INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Hematopoiesis is the process through which mature blood cells of distinct lineages are produced from pluripotent stem cells. Like many differentiation systems, transcription factors that activate lineage-specific genes are essential to the commitment and development of specific hematopoietic lineages (57, 63). One such transcription factor essential for commitment to and development of the granulocytic lineage is CCAAT/enhancer binding protein  (C/EBP).

C/EBP is a basic leucine zipper protein (bZIP) that forms homodimers or heterodimers with other C/EBP proteins to activate the transcription of target genes (reviewed in references 34 and 63). In addition to granulocytes, C/EBP is highly expressed in many differentiated cell types such as hepatocytes and adipocytes. A number of reports indicate that C/EBP has a crucial role in regulating the balance between cell proliferation and differentiation, which is crucial for lineage commitment of any cell type. First, C/EBP has been shown to cause growth arrest in adipocytes as well as in hepatocytes (18, 64, 67, 68, 71). C/EBP initiates growth arrest through its ability to stabilize the expression of the cyclin-activating kinase inhibitor (CAK), p21, as well as through disruption of E2F transcriptional complexes during the G₁ phase of the cell cycle (64-67). Additionally, expression of antisense C/EBP RNA prevents both growth arrest and terminal differentiation of 3T3 L1 adipocytes (36). Finally, C/EBP^/ mice exhibited improper development of lung and liver with increased hepatocyte proliferation, supporting the role of C/EBP in the differentiation of these tissues (17). A striking feature of the C/EBP^/ mice was the complete absence of any mature neutrophils (73). This result demonstrates the indispensability of C/EBP for the granulocytic differentiation pathway.

C/EBP^/ mice exhibit a block in granulocytic differentiation that is early in the developmental pathway. Fluorescence-activated cell sorter analysis of embryonic and newborn animals demonstrated no detectable expression of the granulocyte colony-stimulating factor (G-CSF) and interleukin-6 (IL-6) receptors, and mRNA levels for both were drastically reduced (73, 74). Consequently, C/EBP^/ mice exhibit a reduced response to those respective cytokines. These results suggested that much of the C/EBP^/ phenotype could be attributed to the decrease in the levels of both the G-CSF receptor and the IL-6 receptor and their respective signaling pathways. However, neither G-CSF receptor^/ mice nor IL-6^/ mice exhibit serious defects in granulocytic differentiation (39, 40). Therefore, it was hypothesized that a cross between G-CSF receptor^/ mice and IL-6^/ mice would mimic the phenotype observed with the C/EBP^/ mice alone. However, this cross did not result in a severe defect in granulocytic differentiation, which indicates that there must be additional C/EBP target genes in myeloid progenitor cells necessary for mature neutrophil development.

c-Myc is a basic helix-loop-helix (HLH) leucine zipper protein that dimerizes with its partner Max to activate gene transcription through consensus E-box elements located on the promoters of certain genes (6, 7). Myc was discovered to be an oncogene causing leukemia in birds and inducing in vitro transformation of avian myeloid cells (56). Dysregulated c-Myc expression has been implicated in the development of lymphoid malignancies and other tumors (13, 33), as well as in the induction of genomic instability (15). This demonstrates the importance of appropriate c-Myc regulation and the role of c-Myc for proper maintenance of the cell cycle (46). c-Myc is expressed in proliferating cells, and both c-Myc mRNA and protein levels are virtually undetectable in terminally differentiated cells (21, 32, 72). These studies indicate that down-regulation of c-Myc is a critical event for a cell to commit to a differentiation pathway (12, 25). This is particularly true in differentiation of myeloid cells (25), and treatment of myeloid cell lines with antisense oligonucleotides that inhibit c-Myc expression induces myeloid cell differentiation (26). Failure to down-regulate c-Myc in transgenic mice can lead to myeloid leukemia, a condition characterized by a block in differentiation (16).

