Previous Article | Next Article 
Molecular and Cellular Biology, June 2001, p. 3830-3839, Vol. 21, No. 11
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.11.3830-3839.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Poly(dA-dT) Promoter Elements Increase the
Equilibrium Accessibility of Nucleosomal DNA Target Sites
J. D.
Anderson1 and
J.
Widom1,2,*
Department of Biochemistry, Molecular
Biology, and Cell Biology1 and
Department of Chemistry2,
Northwestern University, Evanston, Illinois 60208
Received 27 November 2000/Returned for modification 3 January
2001/Accepted 12 March 2001
 |
ABSTRACT |
Polypurine tracts are important elements of eukaryotic promoters.
They are believed to somehow destabilize chromatin, but the mechanism
of their action is not known. We show that incorporating an
A16 element at an end of the nucleosomal DNA and further
inward destabilizes histone-DNA interactions by 0.1 ± 0.03 and
0.35 ± 0.04 kcal mol
1, respectively, and is
accompanied by 1.5- ± 0.1-fold and 1.7- ± 0.1-fold
increases in position-averaged equilibrium accessibility of nucleosomal
DNA target sites. These effects are comparable in magnitude to effects
of A16 elements that correlate with transcription in vivo,
suggesting that our system may capture most of their physiological
role. These results point to two distinct but interrelated models for
the mechanism of action of polypurine tract promoter elements in vivo.
Given a nucleosome positioned over a promoter region, the presence of a
polypurine tract in that nucleosome's DNA decreases the stability of
the DNA wrapping, increasing the equilibrium accessibility of other DNA
target sites buried inside that nucleosome. Alternatively (if
nucleosomes are freely mobile), the presence of a polypurine tract
provides a free energy bias for the nucleosome to move to alternative
locations, thereby changing the equilibrium accessibilities of other
nearby DNA target sites.
 |
INTRODUCTION |
Eukaryotic site-specific DNA binding
proteins often occlude much of the entire circumference of their DNA
target sites yet are able to bind to target sites that are wrapped in
nucleosomes and hence inaccessible. How this is accomplished is not
known. Earlier ideas that entry to such sites might be dependent on the prior action of histone acetylases or ATP-dependent chromatin remodeling machines are supplanted by recent discoveries that these
factors themselves are recruited to specific chromatin regions by
previously bound site-specific regulatory proteins (6,
26).
It is likely that multiple distinct mechanisms may each contribute to
allowing and regulating the initial entry of regulatory proteins into
their target sites in chromatin. One pathway that is not understood
mechanistically but appears to be involved utilizes polypurine tracts
that are incorporated into genomic DNA, near DNA target sites for
upstream activator proteins. Polypurine tracts 15 to 30 bp long are
overrepresented in the genomes of all eukaryotes examined
(3) and are particularly enriched in promoter regions. In
yeast, approximately one out of every four promoters includes an
uninterrupted poly(dA) tract, and numerous additional promoters contain
imperfect ones (3, 14, 33). The mechanisms by which these
elements contribute to gene activation are not known, but studies of
Saccharomyces cerevisiae (5, 13, 22, 35) and Candida glabrata (40) suggest that they may act
to alter the stability or dynamics of nucleosomes, somehow enhancing
the ability of gene activator proteins to bind to nearby DNA target sites.
Studies of DNA sequences present in isolated natural nucleosomes
revealed a preference for stretches of poly(dA-dT) to occur at the ends
of the nucleosomal DNA versus the middle (31), consistent with the view that poly(dA-dT) may have an intrinsic preference for
adopting distinctive straight helical structures (7, 23, 24). While poly(dA-dT) elements do not necessarily exclude
nucleosomes in vivo (17), longer poly(dA-dT) elements can
exhibit this distinctive unbent DNA conformation in vivo and can
disrupt the ordering of positioned nucleosomes in minichromosomes
(33).
Several studies have investigated the effects on histone-DNA
interaction affinities when poly(dA-dT) elements are incorporated into
nucleosomal DNA. One study (12) reports that a 40-bp
poly(dA-dT) stretch containing two 1-bp interruptions, roughly centered
in a nucleosomal DNA, destabilized the nucleosome by ~0.8 kcal
mol
1 relative to a similar sequence containing
alternating A-T dinucleotides in place of the poly(dA-dT). Another
study (10) reports that individual 10-bp-long dA-dT
stretches destabilized nucleosomes by ~0.2 to 0.3 kcal
mol
1, independent of their position in the nucleosome.
However, a more recent report (21) suggested the opposite,
namely, that 25-bp-long stretches of poly(dA-dT) actually stabilize the
nucleosome by up to ~1 kcal mol
1, with the amount
depending on position of the (dA-dT) tract. Thus, the contributions of
poly(dA-dT) elements to the affinity of histone-DNA interactions remain
uncertain, and in any case it is not known how these effects on
affinity would relate to changes in the behaviour of nucleosomes.
In this study, we used a purified in vitro system to examine the
effects of incorporating poly(dA-dT) elements into two different locations inside nucleosomal DNA. We quantified the effects on the free
energy of histone-DNA interactions and tested for and quantified
effects on the equilibrium accessibility of DNA target sites inside the
nucleosomes. We find that incorporating an A16 element at
one end of the nucleosomal DNA and further inward destabilizes histone-DNA interactions by 0.1 ± 0.03 and 0.35 ± 0.04 kcal
mol
1, respectively. This is accompanied by 1.5- ± 0.1-fold and 1.7- ± 0.1-fold increases, respectively, in
position-averaged equilibrium constants for the dynamic accessibility
of nucleosomal DNA target sites. These effects of A16
elements on accessibility of DNA target sites in vitro are comparable
in magnitude to the effects seen in vivo, suggesting that this system
may be capturing most of the physiological role of the polypurine
tracts. These results point to two distinct but interrelated models for
the mechanism of action of polypurine tract promoter elements in vivo.
 |
MATERIALS AND METHODS |
Preparation of DNA and histones.
Construct 601.2 (174 bp)
was prepared by PCR as previously described (2). The
slightly shorter (152-bp) construct 601.3 was chosen based on
exonuclease III mapping data for nucleosome positioning on 601.2; it
incorporates the 145-bp mapped nucleosome region of 601.2 with an
additional 4 bp of 601.2 sequence on the left side and 3 bp on the
right side (for the sequence as indicated in Fig. 1). Construct 601.3 and its derivatives were prepared by PCR using 601.2 DNA as the
template. The primer pairs were as follows (nucleotide changes from
601.2 sequence are capitalized; changes represent the introduction of
A16 elements or 16-bp segments of randomly chosen bacterial
plasmid DNA sequence). For construct 601.3, the primers were 601.3 152 LE (left end; gcgggcgccctgcagaagcttg) and 601.3 152 RE
(right end; gatgtatatatctgacacgtgc). For derivatives of
601.3, we used primer 601.3 152 RE for the right-hand end primer, together with the following left-hand end primers: for construct 601.3(A16End), AAAAAAAAAAAAAAAAgcttggtcccggggcc;
for construct 601.3(A16Mid),
gcgggcgccctgcagaagcttggtcccggggccgctAAAAAAAAAAAAAAAAgctctggatccgcttgatc; for construct 601.3(Random End),
CAAGTGGACGGAGCATagcttggtcccggggccg; and for construct
601.3(Random Mid), gcgggcgccctgcagaagcttggtcccggggccgctCAAGTGGACGGAGCATgctctggatccgcttgatcg.
