Previous Article | Next Article 
Molecular and Cellular Biology, June 2001, p. 3935-3946, Vol. 21, No. 12
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.12.3935-3946.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
RAG-1 Mutations Associated with B-Cell-Negative
SCID Dissociate the Nicking and Transesterification Steps of
V(D)J Recombination
Wenhui
Li,
Fu-Chung
Chang, and
Stephen
Desiderio*
Department of Molecular Biology and Genetics
and Howard Hughes Medical Institute, The Johns Hopkins University
School of Medicine, Baltimore, Maryland 21205
Received 13 November 2000/Returned for modification 9 January
2001/Accepted 30 March 2001
 |
ABSTRACT |
Some patients with B-cell-negative severe combined immune
deficiency (SCID) carry mutations in RAG-1 or RAG-2 that impair V(D)J
recombination. Two recessive RAG-1 mutations responsible for
B-cell-negative SCID, R621H and E719K, impair V(D)J recombination without affecting formation of single-site recombination signal sequence complexes, specific DNA contacts, or perturbation of DNA
structure at the heptamer-coding junction. The E719K mutation impairs
DNA cleavage by the RAG complex, with a greater effect on nicking than
on transesterification; a conservative glutamine substitution exhibits
a similar effect. When cysteine is substituted for E719, RAG-1 activity
is enhanced in Mn2+ but remains impaired in
Mg2+, suggesting an interaction between this residue and an
essential metal ion. The R621H mutation partially impairs nicking, with little effect on transesterification. The residual nicking activity of
the R621H mutant is reduced at least 10-fold upon a change from pH 7.0 to pH 8.4. Site-specific nicking is severely impaired by an alanine
substitution at R621 but is spared by substitution with lysine. These
observations are consistent with involvement of a positively charged
residue at position 621 in the nicking step of the RAG-mediated
cleavage reaction. Our data provide a mechanistic explanation for one
form of hereditary SCID. Moreover, while RAG-1 is directly involved in
catalysis of both nicking and transesterification, our observations
indicate that these two steps have distinct catalytic requirements.
 |
INTRODUCTION |
The central event in the generation
of immunological diversity is the assembly of T-cell receptor and
immunoglobulin genes from discrete DNA segments, V, D, and J, during
lymphocyte development. This process, termed V(D)J recombination, is
the only known form of site-specific DNA rearrangement in vertebrates.
V(D)J recombination is mediated by heptamer and nonamer signal
sequences, which are separated by spacer regions of 12 or 23 bp
(28), and is initiated by the recombination-activating
proteins RAG-1 and RAG-2 (33, 39), which act in concert to
cleave DNA at the junctions between antigen receptor coding segments
and conserved recombination signals that specify sites of recombination
(31, 48).
RAG-mediated DNA cleavage occurs in two steps (31). First,
one DNA strand is nicked between the recombination signal sequence (RSS) heptamer and the coding sequence. This is followed by a transesterification reaction in which the free hydroxyl group at the 3'
end of the coding sequence attacks a phosphodiester on the opposite
strand (49, 50). As a result, two DNA ends are produced: a
signal end, terminating in a blunt, 5'-phosphorylated, double-strand
break, and a coding end, terminating in a hairpin.
RAG-1 and RAG-2 are both essential for initiation of V(D)J
recombination. RAG-2 alone has no detectable DNA binding activity in
vitro but collaborates with RAG-1 in RSS recognition (2, 11, 20,
29, 44, 45). In the absence of RAG-2, RAG-1 interacts weakly
with the RSS through the nonamer element (11, 20, 42, 45).
In contrast, assembly of a complex containing the RSS, RAG-1, and RAG-2
is strongly heptamer dependent (2, 11, 20, 45) and is
accompanied by kinking or unwinding of substrate DNA near the scissile
bond at the heptamer-coding boundary (45). Chemical
interference and footprinting have shown that in the presence of RAG-1
alone, DNA contacts are restricted to the vicinity of the nonamer
(45). Occupancy of the heptamer requires RAG-2
(45), which induces RAG-1 to approach the scissile bond
(44). The proximity of RAG-1 to the site of DNA cleavage in the presence of RAG-2 has suggested a direct role for RAG-1 in DNA
cleavage. The relative roles of RAG-1 and RAG-2 in catalysis of nicking
and transesterification, however, remain incompletely understood.
The chemistry of DNA cleavage by the RAG proteins is formally
equivalent to that employed by classical transposases such as Mu A
(37, 49, 50). Several additional lines of evidence indicate that V(D)J recombination represents a specialized form of DNA
transposition, including the formal equivalence of hybrid joint
formation to the retroviral disintegration reaction and the ability of
the RAG proteins to integrate signal ends into nonhomologous DNA
(1, 21). The similarity between V(D)J rearrangement and
other types of transposition suggests that the RAG catalytic core may
resemble that of other transposases. The transposases of retroviruses,
retrotransposons, IS3 elements, and Mu, as well as the TnsB
transposase component of Tn7, all contain an array of acidic
amino acids, the DDE motif (7, 35), which binds an
essential divalent cation such as Mg2+ at or near the
active sites for DNA cleavage and strand transfer (3, 5, 12, 24,
36, 38). Direct participation of the DDE motif residues in metal
binding has been demonstrated for the human immunodeficiency virus and
avian sarcoma virus integrases by crystallographic analysis (5,
12) and for TnsB of Tn7 by the observation that
cysteine substitution results in altered metal specificity
(38). Although the RAG proteins lack significant homology
to the retroviral integrase superfamily, precluding identification of a
putative active center by sequence alignment, recent studies employing
iron-induced hydroxyl radical cleavage and site-directed mutagenesis
have identified three acidic residues within RAG-1, D600, D708, and
E962, that are essential for nicking and transesterification activity
(14, 23, 27). Substitution of cysteine at two of these
residues, D600 and D708, was associated with metal ion-specific recovery of DNA cleavage activity, implicating these amino acids in the
binding of an essential divalent cation.
About one-third of all patients with severe combined immunodeficiency
(SCID) lack detectable B cells. A number of B-cell-negative SCID
patients have been shown to carry debilitating mutations in RAG-1,
RAG-2, or both, resulting in impairment of V(D)J recombination (40). In this communication we have examined the
biochemical properties of SCID-associated RAG-1 alleles, with the goal
of defining the precise molecular defects arising from these mutations.
Two RAG-1 mutations associated with B-cell-negative SCID, R621H and
E719K, impair V(D)J recombination in vivo without affecting formation
of single-site RSS complexes in vitro. The E719K mutation impaired both
the nicking and transesterification steps of DNA cleavage. In contrast,
the R621H mutation partially impaired nicking, with little or no effect
on transesterification. Further analysis suggested that RAG-mediated
strand scission requires a positively charged residue at position 621 of RAG-1. These data provide a mechanistic explanation for one form of
hereditary SCID and indicate that RAG-dependent nicking and
transesterification are likely to have distinct catalytic requirements.
 |
MATERIALS AND METHODS |
DNA constructs and site-directed mutagenesis.
Maltose-binding protein (MBP) fusions containing RAG-1 (residues 384 to
1008) or RAG-2 (residues 1 to 387) cores, tagged at the carboxyl
terminus with a myc epitope and polyhistidine, have been described
previously (31, 48). DNA fragments encoding these proteins
(gifts of Dik van Gent and Martin Gellert) were cloned between the
BamHI and NotI sites of pcDNA-1 (Invitrogen) to
create pcDNAR1 and pcDNAR2 (45).
RAG-1 cDNA, cloned into pBluescript SK(II), was the starting material
for mutagenesis. Mutations R621H, E719K, and Y935Stop were introduced
by standard PCR; E719C was introduced using divergent PCR
(30). Products were confirmed by nucleotide sequencing. For expression in mammalian cells, DNA cassettes spanning the mutations
were exchanged for the corresponding wild-type fragment of pcDNAR1.
Cell culture, transfection, and protein purification.
The
293 cell line was maintained in Dulbecco's modified Eagle's medium
supplemented with 10% fetal bovine serum. RAG expression constructs
were cotransfected with pRSV-T into 293 cells by the calcium phosphate method.
For purification of RAG fusion proteins, pcDNAR1 or a corresponding
mutant construct was cotransfected with pcDNAR2 into 293
cells (10 µg
of each plasmid per 10-cm-diameter culture plate).
At 48 h after
transfection, RAG-1 and RAG-2 fusion proteins were
copurified by
amylose affinity chromatography as described elsewhere
(
29,
45).
EMSAs.