As proliferation and differentiation are mutually exclusive, c-Myc, a proliferative factor, and C/EBP, a differentiation factor, act in opposition to each other. First, c-Myc and C/EBP act reciprocally during adipogenesis (18). Overexpression of c-Myc blocks the ability of adipoblasts to terminally differentiate, while the introduction of C/EBP overcomes this c-Myc-induced differentiation block (37). Next, c-Myc can activate cyclin E complexes, which results in increased active E2F transcription complexes. This leads cells into the G₁/S transition of the cell cycle. Moreover, expression of c-Myc can overcome growth arrest imposed by the p21, p27, and p16 cyclin-dependent kinase (cdk) inhibitor proteins (61). In contrast, C/EBP achieves growth arrest through increased p21 CAK inhibitor protein, which ultimately results in decreased numbers of active E2F transcription complexes (65, 66). Most importantly for their opposing effects in cells, c-Myc and C/EBP can reciprocally regulate the expression of their respective genes. c-Myc has previously been shown to negatively regulate C/EBP expression and block C/EBP transactivation function (2, 35, 43). However, the effects of C/EBP on c-Myc regulation have not been investigated.

In order to identify C/EBP targets in myeloid cells, we performed both representational difference analysis (RDA) and oligonucleotide array screening. From both of these independent screens, we identified c-Myc as a target gene of C/EBP. We show that C/EBP can directly down-regulate human c-Myc promoter activity. Moreover, we have identified a consensus E2F site located between the P1 and P2 c-Myc promoter elements as being critical for C/EBP negative regulation. This is the first investigation to show that C/EBP directly affects c-Myc expression levels and thus further elucidates the mechanisms through which C/EBP induces cellular differentiation.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Cell culture conditions. U937 cells stably transfected with a zinc-inducible C/EBP construct (U937#2) or vector alone [U937(vect)#1] have been described previously (52). C/EBP expression from the metallothionein promoter was induced by adding 100 µM ZnSO₄ to the culture medium. The Tet-o-myc 1137 myeloblast cell line has been previously described (16). The addition of 20 ng of tetracycline/ml to the culture medium turns off the expression of the human c-Myc transgene which induces the cells to differentiate. 1137 cells stably transfected with a metallothionein-driven C/EBP cDNA (1137/C/EBP) or metallothionein vector alone (1137/vector) were generated using previously described methods (52). In these 1137 stably transfected cells, the level of human c-Myc was titrated using the indicated dilutions of tetracycline. C/EBP expression was induced by addition of ZnSO₄ as previously described (52). Differentiated 1137 cells were quantified by Wright-Giemsa staining and differential cell counts. Monkey kidney lines, CV-1 and COS7, as well as the Rb-Saos osteosarcoma cell line, were maintained in Dulbecco modified Eagle medium (BioWhittaker, Walkersville, Md.) supplemented with 10% fetal bovine serum.

Plasmids and transient transfection. A series of 5' deletions were generated from an EcoRI/NaeI genomic fragment of the human c-Myc gene (3) using internal restriction sites EcoRI (6.5 kb to +49 bp), XmnI (2,451 to +49 bp), PvuII (511 to +49 bp), XbaI (263 to +49 bp), and XhoI (92 to +49 bp) and subcloned into the pXP2 firefly luciferase reporter (45). The 0.14-kb mutant E2F reporter construct was generated by PCR to produce a mutation in the consensus E2F binding site sequence from GCGGGAAA to GTTTCAAA. The 2.5-kb mutant E2F reporter construct was made by linearizing the pXP2 0.14-kb mutant E2F construct with HindIII and XhoI. A HindIII/XhoI fragment from the pXP2 2.5-kb reporter construct was subsequently cloned into corresponding sites to create the larger construct. The pcDNA3 C/EBP construct was generated by releasing a BamHI/EcoRI fragment of rat C/EBP cDNA from the pUC18 vector and ligating this fragment into pcDNA3 (Invitrogen) prepared with BamHI and EcoRI. 4HEP C/EBP was a gift of Charles Vinson (National Cancer Institute, Bethesda, Md.) and has been previously described (49). pECE PU.1 was described previously (30). The reporter construct pTK81G-CSFr contains four consensus C/EBP binding sites from the G-CSF receptor promoter linked in tandem and cloned into pTK81 luciferase (45, 60). Approximately 2 × 10⁴ CV-1 cells (or Saos cells) were transfected by Lipofectamine according to the manufacturer's instructions (Promega, Madison, Wis.) with 200 ng of reporter gene, 20 ng of expression plasmid DNA, and 20 pg of promoterless Renilla luciferase as an internal control. Twenty-four hours later, firefly luciferase activities were determined and normalized to Renilla luciferase (4). Results are presented as the percentage of luciferase activity with pcDNA3 vector alone set to 100% activity, except for transfections with c-Myc reporter constructs containing a mutated E2F site, which are given in actual relative light units. Results are given as the averages of at least three independent experiments, and error bars represent the standard errors of the means.