All PCR products were purified by ion-exchange high-pressure liquid
chromatography (HPLC) on an anion-exchange column (Mono-Q HR5/5) using
a linear gradient of 0.65 M NaCl in Tris-EDTA (TE; pH 8.0, room
temperature) to 0.8 M NaCl in TE over 90 min at a flow rate of 0.25 ml
min
1. The purified products were concentrated on
Centricon-30 filters (Millipore) and resuspended in 0.1× TE (1 mM Tris
[pH 8.0], 0.1 mM EDTA). A typical yield from 10 ml of PCR synthesis
was 150 µg of DNA after HPLC purification. Chicken erythrocyte
histones were prepared as described elsewhere (8).
Reconstitution and purification of nucleosome core
particles.
Prior to reconstitution, construct DNAs were labeled
with [
-32P]ATP using T4 polynucleotide kinase (New
England Biolabs [NEB]). The 256-bp EcoRI fragment of the
natural 5S gene nucleosome positioning sequence (34) used
as a reference for free energy measurement (see below) was labeled by
filling in the ends with the Klenow fragment of Escherichia
coli DNA polymerase I, using dTTP and [
-32P]dATP. Reconstitution reaction mixtures
contained 200 ng of labeled construct DNA, 19.2 µg of chicken
erythrocyte core particle DNA, and 15.5 µg of chicken erythrocyte
histone octamer in a 50-µl volume of 2.0 M NaCl, in 0.1× TE-0.5 mM
phenylmethylsulfonyl fluoride (PMSF)-0.1 mM benzamidine (BZA). The
reconstitutions were performed by a gradual stepwise salt dialysis,
beginning at 2.0 M NaCl and then stepping successively to 1.5 M NaCl,
1.0 M NaCl, 0.5 M NaCl, and 5 mM NaCl, each for a minimum of 2 h
and each supplemented with 0.5× TE, 0.1 mM BZA, and 0.5 mM PMSF. A
final overnight dialysis step into 0.5× TE was performed before
further processing. All dialyses were performed at 4°C.
Core particle samples were run on 5 to 30% (wt/vol) sucrose gradients
(in 0.5× TE) at 41,000 rpm in a Beckman SW41 rotor for
24 h at
4°C. Gradients were fractionated into 0.5-ml fractions
and quantified
by Cerenkov counting. Fractions containing nucleosome
core particles
were pooled and exchanged into 0.5× TE on Centricon-30
concentrators
and analyzed by native polyacrylamide gel
electrophoresis.
Competitive reconstitutions and free energy measurements.
Free energies for histone binding in nucleosome reconstitution were
measured using the double-dialysis competitive reconstitution procedure
as described previously (18, 37). Chicken erythrocyte core
particle DNA (30 µg) and tracer amounts of the gel-purified, radiolabeled DNA tracer were mixed with 2 µg of histone octamer in a
total volume of 50 µl containing 10 mM Tris-HCL (pH 7.5), 1 mM EDTA,
2 M NaCl, 0.5 mM PMSF, and 1 mM BZA. The mixture was loaded into
microdialysis buttons, which were then loaded into a dialysis bag
containing approximately 200 ml of the same buffer. Samples were
dialyzed for
2 h at 4°C in the starting buffer, followed by two
dialyses at 4°C in 0.5× TE containing PMSF and BZA for
12 h.
Aliquots of each competitive reconstitution were run on 5% native
polyacrylamide gels containing 1/3× TBE (33 mM Tris-borate, 0.67 mM
EDTA) and quantified by phosphorimager analysis. Equilibrium constants
were calculated as the ratios of background subtracted counts in
nucleosomal bands (or sets of bands) to counts in free DNA bands, and
free energies were calculated from the relationship
G° =
RT ln
Keq. 
G°s represent
differences between
G°s measured for a test sequence
and a reference standard sequence, measured at the same time in the
identical competitive environment. We used the well-characterized
EcoRI fragment of the sea urchin 5S RNA gene nucleosome
positioning sequence (34) as a reference tracer DNA.
Restriction enzyme assays.
Nucleosome samples were digested
with the following enzymes, all at 37°C: PstI,
HindIII, MspI, HaeIII,
BamHI, RsaI, HhaI, MseI,
StyI, BfaI, and PmlI. TaqI
digestions were carried out at 65°C. All enzymes were obtained in
their most concentrated commercially available form from NEB, and all
digestions were carried out with the buffer supplied by NEB,
supplemented with 100 µg of bovine serum albumin per ml. For
digestions on naked DNA, we typically used 1 × 104-
to 2 × 104-fold-lower enzyme concentration. Glycerol
was added to all naked DNA digests to the same final concentration
present in the corresponding core particle digestion and never exceeded
5% (vol/vol) in any reaction. The buffers used for each enzyme are as
follows: 10 mM bis Tris propane-HCl-10 mM MgCl2-1 mM
dithiothreitol (DTT) (pH 7.0) for RsaI and PmlI;
10 mM Tris-HCl-10 mM MgCl2-50 mM NaCl-1 mM DTT (pH 7.9)
for HindIII, MspI, HaeIII, and
MseI; 50 mM Tris-HCl-10 mM MgCl2-100 mM
NaCl-1 mM DTT (pH 7.9) for PstI and StyI; 20 mM Tris-acetate-10 mM magnesium acetate-1 mM DTT (pH 7.9) for
HhaI and BfaI; 10 mM Tris-HCl-10 mM
MgCl2-100 mM NaCl (pH 8.4) for TaqI; and 10 mM
Tris-HCl-10 mM MgCl2-150 mM NaCl-1 mM DTT (pH 7.9) for
BamHI.
At various time points during the reactions, 10-µl aliquots were
removed, quenched with 40 mM EDTA, and subsequently digested
overnight
at 37°C with 100 µg of proteinase K ml
1. Samples were
analyzed on denaturing polyacrylamide gels and
quantified with a
phosphorimager. Background values were obtained
from regions between
bands on each gel and subtracted from the
integrals measured for each
band of interest. The substrate DNA
(S) and the two products (P1 and
P2) are simultaneously resolved,
allowing the fraction of uncut DNA to
be calculated as follows:
(counts in S)/(counts in S + P1 + P2), all after background subtraction.
This definition is insensitive
to variations in gel loading. See
references
27 and
29 for further
discussion.
The data analysis was complicated by two issues, described also in
references
1,
2, and
27. First, the initial time
point in
the nucleosomal restriction digestions exhibits an anomalously
large
extent of digestion. Native gels of parallel mock digestion
reactions
exhibit quantitatively similar fractions of apparent
naked DNA. We
concluded that a small fraction of the nucleosomes
dissociates upon
exposure to digestion conditions (elevated [Mg
2+] and
temperature), thus allowing a burst of digestion on the
newly generated
naked DNA. Due to the high concentrations of restriction
enzyme
utilized in the nucleosome digestions (500 to 10,000 U
ml
1), the naked DNA is digested nearly instantaneously.
To address
and eliminate this issue, we omitted the initial time point,
defined
the uncut scaled fraction of the second time point as 1.0, and
rescaled the uncut scaled fraction of the remaining time points
accordingly. In a recent study of the effects of histone
hyperacetylation
on nucleosomal site exposure (
1), we
detected a sample-dependent
(i.e., hyperacetylation-dependent)
dissociation of a fraction
of nucleosomes when they were brought to
digestion conditions.
Nevertheless, our analysis method successfully
eliminates this
contribution to the decay kinetics, allowing additional
effects
on the properties of intact nucleosomes to be revealed. And in
the present case we do not detect any systematic (i.e.,
sample-dependent)
effects on overall nucleosome stability due to the
A
16 elements.