Electrophoretic mobility shift assays (EMSAs) were
carried out as described previously (45). Binding reaction
mixtures (10 µl) contained 0.02 pmol of 32P-labeled
substrate DNA, 100 nM nonspecific duplex oligonucleotide DAR81/82
(20), 20 ng of RAG-1, and 15 ng of RAG-2 in 60 mM
potassium acetate, 60 mM KCl, 25 mM morpholinepropanesulfonic acid-KOH
(pH 7.0), 10 mM Tris Cl (pH 7.6), 1 mM CaCl2, 0.8 mM
dithiothreitol, 100 µg of bovine serum albumin/ml, 20% dimethyl
sulfoxide, and 4% glycerol. Except where indicated, reaction mixtures
were incubated at 37°C for 20 min and chilled on ice for 5 min, after
which time 4 µl of ice-cold 25% glycerol and 0.01% bromophenol blue
was added. Samples were fractionated by 4% polyacrylamide gel
electrophoresis in 0.5× Tris-borate-EDTA (TBE). Gels and running
buffer were equilibrated to 4°C before loading, and electrophoresis
was carried out at 4°C. 32P was detected using a phosphorimager.
DNA cleavage assays.
Except where indicated, DNA cleavage
reactions were performed in Mg2+ as described previously
(19), using substrates DAR39/DAR40 (containing a 12-spacer
RSS), DAR61/DAR62 (containing a 23-spacer RSS), or both, as indicated
in Results. Reaction mixtures (10 µl) contained 0.02 pmol of
radiolabeled substrate, 20 ng of RAG-1, and 15 ng of RAG-2. In assays
involving the sulfur-substituted RAG-1 mutant E719C, reactions were
conducted in 6 mM Mg2+ or 1 mM Mn2+. The
prenicked substrate was constructed by annealing oligonucleotides SD2049 (5'-GATCTGGCCTGTCTTA-3'), SD2050
(5'-CACAGTGCTACAGACTGGAACAAAAACCCTGCAG-3'), and SD2082
(5'-CTGCAGGGTTTTTGTTCCAGTCTGTAGCACTGTGTAAGACAGGC CAGATC-3'). SD2050 was phosphorylated by T4 polynucleotide kinase at its 5' end
before annealing to simulate a physiologic nicking product. HMG-1
protein (8 µg/ml, final concentration) was added to some cleavage
reaction mixtures as indicated in Results. Reaction products were
detected with a phosphorimager and quantitated using ImageQuant software.
Assays for V(D)J recombination and DNA cleavage in vivo.
The
wild-type RAG-1 expression construct pcDNAR1 (5 µg) or corresponding
mutant plasmids were contransfected into 293 cells with 10 µg of the
recombination substrate pJH200 (17) and 5 µg of pcRAG-2.
Rearrangement of the recombination substrate was assayed as described
elsewhere (17). Signal ends at the 12-spacer RSS were
assayed by ligation-mediated PCR using the oligonucleotide linker
FM25/11 (48); amplification was performed with primers 1233 and FM25 as described previously (48). To control for
recovery of the recombination substrate, primers 1233 and DR1
(48) were used to amplify a portion of the pJH200 backbone.
Modification interference assays.
Modification interference
assays were performed as described previously (45). In
brief, a 12-spacer substrate was formed by annealing oligonucleotides
SD2609
(5'-CGTGATCTGGCCTGTCT TACACAGTGCTACAGACTGGAACAAAAACCCTGCAGTGTAACGTAG) and SD2610
(5'-CTACGTTACACTGCAGGGTTTTTGTTCCAGTCTGTAGCACTGTGTAAGACAGGCCAGATCACG); heptamer and nonamer sequences are underlined.
5'-32P-labeled oligonucleotides were modified with dimethyl
sulfate (DMS) or KMnO4 (41, 46), annealed to
the unlabeled complementary strand, and purified (29).
Preparative EMSA was carried out as described above. DNA was
electrophoretically transferred to DEAE cellulose paper (DE81; Whatman)
in 0.5× TBE at 20 V and 4°C for 18 h. The paper was washed in
50 mM NaCl, 10 mM Tris (pH 7.6), and 1 mM EDTA for 5 min at 25°C, and
DNA was eluted in 1 M NaCl, 10 mM Tris (pH 7.6), and 1 mM EDTA at
65°C for 30 min. The eluate was filtered through 0.22-µm-pore-size
cellulose acetate (Spin-X; Costar), and DNA was recovered by ethanol
precipitation. DNA was cleaved at modified positions in 10%
piperidine. Cleavage products were fractionated by denaturing gel
electrophoresis and detected with a phosphorimager.
 |
RESULTS |
SCID-associated RAG-1 mutations R621H and E719K impair accumulation
of free signal ends in vivo.
It has previously been shown by
photo-cross-linking that RAG-1 is positioned near the scissile bond in
a precleavage complex containing RAG-2 and an RSS (13, 32,
44), suggesting that RAG-1 might participate directly in DNA
cleavage. This was borne out by evidence that residues D600, D708, and
E962 of RAG-1 play an intimate role in catalysis of DNA cleavage
(14, 23, 27). It has been estimated that about 10% of
patients with SCID carry mutations in RAG-1 or RAG-2 that impair V(D)J
recombination (40). The SCID-associated RAG-1 point
mutations R624H and E722K profoundly impair both signal joint formation
and coding joint formation in an extrachromosomal V(D)J recombination
assay (40). Both mutations occur at residues that are
phylogenetically invariant. Defective recombination does not result
from mislocalization of mutant proteins or defects in protein
accumulation (40).
To determine whether the R624H and E722K mutations exert their effects
before or after DNA cleavage, the corresponding amino
acid
substitutions, R621H and E719K, were introduced into a mouse
RAG-1 core
(amino acids 384 to 1008), fused at the amino terminus
to MBP and at
the carboxyl terminus to polyhistidine and a c-myc
epitope (Fig.
1A) (
31,
45,
48). A similar
fusion protein
representing a SCID-associated RAG-1 truncation at
residue Y935
(corresponding to human RAG-1 residue Y938
[
40]) was also constructed.
The extrachromosomal V(D)J
recombination substrate pJH200 was
cotransfected into 293 cells with
expression plasmids encoding
wild-type or mutant RAG-1 and wild-type
RAG-2 core (residues 1
to 387) fusion proteins. Recombination frequency
was scored at
48 h (
17). Plasmid DNA was examined in
parallel by ligation-mediated
PCR for the presence of signal breaks at
the 12-spacer RSS (
48).
As expected, each of the RAG-1
mutations impaired recombination
in vivo (Fig.
1B, lanes 5 to 7).
Moreover, recombination was not
rescued by coexpression of any two
mutant alleles of RAG-1 (Fig.
1B, lanes 2 to 4), indicating a lack of
interallelic complementation.
Although similar amounts of pJH200
plasmid DNA were recovered
from all transfections, only wild-type RAG-1
supported detectable
production of free signal ends (Fig.
1C, compare
lane 1 to lanes
2 through 7). While RAG-1(Y935Stop) was poorly soluble
(data not
shown), RAG-1(R621H) and RAG-1(E719K) were expressed in
soluble
form at levels equivalent to that of wild-type RAG-1 (Fig.
2 and
data not shown). From these results
we infer that the R621H and
E719K mutations act at or prior to DNA
cleavage.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 1.
Impairment of V(D)J recombination and DNA cleavage in
vivo by RAG-1 mutations associated with B-cell-negative SCID. (A)
Diagram of the RAG-1 fusion protein. The RAG-1 core (amino acids 384 to
1008), MBP, polyhistidine tag (H), and c-Myc epitope (M) are indicated.
Positions of SCID-associated point mutations are indicated. (B)
Wild-type or mutant RAG-1 fusion protein was coexpressed with the RAG-2
core in 293 cells and signal joint formation was quantitated by using
the extrachromosomal V(D)J recombination substrate pJH200. Percent
recombination was calculated as described by Hesse et al.
(17); values represent the means of at least three
independent experiments. Lanes: 1, wild-type RAG-1; 2, RAG-1(R621H) and
RAG-1(E719K); 3, RAG-1(R621H) and RAG-1(Y935Stop); 4, RAG-1(E719K) and
RAG-1(Y935Stop); 5, RAG-1(R621H); 6, RAG-1(E719K); 7, RAG-1(Y935Stop).
All assays included wild-type RAG-2 core. (C) Signal ends (upper panel)
were assayed by ligation-mediated PCR. Products were detected by
staining with ethidium bromide. Total pJH200 was assayed by PCR
amplification of a backbone sequence (lower panel), as described in
Materials and Methods. Lanes are numbered as for panel B.
|
|

View larger version (88K):
[in this window]
[in a new window]
|
FIG. 2.
Impairment of RSS cleavage in vitro by SCID-associated
RAG-1 mutations. (A) Wild-type or mutant RAG-1 core fusion proteins,
diagrammed in Fig. 1A, were coexpressed with an MBP-tagged RAG-2 core
in 293 cells and purified by affinity chromatography as described
elsewhere (29, 45). Equal volumes of purified protein (25 µl) were fractionated by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis and detected by silver staining. Lane 1, wild-type
RAG-1; lane 2, wild-type RAG-1 and RAG-2; lane 3, RAG-1(R621H) and
RAG-2; lane 4, RAG-1(E719K) and RAG-2. Positions of RAG-1 and RAG-2
fusion proteins are indicated by arrows. (B) In vitro cleavage assay.