Identification of C/EBP-regulated genes. RDA was performed as described previously (29) but with the substitution of poly(A)⁺ mRNA derived from U937#2 cells stimulated with ZnSO₄ for 8 and 12 h to derive the "tester" cDNA and unstimulated cells to derive the "driver" cDNA. Nucleotide array analysis was performed as described previously (62) but with the substitution of RNA isolated from U937#2 cells stimulated with ZnSO₄ for 8 and 24 h. A detailed protocol is available at http://waldo.wi.mit.edu/MPR or http://www.genome.wi.mit.edu/MPR.

Northern analysis. U937#2 and U937(vect)#1 cells were stimulated with ZnSO₄, and total RNA was isolated at the indicated time points as described previously (29). Fifteen micrograms of each RNA sample was analyzed by Northern blotting as described previously (29). Blots were hybridized to an [-³²P]dCTP-labeled human c-Myc probe (a 305-bp XbaI/EcoRI cDNA fragment isolated from the cDNA clone obtained from the RDA screen above), an [-³²P]dCTP-labeled rat C/EBP probe (a 300-bp HincII-BamHI cDNA fragment from the pcDNA3 C/EBP plasmid described above), and an [-³²P]dCTP-labeled glyceraldehyde-3-phosphate dehydrogenase probe to control for RNA loading and integrity. Northern blots were stripped between hybridizations by incubation in 0.1× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-0.5% sodium dodecyl sulfate (SDS) at 100°C for 20 min.

Western analysis. At the indicated time points following treatment with ZnSO₄ for U937 stable lines or tetracycline for the 1137 cell line, cells were harvested for total cell lysates with modified RIPA buffer (1% Triton X, 0.5% sodium deoxycholate, 0.1% SDS, 150 mM NaCl₂, 5 mM EDTA, 50 mM Tris, pH 8.0). Cell lysates were subsequently resolved on SDS-10% polyacrylamide gels and transferred to nitrocellulose membranes (Bio-Rad). Western blots were incubated with c-Myc antisera (sc-764; Santa Cruz; 1:200 dilution), C/EBP antisera (sc-61; Santa Cruz; 1:250 dilution), or -tubulin monoclonal antibody (catalog no. 1111 876; Boehringer Mannheim; 1:500 dilution) followed by a 1:5,000 dilution of an appropriate anti-mouse or anti-rabbit immunoglobulin G antibody conjugated with horseradish peroxidase (Santa Cruz). Detection of immune complexes was achieved by enhanced chemiluminescence (NEN DuPont) and autoradiography. Western blots were stripped between hybridizations by incubating blots at 65°C for 5 min in buffer containing 62.5 mM Tris (pH 6.8), 0.02% SDS, and 10 mM -mercaptoethanol.

In vitro protein-protein binding assays. Glutathione S-transferase-DP1 (GST-DP1) and GST-E2F1 were a gift of S. Chellappan and are described in reference 70. Other GST fusion proteins have previously been described (51). GST fusion proteins were bound to a 1:1 slurry of glutathione-X-linked beads (Sigma) in GST binding buffer (phosphate-buffered saline containing 20% glycerol, 0.1% NP-40, 1 mM dithiothreitol [DTT], 1 mM EDTA, and 1 mM phenylmethylsulfonyl fluoride [PMSF]). All proteins were quantitated by SDS-polyacrylamide gel electrophoresis (PAGE) and Coomassie blue staining. [³⁵S] methionine-labeled rat C/EBP and E2F1 proteins were prepared using 2 µg of pcDNA3 C/EBP and pPS75 E2F1 (gift of William Kaelin), respectively, as template for coupled in vitro transcription-translation (TNT kit; Promega). For the in vitro binding assays, equal amounts of all GST proteins were incubated with 5 µl of ³⁵S-labeled proteins. The bead volume of all samples was adjusted to 50 µl with GST beads alone. The binding reaction mixtures were then resuspended in a total volume of 250 µl of protein binding buffer (10 mM Tris [pH 7.5], 150 mM NaCl₂, 1 mM DTT, and 1 mM PMSF). Bound proteins were released by heating at 95°C in 2× SDS gel loading buffer and resolved on SDS-10% polyacrylamide gels followed by exposure to X-ray film for 24 h. The percentages of in vitro-translated protein complexed with GST fusion proteins on beads were calculated with a phosphorimager.

