Previous Article | Next Article 
Molecular and Cellular Biology, July 2001, p. 4097-4109, Vol. 21, No. 13
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.13.4097-4109.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Eukaryotic Initiation Factor 4G-Poly(A) Binding Protein
Interaction Is Required for Poly(A) Tail-Mediated Stimulation of
Picornavirus Internal Ribosome Entry Segment-Driven Translation but Not
for X-Mediated Stimulation of Hepatitis C Virus
Translation
Yanne M.
Michel,
Andrew M.
Borman,
Sylvie
Paulous, and
Katherine M.
Kean*
U.P. Régulation de la Traduction
Eucaryote et Virale, CNRS URA 1966, Institut Pasteur, 75724 Paris
Cedex 15, France
Received 8 November 2000/Returned for modification 20 December
2000/Accepted 4 April 2001
 |
ABSTRACT |
Efficient translation of most eukaryotic mRNAs results from
synergistic cooperation between the 5' m7GpppN cap and the
3' poly(A) tail. In contrast to such mRNAs, the polyadenylated genomic
RNAs of picornaviruses are not capped, and translation is initiated
internally, driven by an extensive sequence termed IRES (for internal
ribosome entry segment). Here we have used our recently described
poly(A)-dependent rabbit reticulocyte lysate cell-free translation
system to study the role of mRNA polyadenylation in IRES-driven
translation. Polyadenylation significantly stimulated translation
driven by representatives of each of the three types of picornaviral
IRES (poliovirus, encephalomyocarditis virus, and hepatitis A virus,
respectively). This did not result from a poly(A)-dependent alteration
of mRNA stability in our in vitro translation system but was very
sensitive to salt concentration. Disruption of the eukaryotic
initiation factor 4G-poly(A) binding protein (eIF4G-PABP) interaction
or cleavage of eIF4G abolished or severely reduced poly(A)
tail-mediated stimulation of picornavirus IRES-driven translation. In
contrast, translation driven by the flaviviral hepatitis C virus (HCV)
IRES was not stimulated by polyadenylation but rather by the authentic
viral RNA 3' end: the highly structured X region. X region-mediated
stimulation of HCV IRES activity was not affected by disruption of the
eIF4G-PABP interaction. These data demonstrate that the protein-protein
interactions required for synergistic cooperativity on capped and
polyadenylated cellular mRNAs mediate 3'-end stimulation of
picornaviral IRES activity but not HCV IRES activity. Their
implications for the picornavirus infectious cycle and for the
increasing number of identified cellular IRES-carrying mRNAs are discussed.
 |
INTRODUCTION |
The initiation of protein synthesis on most mRNAs
in eukaryotes follows binding of the 40S ribosomal subunit near the
capped 5' end of the mRNA and subsequent migration of this subunit
along the mRNA in a 5'-to-3' direction until a suitable initiation
codon is selected (for a review, see reference 29).
Recognition of the mRNA 5' end and 40S subunit recruitment requires the
eukaryotic initiation factor (eIF) 4F complex (for reviews, see
references 35 and 43). The eIF4F complex comprises the cap
binding protein (eIF4E) and an ATP-dependent RNA helicase (eIF4A)
bound, respectively, toward the N and C termini of a scaffold protein,
eIF4G (for a review, see references 14 and 35). The
C-terminal half of eIF4G is also thought to associate with the
multisubunit eIF3 complex, which binds the 40S ribosomal subunit
directly thus bridging the gap between the mRNA 5' end and the 40S
subunit (reviewed in reference 17).
The vast majority of eukaryotic mRNAs are not only capped at their 5'
end but are also polyadenylated at their 3' end. Aside from a role in
mRNA metabolism (see reference 45 for a review), the
poly(A) tail functions as a translational enhancer and interacts synergistically with the 5' cap to stimulate translation initiation (12, 23, 42, 43). This cooperativity between the cap and poly(A) requires the poly(A) binding protein (PABP) (48).
PABP has been shown to bind the N-terminal part of eIF4G in mammals (19, 41), plants (31), and yeast
(49), leading to the suggestion that efficiently
translated mRNAs are circularized via a cap-eIF4E-eIF4G-PABP-poly(A)
tail interaction (the closed-loop model [23]). Indeed,
capped and polyadenylated mRNAs can be circularized in vitro using
purified yeast eIF4E, eIF4G, and PABP (51). Moreover, at
least in mammalian systems, the integrity of the eIF4G-PABP interaction
is critical for cap-poly(A) cooperativity (34), and this
interaction results in an increased functional affinity of eIF4E for
the capped mRNA 5' end (8).
The animal picornaviruses bear witness to an alternative mode of
translation initiation. Their uncapped, polyadenylated genomes which
serve as mRNAs contain an extensive (ca. 450 nucleotides [nt]),
heavily structured sequence within the 5' noncoding region, known as
the IRES (for internal ribosome entry segment). This allows direct
internal entry of ribosomes some several hundred nucleotides from the
RNA 5' end (for a review, see reference 22). Thus,
translation of the picornaviral RNAs is both cap and 5'-end independent. A similar mechanism of translation initiation has been
described for the flavivirus, hepatitis C virus (HCV), whose uncapped
and nonpolyadenylated, positive-strand RNA genome also carries an IRES
(20, 38; for a review, see reference 22). In
fact, IRESes have now been identified in many cellular mRNAs (for a
review, see reference 9), and various lines of evidence suggest that up to or even more than 10% of cellular mRNAs may be
translated by internal initiation. Hence, the question of how cap- and
5'-end-independent translation can be encompassed in a closed-loop
translation model is extremely pertinent.
In effect, it has been postulated that picornaviral RNAs and HCV RNA
would be difficult to accommodate within the form of the closed-loop
translation model proposed for classical cellular mRNAs (for a review,
see reference 26). Aside from the different natures of the
3' and/or 5' ends of these viral mRNAs compared to the majority of
cellular mRNAs, one must take into consideration the known factor
requirements for viral IRES-driven translation initiation. Most
picornavirus genomes encode proteinases which cleave components of the
eIF4F complex. Thus, the entero-and rhinoviral 2A proteinases and the
aphthoviral L proteinase cleave eIF4G (28, 32) to separate
the N-terminal eIF4E- and PABP-binding domains from the C-terminal
eIF3- and eIF4A-binding regions (30). Furthermore, the
entero- and rhinovirus 3C and/or 2A proteinases were recently demonstrated to induce cleavage of PABP both in vitro and in the infected cell (25, 27; A. M. Borman, Y. M. Michel, and K. M. Kean submitted for publication). These cleavage
events account, at least in part, for the dramatic shutoff of host cell
translation observed during infection with all picornaviruses, except
for hepatitis A virus (HAV). With the exception of the HAV IRES, which requires intact eIF4G for activity (5), picornaviral
IRES-driven translation continues unabated upon eIF4G cleavage
(2). Effectively, entero-, rhino-, cardio-, and
aphthoviral IRES activity requires only the C-terminal cleavage product
of eIF4G and its associated proteins, which do not include eIF4E or
PABP (6, 33, 36). Indeed, the C-terminal cleavage product
of eIF4G or a recombinant fragment spanning part of this cleavage
product has been shown to interact directly with these IRESes
(33, 39; Borman et al. submitted) and can substitute for
intact eIF4G in 48S initiation complex formation on the
encephalomyocarditis virus (EMCV) IRES (37). HCV
represents an even more extreme case, since eIF4F is not needed at all
for the binding of ribosomal subunits to this IRES (38).
Nevertheless, it seems clear that the efficiency of picornavirus
IRES-driven translation is dependent on the nature of the 3' end of the
mRNA. Even though the poly(A) tails of picornaviral RNAs are
heterogeneous in length, good evidence exists that
poly(A)
picornavirus genomes have a considerably reduced
infectivity (15, 44, 46). Although this reduction in
infectivity may partly reflect a role of the poly(A) tail in viral RNA
synthesis, it has long been known that translation of EMCV genomic RNA
is moderately increased in vitro as the length of the poly(A) tail is
increased (18). Using artificial reporter RNAs, we
recently showed that translation from the EMCV IRES is indeed
stimulated approximately threefold upon polyadenylation of the mRNA in
appropriate in vitro systems (34). Furthermore, it has
since been reported that such poly(A) tail-mediated stimulation of
translation is also exhibited by the other two classes of picornaviral
IRESes (1). Similarly, translation driven by the
flaviviral HCV IRES is significantly increased on mRNAs which carry the
authentic viral 3' end (20), which in this case is not a
poly(A) tail but a conserved three-stem-loop structure which binds
polypyrimidine tract-binding protein (50).
To date, no study has been undertaken which attempts to address the
underlying molecular mechanisms of 3'-end stimulation of IRES-driven
translation, other than our reported results restricted to the EMCV
IRES (34). In the light of the data outlined above, and of
the role of the eIF4G-PABP interaction in synergistically stimulating
capped and polyadenylated cellular mRNA translation, the aim of the
current work was to evaluate the factors required for mRNA
3'-end-mediated stimulation of IRES-driven translation. Using our
recently described poly(A)-dependent rabbit reticulocyte lysate
extracts (34), we confirm that polyadenylation
significantly stimulates translation driven by the picornaviral HAV,
EMCV, and poliovirus (PV) IRESes but not that driven from the unrelated flaviviral HCV IRES.
Of more novel import, we show that poly(A)-mediated stimulation of
picornaviral IRES activity requires the integrity of the eIF4G-PABP
interaction, indicating that mRNA 5'-3' cross talk is mechanistically
conserved between classical eukaryotic mRNAs and picornaviral
IRES-carrying RNAs. Furthermore, we present data indicative of
jettisoning of 5' to 3'-end cross talk in the case of PV IRES-carrying
RNAs upon shutoff of host cell translation. Finally, we show that the
mechanism of HCV IRES translation stimulation mediated by the cognate
viral 3' end is distinct from that of classical eukaryotic mRNAs.
 |
MATERIALS AND METHODS |
Plasmid constructions and in vitro transcriptions.
The
plasmids used in this work are represented schematically in Fig.
1. Plasmids were derived from the previously described p0p24 (34), which contains, under the control of the T7
promoter, a short oligonucleotide-derived 5' untranslated region (UTR), followed by the region coding for the human immunodeficiency virus (HIV-1Lai) p24 protein and the influenza virus NS 3' UTR.
Two versions of this plasmid differ only in the presence or absence of
an A50 tract inserted at the unique EcoRI site,
located 24 nt downstream of the authentic polyadenylation signal.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic representation of the plasmids used in this
work. The HIV-1p24 coding region and the regions corresponding to the
different IRESes are shown as open boxes. Numbers below the coding
region refer to the first and last amino acids of HIV-1p24, and
numbering below the IRESes denotes the first and last nucleotides of
the corresponding viral genome sequences. The ATG codon initiating
HIV-1p24 synthesis is shown in boldface and is underlined; the TGA stop
codon is shown in boldface. The NS 3' UTR is depicted as a thick
speckled line. Clones were constructed either in duplicate, differing
only by the presence or absence of an A50 insertion
(bracketed) at the EcoRI site used for linearization prior
to transcription, or in triplicate (p0p24 and pHCVp24) including,
instead of the A50 oligonucleotide, 98 nt corresponding to
the 3' X region from the HCV genome (bracketed).
|
|
All IRES-containing constructs were obtained by inserting the region
corresponding to each entire IRES into the poly(A)
+ and
poly(A)

