Molecular and Cellular Biology, July 2001, p. 4097-4109, Vol. 21, No. 13
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.13.4097-4109.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
U.P. Régulation de la Traduction Eucaryote et Virale, CNRS URA 1966, Institut Pasteur, 75724 Paris Cedex 15, France
Received 8 November 2000/Returned for modification 20 December 2000/Accepted 4 April 2001
| |
ABSTRACT |
|---|
|
|
|---|
Efficient translation of most eukaryotic mRNAs results from synergistic cooperation between the 5' m7GpppN cap and the 3' poly(A) tail. In contrast to such mRNAs, the polyadenylated genomic RNAs of picornaviruses are not capped, and translation is initiated internally, driven by an extensive sequence termed IRES (for internal ribosome entry segment). Here we have used our recently described poly(A)-dependent rabbit reticulocyte lysate cell-free translation system to study the role of mRNA polyadenylation in IRES-driven translation. Polyadenylation significantly stimulated translation driven by representatives of each of the three types of picornaviral IRES (poliovirus, encephalomyocarditis virus, and hepatitis A virus, respectively). This did not result from a poly(A)-dependent alteration of mRNA stability in our in vitro translation system but was very sensitive to salt concentration. Disruption of the eukaryotic initiation factor 4G-poly(A) binding protein (eIF4G-PABP) interaction or cleavage of eIF4G abolished or severely reduced poly(A) tail-mediated stimulation of picornavirus IRES-driven translation. In contrast, translation driven by the flaviviral hepatitis C virus (HCV) IRES was not stimulated by polyadenylation but rather by the authentic viral RNA 3' end: the highly structured X region. X region-mediated stimulation of HCV IRES activity was not affected by disruption of the eIF4G-PABP interaction. These data demonstrate that the protein-protein interactions required for synergistic cooperativity on capped and polyadenylated cellular mRNAs mediate 3'-end stimulation of picornaviral IRES activity but not HCV IRES activity. Their implications for the picornavirus infectious cycle and for the increasing number of identified cellular IRES-carrying mRNAs are discussed.
| |
INTRODUCTION |
|---|
|
|
|---|
The initiation of protein synthesis on most mRNAs in eukaryotes follows binding of the 40S ribosomal subunit near the capped 5' end of the mRNA and subsequent migration of this subunit along the mRNA in a 5'-to-3' direction until a suitable initiation codon is selected (for a review, see reference 29). Recognition of the mRNA 5' end and 40S subunit recruitment requires the eukaryotic initiation factor (eIF) 4F complex (for reviews, see references 35 and 43). The eIF4F complex comprises the cap binding protein (eIF4E) and an ATP-dependent RNA helicase (eIF4A) bound, respectively, toward the N and C termini of a scaffold protein, eIF4G (for a review, see references 14 and 35). The C-terminal half of eIF4G is also thought to associate with the multisubunit eIF3 complex, which binds the 40S ribosomal subunit directly thus bridging the gap between the mRNA 5' end and the 40S subunit (reviewed in reference 17).
The vast majority of eukaryotic mRNAs are not only capped at their 5' end but are also polyadenylated at their 3' end. Aside from a role in mRNA metabolism (see reference 45 for a review), the poly(A) tail functions as a translational enhancer and interacts synergistically with the 5' cap to stimulate translation initiation (12, 23, 42, 43). This cooperativity between the cap and poly(A) requires the poly(A) binding protein (PABP) (48). PABP has been shown to bind the N-terminal part of eIF4G in mammals (19, 41), plants (31), and yeast (49), leading to the suggestion that efficiently translated mRNAs are circularized via a cap-eIF4E-eIF4G-PABP-poly(A) tail interaction (the closed-loop model [23]). Indeed, capped and polyadenylated mRNAs can be circularized in vitro using purified yeast eIF4E, eIF4G, and PABP (51). Moreover, at least in mammalian systems, the integrity of the eIF4G-PABP interaction is critical for cap-poly(A) cooperativity (34), and this interaction results in an increased functional affinity of eIF4E for the capped mRNA 5' end (8).
The animal picornaviruses bear witness to an alternative mode of translation initiation. Their uncapped, polyadenylated genomes which serve as mRNAs contain an extensive (ca. 450 nucleotides [nt]), heavily structured sequence within the 5' noncoding region, known as the IRES (for internal ribosome entry segment). This allows direct internal entry of ribosomes some several hundred nucleotides from the RNA 5' end (for a review, see reference 22). Thus, translation of the picornaviral RNAs is both cap and 5'-end independent. A similar mechanism of translation initiation has been described for the flavivirus, hepatitis C virus (HCV), whose uncapped and nonpolyadenylated, positive-strand RNA genome also carries an IRES (20, 38; for a review, see reference 22). In fact, IRESes have now been identified in many cellular mRNAs (for a review, see reference 9), and various lines of evidence suggest that up to or even more than 10% of cellular mRNAs may be translated by internal initiation. Hence, the question of how cap- and 5'-end-independent translation can be encompassed in a closed-loop translation model is extremely pertinent.
In effect, it has been postulated that picornaviral RNAs and HCV RNA would be difficult to accommodate within the form of the closed-loop translation model proposed for classical cellular mRNAs (for a review, see reference 26). Aside from the different natures of the 3' and/or 5' ends of these viral mRNAs compared to the majority of cellular mRNAs, one must take into consideration the known factor requirements for viral IRES-driven translation initiation. Most picornavirus genomes encode proteinases which cleave components of the eIF4F complex. Thus, the entero-and rhinoviral 2A proteinases and the aphthoviral L proteinase cleave eIF4G (28, 32) to separate the N-terminal eIF4E- and PABP-binding domains from the C-terminal eIF3- and eIF4A-binding regions (30). Furthermore, the entero- and rhinovirus 3C and/or 2A proteinases were recently demonstrated to induce cleavage of PABP both in vitro and in the infected cell (25, 27; A. M. Borman, Y. M. Michel, and K. M. Kean submitted for publication). These cleavage events account, at least in part, for the dramatic shutoff of host cell translation observed during infection with all picornaviruses, except for hepatitis A virus (HAV). With the exception of the HAV IRES, which requires intact eIF4G for activity (5), picornaviral IRES-driven translation continues unabated upon eIF4G cleavage (2). Effectively, entero-, rhino-, cardio-, and aphthoviral IRES activity requires only the C-terminal cleavage product of eIF4G and its associated proteins, which do not include eIF4E or PABP (6, 33, 36). Indeed, the C-terminal cleavage product of eIF4G or a recombinant fragment spanning part of this cleavage product has been shown to interact directly with these IRESes (33, 39; Borman et al. submitted) and can substitute for intact eIF4G in 48S initiation complex formation on the encephalomyocarditis virus (EMCV) IRES (37). HCV represents an even more extreme case, since eIF4F is not needed at all for the binding of ribosomal subunits to this IRES (38).