Coimmunoprecipitation conditions. Cytomegalovirus-E2F1 was a gift from Jacqueline Lees (69). COS7 cells (10⁶) for each immunoprecipitation group were either transfected with 20 µg of cytomegalovirus promoter-E2F1 and 5 µg of pcDNA3 C/EBP (to yield equal protein expression) using Lipofectamine (Gibco-BRL) according to the manufacturer's directions or mock transfected (untransfected) by treatment with the same reagents minus plasmid DNA. Cell lysates were harvested 24 h following transfection by lysing cells in 200 µl of lysis buffer (50 mM NaCl₂, 150 mM Tris [pH 7.6], 0.1% NP-40, 1 mM PMSF, and 10 µM aprotinin and leupeptin). One-thirtieth the amounts of lysate from both untransfected and transfected cells were used in Western analysis without immunoprecipitation as a control for protein expression. For immunoprecipitations performed using the U937#2 cell line, approximately 10⁷ cells per experimental group were treated with ZnSO₄ to induce C/EBP expression or left untreated. Cell lysates were harvested at 12 h following ZnSO₄ treatment by lysing cells in 200 ml of lysis buffer. Supernatants were precleared with 50 ml of a 1:1 slurry of protein A-agarose (Santa Cruz) in lysis buffer with 6 µg of normal rabbit serum (NRS). The precleared supernatants were recovered and incubated with 12 µg of either C/EBP antiserum or NRS antiserum (as a control) and 50 µl of a 1:1 slurry of protein A-agarose. The bound protein-protein A complexes were washed once with lysis buffer and once with wash buffer (50 mM NaCl₂, 150 mM Tris [pH 7.6], 1 mM PMSF, and 10 µg of aprotinin and leupeptin/ml). Bound complexes were released by being heated to 100°C for 5 min, resolved on SDS-10% polyacrylamide gels, and analyzed by Western analysis as described above. To detect immunoprecipitated E2F1, E2F2, or E2F4 protein, membranes were hybridized with a 1:2,000 dilution of E2F1 antibody (sc-251x), E2F2 antiserum (sc-633x), or E2F4 antiserum (sc-1082x; Santa Cruz).

EMSAs. Electrophoretic mobility shift assays (EMSAs) were performed as described previously (41) using an E2F binding site oligonucleotide (CTCAGAGGCTTGGCGGGAAAAAGAACGGAGGG) from the human c-Myc promoter sequences located at bp 82 to 46 (GenBank accession no. J00120) or the C/EBP binding site oligonucleotide from the G-CSF receptor promoter sequence extending from bp 57 to 38 (60). E2F binding reactions were performed in 20 mM Tris (pH 7.5)-100 mM KCl-5 mM DTT-2 mM MgCl₂-10% glycerol-0.5 µg of double-stranded salmon sperm DNA with nuclear extracts from COS7 cells transfected with E2F1 or C/EBP plasmid. C/EBP binding was performed with in vitro-translated protein and COS7 cells transfected with C/EBP plasmid in 10 mM HEPES (pH 7.9)-50 mM KCl-5 mM MgCl₂-1 mM DTT-1 mM EDTA-1 µg of bovine serum albumin per µl-10% glycerol with 2 µg of poly(dI-dC). For specific competition, unlabeled competitor oligonucleotide was added to the binding reaction mixtures at a 200-fold molar excess. In some competition reactions, a shorter E2F double-stranded oligonucleotide (GCTTGGCGGGAAAAAG) was used based on sequences located at bp 70 to 51 in the human c-Myc promoter. For supershift experiments, 3 µl of specific C/EBP or E2F1 antiserum (200 µg/0.1 ml) (Santa Cruz) or NRS was added to the reactions. For competition experiments with E2F1 and C/EBP proteins, 16 µg of nuclear extract from COS7 cells transfected with E2F1 was incubated with increasing amounts of in vitro-translated C/EBP. All binding reactions were adjusted with control unprogrammed lysate to contain a total of 25 µg of rabbit reticulocyte lysate. In competition reactions using nuclear extract from COS7 cells cotransfected with E2F1 and C/EBP expression plasmids, 10 mg of E2F1 was cotransfected along with increasing amounts of C/EBP or PU.1 for a control. Vector DNA (pcDNA3) was added to all transfections to ensure that equal amounts of total DNA were transfected.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Identification of c-Myc as a potential C/EBP target. Because mice devoid of the G-CSF and IL-6 signaling pathways did not duplicate the dramatic phenotype demonstrated by the C/EBP-targeted mice (39), we hypothesized that there are additional C/EBP-targeted genes required for appropriate granulocytic differentiation. In order to identify these additional C/EBP-regulated genes, we performed RDA (27, 38), a PCR-based subtractive hybridization technique using mRNA derived from a U937 cell line stably transfected with a rat C/EBP gene under the control of the human metallothionein promoter, U937#2 (52). From this RDA screen, we identified several novel cDNAs, as well as previously identified cDNAs such as inhibitor of differentiation 2H (Id-2H), ornithine decarboxylase, and thyroid hormone binding protein. In addition, we identified the c-Myc gene as a target for regulation by C/EBP (Table 1). The discovery of c-Myc as a C/EBP-regulated gene is intriguing because it has been previously shown that down-regulation of the c-Myc gene can induce myeloid differentiation (16, 26). Additionally, c-Myc has been shown to negatively regulate C/EBP expression (2, 35, 43).