Taken together, these results imply that
dissociation of nucleosomes
prior to the restriction enzyme digestion
reactions does not contribute
to the rate constants (or the
corresponding equilibrium accessibilities)
obtained.
In addition, slow dissociation of nucleosomes during the digestions
does not contribute significantly to the observed kinetics,
since (i)
analysis of mock digestion kinetics directly shows this
not to occur at
detectable levels and (ii) the digestion kinetics
are strictly first
order in the enzyme concentration used (
28,
29; J. D. Anderson and J. Widom, submitted for
publication).
A second factor complicating the quantitative analysis is that a
fraction of the nucleosomes is never digested. We traced
this behavior
to a fraction of nucleosomes being insoluble in
the digestion buffer,
as measured by an ultracentrifuge-based
sedimentation assay
(unpublished results). This behavior has been
demonstrated before in
nucleosome solubility experiments (
32).
In our recent
study of hyperacetylated nucleosomes (
1), we
observed a
systematic sample dependence to the nucleosome solubility.
In contrast,
in the present study we observed no systematic dependence
to solubility
correlating with the presence or absence of A
16 elements.
In any case, variable solubility is addressed by allowing
the baseline
to float in the nonlinear least-squares fit of the
data (
1,
2,
27): we fit the scaled fraction uncut data
(see above) from each
digestion to a single exponential decay
using the following equation:
uncut scaled fraction =
a0 + (1
a0) × exp(
a1 × time), where
a0 is the best-fit baseline and
a1 is the best-fit rate constant. The ratio of
a1 values for control
nucleosomes versus
experimental nucleosomes (scaled for their
enzyme concentrations, which
are usually identical between pairs
of nucleosomal samples) yields the
fold enhancement of site exposure
due to the presence of a poly(dA-dT)
element.
To assess the appropriateness of this analysis in an earlier study
(
27), several of the data sets were fit to a double
exponential.
Examining the resulting pairs of rate constants separately
or
averaging them to obtain amplitude-weighted mean values leads
to
results that are quantitatively similar and qualitatively equivalent
to
those obtained in the single exponential analysis. We therefore
focused
the analysis on the single exponential fits, as these
have fewer
adjustable
parameters.
 |
RESULTS |
DNA templates.
In this study we used a family of DNA
constructs that derive from a strong non-natural nucleosome positioning
sequence (clone 601) isolated in an earlier SELEX (binding site
selection) experiment (18). Construct 601.2 (2) introduced a number of nucleotide substitutions into
601 so as to create sites for different restriction enzymes at
locations along the entire nucleosomal length. The free energy of
interaction of 601.2 with histone octamer in nucleosome reconstitution,
the location of the single strongly preferred nucleosome position on
this template, and the position-dependent equilibrium accessibility of
sites along the nucleosome length have previously been reported
(2). The restriction sites are used in studies described
below to quantify the dynamic equilibrium accessibility of DNA target
sites contained within the nucleosomes.
Construct 601.3 (Fig.
1A) is identical to
601.2 except that it lacks a few base pairs from the short stretches of
DNA extending
beyond each nucleosome end of 601.2. 601.3 was modified
by replacement
of 16 contiguous residues with A's either at the
nucleosome end,
creating 601.3(A
16End) (Fig.
1B), or
further in toward the middle,
creating 601.3(A
16Mid) (Fig.
1C). We also produced variants of
these two A
16-containing
constructs in which the A
16 segments
were replaced by a
randomly chosen 16-bp stretch of bacterial
plasmid DNA sequence,
creating constructs 601.3(Random End) (Fig.
1B) and 601.3(Random Mid)
(Fig.
1C). These latter constructs allow
us to assess whether any
effects arising from substitution of
original 601.2 sequence with
A
16 are attributable to the presence
of the A
16
element or simply to loss of the corresponding patch
of original 601.2 sequence.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 1.
DNA constructs used. (A) Construct 601.3. The boundaries
of the nucleosomal DNA as mapped on our earlier study of the slightly
longer construct 601.2 are indicated by the black vertical bars;
relative locations of specific restriction enzyme recognition sites are
shown. The other sequences in the 601.3 series (B and C) incorporate
various alterations from 601.3 that are represented as shaded boxes.
(B) 601.3(A16End) and 601.3(Random End). The shaded box
extends from bp 1 to 16 and represents poly(dA-dT) DNA
[601.3(A16End)] or random pGEM3z DNA [601.3(Random
End)]. (C) 601.3(A16Mid) and 601.3(Random Mid) DNA. The
shaded box extends from bp 37 to 52 and represents poly(dA-dT) DNA
[601.3(A16Mid)] or random pGEM3z DNA [601.3(Random
Mid)].
|
|
Purification and characterization of reconstituted
nucleosomes.
Nucleosomes were reconstituted from purified DNA and
histones by salt gradient dialysis and purified by sucrose gradient
ultracentrifugation. Examples of typical gradient profiles are shown in
Fig. 2A. Subsequent reanalysis of the
purified nucleosomes on sucrose gradient (Fig. 2A) or by native gel
electrophoresis (Fig. 2B) shows them to be largely free of
contaminating naked DNA and to migrate predominantly as single bands,
consistent with a single strongly preferred nucleosome position. Note
that multiple nucleosome positions, when these exist, can be detected
and resolved by native gel electrophoresis even with DNA as short as
146 bp (9, 20). Direct mapping data and other results that
imply a single strongly preferred nucleosome position on construct
601.2 are discussed in reference 2. We conclude that each
of the reconstituted nucleosome samples used in the present study is
strongly biased for occupancy of a single nucleosome position.
Additional direct data confirming this interpretation are discussed
below.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 2.
Sucrose gradient purification and reanalysis by sucrose
gradient and native gel electrophoresis. Nucleosomes are reconstituted
by gradual salt dialysis and separated from naked DNA on 5 to 30%
(wt/vol) sucrose gradients (A). Purified nucleosomes are further
analyzed on a second sucrose gradient (A) and by native gel
electrophoresis (B) +, naked 601.3 DNA; , preparative run of
reconstituted 601.3 nucleosomes; , preparative run of reconstituted
601.3(A16End) nucleosomes; , preparative run of
reconstituted 601.3(A16Mid) nucleosomes; ×, reanalysis of
gradient purified 601.3 nucleosomes. (B) Native gel analysis. W
indicates the location of the loading wells; R indicates the mobility
of the reconstituted nucleosomes; D indicates the mobility of naked
DNA. Lane M, 100-bp DNA marker; lane 1, naked 601.3 DNA; lane 2, purified 601.3 nucleosomes; lane 3, purified 601.3(A16End)
nucleosomes; lane 4, purified 601.3(A16Mid); lane 5, purified 601.3(Random End) nucleosomes; lane 6, purified 601.3(Random
Mid) nucleosomes. Phosphorimager analysis of the gel reveals
contamination by free DNA and other nonnucleosomal aggregates to be
0.5%. This small level of naked DNA does not contribute to the
observed kinetics because it is digested to completion within the first
time point, which we omit from the kinetic analysis.
|
|
Free energy measurements.