Nevertheless, it seems clear that the efficiency of picornavirus
IRES-driven translation is dependent on the nature of the 3' end of the
mRNA. Even though the poly(A) tails of picornaviral RNAs are
heterogeneous in length, good evidence exists that
poly(A)
picornavirus genomes have a considerably reduced
infectivity (15, 44, 46). Although this reduction in
infectivity may partly reflect a role of the poly(A) tail in viral RNA
synthesis, it has long been known that translation of EMCV genomic RNA
is moderately increased in vitro as the length of the poly(A) tail is
increased (18). Using artificial reporter RNAs, we
recently showed that translation from the EMCV IRES is indeed
stimulated approximately threefold upon polyadenylation of the mRNA in
appropriate in vitro systems (34). Furthermore, it has
since been reported that such poly(A) tail-mediated stimulation of
translation is also exhibited by the other two classes of picornaviral
IRESes (1). Similarly, translation driven by the
flaviviral HCV IRES is significantly increased on mRNAs which carry the
authentic viral 3' end (20), which in this case is not a
poly(A) tail but a conserved three-stem-loop structure which binds
polypyrimidine tract-binding protein (50).
To date, no study has been undertaken which attempts to address the underlying molecular mechanisms of 3'-end stimulation of IRES-driven translation, other than our reported results restricted to the EMCV IRES (34). In the light of the data outlined above, and of the role of the eIF4G-PABP interaction in synergistically stimulating capped and polyadenylated cellular mRNA translation, the aim of the current work was to evaluate the factors required for mRNA 3'-end-mediated stimulation of IRES-driven translation. Using our recently described poly(A)-dependent rabbit reticulocyte lysate extracts (34), we confirm that polyadenylation significantly stimulates translation driven by the picornaviral HAV, EMCV, and poliovirus (PV) IRESes but not that driven from the unrelated flaviviral HCV IRES.
Of more novel import, we show that poly(A)-mediated stimulation of picornaviral IRES activity requires the integrity of the eIF4G-PABP interaction, indicating that mRNA 5'-3' cross talk is mechanistically conserved between classical eukaryotic mRNAs and picornaviral IRES-carrying RNAs. Furthermore, we present data indicative of jettisoning of 5' to 3'-end cross talk in the case of PV IRES-carrying RNAs upon shutoff of host cell translation. Finally, we show that the mechanism of HCV IRES translation stimulation mediated by the cognate viral 3' end is distinct from that of classical eukaryotic mRNAs.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid constructions and in vitro transcriptions.
The
plasmids used in this work are represented schematically in Fig.
1. Plasmids were derived from the previously described p0p24 (34), which contains, under the control of the T7
promoter, a short oligonucleotide-derived 5' untranslated region (UTR), followed by the region coding for the human immunodeficiency virus (HIV-1Lai) p24 protein and the influenza virus NS 3' UTR.
Two versions of this plasmid differ only in the presence or absence of
an A50 tract inserted at the unique EcoRI site,
located 24 nt downstream of the authentic polyadenylation signal.
|
forms of p0p24. pPVp24 was obtained by inserting
the PV IRES, namely, the in-filled Asp718-MscI
fragment (nt 67 to 630) from pKK-C2 (3), into the
in-filled SalI site of p0p24. pEMCVp24 was constructed by
inserting the EMCV IRES (from the polyC tract to nt 848, i.e., the
in-filled EcoRI-NcoI small fragment from p-CITE;
Novagen) into the in-filled BamHI site of p0p24. pHAVp24 resulted from the insertion of the in-filled
NcoI-AflII fragment (nt 44 to 738) of the
full-length cDNA clone of HAV (p16HM175 [24]) into the
in-filled BamHI site of p0p24. pHCVp24 was generated by
inserting the SalI-BamHI short fragment from the
bicistronic pXLJ-HCV construct (2), which includes nt 40 to 372 of the HCV genome, into p0p24 which had been digested with the
same enzymes. Thus, each plasmid was constructed in such a way that the
minimal sequences required for efficient IRES activity were maintained.
Plasmids containing the 3' UTR X region from the HCV were derived from
the poly(A)
p0p24 or pHCVp24 plasmids by inserting
annealed
5'-AATTGGTGGC TCCATCT TAGCCC TAG TCACGGC TAGC TG TGAAAGG TCCG TGAGCCGCATGAC TGCAGAGAGTGC TGATAC TGGCC TC TC TGCAGTCATGTG-3'
and
5'-AAT TCACATGACTGCAGAGAGGCCAGTATCAGCACTC TC TGCAG TCATGCGGC TCACGGACC T T TCACAGC TAGCCG TGAC TAGGGCTAAGATGGAGCCACC-3' oligonucleotides into the unique EcoRI site at the 3'
end of the NS 3' UTR. All constructs were verified by sequencing.
In vitro transcriptions, performed on plasmids linearised by
EcoRI, and quantification and purification of the
synthesized transcripts were done exactly as described previously
(34).
Antibodies and recombinant proteins.
Rabbit anti-eIF4G
peptide 7 antiserum (raised against residues 327 to 342) and monoclonal
antibody 10E10 raised against human PABP have been described previously
(16, 52). Recombinant wild-type human rhinovirus 2A
proteinase, expressed in Escherichia coli and purified to
homogeneity as described previously (32) was a gift from
T. Skern. A recombinant fragment of rotavirus NSP3 protein encompassing
amino acids 163 to 313, overexpressed in E. coli and
purified exactly as described previously (40, 41), was a
gift from D. Poncet. Both 2A proteinase and NSP3 were dialyzed against
H100 buffer (10 mM HEPES-KOH, pH 7.5; 100 mM KCl; 1 mM
MgCl2; 0.1 mM EDTA; 7 mM
-mercaptoethanol) prior to use.
