Previous Article | Next Article 
Molecular and Cellular Biology, June 2001, p. 3974-3985, Vol. 21, No. 12
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.12.3974-3985.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
The Corepressor mSin3a Interacts with the
Proline-Rich Domain of p53 and Protects p53 from
Proteasome-Mediated Degradation
Jack T.
Zilfou,1
William H.
Hoffman,1
Michael
Sank,2
Donna L.
George,2 and
Maureen
Murphy1,*
Department of Pharmacology, Fox Chase Cancer
Center, Philadelphia Pennsylvania 19111,1 and
Department of Genetics, University of Pennsylvania School of
Medicine, Philadelphia, Pennsylvania 191042
Received 2 November 2000/Returned for modification 22 December
2000/Accepted 19 March 2001
 |
ABSTRACT |
While the transactivation function of the tumor suppressor
p53 is well understood, less is known about the transrepression functions of this protein. We have previously shown that p53 interacts with the corepressor protein mSin3a (hereafter designated Sin3) in vivo and that this interaction is critical for the ability of p53 to
repress gene expression. In the present study, we demonstrate that
expression of Sin3 results in posttranslational stabilization of both
exogenous and endogenous p53, due to an inhibition of proteasome-mediated degradation of this protein. Stabilization of p53
by Sin3 requires the Sin3-binding domain, determined here to map to the
proline-rich region of p53, from amino acids 61 to 75. The correlation
between Sin3 binding and stabilization supports the hypothesis that
this domain of p53 may normally be subject to a destabilizing
influence. The finding that a synthetic mutant of p53 lacking the
Sin3-binding domain has an increased half-life in cells, compared to
wild-type p53, supports this premise. Interestingly, unlike
retinoblastoma tumor suppressor protein, MDMX, and
p14ARF, Sin3 stabilizes p53 in an MDM2-independent manner.
The ability of Sin3 to stabilize p53 is consistent with the model
whereby these two proteins must exist on a promoter for extended
periods, in order for repression to be an effective mechanism of gene
regulation. This model is consistent with our data indicating that,
unlike the p300-p53 complex, the p53-Sin3 complex is immunologically detectable for prolonged periods following exposure of cells to agents
of DNA damage.
 |
INTRODUCTION |
The p53 tumor suppressor protein is
widely believed to monitor the cellular stress response to genotoxic
damage, as well as unfavorable environmental conditions such as
hypoxia, inadequate growth factor levels, and unscheduled cellular
division (31). In response to these stimuli, p53 becomes
posttranslationally stabilized and activated as a transcription factor
(for review, see references 15, 27, and 31).
The cellular outcome of this response is p53-mediated growth arrest at
the G1 and G2/M checkpoints
or induction of programmed cell death (apoptosis). In part, cell type
and environmental signals mediate the decision between growth arrest
and apoptosis, but the level of p53 induced in the cell also plays a
role (9). Given the significance of the outcome of
unregulated amounts of p53 protein in a cell (growth arrest or cell
death), elucidation of the parameters that control p53 levels in vivo
continues to be an important area of study.
In normal cells p53 protein has a very short half-life (5 to 20 min),
and there is good evidence that it is subject to ubiquitin-mediated degradation via the 26S proteasome (32, 44). Cells with a temperature-sensitive E1 enzyme show high levels of p53 at the restrictive temperature (10), and ubiquitin conjugates of
p53 are evident in many cell types (32). There exist
several proteins that control the level of p53 in the cell; not
surprisingly, the functions of many of these are altered in human
cancer. Perhaps chief in importance among these proteins is MDM2. MDM2
binds to p53 and enhances its ubiquitin-mediated degradation by acting directly as an E3 ubiquitin ligase; this activity requires MDM2's nuclear export function (18, 21, 22, 29, 39, 48). This
appears to occur only for the p53 oligomer, as the p53 monomer is
unable to interact with MDM2 (33). Nontetrameric p53 also requires its own nuclear export sequence, which is deeply imbedded in
the oligomerization domain and consequently masked on the monomer (14, 45). These data implicate the existence of multiple
mechanisms controlling p53 stability.
Inhibition of normal MDM2 function, by antibody binding (which breaks
the p53-MDM2 complex), by expression of antisense RNA to MDM2, or by
the drug leptomycin B (which inhibits nucleocytoplasmic shuttling),
leads to accumulated p53 in the cell and subsequent apoptosis (6,
8, 12). Additionally, much of the posttranslational stabilization of p53 following exposure to DNA-damaging agents results
from inhibition of the MDM2-p53 interaction. This interaction is
weakened by phosphorylation of p53 at serine 20 following genotoxic stress (7, 38, 43), as well as by phosphorylation of MDM2 by kinases of the ATM family (26, 37). Similarly, there
are at least three cellular proteins that stabilize p53 by antagonizing MDM2 function. The p14ARF tumor suppressor
protein directly antagonizes the ability of MDM2 to degrade p53 by
relocalizing the p14ARF-MDM2-p53 complex
in a manner that interferes with degradation of p53 (25,
52) and by inhibiting MDM2's ubiquitin ligase activity
(22). The retinoblastoma tumor suppressor protein (pRB) and the MDM2 homologue MDMX have also been shown to stabilize p53; like
p14ARF, these proteins accomplish this by
inhibiting the function of MDM2 (23, 42). Additionally,
however, control of p53 stability by mechanisms that are independent of
MDM2, by calpain 1, Jun N-terminal kinase (JNK), and
-catenin, has
also been observed (11, 13, 28).
We previously described the interaction of p53 with the corepressor
protein mSin3a (hereafter designated Sin3); this interaction is
necessary for the ability of p53 to repress transcription
(36). Sin3 is a ubiquitous nuclear corepressor protein
that is utilized by many other transcriptional repressors (for a
review, see reference 3). When analyzing the ability of
p53 to cooperate with Sin3 to repress gene expression, we noted a
consistent increase in both endogenous and exogenous p53 in cells in
which Sin3 is introduced. We report here that interaction with Sin3
stabilizes p53 protein by inhibiting proteasome-mediated degradation of
this protein. This stabilization requires the Sin3-binding domain of
p53 (amino acids 61 to 75) and specifically requires the proline
residue at amino acid 71 of p53. Interestingly, we show that unlike
pRB, MDMX, and p14ARF, Sin3 can stabilize p53 in
MDM2-null cells. The combined data suggest that the Sin3-binding domain
of p53, which maps within the proline-rich region of p53, may normally
be subject to interaction with a destabilizing protein. Interaction
with Sin3 would be predicted to inhibit this destabilization, thereby
facilitating the existence of the p53-Sin3 repression complex on the
promoters of p53-repressed genes.
 |
MATERIALS AND METHODS |
Cell culture.
The H1299 human lung adenocarcinoma cell line
was maintained in Dulbecco's modified Eagle medium supplemented with
10% fetal bovine serum (FBS) and 100 U of
penicillin-streptomycin/ml. MCF-7 human breast carcinoma cells
were maintained in RPMI 1640 medium supplemented with 10% FBS and 100 U of penicillin-streptomycin/ml. 174-1 cells are murine embryo
fibroblasts that are null for both p53 and MDM2 and were provided
courtesy of Gigi Lozano, M. D. Anderson Cancer Center. These cells
were maintained in Dulbecco's modified Eagle medium supplemented with
10% FBS and 100 U of penicillin-streptomycin/ml. All cells were grown
at 37°C in a 5% CO2 humidified atmosphere.
Plasmid constructs and transfections.
Kevin Ryan and Karen
Vousden (National Cancer Institute) kindly provided the Tyr175 mutant
of p53. The deletion mutants of p53 (
1-40TZ,
44-61TZ,
61-75TZ, and
1-100TZ) were generated by PCR of the parent
plasmid p53TZ (kindly provided by Thanos Halazonetis, The Wistar
Institute) and subcloned into the vector pCR3.1 (Invitrogen), and the
correct sequence was confirmed by sequence analysis. The p53 point
mutants P71R and P80L were generated in this vector with the
QuickChange site-directed mutagenesis protocol (Stratagene). All p53
constructs utilized in this study were of human origin and were driven
by the same cytomegalovirus immediate-early promoter. The human
wild-type (wt) p53 construct was cloned in pRc/CMV and was courtesy of
Arnold Levine (Rockefeller University). The human
p14ARF construct was generated by reverse
transcription-PCR of mRNA from human thymus, sequenced, and cloned into
CMV-neo-Bam3. The human Mdm2 cDNA in CMV-neo-Bam3, pCHDM1A, was
provided by Jiandong Chen (H. Lee Moffitt Cancer Center, University of
South Florida). The p53-inducible plasmid construct SpVII contains a
p53 consensus site (5' GGGCGTGCGCCGACATGCCC 3') linked to
the minimal promoter construct E1B-TATA, courtesy of James Manfredi,
Mount Sinai School of Medicine.
For transfections, H1299 cells were seeded at 2 × 106 cells per 10-cm dish, allowed to recover
overnight, and transfected for 24 h with calcium phosphate or
FuGene, according to protocols provided by the manufacturer (Gibco/BRL
and Roche Molecular Systems, respectively). MCF-7 and 174-1 cells were
transfected for 24 h with Lipofectin or FuGene, with protocols
provided by the manufacturer (Gibco/BRL and Roche Molecular Systems,
respectively). A total of 0.5 to 1 µg of p53 plasmid was transfected
with 7.5 to 8 µg of Sin3 (pCMX-mSin3a, kindly provided by Ron Evans,
The Salk Institute) or p14ARF, 4 µg of MDM2,
and 1 µg of CMV-
-galactosidase as a control for transfection
efficiency. For treatment with proteasome inhibitors, transfected cells
were treated with 200 µM MG132 (Calbiochem), 45 µM ALLN
(N-acetyl-Leu-Leu-norleucinal; Sigma), 25 µm
lactacystin (Calbiochem), or dilution vehicle alone (dimethyl sulfoxide
[DMSO]) for 2 h.