We used a standard competition
method (18, 19, 37) to measure the differences in free
energy of histone-DNA interactions in nucleosome reconstitution that
result from substitution of 16-bp-long stretches of 601.3 sequence with
16 A's or with random sequence 16-mers (Fig.
3). In this assay, tracer quantities of radiolabeled test DNA competes with a large excess of unlabeled arbitrary-sequence competitor DNA for limiting amounts of histone octamer. The ratio of nucleosomal to free tracer DNA defines an equilibrium constant (affinity) and a corresponding free energy for the
tracer that is valid for that competitive environment. To facilitate
comparisons between studies, we report differences in free energies
(
G°s), measuring the free energy of the tracer relative to that of a reference sequence measured at the same time in
the identical competitive environment; we used a fragment of the sea
urchin 5S rRNA gene nucleosome positioning sequence (34)
as a reference tracer DNA. Note that the use of this (or any) reference
molecule does not influence the 
G°s obtained for
comparison between differing DNA samples measured in the same competitive environment.

View larger version (72K):
[in this window]
[in a new window]
|
FIG. 3.
Native gel analysis of competitive reconstitution
assays. Radiolabeled tracer competes with a large excess of unlabeled
natural nucleosome core particle DNA for limiting quantities of histone
octamer in dialysis from concentrated NaCl. Lane M, 100-bp DNA marker;
lane 1, 601.3; lane 2, 601.3(A16End); lane 3, 601.3(A16Mid); lane 4, 601.3(Random End); lane 5, 601.3(Random Mid); lane 6, the 256-bp EcoRI fragment of the
well-characterized natural nucleosome-positioning sequence from sea
urchin 5S rRNA gene (34); lane 7, 601.2; D, mobility of
naked DNA; R, mobilities of reconstituted nucleosomes. The diverse
mobilities represent reflect a range of positionings on the different
molecules. The 5S derivative yields several distinct nucleosomal
positions, whereas 601.2 and the 601.3 series show one predominant
position. The raw data show that 601.2 and the 601.3 series compete
much more effectively for the limiting histone octamer than does the 5S
sequence (greater ratio of counts in band R versus counts in band D).
The contrast in lane 6 was increased to a larger degree than the rest
of the gel due to the presence of fewer counts in that lane (see
Materials and Methods). Note that this lane is included only for
comparison with other studies; the use of this (or any) reference
molecule does not influence the  G°s obtained for
comparison between differing DNA samples measured in the same
competitive environment.
|
|
The results of one such experiment are illustrated in Fig.
3 for the
601.3 sequence (lane 1) and the 5S reference molecule
(lane 6). The
results from many such experiments are summarized
quantitatively in
Table
1. The free energy of sequence
601.3(A
16End)
(lane 2) is 0.11 kcal mol
1
greater (i.e., lower affinity) than that of the parent 601.3
sequence,
and that of 601.3(A
16Mid) variant (lane 3) is 0.35 kcal
mol
1 greater.
To test whether the observed small effects on free energy were due to
inherent A
16 characteristics and not simply the loss
of
native 601.3 sequence, a randomly chosen sequence from plasmid
pGEM3z
was used to replace the poly(dA-dT) sequences [601.3(Random
End), lane
4; 601.3(Random Mid), lane 5]. The plasmid sequence
restored most of
the lost affinity, implying that most of the
small destabilization is
an active consequence of the presence
of the A
16 elements.
Restriction enzyme digestion kinetics assay for position-dependent
equilibrium accessibility of nucleosomal DNA target sites.
Nucleosomes in vitro are in rapid dynamic equilibrium with alternative
conformational states in which the nucleosomal DNA is partially
unwrapped off the histone surface. Thus, DNA target sites that in the
time average are buried inside the nucleosome and inaccessible are
nevertheless transiently freely accessible to a binding protein R or
nuclease E (27-30). Such site exposure processes are
occurring constantly yet transiently in a rapid preequilibrium. Site
exposure is nondissociative: one side of the DNA remains bound, while
the other side is exposed. In vitro, site exposure occurs via partial
uncoiling of the nucleosomal DNA, rather than by translocation of the
histone octamer (Anderson and Widom, submitted). The equilibrium
constants for site exposure Keqconf
(the equilibrium fraction of the time that nucleosomal DNA target sites
are freely accessible, as though they were naked DNA) decrease from the
end of the nucleosomal DNA inward toward the middle (2). The apparent equilibrium affinities of proteins binding to nucleosomal target sites, and
equivalently
the observed rate constants for digestion of nucleosomal DNA by restriction endonucleases or
nonspecific exonucleases, are reduced from their values on naked DNA by
a factor equal to the position-dependent value of
Keqconf. For further discussion of
the site exposure model, see references 27 to 29.
We used the restriction enzyme digestion kinetics assay (
1,
2,
27,
29) to measure relative values
Keqconf at target sites throughout
the nucleosome. The goal of this study
is to compare
Keqconf values at sites throughout
the nucleosome for A
16-containing
sequences versus the same
sequences lacking the A
16 element. Consequently,
rather
than measuring absolute values of
Keqconf (which requires parallel
analyses of naked DNA), we measured
relative values, obtained from the
ratio of digestion rates on
the pairs of nucleosomal samples in
parallel digestions in identical
conditions.
Parallel digestions of native nucleosomes (containing DNA construct
601.3) and test nucleosomes (containing a 601.3 derivative)
were
carried out in identical solution conditions initiated by
the addition
of enzyme. Aliquots were removed as a function of
time and quenched.
Samples were analyzed via denaturing polyacrylamide
gel
electrophoresis. Representative results of one such experiment,
probing
the
HhaI recognition sequence spanning bp 76 to 79 from
the
edge of the nucleosome, are illustrated in Fig.
4A to D for
naked 601.3 DNA, 601.3 nucleosomes, 601.3(A
16End), and 601.3(A
16Mid),
respectively. Figure
4E to H show the corresponding quantitative
analyses for Fig.
4A to D, respectively.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 4.
Representative kinetic analysis, probing site exposure
at the HhaI site, 76 to 79 bp pairs from the 5' end of the
predominant core particle position. (A to D) Denaturing polyacrylamide
gel analysis of the time course of digestion. Lanes 1 through 7 in all
digestion gels are samples removed at 0, 0.5, 1, 2, 5, 10, and 15 min
from reaction initiation. In each case, the substrate (S; 152 nucleotides [nt] for all 601.3 constructs) is converted over time to
two products (82 nt [P1] and 72 nt [P2] for all 601.3 constructs).
The sizes of S, P1, and P2 expected from the DNA sequence are confirmed
against the 100-bp DNA markers in lane M. (A) Naked 601.3 DNA, digested
with HhaI at 0.1 U ml 1; (B) 601.3 nucleosomes,
digested with HhaI at 2,000 U ml 1; (C)
601.3(A16End) nucleosomes, digested with HhaI at
2,000 U ml 1; (D) 601.3(A16Mid) nucleosomes,
digested with HhaI at 2,000 U ml 1. (E to H)
Quantitative analyses of the time course of digestion from the data in
panels A to D, respectively. The fraction of DNA remaining uncut is
corrected for a small initial extent of nucleosome dissociation (which
did not correlate with the presence or absence of A16
elements, in contrast to another case in which nucleosome stability was
dependent on the acetylation state of the histones [1])
and is plotted versus time. The superimposed lines represent the
results of fits to a single exponential decay. See Materials and
Methods for further discussion of the kinetic analysis. Note that a
20,000-fold-lower enzyme concentration was used for the digestion on
naked DNA.
|
|
The raw data in the gel phosphorimages themselves show that (i) all
nucleosomal samples have equilibrium accessibilities much
lower than
those for naked DNA (note that the digestions on naked
DNA utilize
20,000-fold-lower enzyme concentration); and (ii)
the equilibrium
accessibility (relative rate of cleavage) on 601.3(A
16Mid)
is detectably greater than that on 601.3 or 601.3(A
16End).