Preparation of translation extracts and in vitro translations. Nuclease-treated Flexi-rabbit reticulocyte lysates (Promega) were partially depleted of ribosomes by ultracentrifugation in a Beckman TL-100 benchtop ultracentrifuge as described previously (8, 34). Translation reactions (12 µl, final volume) containing 50% by volume RRL or ribosome-depleted RRL and 33% by volume H100 buffer were programmed with the indicated concentrations of in vitro-transcribed mRNAs. For pPVp24-derived mRNAs, reactions contained HeLa cell S10 extract (to 2.5% [vol/vol]) prepared as described earlier (3). Reactions which included recombinant proteins were preincubated with the indicated concentrations of 2A proteinase or NSP3 (each diluted in H100 buffer) for 10 min at 30°C (for 2A) or 4°C (for NSP3) before the addition of RNA. The final concentrations of added KCl and MgCl2 in translation reactions were 130 and 0.9 mM, respectively, for p0p24 and were varied according to the IRES-containing mRNAs used as indicated. Translations were performed at 30°C (typically for 90 min) in the presence of [35S]methionine. In certain experiments, RNAs labeled with trace quantities of 32P were extracted from translation reactions prior to retranslation in fresh extracts. Briefly, at the appropriate times, translation reactions were placed on ice and made 5 mM in EDTA. After 5 min at 4°C, reactions received 10 volumes of extraction buffer (200 mM NaCl; 10 mM Tris-HCl, pH 9; 1 mM EDTA; 1% sodium dodecyl sulfate [SDS]) and were extracted twice with phenol and chloroform. Nonaqueous phases were back extracted with extraction buffer, extracted RNA was precipitated by ethanol, and the RNA pellet was washed with 70% ethanol. Extracted RNA was quantified by scintillation counting prior to retranslation.
Translation products were analyzed by SDS-polyacrylamide gel electrophoresis as described previously (11), using gels containing 20% (wt/vol) polyacrylamide. Dried gels were exposed to Bio-max MR film (Kodak) for 1 to 15 days, depending on the experiments. Densitometric quantification of translation products was performed exactly as described previously (5), using multiple exposures of each gel to ensure that the linear response range of the film was respected. The data presented in each figure are representative of at least three independent translation assays.Western blotting analysis. Western blot analysis of eIF4G or PABP was performed exactly as described previously (6) using rabbit anti-eIF4G peptide 7 antisera (for detection of the N-terminal cleavage product of eIF4G) or monoclonal antibody 10E10 (for PABP) as primary antibodies. Membranes were then incubated with horseradish peroxidase-linked goat anti-mouse or anti-rabbit secondary antibodies and were revealed by enhanced chemiluminescence (ECLplus; Amersham) or the commercial DAB peroxidase substrate kit (Vector Laboratories, Inc.).
| |
RESULTS |
|---|
|
|
|---|
Efficient translation of classical cellular mRNAs requires cooperative interplay between the 5' cap structure and 3' poly(A) tail [cap-poly(A) synergy (12, 23, 42, 48)]. We recently described a nuclease-treated, ribosome-depleted rabbit reticulocyte lysate (RRL) cell-free translation system which recapitulates cap-poly(A) synergistic stimulation of cellular mRNA translation in vitro (34). Polyadenylation stimulated translation driven by the one IRES tested in this system, that of the picornavirus EMCV (34). Thus, the aims of the current study were to confirm that polyadenylation stimulates translation driven by all picornaviral IRESes in our ribosome-depleted RRL system and, more importantly, to investigate the molecular mechanisms involved. The flaviviral HCV IRES was also studied, since this viral RNA is nonpolyadenylated and the viral 3' X region has previously been reported to stimulate HCV IRES activity in vitro (20). Toward this end, different cDNAs were constructed which could be used to generate monocistronic mRNAs in which representatives of the three major classes of picornaviral IRESes precede an identical reporter gene (HIV-1 p24) and 3'-UTR (Fig. 1). Two different cDNA templates were generated for each IRES, which differed only by the presence or absence of an A50 tract inserted at the restriction site used for linearization prior to in vitro transcription. A series of similar cDNAs was also constructed to carry the HCV IRES but including a construction with the viral 3' X region, which has previously been reported to stimulate HCV IRES activity in vitro (20).
While the type II cardio- and aphthoviral IRESes and the type III HAV
IRES are functional in an unadulterated RRL system, the type I entero-
and rhinoviral IRESes are virtually inactive in RRL which has not been
supplemented with cytoplasmic extracts from permissive cells such as
HeLa cells (2, 4). Thus, we first verified that a
ribosome-depleted RRL supplemented with a nucleased HeLa cell S10
extract still exhibited cap-poly(A) cooperative stimulation of cellular
mRNA translation. Translation of monocistronic p0p24-derived cellular
mRNAs in standard RRL is strongly stimulated by capping and modestly
stimulated by polyadenylation, and the combined effects of cap and
poly(A) are at best additive (Fig. 2, RRL lanes
[34]). However, when the same RNAs are translated in
ribosome-depleted RRL, the stimulation observed upon capping and
polyadenylation of an mRNA is much greater than the sum of the effects
of cap and poly(A) alone (Fig. 2, ribosome-depleted RRL + H100
lanes, cap-poly(A) synergy of 4.5-fold). Importantly, cap-poly(A)
synergy, although quantitatively reduced, is still observed in
ribosome-depleted RRL supplemented with low concentrations of
nuclease-treated HeLa cell S10 extract (Fig. 2, ribosome-depleted RRL + 2.5% S10 lanes), indicating that the potential effects of polyadenylation on entero- and rhinoviral IRES-driven translation can
be examined in this system.
|
The poly(A) tail stimulates translation driven by picornaviral, but
not a flaviviral, IRESes in ribosome-depleted RRL.
