
N. D. Wang,
C. J. Hetherington,
G. J. Darlington, and D. G. Tenen.
1997.
Absence of granulocyte colony-stimulating factor signaling and neutrophil development in CCAAT enhancer binding protein -deficient mice.
Proc. Natl. Acad. Sci. USA
94:569-574[Abstract/Free Full Text].
|
| 74.
|
Zhang, P.,
A. Iwama,
M. W. Datta,
G. J. Darlington,
D. C. Link, and D. G. Tenen.
1998.
Upregulation of interleukin 6 and granulocyte colony-stimulating factor receptors by transcription factor CCAAT enhancer binding protein (C/EBP ) is critical for granulopoiesis.
J. Exp. Med.
188:1173-1184[Abstract/Free Full Text].
|
| 75.
|
Zobel, A.,
F. Kalkbrenner,
S. Guehmann,
M. Nawrath,
G. Vorbrueggen, and K. Moelling.
1991.
Interaction of the v- and c-Myb proteins with regulatory sequences of the human c-myc gene.
Oncogene
6:1397-1407[Medline].
|
Molecular and Cellular Biology, June 2001, p. 3789-3806, Vol. 21, No. 11
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.11.3789-3806.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ho, P. A., Alonzo, T. A., Gerbing, R. B., Pollard, J., Stirewalt, D. L., Hurwitz, C., Heerema, N. A., Hirsch, B., Raimondi, S. C., Lange, B., Franklin, J. L., Radich, J. P., Meshinchi, S.
(2009). Prevalence and prognostic implications of CEBPA mutations in pediatric acute myeloid leukemia (AML): a report from the Children's Oncology Group. Blood
113: 6558-6566
[Abstract]
[Full Text]
-
Koschmieder, S., Halmos, B., Levantini, E., Tenen, D. G.
(2009). Dysregulation of the C/EBP{alpha} Differentiation Pathway in Human Cancer. JCO
27: 619-628
[Abstract]
[Full Text]
-
Soliera, A. R., Lidonnici, M. R., Ferrari-Amorotti, G., Prisco, M., Zhang, Y., Martinez, R. V., Donato, N. J., Calabretta, B.
(2008). Transcriptional repression of c-Myb and GATA-2 is involved in the biologic effects of C/EBP{alpha} in p210BCR/ABL-expressing cells. Blood
112: 1942-1950
[Abstract]
[Full Text]
-
Koschmieder, S., D'Alo, F., Radomska, H., Schoneich, C., Chang, J. S., Konopleva, M., Kobayashi, S., Levantini, E., Suh, N., Di Ruscio, A., Voso, M. T., Watt, J. C., Santhanam, R., Sargin, B., Kantarjian, H., Andreeff, M., Sporn, M. B., Perrotti, D., Berdel, W. E., Muller-Tidow, C., Serve, H., Tenen, D. G.
(2007). CDDO induces granulocytic differentiation of myeloid leukemic blasts through translational up-regulation of p42 CCAAT enhancer binding protein alpha. Blood
110: 3695-3705
[Abstract]
[Full Text]
-
Chen-Goodspeed, M., Cheng Chi Lee,
(2007). Tumor Suppression and Circadian Function. J Biol Rhythms
22: 291-298
[Abstract]
-
Chang, J. S., Santhanam, R., Trotta, R., Neviani, P., Eiring, A. M., Briercheck, E., Ronchetti, M., Roy, D. C., Calabretta, B., Caligiuri, M. A., Perrotti, D.
(2007). High levels of the BCR/ABL oncoprotein are required for the MAPK-hnRNP-E2 dependent suppression of C/EBP{alpha}-driven myeloid differentiation. Blood
110: 994-1003
[Abstract]
[Full Text]
-
Lee, Y.-J., Jones, L. C., Timchenko, N. A., Perrotti, D., Tenen, D. G., Kogan, S. C.
(2006). CCAAT/enhancer binding proteins alpha and epsilon cooperate with all-trans retinoic acid in therapy but differ in their antileukemic activities. Blood
108: 2416-2419
[Abstract]
[Full Text]
-
Sato, Y., Miyake, K., Kaneoka, H., Iijima, S.
(2006). Sumoylation of CCAAT/Enhancer-binding Protein {alpha} and Its Functional Roles in Hepatocyte Differentiation. J. Biol. Chem.
281: 21629-21639
[Abstract]
[Full Text]
-
Yin, H., Glass, J.
(2006). In Prostate Cancer Cells the Interaction of C/EBP{alpha} with Ku70, Ku80, and Poly(ADP-ribose) Polymerase-1 Increases Sensitivity to DNA Damage. J. Biol. Chem.
281: 11496-11505
[Abstract]
[Full Text]
-
Berberich-Siebelt, F., Berberich, I., Andrulis, M., Santner-Nanan, B., Jha, M. K., Klein-Hessling, S., Schimpl, A., Serfling, E.