The increased accessibilities due to the A
16 elements are
properties of actual A
16-containing nucleosomes, not
artifacts arising
from A
16 element-dependent decreased
overall stability of the
nucleosomes. The analysis method quantifies
and accounts for any
nucleosome dissociation caused by initial
adjustment of the sample
to the elevated [Mg
2+] and
temperature needed for the restriction enzyme digestions
(see Materials
and Methods), revealing and eliminating contributions
of
sample-dependent decreased overall stability when this does
in fact
occur (
1). In fact, such dissociation occurred only
at low
levels and was not systematically dependent on the sample
(in contrast
to our findings in a recent study of the effects
of histone
hyperacetylation [
1]). Moreover, subsequent additional
slow nucleosome dissociation does not contribute significantly
to the
observed kinetics, since direct analysis of mock digestions
shows no
significant slow dissociation beyond the small extent
of dissociation
which occurs immediately on elevation of [Mg
2+] and
temperature and also since the reactions occur as first-order
ones in
the enzyme concentration used (see Materials and
Methods).
The results from many such experiments are summarized quantitatively in
Table
2. The presence of an
A
16 element at the end
of the nucleosomal DNA, from bp 1 to
16 on the construct, changes
Keqconf
0.7- to 2.2-fold, depending on position, with an average increase
of
1.5- ± 0.1-fold (mean ± standard error). Placing the
A
16 element
further in toward the middle of the nucleosome,
from bp 37 to
52 (approximately 24 bp from the nucleosomal dyad),
increases
Keqconf 1.0- to 2.3-fold,
with an average increase of 1.7- ± 0.1-fold.
The significance of
these changes is discussed below.
Additional studies (not shown) were carried out to compare
Keqconf at various sites for the new
construct 601.3 versus 601.2, which
we have extensively characterized
(
2). The results for the
two constructs are identical
within experimental error, consistent
with the results of a detailed
analysis of the dependence of
Keqconf on DNA length (Anderson and
Widom, submitted). These observations
allow us to relate the present
relative measurements of
Keqconf for
A
16-containing derivatives of 601.3 versus 601.3 itself to
the absolute measurements of the position-dependent values of
Keqconf for 601.2 measured in our
earlier work. The resulting position-dependent
values for
Keqconf for constructs
601.2, 601.3(A
16Mid), and 601.3(A
16End) are
summarized
in Fig.
5.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 5.
Effects of poly(dA-dT) elements on position-dependent
equilibrium accessibilities of nucleosomal DNA target sites. Results
for poly(dA-dT)-containing constructs are determined relative to those
for reference construct 601.2, which were measured on an absolute scale
(2). See Fig. 1 for nucleosomal locations of the different
restriction sites. Open bars, 601.2 reference; shaded bars,
601.3(A16End); hatched bars, 601.3(A16Mid).
Note the log scale for Keqconf.
|
|
 |
DISCUSSION |
Keqconf values are strongly
dependent on position in the nucleosome.
The approximately 1.5- to
1.7-fold average increases in equilibrium accessibility
(Keqconf) detected here (Table 2)
are superimposed on a strong dependence of
Keqconf on position within the
nucleosome: Keqconf decreases
progressively by 2 to 3 orders of magnitude with distance from either
nucleosome end in toward the middle (dyad axis) of the nucleosomal DNA
(Fig. 5 and references 2 and 28). Thus, the small effects
on Keqconf arising from the
incorporation of an A16 element are a positive demonstration of small changes, not a negative finding that might have
resulted were the assay unable to detect large changes in protection
when these in fact exist.
The strong dependence of
Keqconf on
position inside the nucleosome, together with the substantial
protection afforded to even
the most accessible regions at the ends of
the nucleosomal DNA,
provides additional evidence that mispositioning
of nucleosomes
did not contribute significantly to the results obtained
here.
Given the known protection factors, any nonnucleosomal DNA
protruding
beyond an end of a mispositioned nucleosome would be
digested
to completion within the first time point and therefore would
not contribute to the present analysis, since we fit the disappearance
of full-length reactant subsequent to the first time point (see
Materials and Methods). Actually, however, we find that the fraction
of
total template DNA digested within the first time point is
quite small
and moreover is closely similar to the small fraction
of naked DNA
present in mock-digested samples as assessed by native
gel
electrophoresis and sucrose gradient ultracentrifugation (data
not
shown). Thus, we conclude that any mispositioned nucleosomes
are
present in at most small amounts, not detectable in the assays
used
here (and therefore also not contributing to the results
obtained),
consistent with the presence of single bands in native
gel
electrophoresis.
Poly(dA-dT) elements decrease the affinity of histone-DNA
interactions in nucleosomes and increase the equilibrium accessibility
of nucleosomal DNA target sites.
Placing an A16
element at bp 1 to 16 or 37 to 52 decreases the favorable free energy
of histone-DNA interactions by approximately 0.1 or 0.35 kcal
mol
1, respectively. While small, these differences are
significant, as the corresponding standard errors are ~0.06 kcal
mol
1. These measured differences in free energies are
consistent with some, but not all, earlier reports of the effects of
poly(dA-dT) elements (see the introduction), although differences in
the details of the experiments prohibit an exact comparison. We
attribute the one report of opposite energetic effects from poly(dA-dT) elements (see the introduction) to a likely failure of that study to
reach equilibrium. The differences in free energies that we report are
attributable to the A16 elements themselves and not simply
to loss of 16-bp stretches of the original high-affinity positioning
sequence 601.3, since replacement of the A16 elements by
randomly chosen bacterial plasmid sequence restores most or all of the
original free energy for nucleosome formation of 601.3.
The decreased favorable free energy of histone-DNA interactions is
accompanied by corresponding increases in
Keqconf averaged over the full set
of measurable locations in the nucleosomes,
of 1.5- and 1.7-fold,
respectively, for the same two A
16-containing
constructs.
These increases are significant, as the corresponding
standard errors
are only 0.14 and 0.12,
respectively.
The measured changes in
Keqconf are
not uniform across the nucleosome and even include a small number of
apparent decreases. The
results are consistent between the two
constructs in showing an
apparent absence of any enhancement in site
accessibility around
the nucleosome dyad (nearest the
RsaI
site). The results for both
constructs are also in agreement in
showing, within experimental
error, that enhanced accessibility extends
to both sides of the
nucleosomal DNA

that is, to the side that does
not contain the
poly(dA-dT) element as well as to the side that does.
This would
imply that there is free energy coupling across the
nucleosome.
We consider that we cannot state with confidence that these
position-dependent
fluctuations are real, as each of them is based on
relatively
fewer measurements with a correspondingly greater standard
error.
For this reason, we focus the present analysis on the average
across the full set of measurements for each construct, which
is much
more robust. However, in other studies (of the effects
of changed DNA
length [Anderson and Widom, submitted]) we detect
no such systematic
changes in a set of measurements made across
the nucleosome, suggesting
that the elevated accessibilities detected
here for both sides versus
the middle may in fact be
real.
Biological significance of 1.5- and 1.7-fold increases in the
equilibrium accessibility of nucleosomal DNA target sites; relation to
studies in vivo.
Do 1.5- or 1.7-fold changes in equilibrium
accessibility of nucleosomal DNA target sites have any biological
significance? Studies of the roles of poly(dA-dT) elements in the
expression of the HIS3 gene in S. cerevisiae
(13) and the AMT1 gene in C. glabrata (40) provide some appropriate comparisons.