Picornaviral
RNAs are naturally uncapped. Thus, to examine the possible role of
poly(A) in IRES-driven translation initiation, only two different forms
of the various IRES-p24 monocistronic mRNAs, which carry or lack a
3'-terminal homopolymer A50 tail, were generated in vitro
(see Fig. 1 and Materials and Methods). These different mRNAs were then
translated in ribosome-depleted RRL (for the type II EMCV and type III
HAV IRESes and the flaviviral HCV IRES) or in ribosome-depleted RRL
containing 2.5% by volume of nucleased HeLa cell S10 extract (for the
type I PV IRES). This concentration of S10 extract had previously been
determined to be the minimal supplement necessary to activate the PV
IRES in depleted RRL (data not shown). Given that cap-poly(A) synergy on classical mRNAs in the depleted system is extremely sensitive to the
concentrations of added KCl and MgCl2 (8), the
various polyadenylated and nonpolyadenylated IRES-containing
mRNAs were translated at a range of final salt concentrations
(Fig. 3).
|
|
derivatives of a given
IRES-p24 mRNA were evaluated in depleted RRL, in order to measure the
functional stability of the different mRNAs (i.e., the stability of the
actively translated fraction of programming mRNA). Figure
4A depicts the results of such an experiment with mRNAs
carrying the HAV IRES, which in conditions of optimal salt was the most
stimulated of the picornaviral elements upon polyadenylation. The
kinetics of protein synthesis were linear for both the
poly(A)
and poly(A)+ forms of HAVp24 from 25 to 90 min of incubation. Similarly, the kinetics of protein synthesis
were linear for both forms of mRNAs carrying the EMCV and PV IRESes
(data not shown), indicating that the observed positive effects of
poly(A) on translation did not stem from significant differences in
mRNA functional stability. However, in the case of poly(A)+
HAV RNA translation, a lag was observed in the appearance of translation products (Fig. 4A). Thus, it could conceivably be argued
that this RNA was in some way processed before translation could begin.
To examine this possibility, poly(A)+ HAVp24 RNA
reextracted from translation reactions after different times of
incubation, was used to program fresh translation reactions. RNA
extracted after 0 and 60 min of incubation showed identical translation
kinetics (Fig. 4B), with a similar delay in the appearance of
translation products to that observed in the original experiment (compare Fig. 4A and B), suggesting that poly(A)+ HAV RNA
had not been irreversibly processed after 60 min of translation in
ribosome-depleted RRL. While we have no concrete explanation for this
apparent lag, it is possible that the observed delay represents the
time required to assemble initiation complexes on the particularly
inefficient HAV IRES. Interestingly, a similar phenomenon has recently
been reported for translation driven by the HAV IRES in synergistic
HeLa cell extracts (1).
|
The HCV 3' X region is a nonspecific stimulator of
translation.
Translation of mRNAs carrying the HCV IRES in
depleted RRL was very efficient, irrespective of the poly(A) status and
salt concentrations tested (see Fig. 3D). However, it was recently reported that HCV IRES-driven translation could be stimulated in vitro
by the authentic HCV genomic 3' X region (20, 21). Thus,
additional cDNAs were constructed, based on p0p24 (as a control against
nonspecific effects of X) or carrying the HCV IRES, in which the
poly(A) tail was replaced by the 98-nt X region from HCV genotype 1b
(Fig. 1). These cDNAs were transcribed in vitro in either capped and
uncapped forms (for the p0p24 constructs) or only in an uncapped form
(for pHCVp24 constructs), and the corresponding mRNAs were translated
in the depleted RRL system at a variety of final RNA concentrations and
in physiological salt concentrations (Fig. 5).
|
Poly(A)-mediated stimulation of picornaviral IRES-driven
translation is sensitive to the disruption of the eIF4G-PABP
interaction.
We previously demonstrated using the depleted RRL
system that cap-poly(A) synergy on cellular mRNAs requires the
eIF4G-PABP interaction (34). In effect, synergy was
sensitive to the rotavirus NSP3 protein which has been shown to bind
the N-terminal part of eIF4G and to displace PABP from the eIF4F
complex (8, 34, 41). Since picornavirus IRES activity is
clearly influenced by polyadenylation, we examined the effects of the
NSP3 protein on poly(A)-mediated stimulation of translation of the
different IRESp24 mRNAs. Toward this end, ribosome-depleted RRL
translation reactions were preincubated with buffer or 10 µg of
recombinant NSP3 fragment per ml (final concentration) and then
programmed with various IRESp24 or 0p24 mRNAs (Fig. 6A).
We have previously shown that this concentration of NSP3 induces
maximal displacement of PABP from eIF4G when added to RRL (8,
34; data not shown). Indeed, this concentration of recombinant
protein was sufficient to abolish cap-poly(A) synergy on a classical
cellular mRNA in the depleted RRL system and to specifically reduce the
translation efficiency of poly(A)+ 0p24 mRNA to approach
that of its poly(A)
counterpart (Fig. 6B). Conversely,
NSP3 had no effect on the translation efficiency of
poly(A)
or poly(A)+ versions of HCV
IRES-carrying mRNAs and, more interestingly, had no significant
inhibitory effect on the stimulation of HCV IRES-driven translation
afforded by the 3' X region (Fig. 6C). Importantly, NSP3 dramatically
reduced the poly(A)-mediated stimulation of PV, HAV, and EMCV
IRES-driven translation (Fig. 6A). Thus, as is the case for cellular
mRNAs, the eIF4G-PABP interaction is indispensable for the poly(A)
stimulation of picornaviral IRES-driven translation. It should also be
noted that NSP3 reproducibly reduced translation efficiency of the
poly(A)
form of mRNAs carrying the type I PV and
especially the type III HAV IRESes [Fig. 6A, compare 0 and N lanes for
each poly(A)-mRNA]. These effects are unlikely to result from a
nonspecific inhibitory activity of NSP3 on translation, given the
insensitivity of the HCV IRES and EMCVp24 poly(A)
mRNA
translation to this protein. Instead, we believe that this inhibition
reflects the sensitivity of the HAV IRES to the conformation of eIF4F,
which is possibly altered by displacement of PABP and binding of NSP3
(Borman et al., submitted).
|
Effects of NSP3 and 2A on poly(A)-mediated stimulation of
IRES-driven translation.
The fact that the poly(A) mediated
stimulation of type I PV IRES-driven translation requires the integrity
of the eIF4G-PABP interaction raises important questions concerning the
pertinence of poly(A)-mediated stimulation during the polioviral
infectious cycle, since both PABP and eIF4G are cleaved by the PV 2A
proteinase in the infected cell (25, 27). Thus, we
examined the efficiency of IRES-driven translation in ribosome-depleted
RRL which had been preincubated with either the NSP3 protein, the human
rhinovirus 2A proteinase, or both NSP3 and 2A together (Fig.
