Previous Article | Next Article 
Molecular and Cellular Biology, July 2001, p. 4129-4139, Vol. 21, No. 13
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.13.4129-4139.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
ATR-Mediated Checkpoint Pathways Regulate
Phosphorylation and Activation of Human Chk1
Hui
Zhao1 and
Helen
Piwnica-Worms1,2,*
Department of Cell Biology and
Physiology1 and Howard Hughes Medical
Institute,2 Washington University School of
Medicine, St. Louis, Missouri 63110-1093
Received 7 February 2001/Returned for modification 19 March
2001/Accepted 23 March 2001
 |
ABSTRACT |
Chk1 is an evolutionarily conserved protein kinase that regulates
cell cycle progression in response to checkpoint activation. In this
study, we demonstrated that agents that block DNA replication or cause
certain forms of DNA damage induce the phosphorylation of human Chk1.
The phosphorylated form of Chk1 possessed higher intrinsic protein
kinase activity and eluted more quickly on gel filtration columns.
Serines 317 and 345 were identified as sites of phosphorylation in
vivo, and ATR (the ATM- and Rad3-related protein kinase) phosphorylated
both of these sites in vitro. Furthermore, phosphorylation of Chk1 on
serines 317 and 345 in vivo was ATR dependent. Mutants of Chk1
containing alanine in place of serines 317 and 345 were poorly
activated in response to replication blocks or genotoxic stress in
vivo, were poorly phosphorylated by ATR in vitro, and were not found in
faster-eluting fractions by gel filtration. These findings demonstrate
that the activation of Chk1 in response to replication blocks and
certain forms of genotoxic stress involves phosphorylation of serines
317 and 345. In addition, this study implicates ATR as a direct
upstream activator of Chk1 in human cells.
 |
INTRODUCTION |
Checkpoints are signaling pathways
that monitor the integrity and replication status of the genetic
material before cells commit to either replicate (in S phase) or
segregate (in mitosis) their DNA (27). Upon activation,
checkpoints interface with cyclin-Cdk complexes to block cell
cycle progression or alternatively to induce cell death. The DNA
replication checkpoint monitors S-phase completion and prevents mitosis
in its absence. The DNA damage checkpoint monitors the integrity of the
genome and arrests the cell cycle either in G1
before DNA replication (termed the G1 DNA damage
checkpoint), in S phase (the S-phase DNA damage checkpoint), or in
G2 before mitosis (the G2
DNA damage checkpoint). Eukaryotic cells activate an evolutionarily
conserved set of checkpoint proteins that rapidly induce cell cycle
arrest to prevent replication or segregation of damaged DNA before
repair is completed.
A key component of the DNA damage checkpoint is ATM (ataxia
telangiectasia-mutated), a 370-kDa protein kinase (58).
The ATM gene is mutated in the human genetic disorder ataxia
telangiectasia (58). Cell lines derived from patients
lacking ATM are radiosensitive and exhibit defects in checkpoint
responses to ionizing radiation (IR), including p53-dependent
G1 cell cycle arrest and p53-independent S and
G2 cell cycle arrests (31). The
kinase activity of ATM is activated in response to double-stranded DNA
breaks, and ATM targets several effectors of checkpoint control,
including Cds1 (also known as Chk2), Brca1, p95 (nbs1), p53, and
Mdm2 (2, 5, 8-10, 15, 23, 33, 34, 41, 42, 47, 69, 74). Checkpoint responses to UV light and base-damaging agents are normal in
cells lacking ATM. Taken together, these findings point to a
seminal role for ATM in the IR-induced DNA damage checkpoint.