(2006). SUMOylation Interferes with CCAAT/Enhancer-Binding Protein beta-Mediated c-myc Repression, but Not IL-4 Activation in T Cells.. J. Immunol.
176: 4843-4851
[Abstract]
[Full Text]
-
Radomska, H. S., Basseres, D. S., Zheng, R., Zhang, P., Dayaram, T., Yamamoto, Y., Sternberg, D. W., Lokker, N., Giese, N. A., Bohlander, S. K., Schnittger, S., Delmotte, M.-H., Davis, R. J., Small, D., Hiddemann, W., Gilliland, D. G., Tenen, D. G.
(2006). Block of C/EBP{alpha} function by phosphorylation in acute myeloid leukemia with FLT3 activating mutations. JEM
203: 371-381
[Abstract]
[Full Text]
-
Porse, B. T., Pedersen, T. A., Hasemann, M. S., Schuster, M. B., Kirstetter, P., Luedde, T., Damgaard, I., Kurz, E., Schjerling, C. K., Nerlov, C.
(2006). The Proline-Histidine-Rich CDK2/CDK4 Interaction Region of C/EBP{alpha} Is Dispensable for C/EBP{alpha}-Mediated Growth Regulation In Vivo. Mol. Cell. Biol.
26: 1028-1037
[Abstract]
[Full Text]
-
Basseres, D. S., Levantini, E., Ji, H., Monti, S., Elf, S., Dayaram, T., Fenyus, M., Kocher, O., Golub, T., Wong, K.-k., Halmos, B., Tenen, D. G.
(2006). Respiratory Failure Due to Differentiation Arrest and Expansion of Alveolar Cells following Lung-Specific Loss of the Transcription Factor C/EBP{alpha} in Mice. Mol. Cell. Biol.
26: 1109-1123
[Abstract]
[Full Text]
-
Gery, S., Gombart, A. F., Yi, W. S., Koeffler, C., Hofmann, W.-K., Koeffler, H. P.
(2005). Transcription profiling of C/EBP targets identifies Per2 as a gene implicated in myeloid leukemia. Blood
106: 2827-2836
[Abstract]
[Full Text]
-
Porse, B. T., Bryder, D., Theilgaard-Monch, K., Hasemann, M. S., Anderson, K., Damgaard, I., Jacobsen, S. E. W., Nerlov, C.
(2005). Loss of C/EBP{alpha} cell cycle control increases myeloid progenitor proliferation and transforms the neutrophil granulocyte lineage. JEM
202: 85-96
[Abstract]
[Full Text]
-
Johnson, P. F.
(2005). Molecular stop signs: regulation of cell-cycle arrest by C/EBP transcription factors. J. Cell Sci.
118: 2545-2555
[Abstract]
[Full Text]
-
Gery, S., Tanosaki, S., Bose, S., Bose, N., Vadgama, J., Koeffler, H. P.
(2005). Down-Regulation and Growth Inhibitory Role of C/EBP{alpha} in Breast Cancer. Clin. Cancer Res.
11: 3184-3190
[Abstract]
[Full Text]
-
Prisco, M., Maiorana, A., Guerzoni, C., Calin, G., Calabretta, B., Voit, R., Grummt, I., Baserga, R.
(2004). Role of Pescadillo and Upstream Binding Factor in the Proliferation and Differentiation of Murine Myeloid Cells. Mol. Cell. Biol.
24: 5421-5433
[Abstract]
[Full Text]
-
Halmos, B., Basseres, D. S., Monti, S., D'Alo, F., Dayaram, T., Ferenczi, K., Wouters, B. J., Huettner, C. S., Golub, T. R., Tenen, D. G.
(2004). A Transcriptional Profiling Study of CCAAT/Enhancer Binding Protein Targets Identifies Hepatocyte Nuclear Factor 3{beta} as a Novel Tumor Suppressor in Lung Cancer. Cancer Res.
64: 4137-4147
[Abstract]
[Full Text]
-
Wang, G.-L., Iakova, P., Wilde, M., Awad, S., Timchenko, N. A.
(2004). Liver tumors escape negative control of proliferation via PI3K/Akt-mediated block of C/EBP{alpha} growth inhibitory activity. Genes Dev.
18: 912-925
[Abstract]
[Full Text]
-
Muller-Tidow, C., Steffen, B., Cauvet, T., Tickenbrock, L., Ji, P., Diederichs, S., Sargin, B., Kohler, G., Stelljes, M., Puccetti, E., Ruthardt, M., deVos, S., Hiebert, S. W., Koeffler, H. P., Berdel, W. E., Serve, H.
(2004). Translocation Products in Acute Myeloid Leukemia Activate the Wnt Signaling Pathway in Hematopoietic Cells. Mol. Cell. Biol.