7). The concentration of 2A proteinase used was
sufficient to cleave all eIF4G in the depleted RRL extract (Fig. 7D,
left panel). In contrast, although this 2A proteinase, like its PV
counterpart, can cleave PABP upon prolonged incubation at 37°C
(Borman et al., submitted) no such cleavage was evidenced under the
conditions of our translation assays (Fig. 7D, right panel).
|
PVp24 mRNA translation [ca. 2.5-fold
stimulation; Fig. 7A, compare lanes 0 and P, poly(A)
],
as described previously (2, 6, 53). This stimulation was
insensitive to inclusion of recombinant NSP3 in the reactions [compare
lanes 0, P, and NP, poly(A)
]. A similar degree of
stimulation (threefold) was afforded by polydenylation of the PVp24
mRNA in this particular experiment in depleted RRL [compare lanes 0 for poly(A)
and poly(A)+], and this
stimulation was abolished upon treatment with NSP3. However, the
combination of 2A proteinase in translation reactions and a poly(A)
tail at the PVp24 mRNA 3' end did not result in an enhanced translation
efficiency compared to that obtained with either poly(A) tail or 2A
alone [Fig. 7A, compare lanes P and 0, poly(A)+, and lane
P, poly(A)
, to lane 0, poly(A)
].
Furthermore, poly(A)+ PVp24 mRNA translation in the
presence of 2A proteinase was resistant to NSP3 inhibition [Fig. 7A,
compare lanes NP and N, poly(A)+], indicating that, upon
cleavage of eIF4G, polyadenylation no longer conferred an advantage on
PV IRES-driven translation.
To examine whether this situation was specific to IRESes derived from
viruses that cleave eIF4G, the same approach was carried out using
EMCVp24 (Fig. 7B) or HAVp24 RNAs (Fig. 7C). For HAVp24 RNA, it could
clearly be seen that cleavage of eIF4G inhibited rather than stimulated
translation (Fig. 7C, compare lanes 0 and P) and that indeed the
stimulation observed upon polyadenylation was abrogated by protease
treatment of extracts [compare lanes 0 and P, poly(A)+,
with lane 0, poly(A)
; Fig. 7C]. For EMCVp24 RNA
translation, the situation was less clear-cut. Cleavage of eIF4G
slightly stimulated (ca. 1.5-fold) poly(A)
EMCVp24 RNA
translation [compare lanes 0 and P, poly(A)
; Fig. 7B].
Conversely, protease treatment of extracts substantially reduced, but
did not completely abolish, the stimulatory effects of polyadenylation
[compare lanes 0 and P, poly(A)+; Fig. 7B], a partial
effect which remains difficult to explain clearly at present. Thus,
cleavage of eIF4G significantly reduced the stimulatory effects of
polyadenylation on translation driven by all of the picornaviral IRESes
examined here but dramatically stimulated only PV IRES-driven translation.
| |
DISCUSSION |
|---|
|
|
|---|
The classical closed-loop model for translation initiation on capped and polyadenylated cellular mRNAs dictates that efficiently translated mRNAs are noncovalently circularized via a cap-eIF4E-eIF4G-PABP-poly(A) tail interaction (13, 23, 43). Although picornaviral RNAs are polyadenylated, they are naturally uncapped and translated following IRES-driven internal ribosome entry. Nevertheless, we previously showed that EMCV IRES-driven translation in a poly(A)-dependent RRL translation system was significantly stimulated upon polyadenylation of the RNA (34). This result was extended recently to include the PV and HAV IRESes by Bergamini et al. (1) in a poly(A)-dependent non-nucleased HeLa cell extract. Unfortunately, translation activity in these latter extracts was abolished by nuclease treatment. Thus, the presence of translationally active endogenous mRNAs precluded a dissection of the molecular mechanism of poly(A) stimulation of IRES-driven translation.
Here we have used our recently described poly(A)-dependent RRL extracts to address this question. Since poly(A) dependency in the RRL system results from partial depletion of ribosomes and their associated initiation factors to yield a competitive translational environment, the complication of the presence of heterologous mRNAs is circumvented (34). An additional advantage of the depleted RRL system is that translating mRNAs are extremely stable (8; this work), opening the possibility of analyzing uncapped IRES-carrying mRNAs without the need for nonphysiological 5'-end modification. Effectively, a limitation of the previously described HeLa cell extract (1) is that uncapped mRNAs were extremely unstable and had to be artificially capped with an ApppG cap analogue.
Picornavirus IRES-driven translation was stimulated by polyadenylation in the depleted RRL system. Under the optimal conditions for each IRES, the degree of stimulation ranged from approximately 3- to 4-fold (for EMCV) and 4- to 6-fold (for PV) to more than 10-fold (for HAV), results in good quantitative agreement with the results of Bergamini et al. (1), who observed 3-fold (for EMCV) and >10-fold stimulation indices with HAV and PV. It is possible that the more modest poly(A) stimulation of PV IRES-driven translation reported here stems from the necessity for PV IRES activity to include non-ribosome-depleted HeLa cell extract in the ribosome-depleted RRL system, which rendered the system less poly(A)-dependent as measured with control capped and/or polyadenylated mRNAs (Fig. 2; see also reference 8). The effects of polyadenylation on picornavirus IRES-driven translation reported here were specific, in that they were not transposable to the unrelated flaviviral HCV IRES (HCV viral RNA is not naturally polyadenylated) and did not result from any detectable differences in functional mRNA stability. It should also be noted that the different picornaviral IRESes are physiologically active in driving internal ribosome entry in the depleted RRL system. First, translation driven by the different uncapped, polyadenylated IRESes was some 20 to 40 times more efficient than an uncapped, polyadenylated control without an IRES (see, for example, Fig. 6). Second, the different IRESes were still functional when placed as the intercistronic spacer of a dicistronic mRNA (data not shown). Third, mutations in the PV IRES known to attenuate poliovirus vaccine strains were still deleterious for translation in the depleted RRL system (C. E. Malnou and K. M. Kean, unpublished data).