ATR (the ATM- and Rad3-related protein kinase) also contributes to
checkpoint control in eukaryotes (13, 32). Unlike
ATM, deletion of ATR in mice results in an
embryonic lethal phenotype indicating that ATR is an
essential gene (6, 17). Another feature that distinguishes
these two kinases is their sensitivity to different types of checkpoint
signals. As mentioned above, cells lacking ATM are hypersensitive to
IR, but not to UV or hydroxyurea (HU), whereas cells overexpressing a
kinase-inactive form of ATR are sensitive to UV and HU, as well as to
IR. This suggests that ATR plays a more prominent role than ATM during
the cellular response to unreplicated DNA (induced by agents such as
HU) and to certain DNA-damaging agents, including UV light (14,
68). However, overexpression of ATR complements the
radioresistant DNA synthesis defect of cells lacking ATM, demonstrating
that these two kinases have overlapping functions in vivo. In support
of this, ATM and ATR have been shown to have similar kinase
specificities (35, 52). Both prefer phosphorylating serine
or threonine residues that are followed by glutamine (SQ/TQ motifs),
and as such, ATM and ATR have overlapping substrate specificity in
vivo. Examples of substrates shared by ATM and ATR include p53 and
Brca1 (40, 62, 63).
Another potential subsrate of ATR is the human Chk1 protein kinase.
Chk1 was first identified in fission yeast as an essential component of
the DNA damage checkpoint (1, 66). An additional role for
Chk1 in the DNA replication checkpoint was revealed when fission yeast
cells lacking both Chk1 and a second checkpoint kinase, Cds1, were
found to advance into mitosis with unreplicated DNA (4, 43,
72). Homologs of Chk1 have also been found in humans,
Drosophila melanogaster,
Caenorhabditis elegans, budding yeast, and Xenopus (20, 21, 38, 50, 55, 60). In
humans, fission yeast, and Xenopus, Chk1 has been proposed
to regulate the G2 checkpoint by phosphorylating
the Cdc25 protein phosphatase on a residue or residues that facilitate
the binding of 14-3-3 proteins (38, 54, 56, 72, 73).
Like ATR, Chk1 has been shown to be an essential
gene in mice (6, 17, 44, 61). These findings unveil
essential functions for both ATR and Chk1 in the absence of
environmentally imposed genotoxic stress. Embryos and conditional ES
cell lines lacking Chk1 also exhibit defective checkpoint responses to
replication blocks and DNA-damaging agents, establishing a checkpoint
function for mammalian Chk1 in mice (44, 61). Evidence
that Chk1 contributes to G2 checkpoint control in
human cells comes from studies showing that agents such as UCN-01 and
SB-218078, which are potent inhibitors of Chk1, abrogate
G2 checkpoint function in human cells (7, 25, 29).
Chk1 is a component of signaling pathways that respond to structures
characteristic of DNA damage and/or incomplete DNA replication. In
fission yeast, Chk1 responds to DNA damage induced by either IR or UV,
and Chk1 also functions in the DNA replication checkpoint (4, 22,
43, 66, 67, 72). Xenopus Chk1 responds to DNA
replication blocks and UV damage, but not to DNA with double-strand breaks, which is characteristic of gamma-irradiated DNA (26, 37). The regulation of Chk1 is perhaps best characterized in Xenopus, where it has been demonstrated that Chk1 is
phosphorylated and activated by ATR and that the ATR-Chk1 pathway
responds to unreplicated DNA and UV-damaged DNA (26). In
the case of human Chk1, there is controversy concerning not only what
types of DNA structures it responds to, but also whether its kinase
activity is elevated in response to genotoxic stress. Some studies have reported that the electrophoretic mobility of human Chk1 is retarded after exposure to IR (7, 44, 56), HU (7, 44),
and UV (44, 46). Other studies failed to observe changes
in the electrophoretic mobility of Chk1 when cells were treated with these agents (30). In addition, two studies have reported
slight increases in Chk1 kinase activity in response to UV and BNP1350, a topoisomerase I inhibitor (46, 71), while other studies have reported that the kinase activity of human Chk1 is not altered in
response to genotoxic stress (30, 76). Finally, human Chk1 has been shown to be phosphorylated on serine 345 when cells are treated with UV, IR, or HU in an ATR-dependent manner
(44). However, it is not known if additional sites become
phosphorylated during genotoxic stress, if phosphorylation contributes
to Chk1 activity, or if human Chk1 is a direct target of ATR.
In this study, we investigated the regulation of human Chk1 in response
to different types of genotoxic stress. We report that human Chk1 is
phosphorylated on serines 317 and 345 in response to checkpoint
activation. The kinase activity of human Chk1 is activated upon
phosphorylation of serines 317 and 345, and the phosphorylated,
activated form of Chk1 elutes more quickly on gel filtration columns.