forms of p0p24. pPVp24 was obtained by inserting
the PV IRES,
namely, the in-filled
Asp718-
MscI
fragment (nt 67 to 630) from
pKK-C2 (
3), into the
in-filled
SalI site of p0p24. pEMCVp24
was constructed by
inserting the EMCV IRES (from the polyC tract
to nt 848, i.e., the
in-filled
EcoRI-
NcoI small fragment from
p-CITE;
Novagen) into the in-filled
BamHI site of p0p24. pHAVp24
resulted from the insertion of the in-filled
NcoI-
AflII fragment
(nt 44 to 738) of the
full-length cDNA clone of HAV (p16HM175
[
24]) into the
in-filled
BamHI site of p0p24. pHCVp24 was generated
by
inserting the
SalI-
BamHI short fragment from the
bicistronic
pXLJ-HCV construct (
2), which includes nt 40 to 372 of the
HCV genome, into p0p24 which had been digested with the
same enzymes.
Thus, each plasmid was constructed in such a way that the
minimal
sequences required for efficient IRES activity were
maintained.
Plasmids containing the 3' UTR X region from the HCV were derived from
the poly(A)

p0p24 or pHCVp24 plasmids by inserting
annealed
5'-AATTGGTGGC
TCCATCT TAGCCC TAG TCACGGC TAGC TG TGAAAGG TCCG TGAGCCGCATGAC
TGCAGAGAGTGC TGATAC TGGCC TC TC TGCAGTCATGTG-3'
and
5'-AAT TCACATGACTGCAGAGAGGCCAGTATCAGCACTC
TC TGCAG TCATGCGGC TCACGGACC T T TCACAGC TAGCCG TGAC TAGGGCTAAGATGGAGCCACC-3'
oligonucleotides into the unique
EcoRI site at the 3'
end of the
NS 3' UTR. All constructs were verified by
sequencing.
In vitro transcriptions, performed on plasmids linearised by
EcoRI, and quantification and purification of the
synthesized
transcripts were done exactly as described previously
(
34).
Antibodies and recombinant proteins.
Rabbit anti-eIF4G
peptide 7 antiserum (raised against residues 327 to 342) and monoclonal
antibody 10E10 raised against human PABP have been described previously
(16, 52). Recombinant wild-type human rhinovirus 2A
proteinase, expressed in Escherichia coli and purified to
homogeneity as described previously (32) was a gift from
T. Skern. A recombinant fragment of rotavirus NSP3 protein encompassing
amino acids 163 to 313, overexpressed in E. coli and
purified exactly as described previously (40, 41), was a
gift from D. Poncet. Both 2A proteinase and NSP3 were dialyzed against
H100 buffer (10 mM HEPES-KOH, pH 7.5; 100 mM KCl; 1 mM
MgCl2; 0.1 mM EDTA; 7 mM
-mercaptoethanol) prior to use.
Preparation of translation extracts and in vitro
translations.
Nuclease-treated Flexi-rabbit reticulocyte lysates
(Promega) were partially depleted of ribosomes by ultracentrifugation
in a Beckman TL-100 benchtop ultracentrifuge as described previously (8, 34). Translation reactions (12 µl, final volume)
containing 50% by volume RRL or ribosome-depleted RRL and 33% by
volume H100 buffer were programmed with the indicated concentrations of
in vitro-transcribed mRNAs. For pPVp24-derived mRNAs, reactions
contained HeLa cell S10 extract (to 2.5% [vol/vol]) prepared as
described earlier (3). Reactions which included
recombinant proteins were preincubated with the indicated
concentrations of 2A proteinase or NSP3 (each diluted in H100 buffer)
for 10 min at 30°C (for 2A) or 4°C (for NSP3) before the addition
of RNA. The final concentrations of added KCl and MgCl2 in
translation reactions were 130 and 0.9 mM, respectively, for p0p24 and
were varied according to the IRES-containing mRNAs used as indicated.
Translations were performed at 30°C (typically for 90 min) in the
presence of [35S]methionine. In certain experiments, RNAs
labeled with trace quantities of 32P were extracted from
translation reactions prior to retranslation in fresh extracts.
Briefly, at the appropriate times, translation reactions were placed on
ice and made 5 mM in EDTA. After 5 min at 4°C, reactions received 10 volumes of extraction buffer (200 mM NaCl; 10 mM Tris-HCl, pH 9; 1 mM
EDTA; 1% sodium dodecyl sulfate [SDS]) and were extracted twice with
phenol and chloroform. Nonaqueous phases were back extracted with
extraction buffer, extracted RNA was precipitated by ethanol, and the
RNA pellet was washed with 70% ethanol. Extracted RNA was quantified
by scintillation counting prior to retranslation.
Translation products were analyzed by SDS-polyacrylamide gel
electrophoresis as described previously (
11), using gels
containing
20% (wt/vol) polyacrylamide. Dried gels were exposed to
Bio-max
MR film (Kodak) for 1 to 15 days, depending on the experiments.
Densitometric quantification of translation products was performed
exactly as described previously (
5), using multiple
exposures
of each gel to ensure that the linear response range of the
film
was respected. The data presented in each figure are
representative
of at least three independent translation
assays.
Western blotting analysis.
Western blot analysis of eIF4G or
PABP was performed exactly as described previously (6)
using rabbit anti-eIF4G peptide 7 antisera (for detection of the
N-terminal cleavage product of eIF4G) or monoclonal antibody 10E10 (for
PABP) as primary antibodies. Membranes were then incubated with
horseradish peroxidase-linked goat anti-mouse or anti-rabbit secondary
antibodies and were revealed by enhanced chemiluminescence (ECLplus;
Amersham) or the commercial DAB peroxidase substrate kit (Vector
Laboratories, Inc.).
 |
RESULTS |
Efficient translation of classical cellular mRNAs requires
cooperative interplay between the 5' cap structure and 3' poly(A) tail
[cap-poly(A) synergy (12, 23, 42, 48)]. We recently described a nuclease-treated, ribosome-depleted rabbit reticulocyte lysate (RRL) cell-free translation system which recapitulates cap-poly(A) synergistic stimulation of cellular mRNA translation in
vitro (34). Polyadenylation stimulated translation driven by the one IRES tested in this system, that of the picornavirus EMCV
(34). Thus, the aims of the current study were to confirm that polyadenylation stimulates translation driven by all picornaviral IRESes in our ribosome-depleted RRL system and, more importantly, to
investigate the molecular mechanisms involved. The flaviviral HCV IRES
was also studied, since this viral RNA is nonpolyadenylated and the
viral 3' X region has previously been reported to stimulate HCV IRES
activity in vitro (20). Toward this end, different cDNAs
were constructed which could be used to generate monocistronic mRNAs in
which representatives of the three major classes of picornaviral IRESes
precede an identical reporter gene (HIV-1 p24) and 3'-UTR (Fig. 1). Two
different cDNA templates were generated for each IRES, which differed
only by the presence or absence of an A50 tract inserted at
the restriction site used for linearization prior to in vitro
transcription. A series of similar cDNAs was also constructed to carry
the HCV IRES but including a construction with the viral 3' X region,
which has previously been reported to stimulate HCV IRES activity in
vitro (20).
While the type II cardio- and aphthoviral IRESes and the type III HAV
IRES are functional in an unadulterated RRL system, the type I entero-
and rhinoviral IRESes are virtually inactive in RRL which has not been
supplemented with cytoplasmic extracts from permissive cells such as
HeLa cells (2, 4). Thus, we first verified that a
ribosome-depleted RRL supplemented with a nucleased HeLa cell S10
extract still exhibited cap-poly(A) cooperative stimulation of cellular
mRNA translation. Translation of monocistronic p0p24-derived cellular
mRNAs in standard RRL is strongly stimulated by capping and modestly
stimulated by polyadenylation, and the combined effects of cap and
poly(A) are at best additive (Fig. 2, RRL lanes
[34]). However, when the same RNAs are translated in
ribosome-depleted RRL, the stimulation observed upon capping and
polyadenylation of an mRNA is much greater than the sum of the effects
of cap and poly(A) alone (Fig. 2, ribosome-depleted RRL + H100
lanes, cap-poly(A) synergy of 4.5-fold). Importantly, cap-poly(A)
synergy, although quantitatively reduced, is still observed in
ribosome-depleted RRL supplemented with low concentrations of
nuclease-treated HeLa cell S10 extract (Fig. 2, ribosome-depleted RRL + 2.5% S10 lanes), indicating that the potential effects of polyadenylation on entero- and rhinoviral IRES-driven translation can
be examined in this system.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 2.
Cap-poly(A) synergistic stimulation of cellular mRNA
translation in ribosome-depleted RRL. Translation reactions containing
standard RRL or ribosome-depleted RRL (see Materials and Methods) were
programmed with 6.3 µg of p0p24 derived mRNAs per ml transcribed in
the form indicated above each lane and contained 33% by volume of H100
buffer or 30.5% H100 and 2.5% nuclease-treated HeLa cell S10 extract
in H100 buffer as indicated. A control reaction was programmed with
water (0 RNA lane). The autoradiograph of the dried 20% polyacrylamide
gel is shown. The position of the p24 protein is indicated. The
translation efficiency was determined densitometrically as described in
Materials and Methods and is plotted below each lane (in arbitrary
units). Cap-poly(A) synergy is indicated below the panel where
appropriate and was calculated according to the following formula:
stimulation upon capping and polyadenylation/(stimulation upon
capping + stimulation upon polyadenylation). The autoradiographs
of reactions performed in ribosome-depleted RRL were exposed 12 times
longer than those performed in standard RRL; hence, the broken
x axis in the histogram. The error bars represent the
standard deviation calculated from at least two independent
experiments.
|
|
The poly(A) tail stimulates translation driven by picornaviral, but
not a flaviviral, IRESes in ribosome-depleted RRL.
Picornaviral
RNAs are naturally uncapped. Thus, to examine the possible role of
poly(A) in IRES-driven translation initiation, only two different forms
of the various IRES-p24 monocistronic mRNAs, which carry or lack a
3'-terminal homopolymer A50 tail, were generated in vitro
(see Fig. 1 and Materials and Methods). These different mRNAs were then
translated in ribosome-depleted RRL (for the type II EMCV and type III
HAV IRESes and the flaviviral HCV IRES) or in ribosome-depleted RRL
containing 2.5% by volume of nucleased HeLa cell S10 extract (for the
type I PV IRES). This concentration of S10 extract had previously been
determined to be the minimal supplement necessary to activate the PV
IRES in depleted RRL (data not shown). Given that cap-poly(A) synergy on classical mRNAs in the depleted system is extremely sensitive to the
concentrations of added KCl and MgCl2 (8), the
various polyadenylated and nonpolyadenylated IRES-containing
mRNAs were translated at a range of final salt concentrations
(Fig. 3).