Immunoprecipitation (IP) and Western analysis.
Western
analysis was performed essentially as previously described
(36). Briefly, subconfluent cells were harvested and lysed
in radioimmunoprecipitation assay buffer (50 mM Tris at pH 7.4, 150 mM NaCl, 1% Triton X-100, 0.1% sodium dodecyl sulfate [SDS],
and 1% sodium deoxycholate) supplemented with protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 10 µg of pepstatin/ml, 10 µg of
aprotinin/ml, and 5 µg of leupeptin/ml). Protein concentrations were
determined with the Bio-Rad DC Protein assay.
Equal amounts of protein (between 50 and 120 µg) were run on SDS-10
or 12% polyacrylamide gel electrophoresis (PAGE) gels and
transferred overnight onto polyvinylidene difluoride membranes
(Bio-Rad). Western blots were incubated in antibody in 5% nonfat dry
milk in phosphate-buffered saline (PBS) supplemented with 0.2% Tween
20. Blots were incubated with primary antibody (in parentheses) at the
following dilutions: p53 (Ab-6; Calbiochem), 1:1,000; actin (Santa
Cruz), 1:400; actin (AC-15; Sigma), 1:5,000; and MDM2 (Ab-1;
Calbiochem), 1:1,000. Blots were washed with 5% nonfat dry milk
in PBS supplemented with 0.2% Tween 20, incubated in horseradish
peroxidase-linked secondary antibody (Jackson ImmunoResearch
Laboratories), and developed via the chemiluminescence protocol
provided by the manufacturer (NEN). Autoradiographs were quantitated
with NIH Image software.
For IP-Western analyses, cells were lysed in NP-40 lysis buffer and
equal amounts of protein (1,000 to 2,000 µg) were immunoprecipitated
with antisera to Sin3 (AK-11; Santa Cruz Biotechnology). Each
IP
mixture was washed twice in NP-40 buffer, followed by four
to six
washes in radioimmunoprecipitation assay buffer. IPs were
run on
SDS-7.5 or 10% PAGE gels and transferred overnight onto
Immuno-Blot
polyvinylidene difluoride membranes (Bio-Rad). Blots
were incubated
with 1 µg of antibody (Ab-6; Calbiochem)/ml for
1 h at room
temperature, followed by washing with PBS-0.2% Tween
20, incubation
in peroxidase-conjugated secondary antibody (Jackson
ImmunoResearch
Laboratories), and chemiluminescence detection
(NEN). Autoradiographs
were quantitated with NIH Image
software.
Pulse-chase analysis and half-life experiments.
For
half-life experiments, H1299 cells were transfected with 0.25 µg of
p53 or the
61-75 mutant for 24 h with FuGene, as per protocols
derived from the manufacturer (Roche Molecular Systems). Cells were
then radiolabeled for 14 h with
[35S]methionine
(35S-EXPRESS; NEN) and chased with cold 2 mM
L-methionine for the time points indicated. Equal counts
per minute of the lysates were immunoprecipitated with anti-p53
polyclonal antisera (Santa Cruz Biotechnology), and SDS-PAGE gels were
fluorographed (Enhance; NEN) and exposed to film overnight. For
cycloheximide experiments, cells were incubated with 40 µg of
cycloheximide/ml for the indicated time points, and equal amounts of
lysate, in micrograms, were subjected to Western analyses.
Autoradiographs were quantitated with NIH Image software.
Immunofluorescence.
MCF-7 cells were seeded at 25%
confluence on coverslips in six-well tissue culture plates and allowed
to recover overnight. Cells were transfected with 0.5 µg of
pCMX-mSin3a or 0.5 µg of p14ARF and 2 µg of
pEGFP with Lipofectin, via the protocol derived from the manufacturer
(Gibco/BRL). Twenty-four hours later, cells were fixed in 4%
paraformaldehyde solution for 10 min at room temperature, followed by a
10-min incubation with 0.2% Triton X-100 diluted in PBS.
Immunofluorescence was performed with p53 rabbit polyclonal antisera
(Santa Cruz Biotechnology) at 1 µg/ml and rhodamine-X-conjugated secondary antibody (Jackson ImmunoResearch Laboratories). Green fluorescent protein (GFP) was visualized at an excitation
wavelength of 490 nm with an emission wavelength of 505 nm, while the
p53-rhodamine X was observed at an excitation wavelength of 555 nm with
an emission wavelength of 605 nm. Images were acquired and analyzed
with Isee software (Innovision) and a Quantix 12-bit cooled
charged-coupled device camera (Photometrics).
Northern analysis and luciferase assays.
Total RNA was
isolated from cells by CsCl purification (35) or with
TRIzol, as per the manufacturer (Gibco/BRL). Northern analyses were
performed as described (35). Probes for Northern analyses
were radiolabeled with random primers (Prime-It-II; Stratagene) and
[
-32P]dCTP (NEN). Autoradiographs were
quantitated with NIH Image software. The data depicted are
representative of at least three independent experiments. For
luciferase assays, H1299 cells were seeded in six-well plates at 2 × 105 cells/well and allowed to settle
overnight. Cells were transfected with 1.25 µg of firefly luciferase
reporter construct SpVII (containing a consensus p53 binding site in
the minimal promoter vector pE1B-TATA, courtesy of James Manfredi,
Mount Sinai School of Medicine), along with the indicated amounts of
p53 expression plasmid (in pRc/CMV) and 100 ng of the transfection
control pEGFP (Clontech). Transfections were performed using FuGene,
according to protocols derived from the manufacturer (Roche). After 24 to 36 h, the cells were harvested and lysed, and luciferase assays
were performed as per the protocol derived from the manufacturer
(Promega) with a Monolight 2010 luminometer (Analytical Luminescence Laboratory).
 |
RESULTS |
Sin3 stabilizes p53 and protects p53 from MDM2-mediated
degradation.
We previously reported that p53 protein interacts
directly with the corepressor protein Sin3. The p53-Sin3 interaction
results in the recruitment of histone deacetylases to the promoters of p53-repressed genes like Map4. This recruitment leads
to subsequent deacetylation of the histones associated with these
promoters (36). In an effort to examine the ability of
Sin3 to cooperate with p53 in the repression of transcription, we noted
that transfection with Sin3, but not vector alone, led to consistent
increases in p53 protein levels. These data led us to test the
possibility that Sin3 expression and/or binding influences p53 stability.
To investigate the ability of Sin3 to alter p53 protein levels, H1299
cells (p53-null human lung adenocarcinoma cells) were
transfected with
wt p53 in the presence of parental vector alone
(pRc/CMV), Sin3, or the
positive regulator of p53 stability, p14
ARF.
p14
ARF stabilizes p53 by inhibiting MDM2 function
(
25,
46,
52).
Western analysis of transfected cells
revealed that wt p53 was
expressed at four- to fivefold-higher levels
when cells were transfected
with Sin3 (Fig.
1A, lane 2). This was comparable to the
level
of p53 induced by p14
ARF transfection (lane
3). In contrast, transfection with Sin3 did
not lead to increased
levels of a cotransfected

-galactosidase
gene, glutathione
S-transferase (data not shown), or MDM2 (Fig.
1B, lane 3);
the latter is, like p53, a short-lived protein that
is degraded by the
proteasome. Increased p53 levels following
cotransfection with Sin3
occurred in several different p53-null
cell lines, with independent
plasmid preparations of p53 and Sin3
(data not shown). Northern
analysis of RNA isolated from transfected
cells revealed no increase in
p53 transcript levels, indicating
that the effect of Sin3 on p53 was
posttranscriptional (data not
shown).

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 1.
Sin3 stabilizes p53 and protects it from MDM2-mediated
degradation. (A) Western analysis of p53 (Ab-6; Calbiochem) in lysates
made from H1299 cells transiently transfected with wt p53 in the
presence of parental vector alone (pRc/CMV) (lane 1), pCMX-Sin3 (lane
2), or p14ARF (lane 3). Equivalent protein loading between
lanes was confirmed by Western analysis of -actin levels. (B)
Western analysis of MDM2 (Ab-1; Calbiochem) in H1299 cells transfected
with parental vector alone (pRc/CMV) (lane 1) or a cytomegalovirus
(CMV)-driven MDM2 expression construct, in the presence (lane 3) and
absence (lane 2) of an equal amount, in micrograms, of cotransfected
Sin3. Equivalent protein loading was confirmed by Western analysis of
-actin. (C) Western analysis of MDM2 and p53 in H1299 cells
transfected with wt p53 in the presence of MDM2 (lane 2) or MDM2 and
Sin3 (lane 3). While transfection with MDM2 leads to significant
decreases in p53 steady-state levels (lane 2), this effect is reversed
by transfection with Sin3 (lane 3). Equal levels of protein loading
were confirmed by Western analysis of -actin levels; the occasional
differences in p53 levels relative to -actin represent the use of
different p53 antisera (Ab-6 or p53 fl1-393 [Santa Cruz
Biotechnology]) as well as different actin antisera (AC-15 [Sigma]
versus antiactin polyclonal Santa Cruz [Biotechnology]). While these
antisera occasionally revealed different levels of p53 and/or actin,
the trends in p53 stabilization in the presence of Sin3 were
consistent.
|
|
To address the possibility that Sin3 transfection counteracts
MDM2-mediated degradation of p53, H1299 cells were transfected
with wt
p53 in the presence or absence of MDM2 or of MDM2 and
Sin3 combined. As
depicted in Fig.