Finally, we report that ATR directly phosphorylates human Chk1 on
serines 317 and 345 in vitro and that the phosphorylation of these
residues is ATR dependent in vivo.
 |
MATERIALS AND METHODS |
Cell lines
293 and HeLa cells were grown in
Dulbecco's modified Eagle's medium (DMEM; Gibco) supplemented with
10% fetal bovine serum (FBS), 100 U (each) of penicillin and
streptomycin per ml, and 1 mM glutamine (culture medium). AT22IJE T
cells expressing ATM (AT+) or not expressing ATM
(AT
) (77) were cultured in a mixture of
DMEM, 10% FBS, 100 U of penicillin and streptomycin per ml, 1 mM
glutamine, and 100 µg of hygromycin per ml. U2OS cells were grown in
modified McCoy's 5A medium (Gibco) supplemented with 10% FBS, 100 U
of penicillin and streptomycin per ml, and 1 mM glutamine.
Antibodies.
Chk1 was detected with a rabbit polyclonal
antibody raised against bacterially-produced glutathione
S-transferase (GST)-Chk1 or with commercial monoclonal
(SC8408) or polyclonal (SC7898) antibodies purchased from Santa Cruz
Biotechnology. Chk1 fusion proteins were precipitated with either
anti-c-Myc (9E10)-agarose conjugate (Santa Cruz Biotechnology) or
anti-Flag M2 antibody-agarose affinity gel (Sigma Chemical Co.) and
detected by Western blotting with c-myc polyclonal antibody (A-14;
Santa Cruz Biotechnology). Bound primary antibodies were detected with
either horseradish peroxidase (HRP)-conjugated goat anti-mouse antibody
(ICN/CAPPEL) or HRP-rat anti-rabbit antibody (Zymed), and proteins
were visualized by chemiluminescence with the ECL enhanced
chemiluminescence reagent (Amersham). Antibodies specific for Chk1
phosphorylated on serine 317 were generated by immunization of rabbits
with the phosphopeptide C-VKYSSpSQPEPRT coupled to keyhole limpet hemocyanin.
Generation of recombinant adenoviruses.
Wild-type and mutant
forms of Chk1 were cloned as Flag-tagged fusions into the adenovirus
shuttle vector pAdTrack-CMV (cytomegalovirus) (28). Chk1
(wild type and mutants) cDNAs were amplified with forward primer 3 containing the Flag tag and a KpnI site
(5'-ATAGGTACCATGGACTATAAGGACGACGATGATAAGGCAGTGC CCTTTGAGGAAG-3')
and reverse primer 4 containing a stop codon and an
XbaI site (5'-ATATCTAGATCATGTGGCAGGAAGCC). PCR
products were digested with KpnI and XbaI and
cloned into pAdTrack-CMV. The pAdTrack-CMV-based plasmids encoding
wild-type and mutant Chk1 proteins were cotransformed with pAdEasy-1
into Escherichia coli BJ5183 to achieve homologous
recombination. Recombinant adenoviruses were generated and propagated
with the pAdEasy system as described previously (28).
Generation of recombinant baculovirus encoding His-Chk1 and
affinity purification of Chk1 antibody.
Chk1 was amplified by PCR
with pAdTrack-CMV-Flag-Chk1(wild type) as template with forward primer
5'-GGGAATTCGGTGGAGTCATGGCAGTGC CC and reverse primer
5'-GGGGTACCCTGTGGCAGGAAGCC. The PCR product was digested
with EcoRI and KpnI and ligated into pFASTBACHTa (Gibco BRL). Recombinant baculovirus encoding
His6-Chk1 was generated with the BAC-TO-BAC
Baculovirus Expression System (Gibco BRL) and protocols suggested by
the manufacturer. His6-Chk1 protein was purified
from infected Sf9 insect cells on Ni-nitrilotriacetic acid agarose
(Qiagen), and purified His6-Chk1 was eluted in a mixture of 50 mM Tris-Cl (pH 8.0), 150 mM NaCl, 200 mM imidazole, and 1 mM dithiothreitol (DTT). Four milligrams of
His6-Chk1 was coupled to 2 g of
CNBr-activated Sepharose 4B (Sigma Chemical Co.) according to the
manufacturer's recommendations. Antibodies generated against GST-Chk1
were applied to the column, and Chk1-specific antibodies were eluted
with 0.1 M glycine (pH 2.8) and immediately neutralized with 1 M Tris
(pH 8.0).