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 3.
Effects of polyadenylation on IRES-driven translation
initiation in ribosome-depleted RRL. Ribosome-depleted RRL was
programmed with poly(A) or poly(A)+ uncapped
IRES-containing mRNAs (final concentration, 10 µg/ml). Translation
reactions contained 0.9 mM added MgCl2 (or 0.5 mM for
HAVp24) and various concentrations of added KCl (from 72 to 130 mM;
left panels) or 130 mM (EMCVp24 and HCVp24), 119 mM (PVp24), or 72 mM
(HAVp24) added KCl and varyious concentrations of added
MgCl2 (0.3 to 1.3 mM; right panels). Reactions programmed
with PVp24 contained 2.5% (vol/vol) nuclease-treated HeLa cell S10
extract. Translation products were analyzed as described in the legend
to Fig. 2. Translation efficiencies of the different RNAs [filled
circles for poly(A) and open squares for
poly(A)+ mRNAs] as a function of salt concentration were
used to calculate the stimulations upon polyadenylation [ratio of
poly(A)+ to poly(A) translation efficiency].
For EMCVp24 and HAVp24, the translation efficiencies are plotted, and
poly(A) stimulation is calculated only for reactions where translation
products were easily detectable. The error bars represent the standard
deviation calculated from at least two independent experiments.
|
|
The three different picornavirus IRESes exhibited significantly
different KCl and MgCl
2 optima for translation, as has
previously
been reported in the standard RRL system (
2).
More interestingly,
translation driven by the PV, HAV, and EMCV IRESes
was reproducibly
stimulated upon polyadenylation in a salt-sensitive
manner. The
greatest poly(A)-mediated stimulation was observed with the
HAV
IRES, which also exhibited the lowest KCl and MgCl
2
optima for
translation (Fig.
3C). As the concentration of either KCl or
MgCl
2 was increased, the magnitude of the poly(A) effect on
the HAV
IRES significantly increased, from ca. 3-fold at the lowest KCl
and MgCl
2 concentrations tested to exceed 10-fold at the
highest
salt concentrations in which translation activity could be
easily
measured (14-fold stimulation at 108 mM added KCl; 12-fold
stimulation
at 0.9 mM added MgCl
2; Fig.
3C). The salt
optima for PV IRES-driven
translation were significantly higher than
those of the HAV IRES.
Poly(A)-mediated stimulation of PV IRES activity
increased significantly
as the KCl and MgCl
2 concentrations
were increased, in a similar
manner to that observed with the HAV IRES,
but was reproducibly
quantitatively lower than for the HAV counterpart
(ca. sevenfold
stimulation with 115 to 120 mM KCl and fourfold
stimulation with
1.1 mM MgCl
2; Fig.
3A). It remains to be
determined whether this
reflects a real reduction in poly(A) dependency
of the PV IRES
compared to its HAV counterpart or rather stems from the
inclusion
of HeLa cell S10 extract in the depleted RRL reactions
programmed
with PVp24 RNAs. The EMCV IRES was also significantly
stimulated
by polyadenylation (stimulation of ca. two- to threefold;
Fig.
3B), although in this case the stimulatory effect of poly(A) was
relatively insensitive to altering the concentrations of
MgCl
2.
Thus, globally picornavirus IRES-driven translation
was most stimulated
by polyadenylation as the concentrations of KCl or
MgCl
2 approached
physiological levels. In addition, in a
manner analogous to that
reported recently for cap-poly(A) synergy in
the ribosome-depleted
RRL system, poly(A) stimulation was maximal at
salt concentrations
in excess of those optimal for translation driven
by the PV or
HAV IRESes. This apparent paradox reflects the fact that
translation
of nonpolyadenylated mRNAs carrying these IRESes was
extremely
inefficient in elevated concentrations of KCl or
MgCl
2. Interestingly,
the magnitude of the poly(A) effects
on picornavirus IRES activity
was not greatly affected by altering the
concentrations of programming
mRNA (data not shown), in contrast to
cap-poly(A) synergy on cellular
mRNAs in the depleted RRL system which
is only observed at low
RNA concentrations (
8,
34).
The HCVp24 mRNAs were included in this assay as a negative control
against nonspecific effects of polyadenylation on IRES-driven
translation, since HCV genomic RNA is not polyadenylated but instead
carries a conserved pyrimidine-rich X region at its 3' end (
20,
50). Not surprisingly, no significant stimulation of HCVp24
RNA
translation was observed upon polyadenylation at any of the
salt
concentrations tested (Fig.
3D). As a further test against
nonspecificity of the poly(A) effects on picornaviral IRES-driven
translation, the various IRESp24 RNAs were also translated in
standard
RRL at the concentrations of added KCl or MgCl
2 which
allowed significant poly(A) stimulation for each IRES in the depleted
system (Table
1). With the exception of the HAV IRES, no
significant
stimulation of IRES-driven translation could be evidenced
in the
standard RRL system, indicating that poly(A) is important for
picornavirus IRES-driven translation specifically in conditions
under
which cap-poly(A) synergy is observed on classical cellular
mRNAs (Fig.
2; see also references
8 and
34).
We next determined whether polyadenylation was significantly altering
the stability of the different IRES-containing mRNAs
in the depleted
system. Thus, the kinetics of protein synthesis
on the
poly(A)
+ and poly(A)

derivatives of a given
IRES-p24 mRNA were evaluated in depleted
RRL, in order to measure the
functional stability of the different
mRNAs (i.e., the stability of the
actively translated fraction
of programming mRNA). Figure
4A depicts the results of such an
experiment with mRNAs
carrying the HAV IRES, which in conditions
of optimal salt was the most
stimulated of the picornaviral elements
upon polyadenylation. The
kinetics of protein synthesis were linear
for both the
poly(A)

and poly(A)
+ forms of HAVp24 from 25 to 90 min of incubation. Similarly, the
kinetics of protein synthesis
were linear for both forms of mRNAs
carrying the EMCV and PV IRESes
(data not shown), indicating that
the observed positive effects of
poly(A) on translation did not
stem from significant differences in
mRNA functional stability.
However, in the case of poly(A)
+
HAV RNA translation, a lag was observed in the appearance of
translation products (Fig.
4A). Thus, it could conceivably be
argued
that this RNA was in some way processed before translation
could begin.
To examine this possibility, poly(A)
+ HAVp24 RNA
reextracted from translation reactions after different
times of
incubation, was used to program fresh translation reactions.
RNA
extracted after 0 and 60 min of incubation showed identical
translation
kinetics (Fig.
4B), with a similar delay in the appearance
of
translation products to that observed in the original experiment
(compare Fig.
4A and B), suggesting that poly(A)
+ HAV RNA
had not been irreversibly processed after 60 min of translation
in
ribosome-depleted RRL. While we have no concrete explanation
for this
apparent lag, it is possible that the observed delay
represents the
time required to assemble initiation complexes
on the particularly
inefficient HAV IRES. Interestingly, a similar
phenomenon has recently
been reported for translation driven by
the HAV IRES in synergistic
HeLa cell extracts (
1).