1C, cotransfection of wt p53
with its negative
regulator MDM2 markedly decreased the amount
of detectable p53 protein,
consistent with published results (
18,
29). Significantly,
cotransfection of Sin3 was able to abrogate
this effect, and p53
returned to its original levels (Fig.
1C,
lane 3). In general, the
level of cotransfected MDM2 remained
largely unchanged, though in some
cases it appeared to increase
with increased p53 levels (Fig.
1C and
data not shown). These
data indicate that Sin3 expression can increase
p53 levels and
that this activity is sufficient to modulate the effect
of MDM2
on p53 stability. It should be noted, however, that these data
do not indicate that Sin3 and MDM2 are directly antagonistic,
as these
proteins may be affecting separate pools of p53. This
possibility is
addressed further
below.
Sin3 inhibits proteasome-mediated degradation of p53.
p53
protein is rapidly turned over in unstressed cells, primarily due to
proteasome-mediated degradation, although the protease calpain 1 also
plays a role in p53 degradation (28). To address the
possibility that Sin3 inhibits proteasome-mediated degradation of p53,
H1299 cells were transiently transfected with combinations of
expression constructs for p53, Sin3, and p14ARF.
Twenty-four hours after transfection, cells were treated with the
proteasome inhibitor MG132 or dilution vehicle alone (DMSO) for 2 h. The finding that MG132 could not further increase the level of
Sin3-stabilized p53 would support the conclusion that these two agents
act on the same pathway by inhibiting proteasome-mediated degradation
of p53.
As shown in Fig.
2, MG132 treatment led
to a threefold increase in transfected p53 (Fig.
2A, compare lanes 1 and 4). Consistent
with previous findings (
46), p53 was
stabilized by p14
ARF, and this stabilization was
not enhanced by MG132 (Fig.
2A, lanes
3 and 6). Significantly, MG132
was likewise unable to function
additively with Sin3 to increase the
level of p53 in Sin3-transfected
cells, indicating that the
stabilization of p53 by both Sin3 and
MG132 occurs via inhibition of
proteasome-mediated degradation
(Fig.
2A, lanes 2 and 5). Results
identical to these were obtained
using the proteasome inhibitor
lactacystin (data not shown). In
contrast, the calpain 1 inhibitor ALLN
was able to further increase
the level of Sin3-stabilized p53 (Fig.
2B). Treatment of transfected
cells with the calpain 1 inhibitor ALLN
at concentrations previously
reported to inhibit calpain-mediated
degradation of p53 (
28)
led to a fivefold increase in p53
protein (Fig.
2B, lane 3). Notably,
when combined with Sin3
transfection, ALLN and Sin3 functioned
in an additive manner, leading
to a 10-fold increase in p53 levels
(Fig.
2B, lane 4). The combined
data support the hypothesis that
Sin3 expression leads to stabilization
of p53 protein and that
this stabilization is due to inhibition of
proteasome-mediated
degradation of p53.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 2.
Sin3 inhibits proteasome-mediated degradation of p53.
(A) Western analysis of p53 levels in H1299 cells transfected with wt
p53 in the presence of cotransfected Sin3 (lanes 2 and 5) or
p14ARF (lanes 3 and 6). Lanes 4 to 6 include a 2-h
posttransfection incubation with a 200 µM concentration of the
proteasome inhibitor MG132, while lanes 1 to 3 are treated with
dilution vehicle (DMSO). While MG132 is able to stabilize transfected
p53 approximately threefold (compare lanes 1 and 4), it has an
insignificant effect on the level of p53 stabilized by Sin3 (compare
lanes 2 and 5), indicating that Sin3 and MG132 likely function through
redundant pathways (inhibition of proteasome-mediated degradation). (B)
The calpain 1 inhibitor ALLN is able to further stabilize
Sin3-stabilized p53 (compare lanes 2 and 4). Both Sin3 transfection and
ALLN treatment (45 µM) result in fivefold increases in p53 levels;
the two agents together function additively (lane 4). Equal protein
loading was confirmed by Western analysis for -actin.
|
|
Stabilization of p53 by Sin3 requires the Sin3-binding domain of
p53 (amino acids 61 to 75).
The accumulated data support the
notion that Sin3 expression can influence the degradation of p53.
However, it remained formally possible that Sin3 expression influenced
p53 levels indirectly, by inducing a stress response. In order to
distinguish between direct and indirect effects of Sin3 on p53 levels,
the requirement for an interaction between Sin3 and p53 for
stabilization was determined. Specifically, deletion constructs of p53
lacking the Sin3-binding domain were generated and tested for their
ability to be stabilized by Sin3. We previously mapped the Sin3-binding domain of p53 to amino acids 40 to 100 of p53 (36). In the
present study, we generated a series of synthetic p53 mutants with
internal deletions encompassing this domain; these include internal
deletions of amino acids 44 to 61 (
44-61), 61 to 75 (
61-75),
and 81 to 96 (
81-96), as well as the extensive deletion of amino
acids 1 to 100 (
1-100). Because Sin3 also interacts weakly but
consistently with the oligomerization domain of p53 (36),
these deletion mutants were created with an artificial tetramerization
domain (TZ) from Saccharomyces cerevisiae GCN4
(51). This artificial TZ still allows p53 to oligomerize,
transactivate, suppress cell growth, and be ubiquitinated normally
(33, 51).
Transfection of H1299 cells with either wt p53 or the full-length p53TZ
construct (containing an artificial oligomerization
domain) resulted in
a three- to fourfold increase in both proteins
in the presence of Sin3,
as assessed by Western analysis (Fig.
3A,
lanes 1 to 4). In contrast, the

1-100TZ mutant, which we
have
previously shown fails to interact with Sin3 (
36), was
unaffected by Sin3 expression (Fig.
3A, lanes 5 and 6). Deletion
of
amino acids 44 to 61 of p53 (

44-61TZ) failed to affect Sin3
stabilization (Fig.
3B, lanes 1 and 2) or binding (lanes 3 and
4). Two
other deletion mutants of p53,

61-75TZ and

81-96TZ,
were also
analyzed for their ability to be stabilized (Fig.
3C)
and interact
(Fig.
3D) with Sin3. As depicted in Fig.
3, the

81-96TZ
mutant can
bind (Fig.
3D, lanes 5 and 6) and be stabilized by
(Fig.
3C, lanes 5 and 6) Sin3, to a level comparable to that of
the full-length p53TZ
control (Fig.
3A). In contrast, the

61-75TZ
mutant was consistently
unable to bind (Fig.
3D, lanes 3 and 4)
or be stabilized by (Fig.
3C,
lanes 3 and 4) Sin3. These data
narrow down the region of interaction
between p53 and Sin3 to
amino acids 61 to 75 of p53. Further, they
indicate that this
minimal interaction domain is required for
stabilization of p53
by Sin3.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 3.
Stabilization of p53 by Sin3 requires the Sin3-binding
domain of p53 (amino acids 61 to 75). (A) Western analysis of H1299
cells transiently transfected with wt p53 (lanes 1 and 2), the p53TZ
construct encoding wt p53 but containing an artificial TZ (lanes 3 and
4), and a deletion mutant of this protein that lacks amino acids 1 to
100 and fails to interact with Sin3 ( 1-100TZ) (lanes 5 and 6).
Odd-numbered lanes are cotransfected with parental vector, and
even-numbered lanes are cotransfected with an equal amount of Sin3
expression construct. (B) Western analysis of a p53 deletion mutant
with amino acids 44 to 61 deleted ( 44-61TZ). This mutant is
stabilized by exogenous Sin3 (lanes 1 and 2) and binds to Sin3 in
transfected H1299 cells that are immunoprecipitated with antiserum to
Sin3 (AK-11) and immunoblotted with p53 antiserum (Ab-6; Calbiochem)
(lanes 3 and 4). (C) Western analysis of H1299 cells transfected with
the p53TZ cDNA or with internal deletions created in the p53TZ backbone
( 61-75TZ) (lanes 3 and 4) and 81-96TZ (lanes 5 and 6).
Odd-numbered lanes are cotransfected with parental vector, and
even-numbered lanes are cotransfected with Sin3 expression construct.
Only the 61-75 mutant fails to be stabilized by exogenous Sin3
(lane 4). (D) IP-Western analysis of the interaction of Sin3 in vivo
with deletion mutants of p53, including the p53 mutant that fails to be
stabilized by Sin3 ( 61-75TZ) (lanes 3 and 4). Odd-numbered lanes
are cotransfected with parental vector, and even-numbered lanes are
cotransfected with Sin3 expression construct.
|
|
A deletion mutant of p53 lacking the Sin3-binding domain
(p53
61-75) has an increased half-life in vivo.
The above data
support the hypothesis that interaction with Sin3 may protect p53 from
degradation. A corollary to this hypothesis would be that the
Sin3-binding domain of p53, from amino acids 61 to 75, is normally
subject to a destabilizing influence and that Sin3 abrogates this
influence by interacting with this domain. In order to test this
hypothesis, we measured the half-life of wt p53 and the
61-75
deletion mutant in transfected cells. H1299 cells were transfected with
wt p53 or the
61-75 mutant, and transfected cells were radiolabeled
with [35S]methionine and chased with cold
methionine for 24 h. Cells were harvested and subjected to IP with
polyclonal antisera to p53. As indicated in Fig.
4A, both wt p53 and the
61-75 mutant
show similar first-order decay kinetics, but the
61-75 mutant
demonstrates a longer half-life. In this study, the half-life of wt p53
was estimated to be approximately 2 h, consistent with published
results of this kind (17), while the
61-75 mutant had
an estimated half-life of approximately 6 h. Similar half-life
experiments, using cycloheximide to block de novo protein synthesis in
transfected cells, likewise revealed a consistent increase in the
half-life of the
61-75 mutant, relative to that of wt p53 (Fig.