Coupling of antibody to immobilized protein A for
immunoprecipitations.
ImmunoPure immobilized protein A agarose
(Pierce) and affinity-purified Chk1 antibodies were incubated for
1 h at 4°C in 1 ml of mammalian cell lysis buffer 1 (MCLB1: 50 mM Tris-HCl [pH 8.0], 2 mM DTT, 5 mM EDTA, 0.5% Nonidet P-40, 100 mM
NaCl, 1 µM microcystin, 1 mM sodium orthovanadate, 2 mM
phenylmethylsulfonyl fluoride [PMSF], 10 µg of aprotinin per ml, 20 µM leupeptin) at a ratio of 14 µg of affinity-purified antibody to
30 µl of packed beads. The antibody-bead mixture was washed once with
1 ml of MCLB1, twice with 1 ml of LiCl buffer (0.5 M LiCl, 50 mM Tris [pH 8.0]), and twice with 1 ml of MCLB1.
Treatment of cells with DNA-damaging agents and
caffeine
HeLa cell cultures were incubated in
culture medium containing 50 µM cisplatin, 3 µM etoposide, or 3 µM 1-
-D-arabinofuranosylcytosine (ara-C) for
1 h. The medium was removed, and cells were washed once and then
incubated for 6 h in culture medium. For UV irradiation, the
culture medium was removed, cells were washed twice with
phosphate-buffered saline (PBS), and cells were irradiated in uncovered
tissue culture dishes with 254-nm UV light at a dose of 10 J/m2 with a Stratalinker (Stratagene). Fresh culture medium
was added back, and cells were incubated for an additional 6 h. In
some experiments, HeLa cells were incubated in 10 mM caffeine for
2.5 h prior to HU treatment.
Plasmids
Chk1 was amplified by PCR with
pAdTrack-CMV-Flag-Chk1(+) as the template with forward primer 1 (5'-AGGGAATCCCATGGCAGTGCCCTTTGTGG-3') and reverse primer 2 (5'-GCTCTAGAGCTCATGTGGCAGGAAGCC-3'). The PCR product was
digested with EcoRI and XbaI and ligated
into pcDNA3-myc to generate pcDNA3-myc-Chk1. Alanine was substituted for aspartic acid at position 130 to generate kinase-inactive Chk1
(Chk1D130A). Phosphorylation-site mutants were made with the Quick
Change mutagenesis kit (Strategene) by using pcDNA3-myc-Chk1 as a
template. In each case, serine was changed to alanine. pcDNA3-myc-Chk1 was used as a template with forward primer
5'-GTGAAGTACTCCAGTGCTCAGCCAGAACCCCGC-3' and reverse primer
5'-GCGGGGTTCTGGCTGAGCACTGGAGTACTTCAC-3' to
generate pcDNA3-myc-Chk1(S317A). pcDNA3-myc-Chk1 was used as a template
with forward primer
5'-CAAGGGATCAGCTTTGCTCAGCCCACATGTCC-3' and reverse primer
5'-GGACATGTGGGCTGAGCAAAGCTGATCCCTTG-3' to generate pcDNA3-myc-Chk1(S345A). pcDNA3-myc-Chk1 was used as a
template with forward primer
5'-CATATGCTTTTGAATGCTCAGTTACTTGGCACCCC-3' and
reverse primer
5'-GGGGTGCCAAGTAACTGAGCATTCAAAAGCATATG-3' to
generate pcDNA3-myc-Chk1(S357A). pcDNA3-myc-Chk1 was used as a template
with forward primer
5'-GGCACCCCAGGATCCGCACAGAACCCCTGGCAG-3' and
reverse primer 5'-CTGCCAGGGGTTCTGTGCGGATCCTGGGGTGCC-3' to generate pcDNA3-myc-Chk1(S366A). pcDNA3-myc-Chk1 was used
as a template with forward primer
5'-GCTGATTGATATTGTGAGCGCACAGAAGGTTTGGCTTCCTGCC-3' and reverse primer
5'-GGCAGGAAGCCAAACCTTCTGTGCGCTCACAATATCAATCAGC-3' to generate pcDNA3-myc-Chk1(S468A). pcDNA3-myc-Chk1(S317A)
was used as a template with primers described above to generate
pcDNA3-myc-Chk1(S317A, S345A). pcDNA3-myc-Chk1(S357A) was used as a
template with the primers described above to generate
pcDNA3-myc-Chk1(S357A, S366A). Chk1 (wild type and D130A) proteins were
also amplified by PCR with forward primer 5 (ATACCCGGGAATGGCAG
TGCCCTTTGTGG) and reverse primer 6 (ATAGAATTCTCATGTGGCAGGAAGCC).