Cleavage of 32P-labeled 12-spacer (lanes 1 to 5, 11 to 15, and 21 to 25) or 32P-labeled 23-spacer (lanes 6 to 10, 16 to 20, and 26 to 30) substrate (0.02 pmol in a 10-µl reaction volume)
was assayed in the presence of Mg2+ as described elsewhere
(19). Lanes 2 to 5 and 7 to 10, wild type RAG-1 and RAG-2;
lanes 12 to 15 and 17 to 20, RAG-1(R621H) and RAG-2; lanes 22 to 25 and
27 to 30, RAG-1(E719K) and RAG-2; lanes 1, 6, 11, 16, 21, and 26, and
RAG added. Lanes 4, 5, 14, 15, 24, and 25, addition of equimolar
unlabeled 23-spacer substrate (u). Lanes 3, 5, 8, 10, 13, 15, 18, 20, 23, 25, 28, and 30, addition of HMG-1 to 8µg/ml. Positions of nicked
and hairpin products are indicated by arrows at left.
|
|
R621H and E719K mutations impair substrate DNA cleavage in
vitro.
To examine the effects of the R621H and E719K mutations on
RAG-1 activity in vitro, the chimeric wild-type and mutant RAG-1 proteins were coexpressed with a chimeric RAG-2 core (amino acids 1 to
387 [31, 45, 48]) in 293 cells and purified by amylose affinity chromatography as described previously (45). All
three RAG-1 proteins were obtained in similar yield and in similar
proportion to the RAG-2 fusion protein (Fig. 2A).
Purified RAG proteins were assayed in the presence of Mg
2+,
which favors pairwise cleavage of 12-spacer and 23-spacer substrates
in
vitro. As expected, wild-type RAG-1, in combination with RAG-2,
supported nicking and transesterification of single 12-spacer
and
23-spacer substrates (Fig.
2B, lanes 2, 3, 7, and 8). Paired
cleavage
of 12-spacer and 23-spacer substrates was also observed,
as evidenced
by a significant increase in the yield of hairpin
product in the
presence of both substrates and HMG-1 protein (Fig.
2B, lanes 5 and
10). Consistent with published results, the efficiency
of hairpin
formation from a radiolabeled 12-spacer substrate was
reduced when
unlabeled 23-spacer substrate was present in the
absence of HMG-1 (Fig.
2B, lane 4), possibly by unproductive,
competitive binding of RAG
proteins. As expected, HMG-1 stimulated
cleavage of a radiolabeled
23-spacer substrate, even in the absence
of unlabeled 12-spacer
oligonucleotide (Fig.
2B, lane 8). DNA
cleavage in Mg
2+ was
most efficient, however, when 12- and 23-spacer substrates
were
combined in the presence of HMG-1 (Fig.
2B, lanes 5 and 10),
consistent
with previous observations (
47).
While DNA cleavage was impaired by both SCID-associated point
mutations, a more severe defect was seen with the E719K mutant
(Fig.
2B, lanes 11 to 30; Fig.
3). RAG-1(R621H)
supported some
nicking of 12- and 23-spacer substrates in the absence
or presence
of HMG-1 (Fig.
2B, lanes 12, 13, 17, and 18). Hairpin
product
was detected in paired cleavage reactions with RAG-1(R621H) in
the presence of HMG-1 (Fig.
2B, lanes 15 and 20), reflecting the
stimulatory effect of paired RSS signals in reaction mixtures
containing Mg
2+. In contrast to RAG-1(R621H), RAG-1(E719K)
exhibited impairment
of DNA cleavage under all conditions tested (Fig.
2B, lanes 21
to 30).

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 3.
Effects of the R621H and E719K mutations on nicking and
transesterification. (A) Kinetic analysis of RSS nicking by
RAG-1(R621H) and RAG-1(E719K) in Mg2+. Lanes 1 to 7, wild-type RAG-1 and RAG-2; lanes 8 to 14, RAG-1(E719K) and RAG-2; lanes
15 to 21, RAG-1(R621H) and RAG-2. Assays were carried out in
Mg2+ as described in Materials and Methods by using the
mutant 12-spacer substrate C17A, which undergoes nicking in the absence
of transesterification (29). Samples were withdrawn at
times indicated. The position of nicked product is indicated by the
shaded arrow at left. (B) Kinetic analysis of hairpin formation by
RAG-1(R621H) and RAG-1(E719K) in Mg2+. Lanes 1 to 6, wild-type RAG-1 and RAG-2; lanes 7 to 12, RAG-2(E719K) and RAG-1; lanes
13 to 18, RAG-1(R621H) and RAG-2. Assays were carried out in
Mg2+ using a prenicked substrate as described in Materials
and Methods. Samples were withdrawn at times indicated. The positions
of prenicked substrate (shaded arrow) and hairpin product (filled
arrow) are indicated at left. (C) Kinetic analysis of hairpin formation
by RAG-1(R621H) and RAG-1(E719K) in Mn2+. Lanes 1 to 8, wild-type RAG-1 and RAG-2; lanes 9 to 16, RAG-1(R621H) and RAG-2; lanes
17 to 24, RAG-1(E719K) and RAG-2. Assays were carried out in
Mn2+ using a prenicked substrate as described in Materials
and Methods. Samples were withdrawn at times indicated. The positions
of prenicked substrate (shaded arrow) and hairpin product (filled
arrow) are indicated at left. (D and F) The yield of nicked products in
panel A and hairpin products in panel B was quantitated by
phosphorimager and plotted as a function of time. Filled squares,
wild-type RAG-1; filled diamonds, RAG-1(E719K); dotted squares,
RAG-1(R621H). (E and G) The kinetics of nicking (E) or hairpin
formation (G) by RAG-1(R621H) and RAG-1(E719K) were assayed for panels
D and F except that reactions were performed in the presence of
Mn2+. Products were quantitated by phosphorimager and
plotted as a function of time. Symbols are as defined for panel D.
|
|
Tests of nicking and transesterification by RAG-1 R621H and E719K
mutants.
We next quantified the effects of the R621H and E719K
mutations on the kinetics of nicking in Mg2+ by using a
mutant 12-spacer substrate (C17A) in which the cytosine residue in the
first heptamer position had been mutated to adenosine. Because the C17A
substrate undergoes nicking without subsequent transesterification
(29), accumulation of nicked products is a direct
indicator of the kinetics of nicking. Substrate was incubated with
RAG-2 and wild-type RAG-1 (Fig. 3A, lanes 1 to 7), RAG-1(E719K) (Fig.
3A, lanes 8 to 14), or RAG-1(R621H) (Fig. 3A, lanes 15 to 21) in the
presence of Mg2+ under standard reaction conditions (see
Materials and Methods), and nicked products were assayed at various
times up to 2 h. The initial reaction rate, relative to that of
the wild type, was decreased more than 20-fold by the R621H mutation
and more than 450-fold by the E719K mutation (Fig. 3D). Purified,
chimeric mutant proteins were also assayed in the presence of RAG-2 and
Mg2+ for the ability to convert a prenicked, 12-spacer
substrate to a hairpin product. Transesterification under these
conditions was severely impaired by both mutations (Fig. 3B and F).
The same mutants were assayed for the ability to support nicking and
hairpin formation in Mn
2+, because under these conditions
transesterification of a single-site
RSS substrate in vitro is more
efficient than in the presence
of Mg
2+. As assayed with the
C17A substrate, the initial rate of nicking
in Mn
2+ was
reduced about 10-fold by the R621H mutation and more than
40-fold by
the E719K mutation (Fig.
3E). Transesterification was
less severely
impaired in Mn
2+ than in Mg
2+, with decreases
in initial reaction rate of about four- to five
fold for RAG-1(R621H)
and seven- to nine fold for RAG-1(E719K)
(Fig.
3C and G). Taken
together, these results are consistent
with participation of residues
E719 and R621 in DNA cleavage by
the V(D)J recombinase, preferentially
at the nicking
step.
Wild-type RAG-1, RAG-1(R621H), and RAG-1(E719K) show similar
patterns of binding to the RSS.
The deleterious effects of the
R621H and E719K mutations on formation of free signal ends in vivo and
DNA cleavage in vitro could result from defects in catalysis or at some
prior step, such as RAG-2 association or DNA binding. Wild-type or
mutant RAG-1 fusion proteins were tested for binding to radiolabeled 12-spacer substrates with or without wild-type RAG-2 in calcium, as
described previously (45). Under these conditions RAG-1, RAG-2, and substrate DNA form a stable preinitiation complex, termed
M1/2, composed of a RAG-1 dimer, monomeric RAG-2, and DNA (45). M1/2 represents a functional complex as assessed by
its ability to support nicking and transesterification
(20), as well as by the coordinate impairment of M1/2
formation, in vitro DNA cleavage, and recombination activity by a
subset of RAG-1 mutations (45). Binding reaction mixtures
containing separately coexpressed RAG proteins were analyzed in
parallel with reaction mixtures containing coexpressed RAG proteins
(Fig. 4A). In the absence
of RAG-2, wild-type RAG-1 forms a mobility shift
complex termed M1 (45) (Fig. 4A, lane 1). RAG-2 alone
exhibits undetectable binding activity (Fig. 4A, lane 2). When RAG-2 is
combined with wild-type RAG-1, the slower migrating M1/2 complex is
observed in addition to the M1 species (45) (Fig. 4A, lane
3).