4B). These data support the hypothesis that amino acids 61 to 75 of p53
may normally be subject to a destabilizing influence.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 4.
A p53 deletion mutant lacking the Sin3-binding domain
( 61-75) shows enhanced stability in vivo. (A) Pulse-chase analysis
of 35S-methionine radiolabeled H1299 cells transfected with
wt p53 or the p53 mutant lacking the Sin3-binding domain ( 61-75).
Cells were radiolabeled with [35S]methionine and chased
for the indicated time points with excess unlabeled methionine. Equal
counts per minute of lysate were immunoprecipitated with polyclonal
antisera to p53 (Santa Cruz Biotechnology), as indicated in Materials
and Methods. The asterisk (*) indicates -actin, which is frequently
nonspecifically immunoprecipitated by polyclonal antisera to p53. The
graph depicts densitometric analysis of this representative experiment,
which indicates that wt p53 has a 2-h half-life, while the 61-75
mutant has an approximately 6-h half-life. (B) Western analysis of the
half-life of wt p53 (lanes 1 to 4) and the 61-75 mutant (lanes 5 to
8) following transfection of H1299 cells for 24 h and treatment
with 40 µg of cycloheximide/ml for the times indicated to halt new
protein synthesis. The data shown are representative of at least three
independent experiments; -actin is shown to control for protein
loading. (C) Northern analysis of H1299 cells transiently transfected
with 0, 1, and 5 µg of the wt p53TZ cDNA or the 61-75 deletion
mutant ( 61-75TZ). Thirty-six hours following transfection, cells
were harvested and analyzed by Northern analysis for the level of
endogenous p21, which was up-regulated equally well by both
forms of p53. A picture of the ethidium bromide-stained gel used as a
control for RNA loading and integrity is included. (D) Western analysis
of p53 levels in cells transfected with parental vector alone
(odd-numbered lanes) or vector expressing MDM2 (even-numbered lanes).
Both wt p53 (lanes 1 and 2) and the 61-75 mutant (lanes 3 and 4)
are effectively degraded by MDM2.
|
|
We next sought to test if the p53 mutant lacking the Sin3-binding
domain (

61-75) retained some of the functions of wt p53,
specifically transactivation and degradation by MDM2. As depicted
in
Fig.
4C, the

61-75 mutant of p53 retained the ability to
transactivate
the endogenous
p21 (waf1) gene when
transfected into p53-null
H1299 cells, to a level comparable to that of
wt p53 (Fig.
4C).
Additionally, this mutant likewise was degraded by
MDM2 to a level
comparable to that of wt p53 (Fig.
4D). Therefore,
deletion of
the Sin3-binding domain from amino acids 61 to 75 does not
denature
or otherwise inactivate
p53.
The P71R mutant of p53 fails to bind to Sin3 or be stabilized by
this protein.
In order to extend the mapping of the Sin3-p53
interaction domain, we created point mutations in several of the
conserved amino acids in the Sin3-binding region of p53. Three of these point mutants, encoding leucine at amino acid 80 (P80L) and glycine at
amino acid 62 or 63 (E62G or A63G, respectively), were able to be
stabilized and bind to Sin3 (Fig. 5A and
data not shown). One point mutant, however, encoding arginine instead
of proline at amino acid 71 (P71R), consistently demonstrated impaired
binding to Sin3 in vivo (Fig. 5A) and failed to be stabilized by
exogenous Sin3 (Fig. 5B, lanes 4 to 6). Identical results were obtained when leucine was substituted for proline at amino acid 71 (P71L) (data
not shown). The proline to arginine substitution at amino acid 71 did
not affect the ability of p53 to function as a transactivator, as the
P71R mutant transactivated the p53-responsive luciferase construct
SpVII to levels equivalent to those of wt p53 (Fig. 5C). As a control
for these studies, Western analysis indicated that both forms of p53
were expressed at equivalent levels in these transfected cells (Fig.
5D).

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 5.
A point mutant of p53 containing arginine instead of
proline at amino acid 71 (P71R) fails to interact with Sin3 in vivo or
to be stabilized by exogenous Sin3. This mutant shows transactivation
potential, however, that is indistinguishable from wt p53. (A)
Transfection of H1299 cells with wt p53 or point mutants containing
leucine at amino acid 80 (P80L) or arginine at amino acid 71 (P71R)
followed by IP with Sin3 antiserum (AK-11; Santa Cruz Biotechnology)
and immunoblotting with p53 antiserum (Ab-6; Calbiochem). The data
indicate that the P71R mutant shows impaired interaction with Sin3 in
transfected cells. (B) Transfection of H1299 cells with 50 ng of p53 or
the P71R mutant, along with increasing concentrations of Sin3
expression plasmid (0.5 and 2.5 µg, lanes 2, 3, 5, and 6). Immunoblot
analysis of p53 levels indicates that p53 is stabilized by Sin3 in a
dose-dependent manner but that neither dose of Sin3 is capable of
stabilizing the P71R mutant, which shows a defective interaction with
Sin3. A -actin control is included for protein loading. (C)
Luciferase activity of the p53-inducible luciferase vector SpVII (a
minimal promoter containing the E1B TATA box and a single p53 consensus
element) transiently transfected into H1299 cells in the presence of
parental vector (pRc/CMV) or increasing concentrations of wt p53 (25 and 100 ng) or the P71R point mutant of p53. The data depicted
represent the fold increase in luciferase activity obtained after
transfection, averaged from five independent experiments. Error bars
depict the standard error of the mean for the five experiments. (D)
Western analysis depicting comparable p53 levels expressed in the
transfected cells analyzed in the results shown in panel C. A total of
1.25 µg of the SpVII luciferase reporter construct was cotransfected
with either vector alone or increasing concentrations of wt p53 (25 and
100 ng), P71R (25 and 100 ng), and 100 ng of pEGFP (transfection
control) in six-well plates and analyzed for p53 levels by Western
analysis. Western analysis of the GFP levels between samples is used to
show relatively equal transfection efficiencies, and equivalent protein
loading is depicted by Western analysis for -actin.
|
|
Stabilization of p53 by Sin3 does not require MDM2.
The MDM2
binding domain of p53 has been mapped to amino acids 17 to 23; this
domain is believed to form an induced-fit amphipathic helix that fits
into a hydrophobic pocket at the amino terminus of MDM2
(30). The juxtaposition of this region to the Sin3-binding domain at residues 61 to 75 raised the possibility that Sin3 stabilizes p53 by sterically hindering MDM2 from binding and degrading p53. A
testable prediction from this hypothesis would be that Sin3 is unable
to stabilize p53 in MDM2-null cells. To address this issue, murine
embryo fibroblasts generated from mice nullizygous for both p53 and
MDM2 (174-1 cells) were transfected with p53 along with parental vector
alone, Sin3, or p14ARF. Western analysis revealed
that Sin3 transfection led to increased p53 levels in these cells,
while p14ARF had no effect (Fig.
6A, lanes 2 and 3). Therefore, unlike
p14ARF, MDMX, and pRB, Sin3 does not appear to
stabilize p53 by binding or inhibiting MDM2. Consistent with these
data, we have found by IP-Western analysis that a complex between p53,
MDM2, and Sin3 is immunologically detectable in MCF-7 cells (data not
shown).

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 6.
Stabilization of p53 by Sin3 occurs in an
MDM2-independent manner. (A) Western analysis of 174-1 cells (p53
/ MDM2 / transfected with wt p53 in the
presence of parental vector alone (lane 1), Sin3 expression construct
(lane 2), or p14ARF (lane 3). (B) Western analysis of H1299
cells transfected with wt p53 (lanes 1 to 3) or the tumor-derived
mutant R175Y (lanes 4 to 6) in the presence of vector alone (lanes 1 and 4), Sin3 expression construct (lanes 2 and 5), and
p14ARF (lanes 3 and 6). Equal protein loading among the
lanes was confirmed by Western analysis for -actin.
|
|
It became of interest to test the ability of Sin3 to stabilize human
tumor-derived mutant forms of p53, which we have previously
shown are
capable of interacting with Sin3 (
36). Using transient
transfection and Western blot analyses, we found that cotransfection
of
Sin3 with the DNA-binding domain mutant R175Y of p53 led to
slight but
consistent increases in the steady-state level of this
protein (Fig.
6B, lanes 4 and 5). In contrast, p14
ARF was
incapable of stabilizing this p53 mutant, consistent with
the inability
of the R175Y mutant to transactivate the endogenous
mdm2
gene, which is necessary for stabilization by
p14
ARF (Fig.
6B, lane 6). These data (Fig.
6)
support the premise that
stabilization of p53 by Sin3 occurs
independently of MDM2
function.
Sin3 stabilizes endogenous p53.
To assess the ability of Sin3
to affect the localization and stabilization of endogenous p53, the
human breast carcinoma cell line MCF-7 was utilized. This cell line
contains wt p53, but much of this protein is poorly detectable by
immunofluorescence, possibly because this protein is sequestered in the
cytoplasm (4, 8). MCF-7 cells were transfected with Sin3
or p14ARF; as a marker for transfected cells,
cells were cotransfected with an expression construct encoding GFP.
Following transfection, cells were assayed by confocal microscopy for
the presence of GFP (a marker for transfected cells), as well as for
p53 immunostaining. In each of three experiments, over 100 GFP-positive
cells were scored for the presence of strong p53 immunostaining, which
would be indicative of p53 stabilization.
Control MCF-7 cells transfected with GFP alone showed strong
immunostaining for p53 in 27% of cells (Fig.