The PCR products were digested with SmaI and
EcoRI and ligated into pGEX2TN. pGEX2TN-Chk1 was used as a
template to generate pGEX2TN-Chk1(S317A), pGEX2TN-Chk1(S345A), pGEX2TN-Chk1(S357A), pGEX2TN-Chk1(S366A), and pGEX2TN-Chk1(S468A) by
using the methodologies and primers described above.
Purification of soluble GST-Chk1 (wild type and mutants) for
kinase assays.
JM109 cells were transformed with plasmids encoding
GST-Chk1 (wild type and mutants). Cultures were grown at 37°C to an
optical density at 600 nm (OD600) of 0.6, and
isopropyl-1-thio-
-D-galactopyranoside (IPTG) was added
to a final concentration of 0.5 mM. After growing for an additional
3 h at 30°C, cells were pelleted by centrifugation. Cell pellets
were washed with PBS buffer and resuspended in STE (100 mM NaCl, 10 mM
Tris HCl [pH 8.0], 1 mM EDTA) supplemented with 2 mM PMSF, 10 µg of
aprotinin per ml, 20 µM leupeptin, and 1.0 mg of lysozyme per
ml. After rocking at 4°C for 20 min, Sarkosyl was added to a final
concentration of 1.5%, and lysis was accomplished by sonication.
Lysates were clarified by centrifugation, and Triton X-100 was added to
a final concentration of 2%. Proteins were precipitated with
glutathione-agarose (Sigma Chemical Co.) and washed twice in
STE, twice in LiCl buffer (0.5 M LiCl, 50 mM Tris HCl [pH 8.0]), and
twice in 50 mM Tris HCl (pH 7.4). GST-fusion proteins were eluted with
20 mM glutathione in 50 mM Tris HCl (pH 7.4).
Purification of GST-Cdc25C200-256
GST-Cdc25C200-256 was produced in bacteria and purified as
described previously (53). The protein was eluted from GSH
agarose in buffer consisting of 50 mM Tris (pH 7.4), 20 mM
glutathione, 2 mM PMSF, 10 µg of aprotinin per ml, and 20 µM
leupeptin followed by dialysis in 1 liter of dialyis buffer (25 mM Tris
[pH 8.0], 5 mM DTT) overnight at 4°C.
Chk1 kinase assays
To monitor the activity
of endogenous Chk1, 3 × 106 HeLa cells were untreated
or treated with 3 mM HU for 17 h. Cells were lysed in MCLB2 (50 mM
Tris-HCl [pH 8.0], 2 mM DTT, 5 mM EDTA, 0.5% Nonidet P-40, 100 mM
NaCl, 1 µM microcystin, 1 mM sodium orthovanadate, 2 mM PMSF,10 µg
of aprotinin per ml, 20 µM [5 µg/ml] leupeptin, 10 mM
-glycerophosphate, 1 mM sodium fluoride). Clarified lysates,
representing 2 mg of total cellular protein, were incubated with 14 µg of affinity-purified Chk1 antibody coupled to protein A agarose
overnight at 4°C. Precipitates were washed twice with MCLB2 and twice
with incomplete kinase buffer (50 mM Tris Cl [pH 7.4], 1 mM DTT, 10 mM MgCl2). Fifty-microliter kinase reactions were carried
out in the presence of incomplete kinase buffer containing 10 µM ATP,
10 µCi of [
-32P]ATP, and 5 µg of soluble
GST-Cdc25C200-256. Reaction mixtures were incubated at
30°C for 25 min and resolved by sodium dodecyl sulfate-polyacrylamide
gel electrophoresis (SDS-PAGE), and proteins were transferred to
nitrocellulose membrane. Radiolabeled proteins were visualized by
autoradiography. The same membranes were then subjected to Western blot
analysis with anti-Chk1 monoclonal antibody. For ectopically produced
Chk1, clarified lysates, representing 2 mg of total cellular protein,
or column fractions were incubated with 30 µl of anti-Flag-agarose
(Sigma Chemical Co.) for 2 h at 4°C. Precipitates were washed
twice with MCLB2, twice with LiCl buffer, and once with incomplete
kinase buffer. Kinase assays were performed as described above.