View larger version (86K):
[in this window]
[in a new window]
|
FIG. 4.
(A to C) RAG-1(R621H), RAG-1(E719K), and RAG-1(E719C)
retain the ability to form RAG-2-dependent RSS complexes. Binding to a
32P-labeled 12-spacer substrate and EMSAs were carried out
as described in Materials and Methods. (A) EMSAs of wild-type RAG-1 and
RAG-1(R621H). Lane 1, wild-type RAG-1 alone; lane 2, RAG-2 alone; lane
3, wild-type RAG-1 and RAG-2, expressed separately and combined; lane
4; wild-type RAG-1 and RAG-2, coexpressed and copurified; lane 5, RAG-1(R621H) and RAG-2, coexpressed and copurified. Positions of the M1
and M1/2 complexes are indicated by arrows at left. (B) Wild-type or
mutant MBP-RAG-1 fusion proteins, coexpressed and copurified with
MBP-RAG-2, were fractionated by sodium dodecyl sulfate-polyacrylamide
gel electrophoresis and detected by silver staining. Increasing amounts
of purified complexes containing wild-type RAG-1 (lanes 1 to 3),
RAG-1(E719K) (lanes 4 to 6), and RAG-1(E719C) (lanes 7 to 9) were
loaded. Positions of RAG-1 and RAG-2 are indicated at left. (C) EMSAs
of wild-type RAG-1 (lanes 3, 6, 9, and 12), RAG-1(E719C) (lanes 1, 4, 7, and 10), and RAG-1(E719K) (lanes 2, 5, 8, and 11) or in the absence
of added protein (lane 13). Equal amounts of protein, copurified with
RAG-2 and quantitated for panel B, were added. Reactions were carried
out in the presence of Mn2+ (lanes 1 to 6),
Mg2+ (lanes 7 to 9), or Ca2+ (lanes 10 to 13)
at 4°C for 30 min (lanes 1 to 3) or at 37°C for 20 min (lanes 4 to
13). (D and E) RAG-1(R621H) and RAG-1(E719K) yield modification
interference patterns identical to that of wild-type RAG-1. (D) DMS
modification interference. Cleavage products from free or bound DNA,
radiolabeled on the top strand (left panel) or bottom strand (right
panel), were fractionated by gel electrophoresis and detected with a
phosphorimager. The RSS heptamer (7) and nonamer
(9) are indicated by vertical bars. The arrowheads mark
positions of strongest interference. Lanes 1 and 9, G-specific
sequencing tracts; lanes 2 and 10, T-specific sequencing tracts; lanes
3, 5, 7, 11, 13, and 15, products from free DNA; lanes 4, 6, 8, 12, 14, and 16, products from bound
fractions. Lanes 3, 4, 11, and 12, wild-type RAG-1 and RAG-2; lanes 5, 6, 13, and 14, RAG-1(R621H) and RAG-2; lanes 7, 8, 15, and 16, RAG-1(E719K) and RAG-2. (E) KMnO4 modification
interference. Cleavage products from free or bound DNA, radiolabeled on
the top strand (left panel) or bottom strand (right panel), were
fractionated by gel electrophoresis and detected by phosphorimager
analysis. The heptamer (7) and nonamer (9)
are indicated by vertical bars. Closed and open arrowheads mark
positions at which modification is underrepresented or overrepresented,
respectively, in the bound fraction. Lanes 1 and 8, G-specific
sequencing tracts; lanes 2, 4, 6, 9, 11, and 13, products from free
DNA; lanes 3, 5, 7, 10, 12, and 14, products from bound fractions.
Lanes 2, 3, 9, and 10, wild-type RAG-1 and RAG-2; lanes 4, 5, 11, and
12, RAG-1(R621H) and RAG-2; lanes 6, 7, 13, and 14, RAG-1(E719K) and
RAG-2.
|
|
As expected from previous observations (
20,
45), the yield
of the M1/2 complex was enhanced when wild-type RAG-1 and RAG-2
were
coexpressed and copurified (Fig.
4A, lane 4). RAG-1(R621H)
(Fig.
4A,
lane 5) and RAG-1(E719K) (Fig.
4C, lane 11) also supported
formation of
M1/2 complexes, suggesting that these mutants retain
the ability to
dimerize, associate with RAG-2, and bind substrate.
Consistent with
previous observations (
19), a complex of slower
mobility
than M1/2 was observed in reaction mixtures containing
wild-type RAG-1
(Fig.
4A, lane 4, and Fig.
4C, lane 12), the R621H
mutant (Fig.
4A,
lane 5), or the E719K mutant (Fig.
4C, lane
11).
To compare RSS binding by wild-type and mutant RAG-1 proteins, we
assessed the effects of guanine- and thymine-specific modification
on
formation of the M1/2 complex by binding interference (
41,
46), reasoning that differences in the interactions between
protein and DNA would be revealed by this approach. Top- or
bottom-strand
oligonucleotides were treated with DMS (Fig.
4D) or
potassium
permanganate (Fig.
4E), which react with G or T residues to
produce
N7 methylguanine or a C5, C6 glycol of thymine, respectively.
N7-methylation of guanine affects major groove contacts
(
41).
Glycolization displaces the modified thymine
(
26), potentially
disrupting major and minor groove
contacts. After chemical modification
and annealing, M1/2 complexes
were formed in the presence of Ca
2+. Bound and free DNA
fragments were separated by gel electrophoresis
and cleaved by
piperidine. Underrepresented cleavages in the bound
fraction indicated
positions at which modification interfered
with formation of the M1/2
complex. In combination with RAG-2,
wild-type RAG-1, RAG-1(R621H), and
RAG-1(E719K) yielded identical
patterns, with prominent interferences
occurring at residues 6
(hT6) and 7 (hG7) of the heptamer, at residues
2 and 4 through
7 of the nonamer (nG2 and nT4 to nT7), and in the
heptamer-proximal
half of the spacer region (sT2, sG4), as numbered in
the sense
orientation (Fig.
4D and E). (The faint band at the
heptamer-coding
junction seen in Fig.
4D, lane 4, probably represents a
small
amount of nicked product formed in the presence of
Ca
2+ and wild-type protein; migration of this species at a
position
midway between piperidine cleavage products is consistent with
this interpretation.)
These observations are consistent with our previous mapping of
DNA-protein contacts in a wild-type RAG-DNA complex (
45)
and strongly suggest that such interactions are not significantly
disrupted by the R621H or E719K mutations. Moreover, the characteristic
overrepresentation of thymine modifications at the heptamer-coding
junction and the nonamer-spacer junction also remains unaltered
in the
two mutant complexes (Fig.
4E), indicating that RAG-1(R621H)
and
RAG-1(E719K), like their wild-type counterpart, retain the
ability to
perturb the DNA structure at these sites. Taken together,
these results
indicate that the defects in single-site DNA cleavage
observed for
RAG-1(R621H) and RAG-1(E719K) do not result from
disruption of RSS
contacts in the prenicking
complex.
Evidence that E719 of RAG-1 interacts with a divalent cation
essential for catalysis of DNA cleavage.
RAG-1(E719K) exhibits
impairment of nicking and transesterification activity in
Mg2+, although its contacts with the DNA substrate are
similar or identical to those of wild-type RAG-1. We considered the
possibility that the deleterious effect of the E719K mutation results
specifically from the nonconservative substitution of lysine for
glutamate. To address this, we tested the more conservative mutants
RAG-1(E719Q) and RAG-1(E719A) for V(D)J recombination and DNA cleavage
in vivo by using the extrachromosomal assay and ligation-mediated PCR as described above. Like E719K, the E719Q and E719A mutations profoundly impaired V(D)J recombination (Fig.
5A, compare lanes 2, 4, and 5 to lane 1).
Although similar amounts of the pJH200 substrate were recovered from
all transfections (Fig. 5B, lower panel), signal ends were undetectable
with RAG-1(E719Q), RAG-1(E719A), or RAG-1(E719K) (Fig. 5B, upper panel,
lanes 3, 4, and 7 to 10). Thus, we excluded the possibility that the
E719K defect in vivo results specifically from the introduction of a
positive charge.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 5.
Impairment of V(D)J recombination and DNA cleavage in
vivo by diverse substitutions at E719 of RAG-1. (A) Wild-type or mutant
RAG-1 fusion protein was coexpressed with RAG-2 core in 293 cells, and
signal joint formation was quantitated using the extrachromosomal V(D)J
recombination substrate pJH200. Percent recombination was calculated;
values represent the means of two independent experiments. Lanes: 1, wild-type RAG-1; 2, RAG-1(E719K); 3, RAG-1(E719C); 4, RAG-1(E719A); 5, RAG-1(E719Q). (B) Signal ends were assayed by ligation-mediated PCR
(upper panel); total pJH200 was assayed by PCR amplification of a
backbone sequence (lower panel), as described in Materials and Methods.