24: 2890-2904
[Abstract]
[Full Text]
-
Schwieger, M., Lohler, J., Fischer, M., Herwig, U., Tenen, D. G., Stocking, C.
(2004). A dominant-negative mutant of C/EBP{alpha}, associated with acute myeloid leukemias, inhibits differentiation of myeloid and erythroid progenitors of man but not mouse. Blood
103: 2744-2752
[Abstract]
[Full Text]
-
Muller, C., Calkhoven, C. F., Sha, X., Leutz, A.
(2004). The CCAAT Enhancer-binding Protein {alpha} (C/EBP{alpha}) Requires a SWI/SNF Complex for Proliferation Arrest. J. Biol. Chem.
279: 7353-7358
[Abstract]
[Full Text]
-
Perrotti, D., Marcucci, G., Caligiuri, M. A.
(2004). Loss of C/EBP{alpha} and Favorable Prognosis of Acute Myeloid Leukemias: A Biological Paradox. JCO
22: 582-584
[Full Text]
-
Gery, S., Gombart, A. F., Fung, Y. K., Koeffler, H. P.
(2004). C/EBP{epsilon} interacts with retinoblastoma and E2F1 during granulopoiesis. Blood
103: 828-835
[Abstract]
[Full Text]
-
Ross, S. E., Radomska, H. S., Wu, B., Zhang, P., Winnay, J. N., Bajnok, L., Wright, W. S., Schaufele, F., Tenen, D. G., MacDougald, O. A.
(2004). Phosphorylation of C/EBP{alpha} Inhibits Granulopoiesis. Mol. Cell. Biol.
24: 675-686
[Abstract]
[Full Text]
-
Tavor, S., Park, D. J., Gery, S., Vuong, P. T., Gombart, A. F., Koeffler, H. P.
(2003). Restoration of C/EBP{alpha} Expression in a BCR-ABL+ Cell Line Induces Terminal Granulocytic Differentiation. J. Biol. Chem.
278: 52651-52659
[Abstract]
[Full Text]
-
McConnell, M. J., Chevallier, N., Berkofsky-Fessler, W., Giltnane, J. M., Malani, R. B., Staudt, L. M., Licht, J. D.
(2003). Growth Suppression by Acute Promyelocytic Leukemia-Associated Protein PLZF Is Mediated by Repression of c-myc Expression. Mol. Cell. Biol.
23: 9375-9388
[Abstract]
[Full Text]
-
Marabese, M., Vikhanskaya, F., Rainelli, C., Sakai, T., Broggini, M.
(2003). DNA damage induces transcriptional activation of p73 by removing C-EBP{alpha} repression on E2F1. Nucleic Acids Res
31: 6624-6632
[Abstract]
[Full Text]
-
D'Alo', F., Johansen, L. M., Nelson, E. A., Radomska, H. S., Evans, E. K., Zhang, P., Nerlov, C., Tenen, D. G.
(2003). The amino terminal and E2F interaction domains are critical for C/EBP{alpha}-mediated induction of granulopoietic development of hematopoietic cells. Blood
102: 3163-3171
[Abstract]
[Full Text]
-
Wang, S. E., Wu, F. Y., Yu, Y., Hayward, G. S.
(2003). CCAAT/Enhancer-Binding Protein-{alpha} Is Induced during the Early Stages of Kaposi's Sarcoma-Associated Herpesvirus (KSHV) Lytic Cycle Reactivation and Together with the KSHV Replication and Transcription Activator (RTA) Cooperatively Stimulates the Viral RTA, MTA, and PAN Promoters. J. Virol.
77: 9590-9612
[Abstract]
[Full Text]
-
Keeshan, K., Santilli, G., Corradini, F., Perrotti, D., Calabretta, B.
(2003). Transcription activation function of C/EBP{alpha} is required for induction of granulocytic differentiation. Blood
102: 1267-1275
[Abstract]
[Full Text]
-
Rylski, M., Welch, J. J., Chen, Y.-Y., Letting, D. L., Diehl, J. A., Chodosh, L. A., Blobel, G. A., Weiss, M. J.
(2003). GATA-1-Mediated Proliferation Arrest during Erythroid Maturation. Mol. Cell. Biol.
23: 5031-5042
[Abstract]
[Full Text]
-
Weber, M., Sydlik, C., Quirling, M., Nothdurfter, C., Zwergal, A., Heiss, P., Bell, S., Neumeier, D., Ziegler-Heitbrock, H. W. L., Brand, K.
(2003). Transcriptional Inhibition of Interleukin-8 Expression in Tumor Necrosis Factor-tolerant Cells: EVIDENCE FOR INVOLVEMENT OF C/EBP{beta}. J. Biol. Chem.