The natural HIS3 promoter contains an imperfect 17-bp-long
poly(dA-dT) element adjacent to a binding site for the protein Gcn4,
the upstream activator protein for that gene. Replacing the endogenous
element with a perfect 42-bp-long one leads to 1.6- and 1.7-fold
increases in the accessibility of two adjacent sites to the restriction enzyme HinfI expressed in vivo, which in turn correlates
with a 3- to 11-fold increase in steady-state transcript levels. One of
the two HinfI sites is actually contained within the Gcn4
site and serves to monitor accessibility precisely at that site. In another experiment, the imperfect 17-bp element was either deleted altogether or replaced with a perfect 17-mer. The perfect 17-mer gave a
threefold increase in steady-state transcript levels compared to the
strain in which the element was deleted. A more recent study from this
laboratory (22) further investigated the contributions of
poly(dA-dT) tracts and other promoter elements to HinfI
accessibility in vivo. This new study suggests that increased site
accessibility of the promoter DNA in vivo cannot be attributed to any
particular promoter element [such as a poly(dA-dT) tract] but rather
may be due to some more global features of the promoter DNA sequence, such as its base composition. However, the data themselves reveal that
each of the two poly(dA-dT) elements that flank the HinfI site contributes ~2-fold increases to the HinfI site
accessibility. Thus, the results of that study show that individual
poly(dA-dT) elements do indeed contribute importantly to site
accessibility, consistent with their earlier results.
A different study investigates the role of a perfect 16-bp-long
poly(dA-dT) element on Cu-dependent activation of the
AMT1 gene in
C. glabrata (
40). These investigators
conclude that
the A
16 element plays a critical role in the
ability of Amt1 protein
to bind to its target site and stimulate
transcription of its
own gene. Deletion of the A
16 element
or its replacement by a
random sequence 16-mer substantially abrogated
activation of the
AMT1 gene, by ~10-fold at early times
and ~2-fold at later times.
The diminished ability of the random
sequence-containing promoter
construct to allow gene activation was
accompanied by ~2.3- and
~1.5-fold reductions in the rate of
digestion of nearby restriction
sites in permeabilized
spheroplasts.
Taken together, these studies show that the effect of poly(dA-dT)
elements in vivo is to cause very modest changes in DNA
accessibility
as measured by restriction enzymes; these changes
correlate with
increased accessibility to gene-activating proteins,
which in turn
cause modest increases in steady-state transcript
levels that are of
critical biological importance to the living
cells. Importantly, the
1.5- and 1.7-fold increases in
Keqconf caused by the incorporation
of A
16 elements found in this study
approximate the
~1.5-, 1.6-, 1.7-, ~2-, and 2.3-fold effects found
for the
experiments in vivo mentioned above, suggesting that our
in vitro
system may be capturing most of the physiological role
of the
poly(dA-dT)
elements.
These poly(dA-dT) elements act in combination with other sequence
motifs or elements that remain to be defined (
22). These
other elements too make small but significant contributions to
the
overall accessibility of the promoter region, allowing for
an overall
larger increase in
accessibility.
Finally, as another measure of the significance of quantitatively
similar effects on transcription, we compare the modest
effects
attributable to poly(dA-dT) elements in vitro and in vivo
with the
consequences of the phenomenon of dosage compensation
in
Drosophila. In that system, many different small effects on
transcription combine to yield an overall twofold increase in
X-chromosome transcription in males (
36).
Two interrelated models for the mechanisms of action of poly(dA-dT)
elements in vivo.
The present results support two interrelated but
distinct models for the mechanism of action of poly(dA-dT) elements. To
understand the distinction between the two models, we must recall that
this study was carried out with nucleosomes that are constrained to exist in a fixed position along the DNA. This constraint is provided in
the forms of a driving force for a particular positioning (18, 19), the use of a DNA sequence that is barely longer than the core particle DNA length (strongly disfavoring alternative
positionings), and a kinetic barrier that effectively prevents movement
away from this position in the time scale of these studies (Anderson and Widom, submitted).
One model for the mechanism of action of poly(dA-dT) elements in vivo
is directly implied by the present results. Given nucleosomes
that are
constrained to a fixed location along the DNA, we show
here that
incorporation of poly(dA-dT) elements destabilize the
wrapping of DNA
on the histone core, thereby increasing the accessibility
of DNA target
sites to transactivating factors that must bind
to sites contained
within the same nucleosome. The present results
show this to be true in
vitro; such a mechanism would apply also
in vivo if nucleosomes are
similarly immobile in vivo or, even
if nucleosomes are mobile in vivo,
if sufficiently large forces
exist to strongly bias the time-averaged
positioning of nucleosomes.
Examples of forces that are likely to be
relevant to nucleosome
positioning in vivo, and their corresponding
magnitudes, are discussed
elsewhere (
39).
A second model recognizes that nucleosomes may be rapidly mobile in
vivo. Many ATP-dependent factors have been discovered
that are capable
of catalyzing nucleosome mobility in vitro and
are linked to gene
regulation in vivo (
11,
15,
16,
25,
26,
38). If
nucleosomes are indeed freely mobile, it follows
that poly(dA-dT)
elements, by disfavoring packaging into nucleosomes
(by the modest but
significant free energy penalties summarized
above), would bias
nucleosome positioning so as to favor (in the
time average) positions
in which the poly(dA-dT) elements lie
outside the nucleosome. Such
nucleosome positions may in turn
favor binding of transactivating
factors, by placing the binding
sites off of the nucleosomes altogether
(where equilibrium accessibility
is greatest) or by placing the binding
sites only short distances
inside the nucleosome, where equilibrium
accessibilities are less
than in linker DNA yet still orders of
magnitude greater than
when the sites are located near the nucleosome
middle (
2,
28).
These two models can in principle both be operative in vivo. Actually,
the two models are closely related: they are simply
two different
manifestations of the same basic behavior of nucleosomes.
This is
because the position-dependent free energy of histone-DNA
interactions
is an important determinant of both nucleosome positioning
(
19) and site exposure (
2). Indeed, the two
effects can be
quantitatively linked, with
Keqconf values for poly(dA-dT)
element-containing nucleosomes increasing
by the factor
exp(


G°/
RT), where

G°
is the magnitude of the
free energy penalty for incorporating the
poly(dA-dT) element
(J. Widom, unpublished results). In this case, the
present measured

G° of ~0.35 kcal
mol
1 for construct 601.3(A
16Mid) would yield
a ~1.8-fold increase
in equilibrium accessibility. This is close to
the ~1.7-fold average
increase that we observe experimentally,
highlighting the relatedness
of these two seemingly different
models.
Other nucleosome-destabilizing DNA sequence elements.
Taken
together with the results of earlier studies, our new results suggest
that poly(dA-dT) elements act in combination with other sequence motifs
or elements to decrease the probability of nucleosomes being located
along a given region of promoter DNA or to destabilize the wrapping of
DNA in a nucleosome that is positioned on the promoter DNA. The results
of Mai et al. (22) suggest that these additional elements
are distributed throughout the length of the promoter region. The
absence of dependence on known histone acetyltransferases or other
chromatin-remodeling enzymes suggests that these sequence elements may,
like the poly(dA-dT) elements, act through a direct effect on the
positioning or stability of nucleosomes.
At present we can only speculate as to the nature of these hypothetical
sequence elements that repel or destabilize nucleosomes.