Lanes 1 and 2, wild-type RAG-1; lanes 3 and 4, RAG-1(E719K); lanes 5 and 6, RAG-1(E719C); lanes 7 and 8, RAG-1(E719A); lanes 9 and 10, RAG-1(E719Q). All transfections included wild-type RAG-2 core.
|
|
In classical transposases, the acidic residues aspartate and glutamate
form a catalytic triad, the DDE motif, which provides
a binding site
for an essential divalent cation at or near the
active site for DNA
hydrolysis and strand transfer (
3,
5,
7,
12,
24,
35,
36,
38). Residues D600 and D708 of
RAG-1 have been implicated in the
binding of a divalent cation
essential for DNA cleavage in vivo
(
23,
27).
To address whether E719 of RAG-1 might also participate in metal
binding, we pursued a strategy previously used to demonstrate
direct
interaction of an essential metal ion with the substrate
in RNA
self-splicing (
8,
34); with the DDE motif of TnsB,
a
subunit of the Tn
7 transposase (
38); or with
other acidic
residues of RAG-1 (
14,
22,
26). This approach
exploits the
differential chemistry of metal-sulfur and metal-oxygen
binding.
In TnsB, for example, replacement of D114 with cysteine
altered
the metal specificity of the 5' processing reaction from
Mg
2+ to Mn
2+, implying that in the wild-type
protein, D114 participates in
metal binding (
38). An
analogous mutation, by which E719 was
replaced with cysteine (E719C),
was introduced into the chimeric
RAG-1 core protein. Unlike E719K,
E719Q, and E719A, the E719C
mutant supported detectable, albeit greatly
reduced, V(D)J recombination
and DNA cleavage in vivo (Fig.
5A, column
3, and 5B, faint bands
in lanes 5 and
6).
RAG-1(E719C) and RAG-2 were coexpressed, copurified, and assayed for
cleavage of the 12-signal substrate in vitro in the presence
of 6 mM
Mg
2+ or 1 mM Mn
2+. Wild-type RAG-1 and RAG-2
were assayed in parallel. The wild-type
RAG proteins readily supported
nicking in Mg
2+ (Fig.
6A,
lanes 1 to 6); transesterification was inefficient
under these
conditions, consistent with published results (
49,
50). In
contrast, RAG-1(E719C) showed very little nicking activity
(about
50-fold reduction in initial rate, relative to that of
the wild type)
in the presence of RAG-2 and Mg
2+ (Fig.
6A, lanes 7 to 12;
Fig.
6B, left panel). In the presence
of Mn
2+, as expected,
the combination of wild-type RAG-1 and RAG-2 core
proteins supported
nicking and hairpin formation (Fig.
6A, lanes
13 to 18). Strikingly, in
the presence of Mn
2+, RAG-1(E719C) exhibited a marked
(approximately fivefold) enhancement
of cleavage activity relative to
that of wild-type protein (Fig.
6A, lanes 18 to 24; Fig.
6B, right
panel).

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 6.
Substitution of RAG-1 E719 by cysteine, but not by
glutamine or lysine, confers preferential cleavage activity in
Mn2+. (A) Kinetic analysis of RSS cleavage by purified
wild-type RAG-1 or RAG-1(E719C) and wild-type RAG-2. Assays were
carried out against a 12-spacer substrate in 6 mM Mg2+
(left panel) or 1 mM Mn2+ (right panel) as described in
Materials and Methods. Lanes 1 to 6 and 13 to 18, wild-type RAG-1 and
RAG-2; lanes 7 to 12 and 19 to 24, RAG-1(E719C) and RAG-2. Samples were
withdrawn at times indicated. Positions of nicked and hairpin products
are indicated at right. (B) The total yield of nicked and hairpin
products shown in panel A, as quantitated by phosphorimager, is plotted
as a function of time. Open squares, wild-type RAG-1; filled diamonds,
RAG-1(E719C); left panel, cleavage activity in Mg2+; right
panel, cleavage activity in Mn2+. (C) RAG-1(E719K) and
RAG-1(E719Q) do not exhibit altered metal ion specificity. Kinetic
analysis of RSS cleavage was carried out by purified proteins against a
12-spacer substrate in 6 mM Mg2+ or 1 mM Mn2+
as in panel A. Lanes 1 to 6 and 19 to 24, wild-type RAG-1 and RAG-2;
lanes 7 to 12 and 25 to 30, RAG-1(E719K) and RAG-2; lanes 13 to 18 and
31 to 36, RAG-1(E719Q) and RAG-2. Positions of nicked and hairpin
products are indicated at right. (D) The total yield of nicked and
hairpin products in panel C, as quantitated by phosphorimager, is
plotted as a function of time. Open squares, wild-type RAG-1; filled
diamonds, RAG-1(E719K); filled squares, RAG-1(E719Q); left panel,
cleavage activity in Mg2+; right panel, cleavage in
Mn2+.
|
|
We considered the possibility that the differential activities of
RAG-1(E719C), RAG-1(E719K), and wild-type RAG-1 in Mg
2+ and
Mn
2+ might reflect differences in RSS binding. Wild-type
RAG-1, RAG-1(E719K),
or RAG-1(E719C) was copurified with RAG-2.
Following quantitation
by gel electrophoresis and silver staining (Fig.
4B), equivalent
amounts of protein were assayed for binding to a
radiolabeled
12-spacer substrate in the presence of Ca
2+
(Fig.
4C, lanes 10 to 12), Mg
2+ (Fig.
4C, lanes 7 to 9), or
Mn
2+ (Fig.
4C, lanes 1 to 6). For comparison, probe was
incubated
in the presence of Ca
2+ but in the absence of
protein (Fig.
4C, lane 13). Binding reactions
were carried out under
standard conditions of time and temperature
(20 min at 37°C; Fig.
4C,
lanes 4 to 13) or for 30 min at 4°C
(Fig.
4C, lanes 1 to 3). In the
presence of each divalent cation,
RAG-1(E719C), RAG-1(E719K), and
wild-type RAG-1 supported formation
of the M1/2 complex. The yields of
M1/2 complexes in reaction
mixtures containing Mn
2+ were
substantially increased when binding was carried out at
4°C for 30 min rather than at 37°C for 20 min (Fig.
4C, compare
lanes 1 to 3 and
lanes 4 to 6). Importantly, under conditions
in which RAG-1(E719C) is
significantly more active for DNA cleavage
than either RAG-1(E719K) or
wild-type RAG-1, all three proteins
supported formation of the M1/2
complex to a similar extent. Moreover,
the ability of the three
proteins to form M1/2 complexes, relative
to each other, was not
substantially altered by changes in the
divalent cation included in the
binding reaction
mixture.
To confirm that the enhanced activity of RAG-1(E719C) in the presence
of Mn
2+ is a specific property of the cysteine mutant,
RAG-1(E719K) and
RAG-1(E719Q) were assayed in parallel in
Mg
2+ or Mn
2+ (Fig.
6C and D). In
Mg
2+, the conservative E719Q mutant exibited a reduction in
activity
similar to that seen for E719K (Fig.
6C; Fig.
6D, left) or
E719C
(Fig.
6B, left). In contrast to its effect on RAG-1(E719C),
Mn
2+ failed to restore activity of either RAG-1(E719K)
(Fig.
6C, lanes
25 to 30) or RAG-1(E719Q) (Fig.
6C, lanes 31 to 36). We
conclude
that the rescue of RAG-1(E719C) activity by Mn
2+
is a specific property of the thiol substitution at that position.
Taken together, these results indicate that residue E719 is intimately
involved in binding of an essential divalent metal ion by RAG-1
and
suggest that this residue lies at or near the catalytic site
for DNA
nicking.
Differential dependence of nicking and transesterification on
presence of positive charge at residue 621 of RAG-1.
The retention
of partial nicking activity by the RAG-1 R621H mutant prompted us to
ask whether catalysis of this step was correlated with the presence of
a positive charge at this position. Lysine or alanine was substituted
for R621 and the resulting MBP fusion proteins were expressed and
purified as described above. RAG-1(R621K) and RAG-1(R621A), like
RAG-1(R621H), were similarly capable of associating with RAG-2 and
binding to a single RSS substrate, as assessed by EMSA (data not
shown). The ability of these mutants to support nicking of the C17A
substrate was assessed in the presence of RAG-2 and Mn2+ at
standard pH (7.0). RAG-1(R621K) exhibited a two- to three fold
diminution in the initial rate of nicking, compared to that of the
wild-type protein, while in a reaction containing RAG-1(R621A) the
initial rate was reduced 20- to 100-fold (Fig. 7A and
B and Table
1). When assayed under the same
conditions for transesterification, however, the R621K and R621A
mutants retained substantial activity, with decreases in initial
reaction rates of only about 1.5- to 4-fold (Fig. 7C and D and Table
1).

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 7.