View this table: [in this window] [in a new window]   TABLE 1.   C/EBP-regulated genes identified by RDAa

View this table: [in this window] [in a new window]   TABLE 2.   C/EBP-regulated genes identified by nucleotide arraya

The endogenous c-Myc gene is negatively regulated by C/EBP. In order to confirm our screening results, we isolated RNA from both the U937#2 stable line and U937(vect)#1 (a U937 line stably transfected with the metallothionein vector lacking the rat C/EBP cDNA) (52) at various time points following treatment with zinc to induce metallothionein promoter-C/EBP gene expression and used this RNA in Northern analysis (Fig. 1A). Previously, we found the induced level of C/EBP protein to be threefold above the level of endogenous C/EBP in these cells. This is sufficient C/EBP expression to fully differentiate precursor cells along the granulocytic pathway (52). Following induction of C/EBP expression, the level of endogenous c-Myc RNA dramatically decreased by 94% at 4 h following zinc treatment, corresponding to the threefold induction of C/EBP RNA. In contrast, the level of c-Myc mRNA remained the same in the U937 vector cell line in which C/EBP was not induced. These results indicate that the level of endogenous c-Myc RNA is substantially affected by the level of C/EBP gene expression.

View larger version (49K): [in this window] [in a new window]   FIG. 1.   (A) The level of c-Myc RNA decreases following the induction of C/EBP gene expression. U937 stable cell lines that contain either a rat C/EBP cDNA under the control of the human metallothionein promoter (U937#2) or the empty metallothionein expression vector alone were harvested for total RNA at the indicated time points following the addition of ZnSO4 to the culture medium. (Top) Northern hybridization with a c-Myc cDNA probe. (Middle) Northern hybridization with a C/EBP cDNA probe. (Bottom) The Northern blot was stripped and rehybridized with a glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA probe to control for RNA loading and integrity. (B) The expression of c-Myc protein decreases as the level of C/EBP protein increases. The U937#2 stable line was harvested for cell lysates for Western analysis at the indicated time points following incubation with ZnSO4. (Top) Western blot hybridized with c-Myc antiserum. (Middle) The same Western blot hybridized with C/EBP antiserum. (Bottom) The same Western blot hybridized with -tubulin antibody to control for protein loading and integrity.

C/EBP negatively regulates the c-Myc promoter through an E2F binding site. In order to determine if C/EBP could negatively regulate the human c-Myc promoter itself, we utilized a human c-Myc promoter construct cloned into the pXP2 reporter vector and performed transfection assays to analyze c-Myc promoter activity. We cotransfected CV-1 cells with the 6.5-kb c-Myc promoter luciferase reporter gene along with increasing amounts of a C/EBP expression plasmid. The results show that C/EBP was able to inhibit c-Myc promoter reporter gene activity (Fig. 2) in a dose-dependent manner, as increasing amounts of C/EBP resulted in a linear decrease in reporter gene activity (Fig. 2).