7A, panel A3); this
is comparable to the
percentage with untransfected cells and is
consistent with previously
published reports about this cell line
(
4). Cotransfection
with Sin3 resulted in a significant increase
in the number of
GFP-positive cells showing strong p53 immunostaining
(from 27% for GFP
alone to 65% in Sin3-transfected cells) (Fig.
7A, panels B2 and B3),
consistent with the endogenous p53 protein
being stabilized.
Transfection with the positive control p14
ARF
resulted in a similar increase in cells with strong immunostaining
for
p53 (from 27% for GFP alone to 74% in
p14
ARF-transfected cells) (Fig.
7A, panels C2 and
C3). These results,
which were obtained in three independent
experiments scored blindly,
were statistically significant
(
P < 0.004 and
P < 0.003 for Sin3
and
p14
ARF, respectively) (Fig.
7B). Notably, Western
analysis of duplicate
plates of transfected cells confirmed these
results, indicating
that the endogenous p53 protein level in this cell
line was increased
2.5- to 3-fold following transfection with Sin3
(Fig.
7C, lane
2) but not GFP alone (lane 1). Similar results were
obtained with
the human melanoma cell line CaCl (wt p53) (data not
shown).

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 7.
Sin3 stabilizes endogenous p53 in MCF-7 cells. (A)
Immunofluorescence of MCF-7 cells transfected with a GFP expression
construct (pEGFP), analyzed by differential interference
contrast (A1 and C1), for GFP fluorescence (A2 and C2) and for
p53 staining (A3 and C3) with polyclonal antisera to p53. GFP-positive
cells were scored as transfected cells, and cells with high levels of
p53 immunostaining were scored as positive for p53. In three
independent blinded studies, over 100 GFP-positive cells were scored
for strong p53 immunostaining; the combined results from these
experiments are presented in panel B. (B) The averaged data from three
independent experiments indicate that transfection with Sin3 and
p14ARF leads to significant increases in the number of
transfected cells with strong immunopositivity for p53. While 27% of
cells transfected with GFP alone show strong immunostaining for p53, 65 and 74% of cells transfected with Sin3 and p14ARF,
respectively, showed increased p53 immunostaining. The asterisks
indicate a statistically significant difference between the indicated
treatment and control (P < 0.005, Student's
t test). The error bars indicate the standard error of
the mean for the combined three experiments. (C) Western analysis of
the levels of endogenous p53 in the samples prepared in the results
shown in panel A. These data indicate that transfection with Sin3 and
transfection with p14ARF both significantly stabilize
endogenous p53, compared to transfection with equal amounts, in
micrograms, of GFP vector alone. Equal protein loading was confirmed by
Western analysis for -actin.
|
|
The Sin3-p53 complex appears for prolonged periods after DNA
damage.
Taken together, the above data indicate that Sin3
stabilizes p53 and that this stabilization requires an interaction
between these two proteins. These data raise the interesting hypothesis that repression complexes containing p53 and Sin3 exist more stably in
the cell than transactivation complexes containing p53 and p300, which
are targeted by MDM2 for degradation (16). As an examination of this hypothesis, we analyzed the abundance of p53-Sin3 immunocomplexes in cells following genotoxic stress and compared this
to p53-p300 complexes. For these studies, p53, Sin3, and p300 were
immunoprecipitated from MCF-7 cells treated with
irradiation, the
DNA-damaging agent doxorubicin (adriamycin), and UV radiation; treated
cells were harvested after 0, 4, 8, and 24 h. These
immunoprecipitates were analyzed by Western analysis for the presence
of p53. As expected, these studies revealed that stabilization of p53
protein occurred as early as 4 h in response to all genotoxic
stresses tested (Fig. 8A, lane 2). The
Sin3-p53 immunocomplex appeared at the earliest time point (4 h) and
persisted in abundance throughout the time course, though with slightly
different kinetics for the three genotoxic stresses. Notably, the
formation and persistence of this complex paralleled the
down-regulation of stathmin, a p53-repressed gene
(1) (Fig. 8B).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 8.
The p53-Sin3 complex is immunologically detectable for
prolonged periods following genotoxic stress, compared to the p53-p300
complex. (A) IP-Western analysis of MCF-7 cells treated with 4 Gy of
irradiation (IR), 0.5 µg of adriamycin (ADR)/ml, or 4 J of UV
radiation/m2. Cells were harvested at the indicated time
points following treatment (0, 4, 8, and 24 h), and lysates were
immunoprecipitated with polyclonal antisera to p53, Sin3 (AK-11; Santa
Cruz Biotechnology), and p300 (Ab-1; Calbiochem), followed by Western
analysis for p53 with a mouse monoclonal antibody (Ab-6; Calbiochem).
Longer exposures for the p300 IPs are shown on the right, and shorter
p53 exposures are shown on the left. The data depicted are
representative of three independent experiments. (B) Northern analysis
of the p53-repressed gene stathmin in cells treated
identically to those shown in panel A. For all stresses tested,
down-regulation of stathmin is evident by 8 h and
increases at 24 h, concomitant with the appearance of the p53-Sin3
complex. The glyceraldehyde-3-phosphate dehydrogenase housekeeping gene
(GAPDH) is included as a control for RNA loading and integrity.
|
|
The p300-p53 complex was much less detectable than the Sin3-p53
complex, possibly because p300 targets p53 for MDM2-mediated
degradation (
16). Further, in the case of
doxorubicin-treated
cells, this complex consistently appeared to be
transient, peaking
at 4 or 8 h and becoming undetectable by
24 h (Fig.
8A). A similarly
transient nature was observed for the
MDM2-p53 complex (data not
shown). Identical results were obtained with
three different antibodies
to Sin3 and p300 (data not shown). These in
vivo data support
the physiological relevance of our finding that
interaction with
Sin3 leads to stabilization of p53. These data also
indicate that
different pools of p53 may have different half-lives in
the cell
and that regulation of p53 stability may have a direct impact
on p53 function (for example, transactivation versus
transrepression).
 |
DISCUSSION |
In the present study, we demonstrate that ectopic expression of
the corepressor protein Sin3 leads to stabilization of both transfected
and endogenous p53. That this effect is a direct impact of interaction
of Sin3 with p53 is supported by our finding that a 15-amino-acid
deletion mutant of p53 that is incapable of interacting with Sin3 also
fails to be stabilized by this protein. Similarly, mutation of proline
71 of p53 to arginine or leucine significantly impairs Sin3 binding and
Sin3-mediated stabilization. These data support a tight correlation
between Sin3 binding and stabilization of p53. Our data also indicate
that stabilization by Sin3 is likely the result of inhibition of
proteasome-mediated degradation of p53. Interestingly, unlike
p14ARF, MDMX, and pRB, Sin3 does not require the
presence of MDM2 for this effect. Therefore, these findings point to
the existence of a potentially novel pathway for p53 stabilization that
does not involve inhibition of MDM2 function.
At least two proteins are implicated in p53 degradation in a manner
that is independent of MDM2. These are the human papillomavirus type 16 or 18 (HPV-16 or -18) E6 protein (coupled with the accessory protein E6-AP) and JNK. As the E6-E6-AP complex and JNK both target p53 for degradation in an MDM2-independent manner (2, 12, 13), it is formally possible that Sin3 stabilizes p53 by
inhibiting the action of these proteins. We have found that Sin3 also
stabilizes the
92-112 mutant of p53 (J. T. Zilfou and M. Murphy, unpublished data); this deletion overlaps with the JNK
binding site, indicating that it is unlikely that Sin3 stabilizes p53
by inhibiting JNK binding and/or destabilization. The contribution of
the E6/E6-AP pathway to p53 degradation in normal (non-HPV-infected)
cells remains controversial. Two groups found no evidence for a role for E6-AP protein in p53 degradation in normal cells (5,
47). In contrast, the E6-AP knockout mouse shows increased p53
levels in certain cell types, indicating that this degradative pathway may play a cell-type-specific role in p53 degradation in normal cells
(24). It is notable that we have mapped the Sin3-binding domain of p53 to a region that is required for degradation by the
HPV-16-HPV-18 E6 protein (34). The possibility that Sin3 interferes with E6-E6-AP-mediated degradation of p53 is currently being tested in the laboratory.
The combined data implicate the Sin3-binding domain of p53, from amino
acids 61 to 75, as a region that normally confers destabilization to
this protein. This region of p53 has been previously implicated as a
destabilization domain for this protein; specifically, removal of amino
acids 62 to 96 has been shown to stabilize p53 in certain cell types
(19). Interestingly, this region also overlaps with the
proline-rich domain of p53 (amino acids 64 to 91), which is absolutely
essential for apoptosis induction by this protein (40, 49,
50). A smaller deletion in this region, retaining only the
Sin3-binding domain (amino acids 62 to 73), also retains the ability to
induce apoptosis (53) and points to the importance of the
p53-Sin3 interaction for the ability of p53 to induce apoptosis. Significantly, the proline-rich domain has also been shown to be
necessary for transcriptional repression by p53 (49, 50). Therefore, Sin3 is not only one of the first proteins found to interact
with the proline-rich domain of p53, it is also the first protein
implicated in transcriptional repression found to interact there.
It should be noted that our data do not imply that interaction with
Sin3 is the exclusive, or even the major, mechanism whereby p53 is
stabilized following DNA damage. In fact, our data indicate that the
amount of p53 associated with Sin3 following DNA damage is rather
small, approaching only 10% of total p53 (Fig. 8 and data not shown).
Additionally, data from several other groups support the notion that
decreased association with MDM2 is the major mechanism whereby p53 is
stabilized in the cell in response to genotoxic stress (6-8, 26,
38). Therefore, the ability of Sin3 to stabilize p53 is relevant
only for that pool of p53 that is bound to Sin3; this stabilization may
even occur exclusively at the promoters of p53-repressed genes.