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 4.
Time course of protein synthesis from the
pHAVp24-derived mRNAs in ribosome-depleted RRL. (A) Ribosome-depleted
RRL reactions containing, respectively, 72 and 0.5 mM of added KCl and
MgCl2 were programmed with poly(A) (filled
circles) or poly(A)+ (open squares) HAVp24 mRNAs at a
10-µg/ml final RNA concentration. Aliquots were removed at 15-min
intervals from 0 to 90 min, and the translation products were analyzed
as described in the legend to Fig. 2. (B) Polyadenylated HAVp24 mRNA
was extracted from ribosome-depleted RRL translation reactions after 0 min (RNA from t = 0; open squares) and 60 min (RNA from
t = 60; filled squares), as described in Materials and
Methods, and quantified and used to reprogram ribosome-depleted RRL
reactions as described for panel A, except that the final mRNA
concentrations were 7.5 µg/ml. Aliquots were removed at 10-min
intervals from 0 to 50 min, and the translation products were analyzed
as described in the legend to Fig. 2. The error bars represent the
standard deviation calculated from two independent experiments.
|
|
The HCV 3' X region is a nonspecific stimulator of
translation.
Translation of mRNAs carrying the HCV IRES in
depleted RRL was very efficient, irrespective of the poly(A) status and
salt concentrations tested (see Fig. 3D). However, it was recently reported that HCV IRES-driven translation could be stimulated in vitro
by the authentic HCV genomic 3' X region (20, 21). Thus,
additional cDNAs were constructed, based on p0p24 (as a control against
nonspecific effects of X) or carrying the HCV IRES, in which the
poly(A) tail was replaced by the 98-nt X region from HCV genotype 1b
(Fig. 1). These cDNAs were transcribed in vitro in either capped and
uncapped forms (for the p0p24 constructs) or only in an uncapped form
(for pHCVp24 constructs), and the corresponding mRNAs were translated
in the depleted RRL system at a variety of final RNA concentrations and
in physiological salt concentrations (Fig. 5).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 5.
Effect of the HCV 3' X region on translation of capped,
uncapped, or HCV IRES-containing mRNAs in ribosome-depleted RRL.
Translation reactions were programmed with 10, 5, and 2.5 µg of
uncapped pHCVp24-derived mRNAs per ml or 6.3, 3.1, and 1.6 µg of
p0p24-derived mRNAs per ml with or without a cap and 3' X region as
indicated (+ or cap/ or X). The final concentrations of KCl
and MgCl2 were, respectively, 130 and 0.9 mM. Translation
products were analyzed as described in the legend to Fig. 2.
Translation efficiencies and the 3' X stimulation (calculated as
translation efficiency with 3' X divided by translation efficiency
without 3' X) are indicated for each lane in which translation products
were easily detectable. The uncapped 0p24 panel was exposed four times
longer than the HCVp24 and capped 0p24 panels. The error bars represent
the standard deviation calculated from two independent experiments.
|
|
Translation driven by the HCV IRES was stimulated approximately
threefold by the X region
in cis, in agreement with previous
studies in standard RRL (
20). However, the X region in our
system
also significantly stimulated (3- to 4-fold) translation of
uncapped
0p24 control mRNA, and moderately stimulated (1.5- to 3-fold)
capped 0p24 mRNA translation, in contrast to previous reports
which
suggested that X-mediated stimulation was specific to IRES-driven
translation. While we have no definitive explanation for this
discrepancy, it should be noted that the HCV and 0p24 mRNAs tested
here
were translated under identical salt conditions (130 mM KCl
and 0.9 mM
MgCl
2). In contrast, while the IRES-carrying mRNAs
were
translated at 120 mM KCl by Ito et al. (
20), the control
cellular mRNAs were translated at 70 mM added KCl, conditions
in which
even cap dependency was minimal. In our experimental
conditions,
kinetics studies failed to detect any significant
differences in
functional mRNA stability between mRNAs with or
without the X region,
strongly suggesting that the nonspecific
effects of X are not due to
its ability to stabilize mRNAs in
the depleted RRL system (data not
shown). Further studies will
be required to dissect the exact mechanism
of X-mediated translation
stimulation (see
below).
Poly(A)-mediated stimulation of picornaviral IRES-driven
translation is sensitive to the disruption of the eIF4G-PABP
interaction.
We previously demonstrated using the depleted RRL
system that cap-poly(A) synergy on cellular mRNAs requires the
eIF4G-PABP interaction (34). In effect, synergy was
sensitive to the rotavirus NSP3 protein which has been shown to bind
the N-terminal part of eIF4G and to displace PABP from the eIF4F
complex (8, 34, 41). Since picornavirus IRES activity is
clearly influenced by polyadenylation, we examined the effects of the
NSP3 protein on poly(A)-mediated stimulation of translation of the
different IRESp24 mRNAs. Toward this end, ribosome-depleted RRL
translation reactions were preincubated with buffer or 10 µg of
recombinant NSP3 fragment per ml (final concentration) and then
programmed with various IRESp24 or 0p24 mRNAs (Fig. 6A).
We have previously shown that this concentration of NSP3 induces
maximal displacement of PABP from eIF4G when added to RRL (8,
34; data not shown). Indeed, this concentration of recombinant
protein was sufficient to abolish cap-poly(A) synergy on a classical
cellular mRNA in the depleted RRL system and to specifically reduce the
translation efficiency of poly(A)+ 0p24 mRNA to approach
that of its poly(A)
counterpart (Fig. 6B). Conversely,
NSP3 had no effect on the translation efficiency of
poly(A)
or poly(A)+ versions of HCV
IRES-carrying mRNAs and, more interestingly, had no significant
inhibitory effect on the stimulation of HCV IRES-driven translation
afforded by the 3' X region (Fig. 6C). Importantly, NSP3 dramatically
reduced the poly(A)-mediated stimulation of PV, HAV, and EMCV
IRES-driven translation (Fig. 6A). Thus, as is the case for cellular
mRNAs, the eIF4G-PABP interaction is indispensable for the poly(A)
stimulation of picornaviral IRES-driven translation. It should also be
noted that NSP3 reproducibly reduced translation efficiency of the
poly(A)
form of mRNAs carrying the type I PV and
especially the type III HAV IRESes [Fig. 6A, compare 0 and N lanes for
each poly(A)-mRNA]. These effects are unlikely to result from a
nonspecific inhibitory activity of NSP3 on translation, given the
insensitivity of the HCV IRES and EMCVp24 poly(A)
mRNA
translation to this protein. Instead, we believe that this inhibition
reflects the sensitivity of the HAV IRES to the conformation of eIF4F,
which is possibly altered by displacement of PABP and binding of NSP3
(Borman et al., submitted).

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 6.
Poly(A)-mediated stimulation of picornaviral IRES-driven
translation requires the eIF4G-PABP interaction. Ribosome-depleted RRL
was programmed with the indicated forms of the different IRESp24 mRNAs
(A and C; final concentration, 10 µg/ml) or p0p24-derived mRNAs (B;
final concentration, 6.3 µg/ml). Reactions contained salt
concentrations, allowing comparable (three- to fourfold) stimulations
upon polyadenylation of each IRES-p24 mRNA and easy detection of
translation products (130 and 0.9 mM, respectively, of added KCl and
MgCl2 [0p24, EMCVp24, and HCVp24]; 119 mM KCl and 0.7 mM
MgCl2 [PVp24]; 72 mM KCl and 0.5 mM MgCl2
[HAVp24]). Reactions were supplemented with H100 buffer (0 lanes) or
recombinant truncated NSP3 protein (10 µg/ml; N lanes) in H100
buffer. Reactions programmed with PVp24 contained 2.5% (vol/vol)
nuclease-treated HeLa cell S10 extract. Translation products were
analyzed as described in the legend to Fig. 2. The error bars represent
the standard deviation calculated from two or three independent
experiments.
|
|
Effects of NSP3 and 2A on poly(A)-mediated stimulation of
IRES-driven translation.
The fact that the poly(A) mediated
stimulation of type I PV IRES-driven translation requires the integrity
of the eIF4G-PABP interaction raises important questions concerning the
pertinence of poly(A)-mediated stimulation during the polioviral
infectious cycle, since both PABP and eIF4G are cleaved by the PV 2A
proteinase in the infected cell (25, 27). Thus, we
examined the efficiency of IRES-driven translation in ribosome-depleted
RRL which had been preincubated with either the NSP3 protein, the human
rhinovirus 2A proteinase, or both NSP3 and 2A together (Fig.
7). The concentration of 2A proteinase used was
sufficient to cleave all eIF4G in the depleted RRL extract (Fig. 7D,
left panel). In contrast, although this 2A proteinase, like its PV
counterpart, can cleave PABP upon prolonged incubation at 37°C
(Borman et al., submitted) no such cleavage was evidenced under the
conditions of our translation assays (Fig. 7D, right panel).

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 7.
Effects of NSP3 and HRV2 2A proteinase on
poly(A)-mediated stimulation of picornavirus IRES-driven translation.
(A to C) Ribosome-depleted RRL was programmed with 10 µg of the
indicated forms of uncapped IRES-p24 mRNAs per ml and contained salt
concentrations allowing comparable (ca. three- to fourfold)
stimulations upon polyadenylation of each IRES-p24 mRNA and easy
detection of translation products (130 and 0.9 mM, respectively, of
added KCl and MgCl2 [EMCVp24]; 119 mM KCl and 0.7 mM
MgCl2 [PVp24]; 72 mM KCl and 0.5 mM MgCl2
[HAVp24]). Reactions programmed with PVp24 mRNAs also contained 2.5%
(vol/vol) nuclease-treated HeLa cell S10 extract. Reactions were
supplemented with H100 buffer (0 lanes), NSP3 protein (10 µg/ml; N
lanes), rhinovirus 2A proteinase (40 µg/ml; P lanes) each in H100
buffer, or both NSP3 and 2A (10 and 40 µg/ml, respectively; NP
lanes), also in H100 buffer. Translation products were analyzed as
described in the legend to Fig. 2. The error bars represent the
standard deviation calculated from two independent experiments. (D)
Western blot analysis of eIF4G and PABP in 2A proteinase-treated
depleted RRL translation extracts. Depleted RRL translation reactions
were assembled as described in Materials and Methods with H100 buffer
( lanes) or 40 µg of of HRV2 2A proteinase per ml (final
concentration) in H100 buffer (+ lanes), incubated at 30°C for 90 min, and then analyzed by Western blotting using antibodies raised
against the N-terminal part of eIF4G (CpN) or against the
C-terminal extremity of PABP as indicated. The positions of intact
PABP, intact eIF4G, and the N-terminal cleavage product of eIF4G are
indicated.
|
|
Inclusion of 2A proteinase in depleted RRL reactions significantly
stimulated poly(A)