Importantly, poly(A)-mediated stimulation of picornaviral IRES-driven translation was sensitive to MgCl2 and KCl concentrations and increased as near-physiological salt concentrations were attained, as we had previously shown for cap-poly(A) synergy on cellular mRNAs translated in this system (8). In addition, the salt optima of the various IRES types differed significantly. While this finding in itself is not necessarily surprising (see, for example, reference 2), important differences should be noted between the optima measured in standard RRL using nonpolyadenylated RNAs and those presented here with poly(A)+ RNAs. The first concerns translation driven from the PV IRES which had been found to be extremely intolerant of MgCl2 in standard RRL, a finding which was difficult to encompass within the context of the infected cell. In the depleted RRL system, translation driven from this element tolerates relatively high concentrations of MgCl2. The second difference concerns the HAV IRES, for which discrepancies had previously been observed between efficient activity under most salt concentrations in standard RRL (2) and virtual inactivity in the intact cell (7). The current study shows that the HAV IRES appears poorly capable of driving translation in extracts in which ribosomes and/or initiation factors are limiting and in which salt concentrations are near physiological. Thus, with respect to both the PV and the HAV IRESes, translation of polyadenylated RNAs in the depleted RRL system appears to more closely reproduce the physiological situation than does translation of nonpolyadenylated RNAs in the standard, nondepleted RRL system.
As mentioned above, the novelty of the depleted RRL system, compared to
the other poly(A)-dependent cell extracts described to date, is the
absence of intact, endogenous competitor mRNAs. This makes it
particularly appropriate for the dissection of the molecular mechanisms
underlying poly(A)-mediated translation stimulation. In effect, in
extracts which rely on mRNA competition to induce poly(A) dependency,
any alterations of components of the translation machinery targeted to
affect such poly(A) dependency cannot distinguish between the
experimental and competitor RNAs. Thus, one cannot separate global
nonspecific reduction of translation efficiency from specific effects
on poly(A) dependency. In contrast, in the depleted RRL system,
specific effects on poly(A) dependency are easily discerned (see, for
example, Fig. 6). Thus, we employed the rotavirus NSP3 protein which
interacts with eIF4G and evicts PABP from eIF4F to analyze the role of
the eIF4G-PABP interaction in poly(A)-mediated stimulation of
picornaviral IRES-driven translation. Poly(A) stimulation of
translation driven by all three types of picornavirus IRES was
abolished by recombinant NSP3, demonstrating that the integrity of the
eIF4G-PABP interaction is required for this effect of poly(A). Thus,
the mechanism of mRNA 5'- to 3'-end cross talk is functionally
conserved between capped-polyadenylated and picornavirus
IRES-carrying-polyadenylated mRNAs. However, one cannot invoke an
eIF4E-cap interaction in the latter case. Rather, it is tempting to
speculate that picornaviral mRNAs are circularized for translation via
an IRES-eIF4G-PABP-poly(A) interaction at least early after infection
(see Fig. 8), and we are currently evaluating this
hypothesis directly. Indeed, the intact eIF4G molecule or a proteolytic
C-terminal cleavage product of eIF4G has been shown to bind an internal
region(s) of the different picornaviral IRESes (33, 39;
Borman et al., submitted; for a review, see reference 26).
|
An important aspect of the results presented here concerns the effects of the human rhinovirus 2A proteinase, which cleaves eIF4G, on poly(A) stimulation of PV IRES activity. Translation driven by the PV IRES could be stimulated independently by either 2A proteinase or poly(A), in a nonadditive manner. In effect, when PV IRES RNAs were translated in the presence of 2A proteinase, no additional stimulation was achievable upon polyadenylation. Most interestingly, translation of poly(A) plus PVp24 RNA was then resistant to NSP3. Thus, since the 2A proteinase did not cleave PABP under our reaction conditions, one can conclude that poly(A) stimulation is abolished upon cleavage of eIF4G. As host cell eIF4G is cleaved early in the PV infectious cycle (25), the results presented here strongly suggest that poly(A)-mediated circularisation of entero- and rhinovirus mRNA is important only for the first rounds of translation in the highly competitive cellular environment, before the shutoff of host cell translation. This mode of translation initiation would then be jettisoned in favor of IRES-driven translation mediated by the C-terminal cleavage product of eIF4G, which does not include the PABP interaction domain (6) (Fig. 8). Conversely, since eIF4G is not cleaved by HAV or EMCV, one can suggest that the corresponding viral genomes might remain in a circular form for translation throughout infection, with or without interruption of cellular mRNA circularization depending on the particular virus (Fig. 8).
Of the IRESes tested here, the HCV element was unique in being stimulated by a 3'-end sequence in a PABP-eIF4G-independent manner. Although translation stimulation affected by the authenthic viral 3' X region appeared not to be specific to the HCV IRES, it was totally resistant to NSP3. In fact, Ito and Lai suggested that HCV RNAs could be circularized by simultaneous binding of PTB to the HCV IRES and 3' X region (21). Further studies will be necessary to test this hypothesis.
Finally, the apparent conservation of 5'- to 3'-end cross talk between capped and polyadenylated cellular mRNAs and picornaviral RNAs is likely to be particularly pertinent to the mechanism of translation of nonclassical cellular mRNAs. In effect, recent estimations suggested that as many as 10% of polyadenylated cellular mRNA species might possess IRESes. Several such cellular IRESes have been shown to be activated in vivo during stress or apoptosis (see, for example, reference 47), conditions in which eIF4G undergoes specific, limited proteolysis in a manner similar to that observed upon picornavirus infection (10). It remains to be determined whether such cellular IRES-carrying mRNAs can be encompassed within a closed-loop model of translation initiation. The translation systems described here should prove a very useful tool to address these questions.
| |
ACKNOWLEDGMENTS |
|---|
We are grateful to Cécile Malnou and Sylvie van der Werf for their interest in this work and to Richard Paul for critical reading of the manuscript. We thank Didier Poncet and Nathalie Castagné for the gift of purified rotavirus NSP3 protein, Tim Skern for purified recombinant 2A proteinase, Bob Rhoads for antibodies raised against eIF4G, and M. Görlach for antibodies against PABP. We also thank Matthias Hentze and Encarna Martinez-Salas for communicating unpublished results.