278: 23586-23593
[Abstract]
[Full Text]
-
Miller, M., Shuman, J. D., Sebastian, T., Dauter, Z., Johnson, P. F.
(2003). Structural Basis for DNA Recognition by the Basic Region Leucine Zipper Transcription Factor CCAAT/Enhancer-binding Protein alpha. J. Biol. Chem.
278: 15178-15184
[Abstract]
[Full Text]
-
Mizuki, M., Schwable, J., Steur, C., Choudhary, C., Agrawal, S., Sargin, B., Steffen, B., Matsumura, I., Kanakura, Y., Bohmer, F. D., Muller-Tidow, C., Berdel, W. E., Serve, H.
(2003). Suppression of myeloid transcription factors and induction of STAT response genes by AML-specific Flt3 mutations. Blood
101: 3164-3173
[Abstract]
[Full Text]
-
Cammenga, J., Mulloy, J. C., Berguido, F. J., MacGrogan, D., Viale, A., Nimer, S. D.
(2003). Induction of C/EBPalpha activity alters gene expression and differentiation of human CD34+ cells. Blood
101: 2206-2214
[Abstract]
[Full Text]
-
Li, B., Yang, F.-C., Clapp, D. W., Chun, K. T.
(2003). Enforced expression of CUL-4A interferes with granulocytic differentiation and exit from the cell cycle. Blood
101: 1769-1776
[Abstract]
[Full Text]
-
Truong, B.-T. H., Lee, Y.-J., Lodie, T. A., Park, D. J., Perrotti, D., Watanabe, N., Koeffler, H. P., Nakajima, H., Tenen, D. G., Kogan, S. C.
(2003). CCAAT/Enhancer binding proteins repress the leukemic phenotype of acute myeloid leukemia. Blood
101: 1141-1148
[Abstract]
[Full Text]
-
Strieder, V., Lutz, W.
(2003). E2F Proteins Regulate MYCN Expression in Neuroblastomas. J. Biol. Chem.
278: 2983-2989
[Abstract]
[Full Text]
-
Schuster, C., Forster, K., Dierks, H., Elsasser, A., Behre, G., Simon, N., Danhauser-Riedl, S., Hallek, M., Warmuth, M.
(2003). The effects of Bcr-Abl on C/EBP transcription-factor regulation and neutrophilic differentiation are reversed by the Abl kinase inhibitor imatinib mesylate. Blood
101: 655-663
[Abstract]
[Full Text]
-
Preudhomme, C., Sagot, C., Boissel, N., Cayuela, J.-M., Tigaud, I., de Botton, S., Thomas, X., Raffoux, E., Lamandin, C., Castaigne, S., Fenaux, P., Dombret, H.
(2002). Favorable prognostic significance of CEBPA mutations in patients with de novo acute myeloid leukemia: a study from the Acute Leukemia French Association (ALFA). Blood
100: 2717-2723
[Abstract]
[Full Text]
-
Mueller, B. U., Pabst, T., Osato, M., Asou, N., Johansen, L. M., Minden, M. D., Behre, G., Hiddemann, W., Ito, Y., Tenen, D. G.
(2002). Heterozygous PU.1 mutations are associated with acute myeloid leukemia. Blood
100: 998-1007
[Abstract]
[Full Text]
-
Wang, Q.-f., Friedman, A. D.
(2002). CCAAT/enhancer-binding proteins are required for granulopoiesis independent of their induction of the granulocyte colony-stimulating factor receptor. Blood
99: 2776-2785
[Abstract]
[Full Text]
-
Wells, J., Graveel, C. R., Bartley, S. M., Madore, S. J., Farnham, P. J.
(2002). The identification of E2F1-specific target genes. Proc. Natl. Acad. Sci. USA
99: 3890-3895
[Abstract]
[Full Text]
-
Gombart, A. F., Hofmann, W.-K., Kawano, S., Takeuchi, S., Krug, U., Kwok, S. H., Larsen, R. J., Asou, H., Miller, C. W., Hoelzer, D., Koeffler, H. P.
(2002). Mutations in the gene encoding the transcription factor CCAAT/enhancer binding protein alpha in myelodysplastic syndromes and acute myeloid leukemias. Blood
99: 1332-1340
[Abstract]
[Full Text]
-
Halmos, B., Huettner, C. S., Kocher, O., Ferenczi, K., Karp, D. D., Tenen, D. G.
(2002). Down-Regulation and Antiproliferative Role of C/EBP{alpha} in Lung Cancer. Cancer Res.
62: 528-534
[Abstract]
[Full Text]
-
Weinmann, A. S., Bartley, S. M., Zhang, T., Zhang, M. Q., Farnham, P. J.
(2001). Use of Chromatin Immunoprecipitation To Clone Novel E2F Target Promoters. Mol. Cell. Biol.
21: 6820-6832
[Abstract]
[Full Text]