View larger version (20K): [in this window] [in a new window]   FIG. 2.   C/EBP down-regulates c-Myc promoter activity. (A) The 6.5-kb c-Myc promoter and indicated 5' deletions were cloned into the pXP2 luciferase reporter vector. (B) CV-1 cells were cotransfected with 200 ng of the indicated reporter gene and increasing amounts of C/EBP expression plasmid (nanograms). Control transfection experiments indicated that C/EBP had no effect on the pXP2 luciferase reporter vector (data not shown). (C) As a positive control for C/EBP transactivation, CV-1 cells were cotransfected with the G-CSF receptor reporter gene containing four C/EBP binding sites (pTK-G-CSFr). All transfection groups were normalized with a Renilla luciferase vector as an internal control. Results represent the percentages of luciferase activity with 0 ng of C/EBP (vector alone) set to 100% activity. Results are given as the averages of at least three independent experiments, and error bars represent the standard errors of the means.

View larger version (28K): [in this window] [in a new window]   FIG. 3.   (A) Dominant-negative C/EBP does not repress c-Myc reporter activity. CV-1 cells were cotransfected with 200 ng of the indicated c-Myc reporter construct along with wild-type C/EBP or dominant-negative C/EBP (4HEP C/EBP). (B) Dominant-negative C/EBP interferes with wild-type C/EBP repression of c-Myc reporter activity. CV-1 cells were cotransfected with wild-type C/EBP along with increasing amounts of dominant-negative C/EBP and either the 2.5-kb or 0.14-kb c-Myc reporter gene. All transfection groups were cotransfected with a Renilla luciferase vector as an internal control. Results represent the percentages of luciferase activity with 0 ng of C/EBP (vector alone) set to 100% activity. (C) Mutation of the E2F DNA binding site on c-Myc reporter constructs abolishes C/EBP negative regulation. Wild-type and mutant sequences of the E2F DNA binding site in the c-Myc promoter located at residues 58 to 51 relative to the P2 promoter are shown at the top. CV-1 cells were cotransfected with either the 2.5-kb or 0.14-kb c-Myc reporter gene containing the wild-type or mutated E2F site along with the C/EBP expression construct. As a control, CV-1 cells were cotransfected with a PU.1 expression construct to demonstrate that c-Myc promoter repression is specific to C/EBP. All transfection groups were normalized with a Renilla luciferase vector as an internal control. Results are presented as the averages of at least three independent experiments, and error bars represent the standard errors of the means.

View larger version (71K): [in this window] [in a new window]   FIG. 4.   C/EBP does not bind to the E2F DNA site in the c-Myc promoter. EMSAs using 32P-labeled, double-stranded oligonucleotides containing either an E2F site from the human c-Myc promoter (A and C) or a C/EBP binding site from the G-CSF receptor promoter (B and D) were performed with in vitro-translated C/EBP protein (in vitro C/EBP) or nuclear extracts prepared from COS7 cells overexpressing C/EBP (COS7/C/EBP), COS7 cells overexpressing E2F1 (COS7/E2F1) as a positive control for E2F binding, or untransfected COS7 cells (UT). The migration of the free probe is indicated along with the positions of E2F1 protein complexes binding to the E2F DNA site and C/EBP binding to the C/EBP binding site. The asterisks indicate the positions of supershifted bands following the addition of either an E2F1 antibody or C/EBP antisera. "competitor" refers to the 100× addition of unlabeled double-stranded E2F or C/EBP DNA binding sites as indicated. "NSB" refers to migration of nonspecific protein complexes binding to the E2F DNA binding site. "Long" or "Short" E2F competitor refers to a double-stranded E2F oligonucleotide that contains more or less DNA sequence, respectively, flanking the E2F1 consensus site.