This work was funded in part by a grant from the MRENT (réseau HCV). We also acknowledge support from the Programme de Recherche Clinique de l'Institut Pasteur, from a Contrat d'Incitation à la Recherche en vue d'Applications (CCV 8) from the Pasteur Institute, from the Association Française contre les Myopathies (AFM), and from the Agence Nationale de Recherches sur le SIDA (ANRS). Y.M.M. is supported by a doctoral fellowship from the Association pour la Recherche sur le Cancer (ARC).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: U.P. Régulation de la Traduction Eucaryote et Virale, CNRS URA 1966, Institut Pasteur, 25 rue du Dr. Roux, 75724 Paris Cedex 15, France. Phone: (33) 1-40-61-33-55. Fax: (33) 1-40-61-30-45. E-mail: kathiemb{at}pasteur.fr.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Bergamini, G., T. Preiss, and M. W. Hentze. 2000. Picornavirus IRESes and the poly(A) tail jointly promote cap-independent translation in a mammalian cell-free system. RNA 6:1773-1780[Abstract]. |
| 2. |
Borman, A. M.,
J.-L. Bailly,
M. Girard, and K. M. Kean.
1995.
Picornavirus internal ribosome entry segments: comparison of translation efficiency and the requirements for optimal internal initiation in vitro.
Nucleic Acids Res.
23:3656-3663 |
| 3. | Borman, A. M., F. G. Deliat, and K. M. Kean. 1994. Sequences within the poliovirus internal ribosome entry segment control viral RNA replication. EMBO J. 13:3149-3157[Medline]. |
| 4. | Borman, A., and R. J. Jackson. 1992. Initiation of translation of human rhinovirus RNA: mapping the internal ribosome entry site. Virology 188:685-696[CrossRef][Medline]. |
| 5. | Borman, A. M., and K. M. Kean. 1997. Intact eukaryotic initiation factor 4G is required for hepatitis A virus internal initiation of translation. Virology 237:129-136[CrossRef][Medline]. |
| 6. | Borman, A. M., R. Kirchweger, E. Ziegler, R. E. Rhoads, T. Skern, and K. M. Kean. 1997. eIF4G and its proteolytic cleavage products: Effect on initiation of protein synthesis from capped, uncapped and IRES-containing mRNAs. RNA 3:186-196[Abstract]. |
| 7. |
Borman, A. M.,
P. Le Mercier,
M. Girard, and K. M. Kean.
1997.
Comparison of picornaviral IRES-driven internal initiation of translation in cultured cells of different origins.
Nucleic Acids Res.
25:925-932 |
| 8. |
Borman, A. M.,
Y. M. Michel, and K. M. Kean.
2000.
Biochemical characterisation of cap-poly(A) synergy in rabbit reticulocyte lysates: the eIF4G-PABP interaction increases the functional affinity of eIF4E for the capped mRNA 5' end.
Nucleic Acids Res.
28:4068-4075 |
| 9. | Carter, M. S., K. M. Kuhn, and P. Sarnow. 2000. Cellular internal ribosome entry site elements and the use of cDNA microarrays in their investigation, p. 615-635. In J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control of gene expression. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 10. | Clemens, M. J., M. Bushell, and S. J. Morley. 1998. Degradation of eukaryotic polypeptide chain initiation factor (eIF) 4G in response to induction of apoptosis in human lymphoma cell lines. Oncogene 17:2921-2931[CrossRef][Medline]. |
| 11. |
Dasso, M. C., and R. J. Jackson.
1989.
Efficient initiation of mammalian mRNA translation at a CUG codon.
Nucleic Acids Res.
17:6485-6497 |
| 12. |
Gallie, D. R.
1991.
The cap and poly(A) tail function synergistically to regulate mRNA translational efficiency.
Genes Dev.
5:2108-2116 |
| 13. | Gallie, D. R. 1998. A tale of two termini: a functional interaction between the termini of an mRNA is a prerequisite for efficient translation initiation. Gene 216:1-11[CrossRef][Medline]. |
| 14. | Gingras, A.-C., B. Raught, and N. Sonenberg. 1999. eIF4 initiation factors: effectors of mRNA recruitment to ribosomes and regulators of translation. Annu. Rev. Biochem. 68:913-963[CrossRef][Medline]. |
| 15. |
Goldstein, N. O.,
I. U. Pardoe, and A. T. Burness.
1976.
Requirement of an adenylic acid-rich segment for the infectivity of encephalomyocarditis virus RNA.
J. Gen. Virol.
31:271-276 |
| 16. | Görlach, M., C. G. Burd, and G. Dreyfuss. 1994. The mRNA poly(A)-binding protein: localization, abundance, and RNA-binding specificity. Exp. Cell Res. 211:400-407[CrossRef][Medline]. |
| 17. | Hershey, J. W. B., and W. C. Merrick. 2000. Pathway and mechanism of initiation of protein synthesis, p. 33-88. In J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control of gene expression. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 18. |
Hruby, D. E., and W. K. Roberts.
1977.
Encephalomyocarditis virus RNA. II. Polyadenylic acid requirement for efficient translation.
J. Virol.
23:338-344 |
| 19. | Imataka, H., A. Gradi, and N. Sonenberg. 1998. A newly identified N-terminal amino acid sequence of human eIF4G binds poly(A)-binding protein and functions in poly(A)-dependent translation. EMBO J. 17:7480-7489[CrossRef][Medline]. |
| 20. |
Ito, T.,
S. M. Tahara, and M. C. Lai.
1998.
The 3' untranslated region of hepatitis C virus enhances translation from an internal ribosomal entry site.
J. Virol.
72:8789-8796 |
| 21. | Ito, T., and M. C. Lai. 1999. An internal polypyrimidine tract binding protein site in the hepatitis C virus RNA attenuates translation which is relieved by the 3' untranslated sequence. Virology 254:288-296[CrossRef][Medline]. |
| 22. | Jackson, R. J., and A. Kaminski. 1995. Internal initiation of translation in eukaryotes: the picornavirus paradigm and beyond. RNA 1:985-1000[Medline]. |
| 23. | Jacobson, A. 1996. Poly(A) metabolism and translation: the closed-loop model, p. 451-480. In J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 24. | Jansen, R. W., J. E. Newbold, and S. M. Lemon. 1988. Complete nucleotide sequence of a cell culture-adapted variant of hepatitis A virus: comparison with wild-type virus with restricted capacity for in vitro replication. Virology 163:299-307[CrossRef][Medline]. |
| 25. |
Joachims, M.,
P. C. Van Breugel, and R. E. Lloyd.
1999.