PVp24 mRNA translation [ca. 2.5-fold
stimulation; Fig.
7A, compare
lanes 0 and P, poly(A)

],
as described previously (
2,
6,
53). This stimulation
was
insensitive to inclusion of recombinant NSP3 in the reactions
[compare
lanes 0, P, and NP, poly(A)

]. A similar degree of
stimulation (threefold) was afforded by
polydenylation of the PVp24
mRNA in this particular experiment
in depleted RRL [compare lanes 0 for poly(A)

and poly(A)
+], and this
stimulation was abolished upon treatment with NSP3.
However, the
combination of 2A proteinase in translation reactions
and a poly(A)
tail at the PVp24 mRNA 3' end did not result in
an enhanced translation
efficiency compared to that obtained with
either poly(A) tail or 2A
alone [Fig.
7A, compare lanes P and
0, poly(A)
+, and lane
P, poly(A)

, to lane 0, poly(A)

].
Furthermore, poly(A)
+ PVp24 mRNA translation in the
presence of 2A proteinase was resistant
to NSP3 inhibition [Fig.
7A,
compare lanes NP and N, poly(A)
+], indicating that, upon
cleavage of eIF4G, polyadenylation no
longer conferred an advantage on
PV IRES-driven
translation.
To examine whether this situation was specific to IRESes derived from
viruses that cleave eIF4G, the same approach was carried
out using
EMCVp24 (Fig.
7B) or HAVp24 RNAs (Fig.
7C). For HAVp24
RNA, it could
clearly be seen that cleavage of eIF4G inhibited
rather than stimulated
translation (Fig.
7C, compare lanes 0 and
P) and that indeed the
stimulation observed upon polyadenylation
was abrogated by protease
treatment of extracts [compare lanes
0 and P, poly(A)
+,
with lane 0, poly(A)

; Fig.
7C]. For EMCVp24 RNA
translation, the situation was less
clear-cut. Cleavage of eIF4G
slightly stimulated (ca. 1.5-fold)
poly(A)

EMCVp24 RNA
translation [compare lanes 0 and P, poly(A)