Phosphatase treatment.
HeLa cells were lysed in MCLB2 (50 mM
Tris-Cl [pH 8.0], 100 mM NaCl, 10 mM MgCl2,
0.5% Nonidet P-40, 2 mM DTT) containing 2 mM PMSF,10 µg of aprotinin
per ml, and 5 µg of leupeptin per ml. Clarified lysates containing
150 µg of total cellular protein were incubated with 5 U of calf
intestinal phosphatase (NEB) in the absence or presence of 10 mM
-glycerophosphate and 10 mM NaF at 37°C for 1 h.
ATR kinase assays.
293 cells (2.8 × 106) were transfected with 30 µg of plasmid
encoding kinase-active or -inactive Flag-ATR by using the calcium phosphate transfection system according to the manufacturer's instructions (Life Technologies). Forty-eight hours after transfection, cells were lysed in MCLB3 (50 mM Tris-Cl [pH 8.0], 150 mM NaCl, 0.5%
Nonidet P-40, 2 mM DTT, 5 mM EDTA, 10% glycerol) containing 1 µM
microcystin, 1 mM sodium orthovanadate, 2 mM PMSF, 10 µg of aprotinin
per ml, 5 µg of leupeptin per ml, 10 mM
-glycerophosphate, and 1 mM sodium fluoride. Lysates representing 4 mg of total cell protein
were incubated with anti-Flag agarose for 2 h at 4°C. Precipitates were washed twice with MCLB3, once with LiCl buffer, and
once with incomplete kinase buffer (20 mM HEPES [pH 7.4], 10 mM
MgCl2, 10 mM MnCl2, 50 mM
NaCl, 1 mM DTT). Kinase assays (50 µl) were performed in incomplete
kinase buffer supplemented with 5 µM ATP, 20 µM
-glycerophosphate, 10 µCi of [
-32P]ATP,
and 1 µg of GST-Chk1 (wild type and mutants) that had been purified
from bacteria.
Adenovirus infections and gel filtration.
HeLa cells were
either mock infected or infected for 60 min with recombinant
adenoviruses encoding Flag-tagged versions of Chk1 (wild type and
mutants) at a multiplicity of infection (MOI) of 10 in 1 ml of
serum-free DMEM. After 1 h, 5 ml of culture medium was added.
After 15 h of infection, cells were either untreated or were
incubated with 10 mM HU for 4 h. Cells were lysed in MCLB1. Lysates were passed through a 27-gauge needle 10 times and then clarified by centrifugation at 20,000 × g for 10 min
followed by 50,000 rpm for 30 min. Clarified lysates containing 2 to 5 mg of total cellular protein were loaded onto a Superdex 200 10/30 column (Pharmacia) and eluted with 50 mM HEPES (pH 7.4), 150 mM NaCl,
and 1 mM EDTA. Columns were run at 0.35 ml/min, and 0.5 ml was
collected per fraction. For mock-infected cells, 150 µl from
fractions 23 to 30 was resolved by SDS-PAGE. Chk1 was visualized by
Western blotting with anti-Chk1 polyclonal antibody (SC7898). For
adenovirus-infected cells, fractions were first incubated with 30 µl
of packed anti-Flag-agarose. Precipitates were resolved by SDS-PAGE,
and Flag-Chk1 (wild type and mutants) proteins were visualized by
Western blotting with Chk1 polyclonal antibody (SC7898). When kinase
assays were performed, precipitates were first incubated in complete
kinase buffer containing GST-Cdc25C200-256. Kinase reactions were resolved by SDS-PAGE, and proteins were transferred to nitrocellulose. Radiolabeled proteins were visualized by
autoradiography, and then the membrane was subjected to Western blotting with Chk1 polyclonal antibody (SC7898).