Cleavage of poly(A)-binding protein by enterovirus proteases concurrent with inhibition of translation in vitro.
J. Virol.
73:718-727 |
| 26. | Kean, K. M., Y. M. Michel, and A. M. Borman. 1999. Viral exceptions to 5'-end dependent initiation of translation: is there really a difference in the mechanism of ribosome recruitment to capped and IRES containing mRNAs. Curr. Top. Virol. 1:191-201. |
| 27. |
Kerekatte, V.,
B. D. Keiper,
C. Badorff,
A. Cai,
K. U. Knowlton, and R. E. Rhoads.
1999.
Cleavage of poly(A)-binding protein by coxsackievirus 2A protease in vitro and in vivo: another mechanism for host protein synthesis shutoff?
J. Virol.
73:709-717 |
| 28. |
Kirchweger, R.,
E. Ziegler,
B. J. Lamphear,
D. Waters,
H. D. Liebig,
W. Sommergruber,
F. Sobrino,
C. Hohenadl,
D. Blaas,
R. E. Rhoads, and T. Skern.
1994.
Foot-and-mouth disease virus leader proteinase: purification of the Lb form and determination of its cleavage site on eIF4G.
J. Virol.
68:5677-5684 |
| 29. | Kozak, M. 1999. Initiation of translation in prokaryotes and eukaryotes. Gene 234:187-208[CrossRef][Medline]. |
| 30. |
Lamphear, B. J.,
R. Kirchweger,
T. Skern, and R. E. Rhoads.
1995.
Mapping of functional domains in eukaryotic protein synthesis initiation factor 4G (eIF4G) with picornaviral proteases. Implications for cap-dependent and cap-independent translational initiation.
J. Biol. Chem.
270:21975-21983 |
| 31. |
Le, H.,
R. L. Tanguay,
M. L. Balasta,
C. C. Wei,
K. S. Browning,
A. M. Metz,
D. J. Goss, and D. R. Gallie.
1997.
Translation initiation factors eIF-iso4G and eIF-4B interact with the poly(A)-binding protein and increase its RNA binding activity.
J. Biol. Chem.
272:16247-16255 |
| 32. | Liebig, H. D., E. Ziegler, R. Yan, K. Hartmuth, H. Klump, H. Kowalski, D. Blaas, W. Sommergruber, L. Frasel, B. Lamphear, R. E. Rhoads, E. Kuechler, and T. Skern. 1993. Purification of two picornaviral 2A proteinases: interaction with eIF4 and influence on in vitro translation. Biochemistry 32:7581-7588[CrossRef][Medline]. |
| 33. | Lopez de Quinto, S., and E. Martinez-Salas. 2000. Interaction of the eIF4G initiation factor with the aphthovirus IRES is essential for internal translation initiation in vivo. RNA 6:1380-1392[Abstract]. |
| 34. |
Michel, Y. M.,
D. Poncet,
M. Piron,
K. M. Kean, and A. M. Borman.
2000.
Cap-poly(A) synergy in mammalian cell-free extracts: investigation of the requirements for poly(A)-mediated stimulation of translation initiation.
J. Biol. Chem.
275:32268-32276 |
| 35. | Morley, S. J., P. S. Curtis, and V. M. Pain. 1997. Translation's mystery factor begins to yield its secrets. RNA 3:1085-1104[Medline]. |
| 36. | Ohlmann, T., M. Rau, V. M. Pain, and S. J. Morley. 1996. The C-terminal domain of eukaryotic protein synthesis initiation factor (elF) 4G is sufficient to support cap-independent translation in the absence of eIF4E. EMBO J. 15:1371-1382[Medline]. |
| 37. | Pestova, T. V., C. U. T. Hellen, and I. N. Shatsky. 1996. Canonical eukaryotic initiation factors determine initiation of translation by internal ribosomal entry. Mol. Cell. Biol. 16:6859-6869[Abstract]. |
| 38. |
Pestova, T. V.,
I. N. Shatsky,
S. P. Fletcher,
R. J. Jackson, and C. U. T. Hellen.
1998.
A prokaryotic-like mode of cytoplasmic eukaryotic ribosome binding to the initiation codon during internal translation initiation of hepatitis C and classical swine fever virus RNAs.
Genes Dev.
12:67-83 |
| 39. | Pestova, T. V., I. N. Shatsky, and C. U. T. Hellen. 1996. Functional dissection of eukaryotic initiation factor 4F: the 4A subunit and the central domain are sufficient to mediate internal entry of 43S preinitiation complexes. Mol. Cell. Biol. 16:6870-6878[Abstract]. |
| 40. |
Piron, M.,
T. Delaunay,
J. Grosclaude, and D. Poncet.
1999.
Identification of the RNA-binding, dimerization and eIF4GI-binding domains of rotavirus nonstructural protein NSP3.
J. Virol.
73:5411-5421 |
| 41. | Piron, M., P. Vende, J. Cohen, and D. Poncet. 1998. Rotavirus RNA-binding protein NSP3 interacts with eIF4GI and evicts the poly(A) binding protein from eIF4F. EMBO J. 17:5811-5821[CrossRef][Medline]. |
| 42. | Preiss, T., and M. W. Hentze. 1998. Dual function of the messenger RNA cap structure in poly(A)-tail-promoted translation in yeast. Nature 392:516-520[CrossRef][Medline]. |
| 42a. | Raught, B., A.-C. Gingras, and N. Sonenberg. 2000. Regulation of ribosomal recruitment in eukaryotes, p. 807-825. In J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control of gene expression. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 43. | Sachs, A. B., P. Sarnow, and M. W. Hentze. 1997. Starting at the beginning, middle and end: translation initiation in eukaryotes. Cell 89:831-838[CrossRef][Medline]. |
| 44. |
Sarnow, P.
1989.
Role of 3'-end sequences in infectivity of poliovirus transcripts made in vitro.
J. Virol.
63:467-470 |