The identification of Sin3 as a stabilizer of p53 appears logical when
the mechanism of action of the p53-Sin3 complex is taken into
consideration. Transactivation of target genes by p53 can proceed
effectively in a transient manner; this transient nature may even be
facilitated by the coactivator p300, which serves as a scaffold for
MDM2-mediated degradation of p53 (16). In contrast, it
could be argued that transcriptional repression is effective only if
repression complexes exist stably on the promoters of repressed genes
for prolonged periods of time. By protecting p53 from degradation, the
corepressor Sin3 therefore would be predicted to enhance the efficacy
of p53 as a transcriptional repressor (Fig.
9). In an analogous manner, E2F-1 and
c-Myc, both of which are unstable transcriptional activators,
have been shown to be protected from proteasome-mediated degradation by
their respective transcriptional repression partners, pRB and miz-1 (20, 41). Our in vivo data, indicating that the p53-Sin3
complex exists for sustained periods following exposure to DNA damage, support this hypothesis. In sum, the data presented in this paper support a novel mechanism for the control of p53 stability and activity
and point to a physiologically relevant mechanism for the control of
p53 degradation, mediated by the Sin3-binding domain of p53.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 9.
Model for the differential stability of p53-dependent
transactivation and transrepression complexes. p53-dependent
transactivation of p53-induced genes such as p21
utilizes p300 as a coactivator; p300 serves as a scaffold for
interaction between p53 and MDM2, thus targeting p53 for degradation
and prohibiting prolonged transactivation. In contrast, the p53 protein
present at the promoters of p53-repressed genes like
map4 would be bound to the corepressor Sin3 (shown here
bound to histone deacetylase 1 [HDAC-1]) and is predicted to be
protected from proteasome-mediated degradation. Such protection would
facilitate prolonged and efficient transcriptional repression.
|
|
 |
ACKNOWLEDGMENTS |
We thank Peter Adams, Warren Davis, Margret Einarson, Geraldine
O'Neill, and Rebecca Raftogianis for critical reading of the manuscript. We also thank Thanos Halazonetis for the p53TZ construct, Jonathan Boyd for confocal expertise, and Pearl Huang and Siham Biade
for helpful discussions throughout the course of this work. We thank
Stephanie Stehman for technical assistance for some of these studies.
This work was supported by NIH grants CA80854 (M.M.) and CA66741
(D.L.G.), as well as by a generous grant from the W. W. Smith Charitable Trust (M.M).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Pharmacology, Fox Chase Cancer Center,7701 Burholme Ave., Philadelphia, PA 19111. Phone: (215) 728-5684. Fax: (215) 728-4333. E-mail: ME_Murphy{at}FCCC.edu.
 |
REFERENCES |
| 1.
|
Ahn, J.,
M. Murphy,
S. Kratowicz,
A. Wang,
A. J. Levine, and D. L. George.
1999.
Down-regulation of the stathmin/Op18 and FKBP25 genes following p53 induction.
Oncogene
18:5954-5958[CrossRef][Medline].
|
| 2.
|
Alarcon, R.,
C. Koumenis,
R. K. Geyer,
C. G. Maki, and A. J. Giaccia.
1999.
Hypoxia induces p53 accumulation through MDM2 down-regulation and inhibition of E6-mediated degradation.
Cancer Res.
59:6046-6051[Abstract/Free Full Text].
|
| 3.
|
Ayer, D. E.
1999.
Histone deacetylases: transcriptional repression with SINers and NuRDs.
Trends Cell Biol.
9:193-198[CrossRef][Medline].
|
| 4.
|
Bartek, J.,
R. Iggo,
J. Gannon, and D. P. Lane.
1990.
Genetic and immunochemical analysis of mutant p53 in human breast cancer cell lines.
Oncogene
5:893-899[Medline].
|
| 5.
|
Beer-Romero, P.,
S. Glass, and M. Rolfe.
1997.
Antisense targeting of E6AP elevates p53 in HPV-infected cells but not in normal cells.
Oncogene
14:595-602[CrossRef][Medline].
|
| 6.
|
Bottger, A.,
V. Bottger,
A. Sparks,
W. Liu,
S. F. Howard, and D. P. Lane.
1997.
Design of a synthetic Mdm2-binding mini protein that activates the p53 response in vivo.
Curr. Biol.
7:860-869[CrossRef][Medline].
|
| 7.
|
Chehab, N. H.,
A. Malikzay,
E. S. Stavridi, and T. D. Halazonetis.
1999.
Phosphorylation of Ser-20 mediates stabilization of human p53 in response to DNA damage.
Proc. Natl. Acad. Sci. USA
96:13777-13782[Abstract/Free Full Text].
|
| 8.
|
Chen, L.,
S. Agrawal,
W. Zhou,
R. Zhang, and J. Chen.
1998.
Synergistic activation of p53 by inhibition of MDM2 expression and DNA damage.
Proc. Natl. Acad. Sci. USA
95:195-200[Abstract/Free Full Text].
|
| 9.
|
Chen, X.,
L. J. Ko,
L. Jayaraman, and C. Prives.
1996.
p53 levels, functional domains, and DNA damage determine the extent of the apoptotic response of tumor cells.
Genes Dev.
10:2438-2451[Abstract/Free Full Text].
|
| 10.
|
Chowdary, D. R.,
J. J. Dermody,
K. K. Jha, and H. L. Ozer.
1994.
Accumulation of p53 in a mutant cell line defective in the ubiquitin pathway.
Mol. Cell. Biol.
14:1997-2003[Abstract/Free Full Text].
|
| 11.
|
Damalas, A.,
A. Ben-Ze'ev,
I. Simcha,
M. Shtutman,
J. Fernando,
M. Leal,
J. Zhurinsky,
B. Geiger, and M. Oren.
1999.
Excess -catenin promotes accumulation of transcriptionally active p53.
EMBO J.
18:3054-3063[CrossRef][Medline].
|
| 12.
|
Freedman, D. A., and A. J. Levine.
1998.
Nuclear export is required for degradation of endogenous p53 by MDM2 and human papillomavirus E6.
Mol. Cell. Biol.
18:7288-7293[Abstract/Free Full Text].
|
| 13.
|
Fuchs, S. Y.,
V. Adler,
T. Buschmann,
Z. Yin,
X. Wu,
S. N. Jones, and Z. Ronai.
1998.
JNK targets p53 ubiquitination and degradation in nonstressed cells.
Genes Dev.
12:2658-2663[Abstract/Free Full Text].
|
| 14.
|
Geyer, R. K.,
Z. K. Yu, and C. G. Maki.
2000.
The MDM2 RING finger is required to promote p53 nuclear export.
Nat. Cell Biol.
2:569-573[CrossRef][Medline].
|
| 15.
|
Gottlieb, T. M., and M. Oren.
1996.
p53 in growth control and neoplasia.
Biochem. Biophys. Acta
1287:77-102[Medline].
|
| 16.
|
Grossman, S. R.,
M. Perez,
A. L. Kung,
M. Joseph,
C. Mansur,
Z. X. Xiao,
S. Kumar,
P. M. Howley, and D. M. Livingston.
1998.
p300/MDM2 complexes participate in MDM2-mediated p53 degradation.
Mol. Cell
2:405-415[CrossRef][Medline].
|
| 17.
|
Gu, J.,
D. Chen,
J. Rosenblum,
R. M. Rubin, and Z.-M. Yuan.
2000.
Identification of a sequence element from p53 that signals for MDM2-targeted degradation.
Mol. Cell. Biol.
20:1243-1253[Abstract/Free Full Text].
|
| 18.
|
Haupt, Y.,
R. Maya,
A. Kazaz, and M. Oren.
1997.
Mdm2 promotes the rapid degradation of p53.
Nature
387:296-299[CrossRef][Medline].
|
| 19.
|
Hengstermann, A.,
N. J. Whitaker,
D. Zimmer,
H. Zentgraf, and M. Scheffner.
1998.
Characterization of sequence elements involved in p53 stability regulation reveals cell type dependence for p53 degradation.
Oncogene
17:2933-2941[CrossRef][Medline].
|
| 20.
|
Hofmann, F.,
F. Martelli,
D. M. Livingston, and Z. Wang.
1996.
The retinoblastoma gene product protects E2F-1 from degradation by the ubiquitin-proteasome pathway.
Genes Dev.
10:2949-2959[Abstract/Free Full Text].
|
| 21.
|
Honda, R.,
H. Tanaka, and H. Yasuda.
1997.
Oncoprotein MDM2 is a ubiquitin ligase E3 for tumor suppressor p53.
FEBS Lett.
420:25-27[CrossRef][Medline].
|
| 22.
|
Honda, R., and H. Yasuda.
1999.
Association of p19ARF with MDM2 inhibits ubiquitin ligase activity of MDM2 for tumor suppressor p53.
EMBO J.
18:22-27[CrossRef][Medline].
|
| 23.
|
Hsieh, J.,
F. S. G. Chan,
D. J. O'Connor,
S. Mittnacht,
S. Zhong, and X. Lu.
1999.
RB regulates the stability and the apoptotic function of p53 via MDM2.
Mol. Cell
3:181-193[CrossRef][Medline].
|
| 24.
|
Jiang, Y. H.,
D. Armstrong,
U. Albrecht,
C. M. Atkins,
J. L. Noebels,
G. Eichele,
J. D. Sweatt, and A. L. Beaudet.
1998.
Mutation of the Angelman ubiquitin ligase in mice causes increased cytoplasmic p53 and deficits of contextual learning and long-term potentiation.
Neuron
21:799-811[CrossRef][Medline].
|
| 25.
|
Kamijo, T.,
J. D. Weber,
G. Zambetti,
F. Zindy,
M. F. Roussel, and C. J. Sherr.
1998.