View larger version (20K): [in this window] [in a new window]   FIG. 5.   C/EBP and E2F1 physically interact in vitro and in vivo. (A) Binding of 35S-labeled in vitro-translated C/EBP (input C/EBP) to GST (negative control for binding), GST-C/EBP (positive control for binding), GST-E2F1, and GST-DP1. (B) Binding of 35S-labeled in vitro-translated E2F1 (input E2F1) to the same GST fusion proteins. Percent input bound represents the amount of in vitro-translated protein complexed with GST fusion proteins as calculated using a phosphorimager (Molecular Dynamics). (C) COS7 cells either untransfected (Unt) or transfected with E2F1 and C/EBP expression vectors (E + C) were immunoprecipitated with C/EBP antisera or control NRS followed by Western analysis with E2F1 antibody. As a control for E2F1 expression and migration, 1/30 of the COS7 lysate used for immunoprecipitation was resolved by SDS-PAGE (marked "" for immunoprecipitation antibody). The position of E2F1 is indicated. (D) C/EBP interacts with endogenous E2F proteins in myeloid cells. Uninduced () or induced (+) U937#2 cells were immunoprecipitated (IP antibody) with C/EBP antisera or control NRS followed by Western analysis with either E2F2 or E2F4 antibody. As a control for E2F2 and E2F4 expression and migration, 1/30 of the lysate used for immunoprecipitation was resolved by SDS-PAGE (marked "" for immunoprecipitation antibody). The positions of E2F2 and E2F4 are indicated.

View larger version (71K): [in this window] [in a new window]   FIG. 6.   C/EBP protein cannot disrupt the binding of E2F1 protein to DNA. (A) EMSAs using a 32P-labeled, double-stranded oligonucleotide containing the E2F site from the human c-Myc promoter were performed with nuclear extracts prepared from COS7 cells overexpressing E2F1 (COS7/E2F1). The addition of increasing amounts of in vitro-translated C/EBP did not alter the amount of E2F1 protein binding to the E2F DNA site. The migration of the free probe is indicated along with the positions of E2F1 protein complexes. The asterisk indicates the position of a supershifted band following the addition of an E2F1 antibody. "self oligo" indicates the 100× addition of unlabeled double-stranded E2F DNA binding site. "NSB" indicates the migration of nonspecific protein complexes binding to the E2F DNA binding site. "control" indicates binding reactions performed with unprogrammed rabbit reticulocyte lysate, and "Gata-1" indicates control binding reactions performed with in vitro-translated GATA-1 protein. (B) EMSAs performed with the E2F site from the c-Myc promoter and nuclear extracts from COS7 cells cotransfected with 10 mg of E2F1 plasmid and indicated amounts of C/EBP plasmid. For control reactions, COS7 cells were cotransfected with PU.1 or left untransfected (UT). The migration of the free probe is indicated along with the positions of the E2F1 protein complexes. "self oligo" indicates the 100× addition of unlabeled double-stranded E2F DNA binding site. "NSB" indicates the migration of nonspecific protein binding complexes.

View larger version (17K): [in this window] [in a new window]   FIG. 7.   C/EBP interferes with E2F1 transactivation of the c-Myc promoter. CV-1 cells or Saos (Rb) cells were cotransfected with 200 ng of the 0.14-kb c-Myc reporter gene (V), 20 ng of C/EBP plasmid alone (), 10 ng of E2F1 plasmid alone, or 10 ng of E2F1 plasmid along with the indicated amounts of C/EBP plasmid. All transfection groups were normalized with a Renilla luciferase vector as an internal control. Results represent the percentages of reporter gene or luciferase activity with vector alone (V) set to 100% activity. Results are given as the averages of at least three independent experiments, and error bars represent the standard errors of the means.

c-Myc must be negatively regulated in order for myeloblasts to differentiate into neutrophils. To determine if c-Myc is an important C/EBP target gene, we investigated how Myc gene expression affected myeloblast differentiation. Tet-o-myc 1137 is a myeloblast cell line derived from a tumor from transgenic mice that express the human c-Myc cDNA under the control of a tetracycline-responsive promoter (16). Treatment with doxycycline or tetracycline turns off c-Myc expression and drives the cells to differentiate into neutrophils. We found that, in the absence of tetracycline, 85% of the cells were myeloblasts, 10% were promyelocytes, and 5% were metamyelocytes and neutrophils (Fig. 8A and B). Following treatment with tetracycline for 24 h, which turns off c-Myc expression, the culture underwent marked differentiation, with 28% myeloblasts, 38% promyelocytes, and 34% metamyelocytes and mature neutrophils (Fig. 8A and B).