; Fig.
7B].
Conversely, protease treatment of extracts substantially
reduced, but
did not completely abolish, the stimulatory effects
of polyadenylation
[compare lanes 0 and P, poly(A)
+; Fig.
7B], a partial
effect which remains difficult to explain
clearly at present. Thus,
cleavage of eIF4G significantly reduced
the stimulatory effects of
polyadenylation on translation driven
by all of the picornaviral IRESes
examined here but dramatically
stimulated only PV IRES-driven
translation.
 |
DISCUSSION |
The classical closed-loop model for translation initiation on
capped and polyadenylated cellular mRNAs dictates that efficiently translated mRNAs are noncovalently circularized via a
cap-eIF4E-eIF4G-PABP-poly(A) tail interaction (13, 23,
43). Although picornaviral RNAs are polyadenylated, they are
naturally uncapped and translated following IRES-driven internal
ribosome entry. Nevertheless, we previously showed that EMCV
IRES-driven translation in a poly(A)-dependent RRL translation system
was significantly stimulated upon polyadenylation of the RNA
(34). This result was extended recently to include the PV
and HAV IRESes by Bergamini et al. (1) in a
poly(A)-dependent non-nucleased HeLa cell extract. Unfortunately,
translation activity in these latter extracts was abolished by nuclease
treatment. Thus, the presence of translationally active endogenous
mRNAs precluded a dissection of the molecular mechanism of poly(A)
stimulation of IRES-driven translation.
Here we have used our recently described poly(A)-dependent RRL extracts
to address this question. Since poly(A) dependency in the RRL system
results from partial depletion of ribosomes and their associated
initiation factors to yield a competitive translational environment,
the complication of the presence of heterologous mRNAs is circumvented
(34). An additional advantage of the depleted RRL system
is that translating mRNAs are extremely stable (8; this
work), opening the possibility of analyzing uncapped IRES-carrying
mRNAs without the need for nonphysiological 5'-end modification.
Effectively, a limitation of the previously described HeLa cell extract
(1) is that uncapped mRNAs were extremely unstable and had
to be artificially capped with an ApppG cap analogue.
Picornavirus IRES-driven translation was stimulated by polyadenylation
in the depleted RRL system. Under the optimal conditions for each IRES,
the degree of stimulation ranged from approximately 3- to 4-fold (for
EMCV) and 4- to 6-fold (for PV) to more than 10-fold (for HAV), results
in good quantitative agreement with the results of Bergamini et al.
(1), who observed 3-fold (for EMCV) and >10-fold
stimulation indices with HAV and PV. It is possible that the more
modest poly(A) stimulation of PV IRES-driven translation reported here
stems from the necessity for PV IRES activity to include
non-ribosome-depleted HeLa cell extract in the ribosome-depleted RRL
system, which rendered the system less poly(A)-dependent as measured
with control capped and/or polyadenylated mRNAs (Fig. 2; see also
reference 8). The effects of polyadenylation on
picornavirus IRES-driven translation reported here were specific, in
that they were not transposable to the unrelated flaviviral HCV IRES
(HCV viral RNA is not naturally polyadenylated) and did not result from
any detectable differences in functional mRNA stability. It should also
be noted that the different picornaviral IRESes are physiologically
active in driving internal ribosome entry in the depleted RRL system.
First, translation driven by the different uncapped, polyadenylated
IRESes was some 20 to 40 times more efficient than an uncapped,
polyadenylated control without an IRES (see, for example, Fig. 6).
Second, the different IRESes were still functional when placed as the
intercistronic spacer of a dicistronic mRNA (data not shown). Third,
mutations in the PV IRES known to attenuate poliovirus vaccine strains
were still deleterious for translation in the depleted RRL system
(C. E. Malnou and K. M. Kean, unpublished data).
Importantly, poly(A)-mediated stimulation of picornaviral IRES-driven
translation was sensitive to MgCl2 and KCl concentrations and increased as near-physiological salt concentrations were attained, as we had previously shown for cap-poly(A) synergy on cellular mRNAs
translated in this system (8). In addition, the salt optima of the various IRES types differed significantly. While this finding in itself is not necessarily surprising (see, for example,
reference 2), important differences should be noted between the optima measured in standard RRL using nonpolyadenylated RNAs and those presented here with poly(A)+ RNAs. The first
concerns translation driven from the PV IRES which had been found to be
extremely intolerant of MgCl2 in standard RRL, a finding
which was difficult to encompass within the context of the infected
cell. In the depleted RRL system, translation driven from this element
tolerates relatively high concentrations of MgCl2. The
second difference concerns the HAV IRES, for which discrepancies had
previously been observed between efficient activity under most salt
concentrations in standard RRL (2) and virtual inactivity
in the intact cell (7). The current study shows that the
HAV IRES appears poorly capable of driving translation in extracts in
which ribosomes and/or initiation factors are limiting and in which
salt concentrations are near physiological. Thus, with respect to both
the PV and the HAV IRESes, translation of polyadenylated RNAs in the
depleted RRL system appears to more closely reproduce the physiological
situation than does translation of nonpolyadenylated RNAs in the
standard, nondepleted RRL system.
As mentioned above, the novelty of the depleted RRL system, compared to
the other poly(A)-dependent cell extracts described to date, is the
absence of intact, endogenous competitor mRNAs. This makes it
particularly appropriate for the dissection of the molecular mechanisms
underlying poly(A)-mediated translation stimulation. In effect, in
extracts which rely on mRNA competition to induce poly(A) dependency,
any alterations of components of the translation machinery targeted to
affect such poly(A) dependency cannot distinguish between the
experimental and competitor RNAs. Thus, one cannot separate global
nonspecific reduction of translation efficiency from specific effects
on poly(A) dependency. In contrast, in the depleted RRL system,
specific effects on poly(A) dependency are easily discerned (see, for
example, Fig. 6). Thus, we employed the rotavirus NSP3 protein which
interacts with eIF4G and evicts PABP from eIF4F to analyze the role of
the eIF4G-PABP interaction in poly(A)-mediated stimulation of
picornaviral IRES-driven translation. Poly(A) stimulation of
translation driven by all three types of picornavirus IRES was
abolished by recombinant NSP3, demonstrating that the integrity of the
eIF4G-PABP interaction is required for this effect of poly(A). Thus,
the mechanism of mRNA 5'- to 3'-end cross talk is functionally
conserved between capped-polyadenylated and picornavirus
IRES-carrying-polyadenylated mRNAs. However, one cannot invoke an
eIF4E-cap interaction in the latter case. Rather, it is tempting to
speculate that picornaviral mRNAs are circularized for translation via
an IRES-eIF4G-PABP-poly(A) interaction at least early after infection
(see Fig. 8), and we are currently evaluating this
hypothesis directly. Indeed, the intact eIF4G molecule or a proteolytic
C-terminal cleavage product of eIF4G has been shown to bind an internal
region(s) of the different picornaviral IRESes (33, 39;
Borman et al., submitted; for a review, see reference 26).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 8.
Models depicting the circularization and translatability
of cellular and viral mRNAs during the infectious cycle of different
picornaviruses. In each panel the majority of the translation machinery
is tied up by the mRNAs depicted as thick lines. Immediately after
infection (see left side), we propose that the RNAs of all
picornaviruses are circularized via the eIF4G-PABP interaction and
probably require this interaction to compete with the actively
translating circularized capped-polyadenylated cellular mRNAs. The
entero- and rhinoviruses induce a dramatic inhibition of host cell
protein synthesis, primarily via viral proteinase-mediated cleavage
first of eIF4G and later of PABP, which will both block eukaryotic mRNA
circularization. From the data presented here, it is clear that viral
5'- to 3'-end cross talk via the eIF4G-PABP interaction will be
abolished concomitantly with host cell shutoff, when the host cell
translation machinery is liberated for viral translation. However,
continued circularization of viral RNAs via eIF4G-PABP is presumably
rendered unnecessary since the corresponding IRESes can preferentially
function with only the C-terminal cleavage product of eIF4G (right
side, panel A). The efficient inhibition of host cell translation
observed upon infection with EMCV results, at least in part, from the
activation of eIF4E binding protein 1 (4EBP1) by its dephosphorylation
(42a). Active (underphosphorylated) 4EBP1 has previously
been shown to inhibit the interaction between eIF4E and eIF4G
(17, 42a). Thus, once again, shutoff correlates with
abrogation of cellular mRNA circularization. Since EMCV IRES activity
does not require eIF4E (39), its translation will continue
unabated. For this virus, which does not effectuate the cleavage of
eIF4G or PABP, it seems reasonable to postulate that circularized viral
genomes could persist throughout the infectious cycle (right side,
panel B). Similarly, it seems likely that circularized viral RNAs will
persist throughout HAV infection. However, since little or no
inhibition of host cell protein sysnthesis is induced by HAV, one can
predict that the circularized HAV RNAs will have to continue to compete
for the translational machinery with circularized, efficiently
translated host cell mRNAs throught the whole infectious cycle (left
side, panel C). This may help to explain the extremely inefficient
nature of HAV infection compared with the other picornaviruses.
|
|
An important aspect of the results presented here concerns the effects
of the human rhinovirus 2A proteinase, which cleaves eIF4G, on poly(A)
stimulation of PV IRES activity. Translation driven by the PV IRES
could be stimulated independently by either 2A proteinase or poly(A),
in a nonadditive manner. In effect, when PV IRES RNAs were translated
in the presence of 2A proteinase, no additional stimulation was
achievable upon polyadenylation. Most interestingly, translation of
poly(A) plus PVp24 RNA was then resistant to NSP3. Thus, since the 2A
proteinase did not cleave PABP under our reaction conditions, one can
conclude that poly(A) stimulation is abolished upon cleavage of eIF4G.
As host cell eIF4G is cleaved early in the PV infectious cycle
(25), the results presented here strongly suggest that
poly(A)-mediated circularisation of entero- and rhinovirus mRNA is
important only for the first rounds of translation in the highly
competitive cellular environment, before the shutoff of host cell
translation. This mode of translation initiation would then be
jettisoned in favor of IRES-driven translation mediated by the
C-terminal cleavage product of eIF4G, which does not include the PABP
interaction domain (6) (Fig. 8). Conversely, since eIF4G