However, two
recent studies provide some examples of DNA sequence
motifs that do
have such behavior, showing that this viewpoint
is plausible. A
negative selection experiment carried out with
nonnatural DNA led to
the isolation of sequences that have anomalously
low affinity for the
histone octamer (
4). The most prevalent
of these sequence
motifs include repeats of TGGA, TGA, or CA,
suggesting that such
sequence motifs may be unfavorable (in comparison
to arbitrary sequence
DNA) for incorporation in nucleosomes. Another
study from our own
laboratory, investigating sequences that favor
incorporation into
nucleosomes (
18), revealed at the same time
certain
sequence motifs that were systematically underrepresented
(i.e.,
actively selected against) and which thus apparently disfavor
nucleosomal packaging. Interestingly, these include the dinucleotide
steps AT and CA (=TG), which are all featured in the longer repeating
motifs isolated in the negative selection. This implies that these
dinucleotides themselves and the longer motifs that contain them
do in
fact disfavor incorporation into nucleosomes. New studies
will be
required to assess whether these particular small sequence
motifs
contribute to gene regulation in
vivo.
 |
ACKNOWLEDGMENTS |
This work was supported by a grant from the NIH (to J.W.) and by
an NIH Cell and Molecular Basis of Disease Traineeship (to J.D.A.).
We acknowledge with gratitude the use of instruments in the Keck
Biophysics Facility. We thank the members of our group for valuable
discussions and comments on the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry, Molecular Biology, and Cell Biology, Northwestern
University, 2153 Sheridan Rd., Evanston, IL 60208-3500. Phone: (847)
467-1887. Fax: (847) 467-1380. E-mail:
j-widom{at}northwestern.edu.
 |
REFERENCES |
| 1.
|
Anderson, J. D.,
P. T. Lowary, and J. Widom.
2001.
Effects of histone acetylation on the dynamic equilibrium accessibility of nucleosomal DNA target sites.
J. Mol. Biol.
307:977-985[CrossRef][Medline].
|
| 2.
|
Anderson, J. D., and J. Widom.
2000.
Sequence- and position-dependence of the equilibrium accessibility of nucleosomal DNA target sites.
J. Mol. Biol.
296:979-987[CrossRef][Medline].
|
| 3.
|
Behe, M. J.
1995.
An overabundance of long oligopurine tracts occurs in the genome of simple and complex eukaryotes.
Nucleic Acids Res.
23:689-695[Abstract/Free Full Text].
|
| 4.
|
Cao, H.,
H. R. Widlund,
T. Simonsson, and M. Kubista.
1998.
TGGA-repeats impair nucleosome formation.
J. Mol. Biol.
281:253-260[CrossRef][Medline].
|
| 5.
|
Chen, W.,
S. Tabor, and K. Struhl.
1987.
Distinguishing between mechanisms of eukaryotic transcriptional activation with bacteriophage T7 RNA polymerase.
Cell
50:1047-1055[CrossRef][Medline].
|
| 6.
|
Cosma, M. P.,
T. Tanaka, and K. Nasmyth.
1999.
Ordered recruitment of transcription and chromatin remodeling factors to a cell cycle- and developmentally regulated promoter.
Cell
97:299-311[CrossRef][Medline].
|
| 7.
|
DiGabriele, A. D., and T. A. Steitz.
1993.
A DNA dodecamer containing an adenine tract crystallizes in a unique lattice and exhibits a new bend.
J. Mol. Biol.
231:1024-1039[CrossRef][Medline].
|
| 8.
|
Feng, H.-P.,
D. S. Scherl, and J. Widom.
1993.
Lifetime of the histone octamer studied by continuous-flow quasielastic light scattering- test of a model for nucleosome transcription.
Biochemistry
32:7824-7831[CrossRef][Medline].
|
| 9.
|
Flaus, A.,
K. Luger,
S. Tan, and T. J. Richmond.
1996.
Mapping nucleosome position at single base-pair resolution by using site-directed hydroxyl radicals.
Proc. Natl. Acad. Sci. USA
93:1370-1375[Abstract/Free Full Text].
|
| 10.
|
Getts, R. C., and M. J. Behe.
1992.
Isolated oligopurine tracts do not significantly affect the binding of DNA to nucleosomes.
Biochemistry
31:5380-5385[CrossRef][Medline].
|
| 11.
|
Hamiche, A.,
R. Sandaltzopoulos,
D. A. Gdula, and C. Wu.
1999.
ATP-dependent nucleosome sliding mediated by the chromatin remodeling complex NURF.
Cell
97:833-842[CrossRef][Medline].
|
| 12.
|
Hayes, J.,
J. Bashkin,
T. D. Tullius, and A. P. Wolffe.
1991.
The histone core exerts a dominant constraint on the structure of DNA in a nucleosome.
Biochemistry
30:8434-8440[CrossRef][Medline].
|
| 13.
|
Iyer, V., and K. Struhl.
1995.
Poly(dA:dT), a ubiquitous promoter element that stimulates transcription via its intrinsic DNA structure.
EMBO J.
14:2570-2579[Medline].
|
| 14.
|
Karlin, S.,
B. E. Blaisdell,
R. J. Sapolsky,
L. Cardon, and C. Burge.
1993.
Assessments of DNA inhomogeneities in yeast chromosome III.
Nucleic Acids Res.
21:703-711[Abstract/Free Full Text].
|
| 15.
|
Kingston, R. E., and G. J. Narlikar.
1999.
ATP-dependent remodeling and acetylation as regulators of chromatin fluidity.
Genes Dev.
13:2339-2352[Free Full Text].
|
| 16.
|
Langst, G.,
E. J. Bonte,
D. F. V. Corona, and P. B. Becker.
1999.
Nucleosome movement by CHRAC and ISWI without disruption or trans-displacement of the histone octamer.
Cell
97:843-852[CrossRef][Medline].
|
| 17.
|
Losa, R.,
S. Omari, and F. Thoma.
1990.
Poly(dA) · poly(dT) rich sequences are not sufficient to exclude nucleosome formation in a constitutive yeast promoter.
Nucleic Acids Res.
18:3495-3502[Abstract/Free Full Text].
|
| 18.
|
Lowary, P. T., and J. Widom.
1998.
New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning.
J. Mol. Biol.
276:19-42[CrossRef][Medline].
|
| 19.
|
Lowary, P. T., and J. Widom.
1997.
Nucleosome packaging and nucleosome positioning of genomic DNA.
Proc. Natl. Acad. Sci. USA
94:1183-1188[Abstract/Free Full Text].
|
| 20.
|
Luger, K.,
T. J. Rechsteiner,
A. J. Flaus,
M. M. Y. Waye, and T. J. Richmond.
1997.
Characterization of nucleosome core particles containing histone proteins made in bacteria.
J. Mol. Biol.
272:301-311[CrossRef][Medline].
|
| 21.
|
Mahloogi, H., and M. J. Behe.
1997.
Oligoadenosine tracts favor nucleosome formation.
Biochem. Biophys. Res. Commun.
235:663-668[CrossRef][Medline].
|
| 22.
|
Mai, X.,
S. Chou, and K. Struhl.
2000.
Preferential accessibility of the yeast his3 promoter is determined by a general property of the DNA sequence, not by specific elements.
Mol. Cell. Biol.
20:6668-6676[Abstract/Free Full Text].
|
| 23.
|
Nelson, H. C.,
J. T. Finch,
B. F. Luisi, and A. Klug.
1987.
The structure of an oligo(dA) · oligo(dT) tract and its biological implications.
Nature
330:221-226[CrossRef][Medline].
|
| 24.
|
Packer, M. J.,
M. P. Dauncey, and C. A. Hunter.
2000.
Sequence-dependent DNA structure: tetranucleotide conformational maps.