View larger version (75K): [in this window] [in a new window]   FIG. 8.   Down-regulation of c-Myc is crucial to the granulocytic differentiation pathway. The 1137 cell line was derived from murine bone marrow of a transgenic line with a human c-Myc cDNA under the control of a tetracycline-responsive promoter. The addition of tetracycline to the culture medium turns off human c-Myc expression, resulting in the differentiation of these myeloblasts to neutrophils. (A) Wright-Giemsa-stained cells without (No Tet) or with (Plus Tet) treatment with tetracycline. Cells treated with tetracycline differentiated into myelocytes (M) and neutrophils (N). (B) Differential analysis of Wright-Giemsa-stained slides following treatment with tetracycline for 0, 24, and 48 h, respectively. (C) 1137 cells were harvested for cell lysates to use in Western blotting at indicated time points following treatment with tetracycline. (Top) Western blot hybridized with C/EBP antiserum shows that the level of endogenous C/EBP protein increased 24 h following treatment with tetracycline. This corresponds to the shift to mature cells seen in panels A and B. (Middle) The same blot hybridized with c-Myc antiserum, showing that c-Myc protein levels dramatically decreased 2 h following treatment with tetracycline. (Bottom) The same blot hybridized with a -tubulin antibody to control for protein loading and integrity. (D) Western analysis of 1137 stable lines with (+) and without () treatment with zinc. "parental" indicates the 1137 parental line, "vector" indicates the 1137 stable line with metallothionein vector, and "C/EBP " indicates the 1137 line with metallothionein-driven C/EBP. (E) Western analysis of cell lysates prepared from the 1137/C/EBP stable line with the indicated treatment with tetracycline. The level of human c-Myc protein was titrated by 100-fold dilutions of tetracycline. A 20-ng/ml concentration turns off c-Myc expression, while a 2-ng/ml concentration results in a low level of c-Myc expression. Lower concentrations of tetracycline result in no decrease in c-Myc protein expression. (F) Differential analysis of Wright-Giemsa-stained slides following treatment of 1137 stable lines with tetracycline, zinc, or the combination of tetracycline and zinc for 48 h.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

C/EBP down-regulates c-Myc through an E2F site, suggesting that other c-Myc and E2F target genes may lie downstream of C/EBP. In order to identify critical C/EBP target genes involved in the differentiation of granulocytic cells, we performed both RDA and oligonucleotide array analysis (Tables 1 and 2). Both of these screens independently identified the c-Myc gene as a target for regulation by C/EBP. This is the first report to demonstrate that C/EBP is a negative regulator of c-Myc gene expression. Using a stable C/EBP-inducible U937 cell line, we have shown that C/EBP expression results in a significant decrease in the levels of endogenous c-Myc mRNA and corresponding protein (Fig. 1). Quantitation by phosphorimager indicates that the level of c-Myc RNA decreased only 30% by 2 h, compared with a dramatic decrease of 94% by 4 h (Fig. 1). The level of C/EBP protein was induced 5-fold by 2 h and 20-fold by 4 h (Fig. 1). Therefore, the 20-fold increase in C/EBP protein at 4 h preceded the decrease seen in c-Myc RNA and corresponding c-Myc protein levels. We have shown by luciferase reporter assays that C/EBP protein itself negatively regulates the human c-Myc promoter (Fig. 2). Therefore, C/EBP expression results in a linear decrease in c-Myc reporter activity.

Mechanism of c-Myc down-regulation through the E2F site. As noted above, C/EBP represses c-Myc gene expression through the consensus E2F binding site located between the P1 and P2 promoter elements (Fig. 3). However, C/EBP protein does not bind to this site directly (Fig. 4). Whether the mechanism for C/EBP negative regulation through this E2F site is direct or indirect through protein-protein interactions remains to be determined. We have shown that C/EBP can physically interact with E2F1 and other E2F family members (Fig. 5), and so we hypothesized that C/EBP might disrupt E2F protein complexes binding to this DNA site. EMSA results demonstrated that C/EBP protein could not directly displace E2F1 binding to the c-Myc promoter E2F site (Fig. 6).