Impairment of nicking but not transesterification by a
nonconservative substitution at R621 of RAG-1. (A) Kinetic analysis of
RSS nicking by RAG-1(R621K) and RAG-1(R621A). Lanes 1 to 9, wild-type
RAG-1 and RAG-2; lanes 10 to 18, RAG-1(R621K) and RAG-2; lanes 19 to
27, RAG-1(R621A) and RAG-2. Assays were carried out in Mn2+
as described in Materials and Methods by using the mutant 12-spacer
substrate C17A, which undergoes nicking in the absence of
transesterification (29). Samples were withdrawn at times
indicated above. The position of nicked product is indicated by the
arrow at left. (B) The yield of nicked products in panel A was
quantitated by phosphorimager and plotted as a function of time. Filled
squares, wild-type RAG-1; filled diamonds, RAG-1(R621K); dotted
squares, RAG-1(R621A). (C) Kinetic analysis of hairpin formation by
RAG-1(R621K) and RAG-1(R621A). Lanes 1 to 8, wild-type RAG-1 and RAG-2;
lanes 9 to 16, RAG-1(R621K) and RAG-2; lanes 17 to 24, RAG-1(R621A) and
RAG-2. Assays were carried out in Mn2+ using a prenicked
substrate as described in Materials and Methods. Samples were withdrawn
at times indicated above. The positions of hairpin product are
indicated at left. (D) The yield of hairpin products in panel C was
quantitated by phosphorimager and plotted as a function of time.
Symbols are as defined for panel B.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Relative initial rates of nicking and hairpin formation
by RAG-1 proteins bearing amino acid substitutions at arginine 621
|
|
To obtain further support for the participation of a positively charged
residue at position 621 in the nicking reaction, the
activities of
RAG-1(R621H) and RAG-1(R621A) were compared at standard
pH conditions
(pH 7.0), relatively near the pK
a of free histidine
(

pH
6.5), and at pH 8.4, well above the pK
a of free histidine
but below that of arginine. At pH 7.0 (Fig.
8A and Table
1),
the initial reaction
rate for RAG-1(R621H) was reduced to between
13 and 18% of wild type,
while the rate for RAG-1(R621A) was about
1 to 5% that of wild type.
At pH 8.4, however, the initial reaction
rates for RAG-1(R621H) and
RAG-1(R621A) were apparently identical,
both being about 2% that of
wild-type RAG-1 (Fig.
8B and Table
1). While other interpretations are
possible, these results suggest
that a positively charged side chain at
residue 621 participates
preferentially in the nicking step of DNA
cleavage.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 8.
Comparison of nicking by RAG-1(R621H) and RAG-1(R621A)
at pH 7.0 and at pH 8.4. (A) Assay at pH 7.0. Assays were carried out
in Mn2+ under standard conditions (pH 7.0) using the mutant
12-spacer substrate C17A. Samples were withdrawn at various times and
products were fractionated by gel electrophoresis. The yield of nicked
products was quantitated by phosphorimager and plotted as a function of
time. Filled squares, wild-type RAG-1; filled diamonds, RAG-1(R621H);
dotted squares, RAG-1(R621A). (B) As in panel A, except that reactions
were carried out at pH 8.4.
|
|
 |
DISCUSSION |
Participation of RAG-1 in catalysis of nicking and
transesterification.
DNA-protein photo-cross-linking had
demonstrated that in the presence of RAG-2, RAG-1 approaches the
scissile bond at the heptamer-coding junction (13, 32,
44). This suggested that RAG-1 might play a direct catalytic
role in one or both steps of DNA cleavage, an idea that was borne out
by mutational analysis (14, 23, 27). The B-cell-negative
SCID mutations analyzed here, R621H and E719K, also confer biochemical
defects consistent with direct involvement of RAG-1 in catalysis of DNA
cleavage. Recombination, accumulation of signal ends in vivo, and DNA
cleavage in vitro are impaired despite the ability of the mutant
proteins to form precleavage complexes that preserve the specific
DNA-protein contacts observed with wild-type protein. Mutations in
RAG-1 are also associated with Omenn syndrome, an immunodeficiency
disorder with less severe impairment of lymphocyte development than
classical B-cell-negative SCID (51). These mutations, in
distinction to those occurring at R621 and E719, exert debilitating
effects on V(D)J recombination by impairing DNA binding or RAG-1-RAG-2
association (51).
Evidence presented here suggests that residue E719 of RAG-1 may
interact with an essential metal ion. The E719K mutation is
associated
with a decrease of more than 450-fold in the initial
rate of substrate
nicking in vitro relative to that of the wild
type. This effect is not
a particular property of the nonconservative
lysine substitution that
occurs in SCID patients, as the conservative
E719Q mutation impaired
RAG-1 activity to a similar extent. When
cysteine is substituted for
E719, the resulting RAG-1 mutant exhibits
enhanced activity in
Mn
2+ but 50-fold reduced activity in Mg
2+,
relative to that of the wild type. The enhanced activity of
RAG-1(E719C) in Mn
2+ likely reflects an alteration in metal
ion specificity conferred
by the substitution of thiol for carboxylate,
rather than a more
general effect, because the activities of neither
RAG-1(E719K)
nor RAG-1(E719Q) were rescued by Mn
2+. A
similar, Mn
2+-specific increase in enzymatic activity is
associated with cysteine
replacement mutations in the catalytic triad
of TnsB (
38). Taken
together, these results provide
evidence that residue E719 of
RAG-1 interacts with a metal ion
essential for DNA cleavage by
the V(D)J
recombinase.
It is likely that two catalytic regions are present in a RAG-1 dimer.
These regions could be distributed between the individual
subunits in
one of two ways. In the first model, each site could
be constructed
from residues contributed by both subunits, so
that an intact catalytic
region would straddle the dimer interface,
as in the site-specific
recombinase Flp (
6). In the second
model, each of the two
catalytic regions would reside in a single
subunit. Recent observations
are consistent with the latter model
and indicate, moreover, that DNA
cleavage is catalyzed in
trans by the RAG-1 subunit residing
opposite the bound subunit (
43).
The present data do not
eliminate the possibility that RAG-2 also
contributes a portion of the
catalytic site. Previous studies
have indicated essential roles for
RAG-2 in formation of stable
RAG-RSS complexes and in promoting contact
between RAG-1 and the
heptamer-coding junction. Whether RAG-2 plays a
more direct role
in catalysis of DNA cleavage remains an open
question.
Comparison to transposases.
The initial steps of V(D)J
recombination and transposition are chemically identical, with the
exception that in V(D)J recombination transesterification occurs
between neighboring DNA strands, while in transposition it occurs
between donor and target duplexes (see reference 35 for
review). This formal chemical identity is reinforced by the ability of
the RAG proteins to promote the transposition of a donor DNA segment
flanked by RSSs into a nonspecific target DNA molecule in vitro
(1, 21). Thus, RAG-1 and RAG-2 can be considered to
represent the subunits of a specialized, multicomponent transposase.
On this basis, the catalytic DDE motif characteristic of classical
transposases, or its functional equivalent, might be expected
to occur
within one or both RAG proteins. The DDE motif cannot
be reliably
assigned on the basis of sequence homology, however,
because it
contains only three highly conserved amino acid residues
whose spacing
is variable. Several acidic residues in RAG-1, including
D600, D708,
and E962, have been identified previously as important
for catalysis of
DNA cleavage and may serve a metal-binding function
similar to that of
the DDE motif (
14,
23,
27). DNA cleavage
is abolished by
nonconservative mutations at these three positions
(
14,
23,
27), in contrast to mutations at E719, which allow
partial
catalytic
activity.
Recent evidence indicates that transposase proteins are more
structurally diverse than previously appreciated. The Tn
7
transposase
contains two components, TnsA and TnsB. TnsA catalyzes DNA
cleavage
at the 5' ends of the transposon, while TnsB is responsible
for
cleavage of the 3' ends and strand transfer (
38).
Unlike TnsB,
which resembles other members of the retroviral integrase
superfamily,
the catalytic fold of TnsA is structurally related to that
of
type II restriction endonucleases. Moreover, the catalytic center
of
TnsA contains a cluster of amino acid residues

E63, D114, K132
and
E149

characteristic of restriction endonuclease active sites;
with
respect to their spatial arrangement, these four residues
correspond
closely to E71, K190, D134, and E204 of the restriction
enzyme
Cfr10I (
18). These observations define a close
relationship
between TnsA and type II restriction enzymes and suggest
that
identification of essential catalytic residues may be insufficient
to allow classification of a transposase in the absence of sequence
homology or direct structural
analysis.
Effects of mutations at R621.
Loss of a positive charge at
residue 621 of RAG-1 is positively correlated with impairment of
RSS-mediated DNA nicking. This effect is not likely to reflect a
general structural perturbation, as hairpin formation is relatively
impervious to nonconservative mutations at R621. While the present
article was under review, RAG-1 mutations that selectively impair the
transesterification step of DNA cleavage were described elsewhere
(22). These complementary observations clearly indicate
that the nicking and transesterification steps of RAG-mediated DNA
cleavage have distinct catalytic requirements.