J. Mol. Biol.
295:85-103[CrossRef][Medline].
|
| 25.
|
Pazin, M. J.,
P. Bhargava,
E. P. Geiduschek, and J. T. Kadonaga.
1997.
Nucleosome mobility and the maintenance of nucleosome positioning.
Science
276:809-812[Abstract/Free Full Text].
|
| 26.
|
Peterson, C. L., and J. L. Workman.
2000.
Promoter pargeting and chromatin remodeling by the SWI/SNF complex.
Curr. Opin. Genet. Dev.
10:187-192[CrossRef][Medline].
|
| 27.
|
Polach, K. J.,
P. T. Lowary, and J. Widom.
2000.
Effects of core histone tail domains on the equilibrium constants for dynamic DNA site accessibility in nucleosomes.
J. Mol. Biol.
298:211-223[CrossRef][Medline].
|
| 28.
|
Polach, K. J., and J. Widom.
1995.
Mechanism of protein access to specific DNA sequences in chromatin: a dynamic equilibrium model for gene regulation.
J. Mol. Biol.
254:130-149[CrossRef][Medline].
|
| 29.
|
Polach, K. J., and J. Widom.
1999.
Restriction enzymes as probes of nucleosome stability.
Methods Enzymol.
304:278-298[CrossRef][Medline].
|
| 30.
|
Protacio, R. U.,
K. J. Polach, and J. Widom.
1997.
Coupled enzymatic assays for the rate and mechanism of DNA site-exposure in a nucleosome.
J. Mol. Biol.
274:708-721[CrossRef][Medline].
|
| 31.
|
Satchwell, S. C., and A. A. Travers.
1989.
Asymmetry and polarity of nucleosomes in chicken erythrocyte chromatin.
EMBO J.
8:229-238[Medline].
|
| 32.
|
Schwarz, P. M.,
A. Felthauser,
T. M. Fletcher, and J. C. Hansen.
1996.
Reversible oligonucleosome self-association: dependence on divalent cations and core histone tail domains.
Biochemistry
35:4009-4015[CrossRef][Medline].
|
| 33.
|
Shimizu, M.,
T. Mori,
T. Sakurai, and H. Shindo.
2000.
Destabilization of nucleosomes by an unusual DNA conformation adopted by poly(dA):poly(dT) tracts in vivo.
EMBO J.
19:3358-3365[CrossRef][Medline].
|
| 34.
|
Simpson, R. T., and D. W. Stafford.
1983.
Structural features of a phased nucleosome core particle.
Proc. Natl. Acad. Sci. USA
80:51-55[Abstract/Free Full Text].
|
| 35.
|
Struhl, K.
1985.
Naturally occurring poly(dA-dT) sequences are upstream promoter elements for constitutive transcription in yeast.
Proc. Natl. Acad. Sci. USA
82:8419-8423[Abstract/Free Full Text].
|
| 36.
|
Stuckenholz, C.,
Y. Kageyama, and M. I. Kuroda.
1999.
Guilt by association: non-coding RNAs, chromosome-specific proteins and dosage compensation in Drosophila.
Trends Genet.
15:454-458[CrossRef][Medline].
|
| 37.
|
Thåström, A.,
P. T. Lowary,
H. R. Widlund,
H. Cao,
M. Kubista, and J. Widom.
1999.
Sequence motifs and free energies of selected natural and non-natural nucleosome positioning DNA sequences.
J. Mol. Biol.
288:213-229[CrossRef][Medline].
|
| 38.
|
Whitehouse, I.,
A. Flaus,
B. R. Cairns,
M. F. White,
J. L. Workman, and T. Owen-Hughes.
1999.
Nucleosome mobilization catalysed by the yeast SWI/SNF complex.
Nature
400:784-787[CrossRef][Medline].
|
| 39.
|
Yao, J.,
P. T. Lowary, and J. Widom.
1993.
Twist constraints on linker DNA in the 30-nm chromatin fiber: implications for nucleosome phasing.
Proc. Natl. Acad. Sci. USA
90:9364-9368[Abstract/Free Full Text].
|
| 40.
|
Zhu, Z., and D. J. Thiele.
1996.
A specialized nucleosome modulates transcription factor access to a C. glabrata metal responsive promoter.
Cell
87:459-470[CrossRef][Medline].
|
Molecular and Cellular Biology, June 2001, p. 3830-3839, Vol. 21, No. 11
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.11.3830-3839.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Wippo, C. J., Krstulovic, B. S., Ertel, F., Musladin, S., Blaschke, D., Sturzl, S., Yuan, G.-C., Horz, W., Korber, P., Barbaric, S.
(2009). Differential Cofactor Requirements for Histone Eviction from Two Nucleosomes at the Yeast PHO84 Promoter Are Determined by Intrinsic Nucleosome Stability. Mol. Cell. Biol.
29: 2960-2981
[Abstract]
[Full Text]
-
Kharchenko, P. V., Woo, C. J., Tolstorukov, M. Y., Kingston, R. E., Park, P. J.
(2008). Nucleosome positioning in human HOX gene clusters. Genome Res
18: 1554-1561
[Abstract]
[Full Text]
-
Mavrich, T. N., Ioshikhes, I. P., Venters, B. J., Jiang, C., Tomsho, L. P., Qi, J., Schuster, S. C., Albert, I., Pugh, B. F.
(2008). A barrier nucleosome model for statistical positioning of nucleosomes throughout the yeast genome. Genome Res
18: 1073-1083
[Abstract]
[Full Text]
-
Hendrix, D. A., Hong, J.-W., Zeitlinger, J., Rokhsar, D. S., Levine, M. S.
(2008). Promoter elements associated with RNA Pol II stalling in the Drosophila embryo. Proc. Natl. Acad. Sci. USA
105: 7762-7767
[Abstract]
[Full Text]
-
Gutierrez, J., Paredes, R., Cruzat, F., Hill, D. A., van Wijnen, A. J., Lian, J. B., Stein, G. S., Stein, J. L., Imbalzano, A. N., Montecino, M.
(2007). Chromatin Remodeling by SWI/SNF Results in Nucleosome Mobilization to Preferential Positions in the Rat Osteocalcin Gene Promoter. J. Biol. Chem.
282: 9445-9457
[Abstract]
[Full Text]
-
Kim, Y., McLaughlin, N., Lindstrom, K., Tsukiyama, T., Clark, D. J.
(2006). Activation of Saccharomyces cerevisiae HIS3 Results in Gcn4p-Dependent, SWI/SNF-Dependent Mobilization of Nucleosomes over the Entire Gene. Mol. Cell. Biol.
26: 8607-8622
[Abstract]
[Full Text]
-
Cioffi, A., Fleury, T. J., Stein, A.
(2006). Aspects of large-scale chromatin structures in mouse liver nuclei can be predicted from the DNA sequence. Nucleic Acids Res
34: 1974-1981
[Abstract]
[Full Text]
-
Yuan, G.-C., Liu, Y.-J., Dion, M. F., Slack, M. D., Wu, L. F., Altschuler, S. J., Rando, O. J.
(2005). Genome-Scale Identification of Nucleosome Positions in S. cerevisiae. Science
309: 626-630
[Abstract]
[Full Text]
-
Anderson, J. D., Thastrom, A., Widom, J.
(2002). Spontaneous Access of Proteins to Buried Nucleosomal DNA Target Sites Occurs via a Mechanism That Is Distinct from Nucleosome Translocation. Mol. Cell. Biol.
22: 7147-7157
[Abstract]
[Full Text]