Functional and physical interactions of the ARF tumor suppressor protein with p53 and Mdm2.
Proc. Natl. Acad. Sci. USA
95:8292-8297[Abstract/Free Full Text].
|
| 26.
|
Khosravi, R.,
R. Maya,
T. Gottlieb,
M. Oren,
Y. Shiloh, and D. Shkedy.
1999.
Rapid ATM-dependent phosphorylation of MDM2 precedes p53 accumulation in response to DNA damage.
Proc. Natl. Acad. Sci. USA
96:14973-14977[Abstract/Free Full Text].
|
| 27.
|
Ko, L. J., and C. Prives.
1996.
p53: puzzle and paradigm.
Genes Dev.
10:1054-1072[Free Full Text].
|
| 28.
|
Kubbutat, M. H., and K. H. Vousden.
1997.
Proteolytic cleavage of human p53 by calpain: a potential regulator of p53 stability.
Mol. Cell. Biol.
17:460-468[Abstract].
|
| 29.
|
Kubbutat, M. H.,
S. N. Jones, and K. H. Vousden.
1997.
Regulation of p53 stability by Mdm2.
Nature
387:299-303[CrossRef][Medline].
|
| 30.
|
Kussie, P. H.,
S. Gorina,
V. Marechal,
B. Elenbaas,
J. Moreau,
A. J. Levine, and N. P. Pavletich.
1996.
Structure of the MDM2 oncoprotein bound to the p53 tumor suppressor transactivation domain.
Science
274:948-953[Abstract/Free Full Text].
|
| 31.
|
Levine, A. J.
1997.
p53, the cellular gatekeeper for growth and division.
Cell
88:323-331[CrossRef][Medline].
|
| 32.
|
Maki, C. G.,
J. M. Huibregtse, and P. M. Howley.
1996.
In vivo ubiquitination and proteasome-mediated degradation of p53.
Cancer Res.
56:2649-2654[Abstract/Free Full Text].
|
| 33.
|
Maki, C. G.
1999.
Oligomerization is required for p53 to be efficiently ubiquitinated by MDM2.
J. Biol. Chem.
274:16531-16535[Abstract/Free Full Text].
|
| 34.
|
Mansur, C. P.,
B. Marcus,
S. Dalal, and E. J. Androphy.
1995.
The domain of p53 required for binding HPV 16 E6 is separable from the degradation domain.
Oncogene
10:457-465[Medline].
|
| 35.
|
Murphy, M.,
A. Hinman, and A. J. Levine.
1996.
Wild-type p53 negatively regulates the expression of a microtubule associated protein.
Genes Dev.
10:2971-2980[Abstract/Free Full Text].
|
| 36.
|
Murphy, M.,
J. Ahn,
K. K. Walker,
W. H. Hoffman,
R. M. Evans,
A. J. Levine, and D. L. George.
1999.
Transcriptional repression by wild-type p53 utilizes histone deacetylases, mediated by interaction with mSin3a.
Genes Dev.
13:2490-2501[Abstract/Free Full Text].
|
| 37.
|
Oren, M.
1999.
Regulation of the p53 tumor suppressor protein.
J. Biol. Chem.
274:36031-36034[Free Full Text].
|
| 38.
|
Prives, C.
1998.
Signaling to p53: breaking the MDM2-p53 circuit.
Cell
95:5-8[CrossRef][Medline].
|
| 39.
|
Roth, J.,
M. Dobbelstein,
D. A. Freedman,
T. Shenk, and A. J. Levine.
1998.
Nucleo-cytoplasmic shuttling of the hdm2 oncoprotein regulates the levels of the p53 protein via a pathway used by the human immunodeficiency virus rev protein.
EMBO J.
17:554-564[CrossRef][Medline].
|
| 40.
|
Sakamuro, D.,
P. Sabbatini,
E. White, and G. C. Prendergast.
1997.
The polyproline region of p53 is required to activate apoptosis but not growth arrest.
Oncogene
15:887-898[CrossRef][Medline].
|
| 41.
|
Salghetti, S. E.,
S. Y. Kim, and W. P. Tansey.
1999.
Destruction of Myc by ubiquitin-mediated proteolysis: cancer-associated and transforming mutations stabilize Myc.
EMBO J.
18:717-726[CrossRef][Medline].
|
| 42.
|
Sharp, D. A.,
S. A. Kratowicz,
M. J. Sank, and D. L. George.
1999.
Stabilization of the MDM2 oncoprotein by interaction with the structurally related MDMX protein.
J. Biol. Chem.
274:38189-38196[Abstract/Free Full Text].
|
| 43.
|
Shieh, S. Y.,
Y. Taya, and C. Prives.
1999.
DNA damage-inducible phosphorylation of p53 at N-terminal sites including a novel site, Ser20, requires tetramerization.
EMBO J.
18:1815-1823[CrossRef][Medline].
|
| 44.
|
Spataro, V.,
C. Norbury, and A. L. Harris.
1998.
The ubiquitin-proteasome pathway in cancer.
Br. J. Cancer
77:448-455[Medline].
|
| 45.
|
Stommel, J. M.,
N. D. Marchenko,
G. S. Jimenez,
U. M. Moll,
T. J. Hope, and G. M. Wahl.
1999.
A leucine-rich nuclear export signal in the p53 tetramerization domain: regulation of subcellular localization and p53 activity by NES masking.
EMBO J.
18:1660-1672[CrossRef][Medline].
|
| 46.
|
Stott, F. J.,
S. Bates,
M. C. James,
B. B. McConnell,
M. Starborg,
S. Brookes,
I. Palmero,
K. Ryan,
E. Hara,
K. H. Vousden, and G. Peters.
1998.
The alternative product from the human CDKN2A locus, p14(ARF), participates in a regulatory feedback loop with p53 and MDM2.
EMBO J.
17:5001-5014[CrossRef][Medline].
|
| 47.
|
Talis, A. L.,
J. M. Huibregtse, and P. M. Howley.
1998.
The role of E6AP in the regulation of p53 protein levels in human papillomavirus (HPV)-positive and HPV-negative cells.
J. Biol. Chem.
273:6439-6445[Abstract/Free Full Text].
|
| 48.
|
Tao, W., and A. J. Levine.
1999.
Nucleocytoplasmic shuttling of oncoprotein Hdm2 is required for Hdm2-mediated degradation of p53.
Proc. Natl. Acad. Sci. USA
96:3077-3080[Abstract/Free Full Text].
|
| 49.
|
Venot, C.,
M. Maratrat,
C. Dureuil,
E. Conseiller,
L. Bracco, and L. Debussche.
1998.
The requirement for the p53 proline-rich functional domain for mediation of apoptosis is correlated with specific PIG3 gene transactivation and with transcriptional repression.
EMBO J.
17:4668-4679[CrossRef][Medline].
|
| 50.
|
Walker, K. K., and A. J. Levine.
1996.
Identification of a novel p53 functional domain that is necessary for efficient growth suppression.
Proc. Natl. Acad. Sci. USA
93:15335-15340[Abstract/Free Full Text].
|
| 51.
|
Waterman, M. J. F.,
J. L. F. Waterman, and T. D. Halazonetis.
1996.
An engineered four-stranded coiled coil substitutes for the tetramerization domain of wild-type p53 and alleviates transdominant inhibition by tumor-derived p53 mutants.
Cancer Res.
56:158-163[Abstract/Free Full Text].
|
| 52.
|
Zhang, Y., and Y. Xiong.
1999.
Mutations in human ARF exon 2 disrupt its nucleolar localization and impair its ability to block nuclear export of MDM2 and p53.
Mol. Cell
3:579-591[CrossRef][Medline].
|
| 53.
|
Zhu, J.,
J. Jiang,
W. Zhou,
K. Zhu, and X. Chen.
1999.
Differential regulation of cellular target genes by p53 devoid of the PXXP motifs with impaired apoptotic activity.
Oncogene
18:2149-2155[CrossRef][Medline].
|
Molecular and Cellular Biology, June 2001, p. 3974-3985, Vol. 21, No. 12
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.12.3974-3985.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lan, M. S., Breslin, M. B.
(2009). Structure, expression, and biological function of INSM1 transcription factor in neuroendocrine differentiation. FASEB J.
23: 2024-2033
[Abstract]
[Full Text]
-
Tsai, W.-W., Nguyen, T. T., Shi, Y., Barton, M. C.
(2008). p53-Targeted LSD1 Functions in Repression of Chromatin Structure and Transcription In Vivo. Mol. Cell. Biol.
28: 5139-5146
[Abstract]
[Full Text]
-
Johnson, T. M., Meade, K., Pathak, N., Marques, M. R., Attardi, L. D.
(2008). Knockin mice expressing a chimeric p53 protein reveal mechanistic differences in how p53 triggers apoptosis and senescence. Proc. Natl. Acad. Sci. USA
105: 1215-1220
[Abstract]
[Full Text]
-
Xu, Y., Harton, J. A., Smith, B. D.
(2008). CIITA Mediates Interferon-{gamma} Repression of Collagen Transcription through Phosphorylation-dependent Interactions with Co-repressor Molecules. J. Biol. Chem.
283: 1243-1256
[Abstract]
[Full Text]
-
Jung, H., Seong, H.-A., Ha, H.
(2007). NM23-H1 Tumor Suppressor and Its Interacting Partner STRAP Activate p53 Function. J. Biol. Chem.
282: 35293-35307
[Abstract]
[Full Text]
-
Lacroix, M., Toillon, R.-A., Leclercq, G.