In addition to R621, R713 has been found to be important for RAG-1
catalytic activity (
23). While the functions of these
basic residues in RAG-mediated DNA cleavage are unknown, several
possibilities are suggested by consideration of classical transposases
and restriction endonucleases. In the Tn
5 transposase and
related
enzymes, a conserved arginine residue appears to stabilize the
hairpin conformation essential for cut-and-paste transposition
(
15). In the Tn
5 synaptic complex this residue,
R322, interacts
with the 5' phosphate group of a thymine residue in the
nontransferred
DNA strand, stabilizing a bend in the phosphodiester
backbone
(
9,
10); in the related IS
10
transposase, an alanine substitution
at the corresponding position
blocks nicking and strand transfer
activities (
4). In the
human immunodeficiency virus type-1
integrase and in Tn
5,
two conserved basic residues near the active
site make specific
contacts with DNA (
10,
16).
Other possibilities are suggested by type II restriction endonuclease.
In these enzymes a conserved, essential lysine (e.g.,
K92 in
EcoRV, corresponding to K190 of
Cfr10I) orients
and stabilizes
a hydroxide ion for attack of the scissile phosphate and
is postulated
to stabilize the negative charge of pentavalent
phosphorus in
the transition state (
25). In TnsA, K132
occupies an analogous
position in the three-dimensional structure,
suggesting that it
may play a similar role in Tn
7
transposition. Whether RAG-1 incorporates
features of TnsA, in addition
to those of the retroviral integrase
family, remains to be
determined.
 |
ACKNOWLEDGMENTS |
We thank Joanne Hesse, Dik van Gent, and Martin Gellert for
reagents and the Howard Hughes Medical Institute Biopolymers Facility at Johns Hopkins for oligonucleotides. We are grateful to Patrick Swanson, Jinhak Lee, Amit Golding, Ashley Ross, and our colleagues in
the Department of Molecular Biology and Genetics for stimulating discussions. Nick Dordai provided expert technical assistance.
This work was supported by grant CA16519 from the National Cancer
Institute and by the Howard Hughes Medical Institute.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Biology and Genetics and Howard Hughes Medical Institute, The Johns Hopkins University School of Medicine, Baltimore, MD 21205. Phone: (410) 955-4735. Fax: (410) 955-9124. E-mail:
sdesider{at}jhmi.edu.
Present address: Division of Biology, California Institute of
Technology, Pasadena, CA 91125.
 |
REFERENCES |
| 1.
|
Agrawal, A.,
Q. M. Eastman, and D. G. Schatz.
1998.
Transposition mediated by RAG1 and RAG2 and its implications for the evolution of the immune system.
Nature
394:744-751[CrossRef][Medline].
|
| 2.
|
Akamatsu, Y., and M. A. Oettinger.
1998.
Distinct roles of RAG1 and RAG2 in binding the V(D)J recombination signal sequence.
Mol. Cell. Biol.
18:4670-4678[Abstract/Free Full Text].
|
| 3.
|
Baker, T. A., and L. Luo.
1994.
Identification of residues in the Mu transposase essential for catalysis.
Proc. Natl. Acad. Sci. USA
91:6654-6658[Abstract/Free Full Text].
|
| 4.
|
Bolland, S., and N. Kleckner.
1996.
The three chemical steps of Tn10/IS10 transposition involve repeated utilization of a single active site.
Cell
84:223-233[CrossRef][Medline].
|
| 5.
|
Bujacz, G.,
M. Jaskolski,
J. Alexandratos,
A. Wlodawer,
G. Merkel,
R. A. Katz, and A. M. Skalka.
1996.
The catalytic domain of avian sarcoma virus integrase: conformation of the active-site residues in the presence of divalent cations.
Structure
4:89-96[Medline].
|
| 6.
|
Chen, J. W.,
J. Lee, and M. Jayaram.
1992.
DNA cleavage in trans by the active site tyrosine during Flp recombination: switching protein partners before exchanging strands.
Cell
69:647-658[CrossRef][Medline].
|
| 7.
|
Craig, N. L.
1996.
Transposon Tn7.
Curr. Top. Microbiol. Immunol.
204:27-48[Medline].
|
| 8.
|
Dahm, S. C., and O. C. Uhlenbeck.
1991.
Role of divalent metal ions in the hammerhead RNA cleavage reaction.
Biochemistry
30:9464-9469[CrossRef][Medline].
|
| 9.
|
Davies, D. R.,
L. M. Braam,
W. S. Reznikoff, and I. Rayment.
1999.
The three-dimensional structure of a Tn5 transposase-related protein determined to 2.9-A resolution.
J. Biol. Chem.
274:11904-11913[Abstract/Free Full Text].
|
| 10.
|
Davies, D. R.,
I. Y. Goryshin,
W. S. Reznikoff, and I. Rayment.
2000.
Three-dimensional structure of the Tn5 synaptic complex transposition intermediate.
Science
289:77-85[Abstract/Free Full Text].
|
| 11.
|
Difilippantonio, M. J.,
C. J. McMahan,
Q. M. Eastman,
E. Spanopoulou, and D. G. Schatz.
1996.
RAG1 mediates signal sequence recognition and recruitment of RAG2 in V(D)J recombination.
Cell
87:253-262[CrossRef][Medline].
|
| 12.
|
Dyda, F.,
A. B. Hickman,
T. M. Jenkins,
A. Engelman,
R. Craigie, and D. R. Davies.
1994.
Crystal structure of the catalytic domain of HIV-1 integrase: similarity to other polynucleotidyl transferases.
Science
266:1981-1986[Abstract/Free Full Text].
|
| 13.
|
Eastman, Q. M.,
I. J. Villey, and D. G. Schatz.
1999.
Detection of RAG protein-V(D)J recombination signal interactions near the site of DNA cleavage by UV cross-linking.
Mol. Cell. Biol.
19:3788-3797[Abstract/Free Full Text].
|
| 14.
|
Fugmann, S. D.,
I. J. Villey,
L. M. Ptaszek, and D. G. Schatz.
2000.
Identification of two catalytic residues in RAG1 that define a single active site within the RAG1/RAG2 protein complex.
Mol. Cell
5:97-107[CrossRef][Medline].
|
| 15.
|
Haren, L.,
B. Ton-Hoang, and M. Chandler.
1999.
Integrating DNA: transposases and retroviral integrases.
Annu. Rev. Microbiol.
53:245-281[CrossRef][Medline].
|
| 16.
|
Hazuda, D. J.,
P. Felock,
M. Witmer,
A. Wolfe,
K. Stillmock,
J. A. Grobler,
A. Espeseth,
L. Gabryelski,
W. Schleif,
C. Blau, and M. D. Miller.
2000.
Inhibitors of strand transfer that prevent integration and inhibit HIV-1 replication in cells.
Science
287:646-650[Abstract/Free Full Text].
|
| 17.
|
Hesse, J.,
M. Lieber,
M. Gellert, and K. Mizuuchi.
1987.
Extrachromosomal DNA substrates in pre-B cells undergo inversion or deletion at immunoglobulin V(D)J joining signals.
Cell
49:775-783[CrossRef][Medline].
|
| 18.
|
Hickman, A. B.,
Y. Li,
S. V. Mathew,
E. W. May,
N. L. Craig, and F. Dyda.
2000.
Unexpected structural diversity in DNA recombination: the restriction endonuclease connection.
Mol. Cell
5:1025-1034[CrossRef][Medline].
|
| 19.
|
Hiom, K., and M. Gellert.
1998.
Assembly of a 12/23 paired signal complex: a critical control point in V(D)J recombination.
Mol. Cell
1:1011-1019[CrossRef][Medline].
|
| 20.
|
Hiom, K., and M. Gellert.
1997.
A stable RAG1-RAG2-DNA complex that is active in V(D)J cleavage.
Cell
88:65-72[CrossRef][Medline].
|
| 21.
|
Hiom, K.,
M. Melek, and M. Gellert.
1998.
DNA transposition by the RAG1 and RAG2 proteins: a possible source of oncogenic translocations.
Cell
94:463-470[CrossRef][Medline].
|
| 22.
|
Kale, S. B.,
M. A. Landree, and D. B. Roth.
2001.
Conditional RAG-1 mutants block the hairpin step of V(D)J recombination.
Mol. Cell. Biol.
21:459-466[Abstract/Free Full Text].
|
| 23.
|
Kim, D. R.,
Y. Dai,
C. L. Mundy,
W. Yang, and M. A. Oettinger.
1999.
Mutations of acidic residues in RAG1 define the active site of the V(D)J recombinase.
Genes Dev.
13:3070-3080[Abstract/Free Full Text].
|
| 24.
|
Kim, K.,
S. Y. Namgoong,
M. Jayaram, and R. M. Harshey.
1995.
Step-arrest mutants of phage Mu transposase. Implications in DNA-protein assembly, Mu end cleavage, and strand transfer.
J. Biol. Chem.
270:1472-1479[Abstract/Free Full Text].
|
| 25.
|
Kovall, R. A., and B. W. Matthews.
1999.
Type II restriction endonucleases: structural, functional and evolutionary relationships.
Curr. Opin. Chem. Biol.
3:578-583[CrossRef][Medline].
|
| 26.
|
Kung, H. C., and P. H. Bolton.
1997.
Structure of a duplex DNA containing a thymine glycol residue in solution.