In vivo 32P labeling and two-dimensional peptide
mapping analysis.
293 cells (2 × 106)
were either mock transfected or transfected with plasmids encoding
myc-tagged wild-type and mutant forms of Chk1 by using the Superfect
transfection reagent (Qiagen). After 16 h of incubation, cells
were incubated in phosphate-free DMEM containing 2 mCi of
32P-labeled inorganic phosphate per ml and 10 mM
HU for 4 h. When labeling exogenous Chk1, 1 µM UCN-01 was also
included during the labeling period. Cells were lysed in MCLB1.
Endogenous Chk1 was immunoprecipitated from mock-transfected cell
lysates with affinity-purified polyclonal antibody that had been
precoupled to protein A beads. Ectopically expressed Chk1 was
immunoprecipitated with anti-myc monoclonal antibody-agarose (Santa
Cruz). Immunoprecipitates were subjected to SDS-PAGE on an 8%
polyacrylamide gel, and proteins were transferred to nitrocellulose.
Radiolabeled Chk1 was digested in a solution containing 0.2 mg of
trypsin (Worthington) per ml in 50 mM ammonium bicarbonate for 17 h. Tryptic phosphopeptides were separated in the first dimension by
thin-layer chromatography at pH 1.9 and in the second dimension by
ascending chromatography in a buffer consisting of
n-butanol-pyridine-acetic acid-water in a ratio of
75/50/15/60 (65). Alternatively, tryptic phosphopeptides were incubated with 1.2 U of Asp-N endopeptidase (Roche) per ml in 50 mM ammonium bicarbonate for 17 h and then incubated with Ziptip
C18 resin (Millipore) to purify the
phosphopeptides prior to two-dimensional phosphopeptide mapping. In
some cases, an unlabeled phosphopeptide of the sequence
LVQGISFpSQPTCP was resolved by two-dimensional mapping.
 |
RESULTS |
Checkpoints induce the phosphorylation and activation of Chk1.
To examine how the Chk1 protein kinase is regulated during checkpoint
responses, HeLa and U2OS cells were treated with HU to activate the DNA
replication checkpoint (Fig. 1A). U2OS
cells contain a functional p53 protein, whereas HeLa cells lack
functional p53 due to the expression of the papillomavirus E6 protein,
which targets p53 for destruction (59). The
electrophoretic mobility of Chk1 was observed to be retarded on SDS
gels after HU treatment of both cell types, suggesting that p53 status
does not impinge upon this pathway (Fig. 1A, lanes 2 and 6).
Phosphatase treatment confirmed that the slower electrophoretic form of
Chk1 was due to HU-induced phosphorylation of Chk1 (lanes 3 and 4).
Interestingly, the reduced electrophoretic mobility of Chk1 was also
observed when HeLa cells were treated with UV light and a variety of
chemotherapeutic agents that induce DNA damage or interfere with DNA
replication, including cisplatin, ara-C, and etoposide (Fig. 1B).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 1.
Checkpoint-induced phosphorylation and activation of
Chk1. (A) HeLa and U20S cells were untreated ( ) or were treated (+)
with 3 mM HU for 20 h. Cellular lysates containing 150 µg of
protein were either resolved directly by SDS-PAGE (lanes 1, 2, 5, and
6) or were treated with 5 U of calf intestinal phosphatase (CIP) in the
absence (lane 3) or in the presence (+ INH) of phosphatase inhibitors,
including 10 mM -glycerophosphate and 10 mM NaF (lane 4). Chk1 was
detected by Western blotting with Chk1-specific polyclonal antibody
(SC7898). (B) HeLa cells were cultured in DMEM alone (lane 1) or DMEM
containing 50 µM cisplatin (lane 2), 3 µM etoposide (lane 3), or 3 µM ara-C (lane 4) for 1 h, after which the medium was replaced
with fresh DMEM, and then the cells were cultured for an additional
6 h. In addition, HeLa cells were irradiated with 254-nm UV light
at a dose of 10 J/m2 (lane 5). Cellular lysates containing
150 µg of protein were resolved directly by SDS-PAGE on an 8%
polyacrylamide gel. Chk1 was detected by Western blotting with
Chk1-specific polyclonal antibody (SC7898). (C) HeLa cells were
untreated ( ) or were treated (+) with 3 mM HU for 17 h.