is not cleaved by HAV or EMCV, one can suggest that the corresponding
viral genomes might remain in a circular form for translation
throughout infection, with or without interruption of cellular mRNA
circularization depending on the particular virus (Fig. 8).
Of the IRESes tested here, the HCV element was unique in being
stimulated by a 3'-end sequence in a PABP-eIF4G-independent manner.
Although translation stimulation affected by the authenthic viral 3' X
region appeared not to be specific to the HCV IRES, it was totally
resistant to NSP3. In fact, Ito and Lai suggested that HCV RNAs could
be circularized by simultaneous binding of PTB to the HCV IRES and 3' X
region (21). Further studies will be necessary to test
this hypothesis.
Finally, the apparent conservation of 5'- to 3'-end cross talk between
capped and polyadenylated cellular mRNAs and picornaviral RNAs is
likely to be particularly pertinent to the mechanism of translation of
nonclassical cellular mRNAs. In effect, recent estimations suggested
that as many as 10% of polyadenylated cellular mRNA species might
possess IRESes. Several such cellular IRESes have been shown to be
activated in vivo during stress or apoptosis (see, for example,
reference 47), conditions in which eIF4G undergoes
specific, limited proteolysis in a manner similar to that observed upon
picornavirus infection (10). It remains to be determined
whether such cellular IRES-carrying mRNAs can be encompassed within a
closed-loop model of translation initiation. The translation systems
described here should prove a very useful tool to address these questions.
 |
ACKNOWLEDGMENTS |
We are grateful to Cécile Malnou and Sylvie van der Werf
for their interest in this work and to Richard Paul for critical reading of the manuscript. We thank Didier Poncet and Nathalie Castagné for the gift of purified rotavirus NSP3 protein, Tim Skern for purified recombinant 2A proteinase, Bob Rhoads for antibodies raised against eIF4G, and M. Görlach for antibodies against PABP. We also thank Matthias Hentze and Encarna Martinez-Salas for
communicating unpublished results.
This work was funded in part by a grant from the MRENT (réseau
HCV). We also acknowledge support from the Programme de Recherche Clinique de l'Institut Pasteur, from a Contrat d'Incitation à la Recherche en vue d'Applications (CCV 8) from the Pasteur Institute, from the Association Française contre les Myopathies (AFM), and from the Agence Nationale de Recherches sur le SIDA (ANRS). Y.M.M. is
supported by a doctoral fellowship from the Association pour la
Recherche sur le Cancer (ARC).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: U.P.
Régulation de la Traduction Eucaryote et Virale, CNRS URA 1966, Institut Pasteur, 25 rue du Dr. Roux, 75724 Paris Cedex 15, France.
Phone: (33) 1-40-61-33-55. Fax: (33) 1-40-61-30-45. E-mail:
kathiemb{at}pasteur.fr.
 |
REFERENCES |
| 1.
|
Bergamini, G.,
T. Preiss, and M. W. Hentze.
2000.
Picornavirus IRESes and the poly(A) tail jointly promote cap-independent translation in a mammalian cell-free system.
RNA
6:1773-1780[Abstract].
|
| 2.
|
Borman, A. M.,
J.-L. Bailly,
M. Girard, and K. M. Kean.
1995.
Picornavirus internal ribosome entry segments: comparison of translation efficiency and the requirements for optimal internal initiation in vitro.
Nucleic Acids Res.
23:3656-3663[Abstract/Free Full Text].
|
| 3.
|
Borman, A. M.,
F. G. Deliat, and K. M. Kean.
1994.
Sequences within the poliovirus internal ribosome entry segment control viral RNA replication.
EMBO J.
13:3149-3157[Medline].
|
| 4.
|
Borman, A., and R. J. Jackson.
1992.
Initiation of translation of human rhinovirus RNA: mapping the internal ribosome entry site.
Virology
188:685-696[CrossRef][Medline].
|
| 5.
|
Borman, A. M., and K. M. Kean.
1997.
Intact eukaryotic initiation factor 4G is required for hepatitis A virus internal initiation of translation.
Virology
237:129-136[CrossRef][Medline].
|
| 6.
|
Borman, A. M.,
R. Kirchweger,
E. Ziegler,
R. E. Rhoads,
T. Skern, and K. M. Kean.
1997.
eIF4G and its proteolytic cleavage products: Effect on initiation of protein synthesis from capped, uncapped and IRES-containing mRNAs.
RNA
3:186-196[Abstract].
|
| 7.
|
Borman, A. M.,
P. Le Mercier,
M. Girard, and K. M. Kean.
1997.
Comparison of picornaviral IRES-driven internal initiation of translation in cultured cells of different origins.
Nucleic Acids Res.
25:925-932[Abstract/Free Full Text].
|
| 8.
|
Borman, A. M.,
Y. M. Michel, and K. M. Kean.
2000.
Biochemical characterisation of cap-poly(A) synergy in rabbit reticulocyte lysates: the eIF4G-PABP interaction increases the functional affinity of eIF4E for the capped mRNA 5' end.
Nucleic Acids Res.
28:4068-4075[Abstract/Free Full Text].
|
| 9.
|
Carter, M. S.,
K. M. Kuhn, and P. Sarnow.
2000.
Cellular internal ribosome entry site elements and the use of cDNA microarrays in their investigation, p. 615-635.
In
J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control of gene expression. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 10.
|
Clemens, M. J.,
M. Bushell, and S. J. Morley.
1998.
Degradation of eukaryotic polypeptide chain initiation factor (eIF) 4G in response to induction of apoptosis in human lymphoma cell lines.
Oncogene
17:2921-2931[CrossRef][Medline].
|
| 11.
|
Dasso, M. C., and R. J. Jackson.
1989.
Efficient initiation of mammalian mRNA translation at a CUG codon.
Nucleic Acids Res.
17:6485-6497[Abstract/Free Full Text].
|
| 12.
|
Gallie, D. R.
1991.
The cap and poly(A) tail function synergistically to regulate mRNA translational efficiency.
Genes Dev.
5:2108-2116[Abstract/Free Full Text].
|
| 13.
|
Gallie, D. R.
1998.
A tale of two termini: a functional interaction between the termini of an mRNA is a prerequisite for efficient translation initiation.
Gene
216:1-11[CrossRef][Medline].
|
| 14.
|
Gingras, A.-C.,
B. Raught, and N. Sonenberg.
1999.
eIF4 initiation factors: effectors of mRNA recruitment to ribosomes and regulators of translation.
Annu. Rev. Biochem.
68:913-963[CrossRef][Medline].
|
| 15.
|
Goldstein, N. O.,
I. U. Pardoe, and A. T. Burness.
1976.
Requirement of an adenylic acid-rich segment for the infectivity of encephalomyocarditis virus RNA.
J. Gen. Virol.
31:271-276[Abstract/Free Full Text].
|
| 16.
|
Görlach, M.,
C. G. Burd, and G. Dreyfuss.
1994.
The mRNA poly(A)-binding protein: localization, abundance, and RNA-binding specificity.
Exp. Cell Res.
211:400-407[CrossRef][Medline].
|
| 17.
|
Hershey, J. W. B., and W. C. Merrick.
2000.
Pathway and mechanism of initiation of protein synthesis, p. 33-88.
In
J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control of gene expression. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 18.
|
Hruby, D. E., and W. K. Roberts.
1977.
Encephalomyocarditis virus RNA. II. Polyadenylic acid requirement for efficient translation.
J. Virol.
23:338-344[Abstract/Free Full Text].
|
| 19.
|
Imataka, H.,
A. Gradi, and N. Sonenberg.
1998.
A newly identified N-terminal amino acid sequence of human eIF4G binds poly(A)-binding protein and functions in poly(A)-dependent translation.
EMBO J.
17:7480-7489[CrossRef][Medline].
|
| 20.
|
Ito, T.,
S. M. Tahara, and M. C. Lai.
1998.
The 3' untranslated region of hepatitis C virus enhances translation from an internal ribosomal entry site.
J. Virol.
72:8789-8796[Abstract/Free Full Text].
|
| 21.
|
Ito, T., and M. C. Lai.
1999.
An internal polypyrimidine tract binding protein site in the hepatitis C virus RNA attenuates translation which is relieved by the 3' untranslated sequence.
Virology
254:288-296[CrossRef][Medline].
|
| 22.
|
Jackson, R. J., and A. Kaminski.
1995.
Internal initiation of translation in eukaryotes: the picornavirus paradigm and beyond.
RNA
1:985-1000[Medline].
|
| 23.
|
Jacobson, A.
1996.
Poly(A) metabolism and translation: the closed-loop model, p. 451-480.
In
J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 24.
|
Jansen, R. W.,
J. E. Newbold, and S. M. Lemon.
1988.
Complete nucleotide sequence of a cell culture-adapted variant of hepatitis A virus: comparison with wild-type virus with restricted capacity for in vitro replication.
Virology
163:299-307[CrossRef][Medline].
|
| 25.
|
Joachims, M.,
P. C. Van Breugel, and R. E. Lloyd.
1999.
Cleavage of poly(A)-binding protein by enterovirus proteases concurrent with inhibition of translation in vitro.
J. Virol.
73:718-727[Abstract/Free Full Text].
|
| 26.
|
Kean, K. M.,
Y. M. Michel, and A. M. Borman.
1999.
Viral exceptions to 5'-end dependent initiation of translation: is there really a difference in the mechanism of ribosome recruitment to capped and IRES containing mRNAs.
Curr. Top. Virol.
1:191-201.
|
| 27.
|
Kerekatte, V.,
B. D. Keiper,
C. Badorff,
A. Cai,
K. U. Knowlton, and R. E. Rhoads.
1999.
Cleavage of poly(A)-binding protein by coxsackievirus 2A protease in vitro and in vivo: another mechanism for host protein synthesis shutoff?
J. Virol.
73:709-717[Abstract/Free Full Text].
|
| 28.
|
Kirchweger, R.,
E. Ziegler,
B. J. Lamphear,
D. Waters,
H. D. Liebig,
W. Sommergruber,
F. Sobrino,
C. Hohenadl,
D. Blaas,
R. E. Rhoads, and T. Skern.
1994.
Foot-and-mouth disease virus leader proteinase: purification of the Lb form and determination of its cleavage site on eIF4G.
J. Virol.
68:5677-5684[Abstract/Free Full Text].
|
| 29.
|
Kozak, M.
1999.
Initiation of translation in prokaryotes and eukaryotes.
Gene
234:187-208[CrossRef][Medline].
|
| 30.
|
Lamphear, B. J.,
R. Kirchweger,
T. Skern, and R. E. Rhoads.
1995.
Mapping of functional domains in eukaryotic protein synthesis initiation factor 4G (eIF4G) with picornaviral proteases. Implications for cap-dependent and cap-independent translational initiation.
J. Biol. Chem.
270:21975-21983[Abstract/Free Full Text].
|
| 31.
|
Le, H.,
R. L. Tanguay,
M. L. Balasta,
C. C. Wei,
K. S. Browning,
A. M. Metz,
D. J. Goss, and D. R. Gallie.
1997.
Translation initiation factors eIF-iso4G and eIF-4B interact with the poly(A)-binding protein and increase its RNA binding activity.
J. Biol. Chem.
272:16247-16255[Abstract/Free Full Text].
|
| 32.
|
Liebig, H. D.,
E. Ziegler,
R. Yan,
K. Hartmuth,
H. Klump,
H. Kowalski,
D. Blaas,
W. Sommergruber,
L. Frasel,
B. Lamphear,
R. E. Rhoads,
E. Kuechler, and T. Skern.
1993.
Purification of two picornaviral 2A proteinases: interaction with eIF4 and influence on in vitro translation.
Biochemistry
32:7581-7588[CrossRef][Medline].
|
| 33.
|
Lopez de Quinto, S., and E. Martinez-Salas.
2000.
Interaction of the eIF4G initiation factor with the aphthovirus IRES is essential for internal translation initiation in vivo.
RNA
6:1380-1392[Abstract].
|
| 34.
|
Michel, Y. M.,
D. Poncet,
M. Piron,
K. M. Kean, and A. M. Borman.
2000.
Cap-poly(A) synergy in mammalian cell-free extracts: investigation of the requirements for poly(A)-mediated stimulation of translation initiation.
J. Biol. Chem.
275:32268-32276[Abstract/Free Full Text].
|
| 35.
|
Morley, S. J.,
P. S. Curtis, and V. M. Pain.
1997.
Translation's mystery factor begins to yield its secrets.
RNA
3:1085-1104[Medline].
|
| 36.
|
Ohlmann, T.,
M. Rau,
V. M. Pain, and S. J. Morley.
1996.
The C-terminal domain of eukaryotic protein synthesis initiation factor (elF) 4G is sufficient to support cap-independent translation in the absence of eIF4E.
EMBO J.
15:1371-1382[Medline].
|
| 37.
|
Pestova, T. V.,
C. U. T. Hellen, and I. N. Shatsky.
1996.
Canonical eukaryotic initiation factors determine initiation of translation by internal ribosomal entry.