J. Biol. Chem.
272:9227-9236[Abstract/Free Full Text].
|
| 27.
|
Landree, M. A.,
J. A. Wibbenmeyer, and D. B. Roth.
1999.
Mutational analysis of RAG1 and RAG2 identifies three catalytic amino acids in RAG1 critical for both cleavage steps of V(D)J recombination.
Genes Dev.
13:3059-3069[Abstract/Free Full Text].
|
| 28.
|
Lewis, S.
1994.
The mechanism of V(D)J joining: lessons from molecular, immunological and comparative analyses.
Adv. Immunol.
56:27-150[Medline].
|
| 29.
|
Li, W.,
P. Swanson, and S. Desiderio.
1997.
RAG-1- and RAG-2-dependent assembly of functional complexes with V(D)J recombination substrates in solution.
Mol. Cell. Biol.
17:6932-6939[Abstract].
|
| 30.
|
Li, Z.,
D. I. Dordai,
J. Lee, and S. Desiderio.
1996.
A conserved degradation signal regulates RAG-2 accumulation during cell division and links V(D)J recombination to the cell cycle.
Immunity
5:575-589[CrossRef][Medline].
|
| 31.
|
McBlane, J. F.,
D. C. van Gent,
D. A. Ramsden,
C. Romeo,
C. A. Cuomo,
M. Gellert, and M. A. Oettinger.
1995.
Cleavage at a V(D)J recombination signal requires only RAG1 and RAG2 proteins and occurs in two steps.
Cell
83:387-395[CrossRef][Medline].
|
| 32.
|
Mo, X.,
T. Bailin, and M. Sadofsky.
1999.
RAG-1 and RAG-2 cooperate in specific binding to the recombination signal sequence in vitro.
J. Biol. Chem.
274:7025-7031[Abstract/Free Full Text].
|
| 33.
|
Oettinger, M. A.,
D. G. Schatz,
C. Gorka, and D. Baltimore.
1990.
RAG-1 and RAG-2, adjacent genes that synergistically activate V(D)J recombination.
Science
248:1517-1523[Abstract/Free Full Text].
|
| 34.
|
Piccirilli, J. A.,
J. S. Vyle,
M. H. Caruthers, and T. R. Cech.
1993.
Metal ion catalysis in the Tetrahymena ribozyme reaction.
Nature
361:85-88[CrossRef][Medline].
|
| 35.
|
Polard, P., and M. Chandler.
1995.
Bacterial transposases and retroviral integrases.
Mol. Microbiol.
15:13-23[CrossRef][Medline].
|
| 36.
|
Rice, P., and K. Mizuuchi.
1995.
Structure of the bacteriophage Mu transposase core: a common structural motif for DNA transposition and retroviral integration.
Cell
82:209-220[CrossRef][Medline].
|
| 37.
|
Roth, D. B., and N. L. Craig.
1998.
VDJ recombination: a transposase goes to work.
Cell
94:411-414[CrossRef][Medline].
|
| 38.
|
Sarnovsky, R. J.,
E. W. May, and N. L. Craig.
1996.
The Tn7 transposase is a heteromeric complex in which DNA breakage and joining activities are distributed between different gene products.
EMBO J.
15:6348-6361[Medline].
|
| 39.
|
Schatz, D. G.,
M. A. Oettinger, and D. Baltimore.
1989.
The V(D)J recombination activating gene, RAG-1.
Cell
59:1035-1048[CrossRef][Medline].
|
| 40.
|
Schwarz, K.,
G. H. Gauss,
L. Ludwig,
U. Pannicke,
Z. Li,
D. Lindner,
W. Friedrich,
R. A. Seger,
T. E. Hansen-Hagge,
S. Desiderio,
M. R. Lieber, and C. R. Bartram.
1996.
RAG mutations in human B cell-negative SCID.
Science
274:97-99[Abstract/Free Full Text].
|
| 41.
|
Siebenlist, U., and W. Gilbert.
1980.
Contacts between Escherichia coli RNA polymerase and an early promoter of phage T7.
Proc. Natl. Acad. Sci. USA
77:122-126[Abstract/Free Full Text].
|
| 42.
|
Spanopoulou, E.,
F. Zaitseva,
F.-H. Wang,
S. Santagata,
D. Baltimore, and G. Panayotou.
1996.
The homeodomain region of Rag-1 reveals the parallel mechanisms of bacterial and V(D)J recombination.
Cell
87:263-276[CrossRef][Medline].
|
| 43.
|
Swanson, P. C.
2001.
The DDE motif in RAG-1 is contributed in trans to a single active site that catalyzes the nicking and transesterification steps of V(D)J recombination.
Mol. Cell. Biol.
21:449-458[Abstract/Free Full Text].
|
| 44.
|
Swanson, P. C., and S. Desiderio.
1999.
RAG-2 promotes heptamer occupancy by RAG-1 in the assembly of a V(D)J initiation complex.
Mol. Cell. Biol.
19:3674-3683[Abstract/Free Full Text].
|
| 45.
|
Swanson, P. C., and S. Desiderio.
1998.
V(D)J recombination signal recognition: distinct, overlapping DNA-protein contacts in complexes containing RAG1 with and without RAG2.
Immunity
9:115-125[CrossRef][Medline].
|
| 46.
|
Truss, M.,
G. Chalepakis, and M. Beato.
1990.
Contacts between steroid hormone receptors and thymines in DNA: an interference method.
Proc. Natl. Acad. Sci. USA
87:7180-7184[Abstract/Free Full Text].
|
| 47.
|
van Gent, D. C.,
K. Hiom,
T. T. Paull, and M. Gellert.
1997.
Stimulation of V(D)J cleavage by high mobility group proteins.
EMBO J.
16:2665-2670[CrossRef][Medline].
|
| 48.
|
van Gent, D. C.,
J. F. McBlane,
D. A. Ramsden,
M. J. Sadofsky,
J. E. Hesse, and M. Gellert.
1995.
Initiation of V(D)J recombination in a cell-free system.
Cell
81:925-934[CrossRef][Medline].
|
| 49.
|
van Gent, D. C.,
K. Mizuuchi, and M. Gellert.
1996.
Similarities between initiation of V(D)J recombination and retroviral integration.
Science
271:1592-1594[Abstract].
|
| 50.
|
van Gent, D. C.,
D. A. Ramsden, and M. Gellert.
1996.
The RAG1 and RAG2 proteins establish the 12/23 rule in V(D)J recombination.
Cell
85:107-113[CrossRef][Medline].
|
| 51.
|
Villa, A.,
S. Santagata,
F. Bozzi,
S. Giliani,
A. Frattini,
L. Imberti,
L. B. Gatta,
H. D. Ochs,
K. Schwarz,
L. D. Notarangelo,
P. Vezzoni, and E. Spanopoulou.
1998.
Partial V(D)J recombination activity leads to Omenn syndrome.
Cell
93:885-896[CrossRef][Medline].
|
Molecular and Cellular Biology, June 2001, p. 3935-3946, Vol. 21, No. 12
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.12.3935-3946.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lu, C. P., Posey, J. E., Roth, D. B.
(2008). Understanding how the V(D)J recombinase catalyzes transesterification: distinctions between DNA cleavage and transposition. Nucleic Acids Res
36: 2864-2873
[Abstract]
[Full Text]
-
Kriatchko, A. N., Anderson, D. K., Swanson, P. C.
(2006). Identification and Characterization of a Gain-of-Function RAG-1 Mutant. Mol. Cell. Biol.
26: 4712-4728
[Abstract]
[Full Text]
-
Doherty, T. M., Fitzpatrick, L. A., Inoue, D., Qiao, J.-H., Fishbein, M. C., Detrano, R. C., Shah, P. K., Rajavashisth, T. B.
(2004). Molecular, Endocrine, and Genetic Mechanisms of Arterial Calcification. Endocr. Rev.
25: 629-672
[Abstract]
[Full Text]
-
De, P., Peak, M. M., Rodgers, K. K.
(2004). DNA Cleavage Activity of the V(D)J Recombination Protein RAG1 Is Autoregulated. Mol. Cell. Biol.
24: 6850-6860
[Abstract]
[Full Text]
-
Jiang, H., Ross, A. E., Desiderio, S.
(2004). Cell Cycle-dependent Accumulation in Vivo of Transposition-competent Complexes between Recombination Signal Ends and Full-length RAG Proteins. J. Biol. Chem.
279: 8478-8486
[Abstract]
[Full Text]
-
Kiss, J., Szabo, M., Olasz, F.
(2003). Site-specific recombination by the DDE family member mobile element IS30 transposase. Proc. Natl. Acad. Sci. USA
100: 15000-15005
[Abstract]
[Full Text]
-
Huye, L. E., Purugganan, M. M., Jiang, M.-M., Roth, D. B.
(2002). Mutational Analysis of All Conserved Basic Amino Acids in RAG-1 Reveals Catalytic, Step Arrest, and Joining-Deficient Mutants in the V(D)J Recombinase. Mol. Cell. Biol.
22: 3460-3473
[Abstract]
[Full Text]