(2006). p53 and breast cancer, an update.. Endocr Relat Cancer
13: 293-325
[Abstract]
[Full Text]
-
Hublitz, P., Kunowska, N., Mayer, U. P., Muller, J. M., Heyne, K., Yin, N., Fritzsche, C., Poli, C., Miguet, L., Schupp, I. W., van Grunsven, L. A., Potiers, N., van Dorsselaer, A., Metzger, E., Roemer, K., Schule, R.
(2005). NIR is a novel INHAT repressor that modulates the transcriptional activity of p53. Genes Dev.
19: 2912-2924
[Abstract]
[Full Text]
-
Zhang, Y., Akinmade, D., Hamburger, A. W.
(2005). The ErbB3 binding protein Ebp1 interacts with Sin3A to repress E2F1 and AR-mediated transcription. Nucleic Acids Res
33: 6024-6033
[Abstract]
[Full Text]
-
Cowley, S. M., Iritani, B. M., Mendrysa, S. M., Xu, T., Cheng, P. F., Yada, J., Liggitt, H. D., Eisenman, R. N.
(2005). The mSin3A Chromatin-Modifying Complex Is Essential for Embryogenesis and T-Cell Development. Mol. Cell. Biol.
25: 6990-7004
[Abstract]
[Full Text]
-
Minegishi, N., Suzuki, N., Kawatani, Y., Shimizu, R., Yamamoto, M.
(2005). Rapid turnover of GATA-2 via ubiquitin-proteasome protein degradation pathway. GENES CELLS
10: 693-704
[Abstract]
[Full Text]
-
Dannenberg, J.-H., David, G., Zhong, S., van der Torre, J., Wong, W. H., DePinho, R. A.
(2005). mSin3A corepressor regulates diverse transcriptional networks governing normal and neoplastic growth and survival. Genes Dev.
19: 1581-1595
[Abstract]
[Full Text]
-
Nguyen, T. T., Cho, K., Stratton, S. A., Barton, M. C.
(2005). Transcription Factor Interactions and Chromatin Modifications Associated with p53-Mediated, Developmental Repression of the Alpha-Fetoprotein Gene. Mol. Cell. Biol.
25: 2147-2157
[Abstract]
[Full Text]
-
Harms, K. L., Chen, X.
(2005). The C Terminus of p53 Family Proteins Is a Cell Fate Determinant. Mol. Cell. Biol.
25: 2014-2030
[Abstract]
[Full Text]
-
Esteve, P.-O., Chin, H. G., Pradhan, S.
(2005). Human maintenance DNA (cytosine-5)-methyltransferase and p53 modulate expression of p53-repressed promoters. Proc. Natl. Acad. Sci. USA
102: 1000-1005
[Abstract]
[Full Text]
-
Stasinopoulos, I. A., Mironchik, Y., Raman, A., Wildes, F., Winnard, P. Jr., Raman, V.
(2005). HOXA5-Twist Interaction Alters p53 Homeostasis in Breast Cancer Cells. J. Biol. Chem.
280: 2294-2299
[Abstract]
[Full Text]
-
Shats, I., Milyavsky, M., Tang, X., Stambolsky, P., Erez, N., Brosh, R., Kogan, I., Braunstein, I., Tzukerman, M., Ginsberg, D., Rotter, V.
(2004). p53-dependent Down-regulation of Telomerase Is Mediated by p21waf1. J. Biol. Chem.
279: 50976-50985
[Abstract]
[Full Text]
-
Lin, Z., Yin, Q., Flemington, E.
(2004). Identification of a Negative Regulatory Element in the Epstein-Barr Virus Zta Transactivation Domain That Is Regulated by the Cell Cycle Control Factors c-Myc and E2F1. J. Virol.
78: 11962-11971
[Abstract]
[Full Text]
-
Scian, M. J., Stagliano, K. E. R., Ellis, M. A., Hassan, S., Bowman, M., Miles, M. F., Deb, S. P., Deb, S.
(2004). Modulation of Gene Expression by Tumor-Derived p53 Mutants. Cancer Res.
64: 7447-7454
[Abstract]
[Full Text]
-
Godefroy, N., Bouleau, S., Gruel, G., Renaud, F., Rincheval, V., Mignotte, B., Tronik-Le Roux, D., Vayssiere, J.-L.
(2004). Transcriptional repression by p53 promotes a Bcl-2-insensitive and mitochondria-independent pathway of apoptosis. Nucleic Acids Res
32: 4480-4490
[Abstract]
[Full Text]
-
Hemann, M. T., Zilfou, J. T., Zhao, Z., Burgess, D. J., Hannon, G. J., Lowe, S. W.
(2004). Suppression of tumorigenesis by the p53 target PUMA. Proc. Natl. Acad. Sci. USA
101: 9333-9338
[Abstract]
[Full Text]
-
Imai, Y., Kurokawa, M., Yamaguchi, Y., Izutsu, K., Nitta, E., Mitani, K., Satake, M., Noda, T., Ito, Y., Hirai, H.
(2004). The Corepressor mSin3A Regulates Phosphorylation-Induced Activation, Intranuclear Location, and Stability of AML1. Mol. Cell. Biol.
24: 1033-1043
[Abstract]
[Full Text]
-
Moraitis, A. N., Giguere, V.
(2003). The Co-repressor Hairless Protects ROR{alpha} Orphan Nuclear Receptor from Proteasome-mediated Degradation. J. Biol. Chem.
278: 52511-52518
[Abstract]
[Full Text]
-
Dornan, D., Shimizu, H., Burch, L., Smith, A. J., Hupp, T. R.
(2003). The Proline Repeat Domain of p53 Binds Directly to the Transcriptional Coactivator p300 and Allosterically Controls DNA-Dependent Acetylation of p53. Mol. Cell. Biol.
23: 8846-8861
[Abstract]
[Full Text]
-
Esfandiari, F., Green, R., Cotterman, R. F., Pogribny, I. P., James, S. J., Miller, J. W.
(2003). Methyl deficiency causes reduction of the methyl-CpG-binding protein, MeCP2, in rat liver. Carcinogenesis
24: 1935-1940
[Abstract]
[Full Text]
-
Chun, A. C. S., Jin, D.-Y.
(2003). Transcriptional Regulation of Mitotic Checkpoint Gene MAD1 by p53. J. Biol. Chem.
278: 37439-37450
[Abstract]
[Full Text]
-
Lohr, K., Moritz, C., Contente, A., Dobbelstein, M.
(2003). p21/CDKN1A Mediates Negative Regulation of Transcription by p53. J. Biol. Chem.
278: 32507-32516
[Abstract]
[Full Text]
-
Childs, K. S., Goodbourn, S.
(2003). Identification of novel co-repressor molecules for Interferon Regulatory Factor-2. Nucleic Acids Res
31: 3016-3026
[Abstract]
[Full Text]
-
Hammond, E. M., Dorie, M. J., Giaccia, A. J.
(2003). ATR/ATM Targets Are Phosphorylated by ATR in Response to Hypoxia and ATM in Response to Reoxygenation. J. Biol. Chem.
278: 12207-12213
[Abstract]
[Full Text]
-
Dearth, L. R., DeWille, J.
(2003). Posttranscriptional and Posttranslational Regulation of C/EBPdelta in G0 Growth-arrested Mammary Epithelial Cells. J. Biol. Chem.
278: 11246-11255
[Abstract]
[Full Text]
-
Xie, A.-Y., Folk, W. R.
(2002). Inhibition of Polyomavirus ori-Dependent DNA Replication by mSin3B. J. Virol.
76: 11809-11818
[Abstract]
[Full Text]
-
Wadhwa, R., Sugihara, T., Hasan, Md. K., Taira, K., Reddel, R. R., Kaul, S. C.
(2002). A Major Functional Difference between the Mouse and Human ARF Tumor Suppressor Proteins. J. Biol. Chem.
277: 36665-36670
[Abstract]
[Full Text]
-
Leung, K. M., Po, L. S., Tsang, F. C., Siu, W. Y., Lau, A., Ho, H. T. B., Poon, R. Y. C.
(2002). The Candidate Tumor Suppressor ING1b Can Stabilize p53 by Disrupting the Regulation of p53 by MDM2. Cancer Res.
62: 4890-4893
[Abstract]
[Full Text]
-
Pile, L. A., Schlag, E. M., Wassarman, D. A.
(2002). The SIN3/RPD3 Deacetylase Complex Is Essential for G2 Phase Cell Cycle Progression and Regulation of SMRTER Corepressor Levels. Mol. Cell. Biol.
22: 4965-4976
[Abstract]
[Full Text]
-
Bergametti, F., Sitterlin, D., Transy, C.
(2002). Turnover of Hepatitis B Virus X Protein Is Regulated by Damaged DNA-Binding Complex. J. Virol.
76: 6495-6501
[Abstract]
[Full Text]
-
Maeda, Y., Seidel, S. D., Wei, G., Liu, X., Sladek, F. M.
(2002). Repression of Hepatocyte Nuclear Factor 4{alpha} by Tumor Suppressor p53: Involvement of the Ligand-Binding Domain and Histone Deacetylase Activity. Mol. Endocrinol.
16: 402-410
[Abstract]
[Full Text]
-
Ogden, S. K., Lee, K. C., Wernke-Dollries, K., Stratton, S. A., Aronow, B., Barton, M. C.
(2001). p53 Targets Chromatin Structure Alteration to Repress alpha -Fetoprotein Gene Expression. J. Biol. Chem.
276: 42057-42062
[Abstract]
[Full Text]
-
Hoffman, W. H., Biade, S., Zilfou, J. T., Chen, J., Murphy, M.
(2002). Transcriptional Repression of the Anti-apoptotic survivin Gene by Wild Type p53. J. Biol. Chem.
277: 3247-3257
[Abstract]
[Full Text]