Mol. Cell. Biol.
16:6859-6869[Abstract].
|
| 38.
|
Pestova, T. V.,
I. N. Shatsky,
S. P. Fletcher,
R. J. Jackson, and C. U. T. Hellen.
1998.
A prokaryotic-like mode of cytoplasmic eukaryotic ribosome binding to the initiation codon during internal translation initiation of hepatitis C and classical swine fever virus RNAs.
Genes Dev.
12:67-83[Abstract/Free Full Text].
|
| 39.
|
Pestova, T. V.,
I. N. Shatsky, and C. U. T. Hellen.
1996.
Functional dissection of eukaryotic initiation factor 4F: the 4A subunit and the central domain are sufficient to mediate internal entry of 43S preinitiation complexes.
Mol. Cell. Biol.
16:6870-6878[Abstract].
|
| 40.
|
Piron, M.,
T. Delaunay,
J. Grosclaude, and D. Poncet.
1999.
Identification of the RNA-binding, dimerization and eIF4GI-binding domains of rotavirus nonstructural protein NSP3.
J. Virol.
73:5411-5421[Abstract/Free Full Text].
|
| 41.
|
Piron, M.,
P. Vende,
J. Cohen, and D. Poncet.
1998.
Rotavirus RNA-binding protein NSP3 interacts with eIF4GI and evicts the poly(A) binding protein from eIF4F.
EMBO J.
17:5811-5821[CrossRef][Medline].
|
| 42.
|
Preiss, T., and M. W. Hentze.
1998.
Dual function of the messenger RNA cap structure in poly(A)-tail-promoted translation in yeast.
Nature
392:516-520[CrossRef][Medline].
|
| 42a.
|
Raught, B.,
A.-C. Gingras, and N. Sonenberg.
2000.
Regulation of ribosomal recruitment in eukaryotes, p. 807-825.
In
J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control of gene expression. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 43.
|
Sachs, A. B.,
P. Sarnow, and M. W. Hentze.
1997.
Starting at the beginning, middle and end: translation initiation in eukaryotes.
Cell
89:831-838[CrossRef][Medline].
|
| 44.
|
Sarnow, P.
1989.
Role of 3'-end sequences in infectivity of poliovirus transcripts made in vitro.
J. Virol.
63:467-470[Abstract/Free Full Text].
|
| 45.
|
Schwartz, D. C., and R. Parker.
2000.
Interaction of mRNA translation and mRNA degradation in Saccharomyces cerevisiae, p. 807-825.
In
J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control of gene expression. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 46.
|
Spector, D. H., and D. Baltimore.
1974.
Requirement of 3'-terminal poly(adenylic acid) for the infectivity of poliovirus RNA.
Proc. Natl. Acad. Sci. USA
71:2983-2987[Abstract/Free Full Text].
|
| 47.
|
Stoneley, M.,
S. A. Chappell,
C. L. Jopling,
M. Dickens,
M. MacFarlane, and A. E. Willis.
2000.
c-myc protein synthesis is initiated from the internal ribosome entry segment during apoptosis.
Mol. Cell. Biol.
20:1162-1169[Abstract/Free Full Text].
|
| 48.
|
Tarun, S. Z., Jr., and A. B. Sachs.
1995.
A common function for mRNA 5' and 3' ends in translation initiation in yeast.
Genes Dev.
9:2997-3007[Abstract/Free Full Text].
|
| 49.
|
Tarun, S. Z., Jr., and A. B. Sachs.
1996.
Association of the yeast poly(A) tail binding protein with translation initiation factor eIF-4G.
EMBO J.
15:7168-7177[Medline].
|
| 50.
|
Tsuchihara, K.,
T. Tanaka,
M. Hijikata,
S. Kuge,
H. Toyoda,
A. Nomoto,
N. Yamamoto, and K. Shimotohno.
1997.
Specific interaction of polypyrimidine tract-binding protein with the extreme 3'-terminal structure of the hepatitis C virus genome, the 3' X.
J. Virol.
71:6720-6726[Abstract].
|
| 51.
|
Wells, S. E.,
P. E. Hillner,
R. D. Vale, and A. B. Sachs.
1998.
Circularization of mRNA by eukaryotic translation initiation factors.
Mol. Cell
2:135-140[CrossRef][Medline].
|
| 52.
|
Yan, R.,
W. Rychlik,
D. Etchison, and R. E. Rhoads.
1992.
Amino acid sequence of the human protein synthesis initiation factor eIF4G.
J. Biol. Chem.
267:23226-23231[Abstract/Free Full Text].
|
| 53.
|
Ziegler, E.,
A. M. Borman,
F. G. Deliat,
H.-D. Liebig,
D. Jugovic,
K. M. Kean,
T. Skern, and E. Kuechler.
1995.
Picornavirus 2A proteinase-mediated stimulation of internal initiation is dependent on enzymatic activity and the cleavage products of cellular proteins.
Virology
213:549-557[CrossRef][Medline].
|
Molecular and Cellular Biology, July 2001, p. 4097-4109, Vol. 21, No. 13
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.13.4097-4109.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Bonderoff, J. M., LaRey, J. L., Lloyd, R. E.
(2008). Cleavage of Poly(A)-Binding Protein by Poliovirus 3C Proteinase Inhibits Viral Internal Ribosome Entry Site-Mediated Translation. J. Virol.
82: 9389-9399
[Abstract]
[Full Text]
-
Thoma, C., Fraterman, S., Gentzel, M., Wilm, M., Hentze, M. W.
(2008). Translation initiation by the c-myc mRNA internal ribosome entry sequence and the poly(A) tail. RNA
14: 1579-1589
[Abstract]
[Full Text]
-
Martinez-Salas, E., Pacheco, A., Serrano, P., Fernandez, N.
(2008). New insights into internal ribosome entry site elements relevant for viral gene expression. J. Gen. Virol.
89: 611-626
[Abstract]
[Full Text]
-
Svitkin, Y. V., Costa-Mattioli, M., Herdy, B., Perreault, S., Sonenberg, N.
(2007). Stimulation of picornavirus replication by the poly(A) tail in a cell-free extract is largely independent of the poly(A) binding protein (PABP). RNA
13: 2330-2340
[Abstract]
[Full Text]
-
Beauchemin, C., Laliberte, J.-F.
(2007). The Poly(A) Binding Protein Is Internalized in Virus-Induced Vesicles or Redistributed to the Nucleolus during Turnip Mosaic Virus Infection. J. Virol.
81: 10905-10913
[Abstract]
[Full Text]
-
Zhang, B., Morace, G., Gauss-Muller, V., Kusov, Y.
(2007). Poly(A) binding protein, C-terminally truncated by the hepatitis A virus proteinase 3C, inhibits viral translation. Nucleic Acids Res
35: 5975-5984
[Abstract]
[Full Text]
-
Bradrick, S. S., Dobrikova, E. Y., Kaiser, C., Shveygert, M., Gromeier, M.
(2007). Poly(A)-binding protein is differentially required for translation mediated by viral internal ribosome entry sites. RNA
13: 1582-1593
[Abstract]
[Full Text]
-
Tellinghuisen, T. L., Evans, M. J., von Hahn, T., You, S., Rice, C. M.
(2007). Studying Hepatitis C Virus: Making the Best of a Bad Virus. J. Virol.
81: 8853-8867
[Full Text]
-
Jackson, R. J., Standart, N.
(2007). How Do MicroRNAs Regulate Gene Expression?. Sci Signal
2007: re1-re1
[Abstract]
[Full Text]
-
Song, Y., Friebe, P., Tzima, E., Junemann, C., Bartenschlager, R., Niepmann, M.
(2006). The Hepatitis C Virus RNA 3'-Untranslated Region Strongly Enhances Translation Directed by the Internal Ribosome Entry Site. J. Virol.
80: 11579-11588
[Abstract]
[Full Text]
-
Castello, A., Alvarez, E., Carrasco, L.
(2006). Differential Cleavage of eIF4GI and eIF4GII in Mammalian Cells: EFFECTS ON TRANSLATION. J. Biol. Chem.
281: 33206-33216
[Abstract]
[Full Text]
-
Bradrick, S. S., Walters, R. W., Gromeier, M.
(2006). The hepatitis C virus 3'-untranslated region or a poly(A) tract promote efficient translation subsequent to the initiation phase. Nucleic Acids Res
34: 1293-1303
[Abstract]
[Full Text]
-
Johnson, R. F., Feng, M., Liu, P., Millership, J. J., Yount, B., Baric, R. S., Leibowitz, J. L.
(2005). Effect of Mutations in the Mouse Hepatitis Virus 3'(+)42 Protein Binding Element on RNA Replication. J. Virol.
79: 14570-14585
[Abstract]
[Full Text]
-
ISKEN, O., GRASSMANN, C. W., YU, H., BEHRENS, S.-E.
(2004). Complex signals in the genomic 3' nontranslated region of bovine viral diarrhea virus coordinate translation and replication of the viral RNA. RNA
10: 1637-1652
[Abstract]
[Full Text]
-
Fabian, M. R., White, K. A.
(2004). 5'-3' RNA-RNA Interaction Facilitates Cap- and Poly(A) Tail-independent Translation of Tomato Bushy Stunt Virus mRNA: A POTENTIAL COMMON MECHANISM FOR TOMBUSVIRIDAE. J. Biol. Chem.
279: 28862-28872
[Abstract]
[Full Text]
-
Cristofari, G., Ivanyi-Nagy, R., Gabus, C., Boulant, S., Lavergne, J.-P., Penin, F., Darlix, J.-L.
(2004). The hepatitis C virus Core protein is a potent nucleic acid chaperone that directs dimerization of the viral (+) strand RNA in vitro. Nucleic Acids Res
32: 2623-2631
[Abstract]
[Full Text]
-
Koloteva-Levine, N., Pinchasi, D., Pereman, I., Zur, A., Brandeis, M., Elroy-Stein, O.
(2004). The Apc5 Subunit of the Anaphase-Promoting Complex/Cyclosome Interacts with Poly(A) Binding Protein and Represses Internal Ribosome Entry Site-Mediated Translation. Mol. Cell. Biol.
24: 3577-3587
[Abstract]
[Full Text]
-
Vitour, D., Lindenbaum, P., Vende, P., Becker, M. M., Poncet, D.
(2004). RoXaN, a Novel Cellular Protein Containing TPR, LD, and Zinc Finger Motifs, Forms a Ternary Complex with Eukaryotic Initiation Factor 4G and Rotavirus NSP3. J. Virol.
78: 3851-3862
[Abstract]
[Full Text]
-
Leonard, S., Viel, C., Beauchemin, C., Daigneault, N., Fortin, M. G., Laliberte, J.-F.
(2004). Interaction of VPg-Pro of Turnip mosaic virus with the translation initiation factor 4E and the poly(A)-binding protein in planta. J. Gen. Virol.
85: 1055-1063
[Abstract]
[Full Text]
-
Dobrikova, E., Florez, P., Bradrick, S., Gromeier, M.
(2003). Activity of a type 1 picornavirus internal ribosomal entry site is determined by sequences within the 3' nontranslated region. Proc. Natl. Acad. Sci. USA
100: 15125-15130
[Abstract]
[Full Text]
-
Imbert, I., Dimitrova, M., Kien, F., Kieny, M. P., Schuster, C.
(2003). Hepatitis C virus IRES efficiency is unaffected by the genomic RNA 3'NTR even in the presence of viral structural or non-structural proteins. J. Gen. Virol.
84: 1549-1557
[Abstract]
[Full Text]
-
Paulous, S., Malnou, C. E., Michel, Y. M., Kean, K. M., Borman, A. M.
(2003). Comparison of the capacity of different viral internal ribosome entry segments to direct translation initiation in poly(A)-dependent reticulocyte lysates. Nucleic Acids Res
31: 722-733
[Abstract]
[Full Text]
-
Wang, H., Iacoangeli, A., Popp, S., Muslimov, I. A., Imataka, H., Sonenberg, N., Lomakin, I. B., Tiedge, H.
(2002). Dendritic BC1 RNA: Functional Role in Regulation of Translation Initiation. J. Neurosci.
22: 10232-10241
[Abstract]
[Full Text]
-
Kong, L. K., Sarnow, P.
(2002). Cytoplasmic Expression of mRNAs Containing the Internal Ribosome Entry Site and 3' Noncoding Region of Hepatitis C Virus: Effects of the 3' Leader on mRNA Translation and mRNA Stability. J. Virol.
76: 12457-12462
[Abstract]
[Full Text]
-
Lopez de Quinto, S., Saiz, M., de la Morena, D., Sobrino, F., Martinez-Salas, E.
(2002). IRES-driven translation is stimulated separately by the FMDV 3'-NCR and poly(A) sequences. Nucleic Acids Res
30: 4398-4405
[Abstract]
[Full Text]
-
Borman, A. M., Michel, Y. M., Malnou, C. E., Kean, K. M.
(2002). Free Poly(A) Stimulates Capped mRNA Translation in Vitro through the eIF4G-Poly(A)-binding Protein Interaction. J. Biol. Chem.
277: 36818-36824
[Abstract]
[Full Text]
-
Gauss-Muller, V., Kusov, Y. Y.
(2002). Replication of a hepatitis A virus replicon detected by genetic recombination in vivo. J. Gen. Virol.
83: 2183-2192
[Abstract]
[Full Text]
-
Leonard, S., Chisholm, J., Laliberte, J.-F., Sanfacon, H.
(2002). Interaction in vitro between the proteinase of Tomato ringspot virus (genus Nepovirus) and the eukaryotic translation initiation factor iso4E from Arabidopsis thaliana. J. Gen. Virol.
83: 2085-2089
[Abstract]
[Full Text]
-
McCormick, C. J., Rowlands, D. J., Harris, M.
(2002). Efficient delivery and regulable expression of hepatitis C virus full-length and minigenome constructs in hepatocyte-derived cell lines using baculovirus vectors. J. Gen. Virol.
83: 383-394
[Abstract]
[Full Text]
-
KIEFT, J.S., GRECH, A., ADAMS, P., DOUDNA, J.A.
(2001). Mechanisms of Internal Ribosome Entry in Translation Initiation. Cold Spring Harb Symp Quant Biol
66: 277-284
[Abstract]