Clarified cellular lysates were incubated with affinity-purified Chk1
antibodies, and kinase assays were performed in vitro in the presence
of 5 µg of GST-Cdc25C200-256. Reactions were resolved by
SDS-PAGE, and proteins were transferred to nitrocellulose. Radiolabeled
GST-Cdc25C200-256was visualized by autoradiography. Levels
of Chk1 in each immunoprecipitate were determined by Western blotting
with monoclonal antibody specific for Chk1 (SC8408).
|
|
To determine whether the protein kinase activity of Chk1 was regulated
by phosphorylation, immune complex kinase assays were
performed in
vitro (Fig.
1C). Endogenous Chk1 was immunoprecipitated
from HeLa cells
that had been cultured in the absence (lane 1)
or in the presence (lane
2) of HU. Chk1 immunoprecipitates were
monitored for their ability to
phosphorylate GST-Cdc25C
200-256,
a protein
consisting of amino acids 200 to 256 of Cdc25C fused
to GST. This
substrate has previously been used to monitor the
activity of Chk1
(
25,
56). Interestingly, the protein kinase
activity of
Chk1 isolated from HU-treated cells was measured to
be approximately
fivefold higher than that isolated from untreated
cells.
Gel filtration analysis of human Chk1.
Gel filtration analysis
was performed to monitor the elution profile of Chk1 before and after
HU treatment (Fig. 2). In the absence of
HU treatment, Chk1 eluted in fractions 29 and 30, consistent with it
being a monomer in cells. However, after HU treatment, Chk1 was also
detected in fractions that eluted earlier (Fig. 2 [and see Fig. 7]).
Interestingly, the phosphorylated form of Chk1 that migrates with a
slower electrophoretic mobility on SDS gels was preferentially found in
the fractions that elute earlier. These findings suggest that the
phosphorylated form of Chk1 either multimerizes, binds to cellular
proteins, or undergoes conformational changes causing it to elute with
protein standards of 100 to 158 kDa. To determine whether ectopically
expressed Chk1 behaved like endogenous Chk1, we produced a recombinant
adenovirus expressing Flag-tagged Chk1. Lysates prepared from infected
HeLa cells were resolved by gel filtration, and selected fractions were
incubated with Flag-agarose to specifically precipitate Flag-tagged
Chk1. Precipitates were analyzed for the presence of Chk1 by Western blotting. As seen in Fig. 2, in the absence of HU treatment, Flag-Chk1 eluted in the same fractions as endogenous Chk1 (fractions 29 and 30).
After HU treatment, Flag-Chk1 was observed to also elute in fractions
27 and 28, as did endogenous Chk1.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 2.
Analysis of Chk11 by gel filtration. HeLa cells were
either mock infected or infected with recombinant adenovirus encoding
Flag-tagged Chk1. After 15 h of infection, cells were either
untreated ( HU) or were incubated with 10 mM HU (+HU) for 4 h.
Clarified lysates were analyzed directly by SDS-PAGE and Western
blotting (Total lysate) or were loaded onto a Superdex 200 10/30
column. For mock-infected cells, 150 µl from fractions 23 to30 was
resolved by SDS-PAGE. For adenovirus-infected cells, fractions 23 to 30 were first incubated with anti-Flag-agarose. Chk1 and Flag-Chk1 were
visualized by Western blotting with Chk1 polyclonal antibody (SC7898).
Fractions containing protein standards of 158 and 44 kDa are indicated.
The 44-kDa protein standard eluted primarily in fractions 30 and 31.
|
|
Checkpoint-induced phosphorylation of Chk1 is ATM independent but
caffeine sensitive.
To determine whether the HU-induced
phosphorylation of Chk1 required functional ATM, immortalized
fibroblasts derived from a patient lacking ATM (AT cells), stably
transfected with either the ATM expression vector
(AT+) or an empty vector
(AT
), were treated with HU. The electrophoretic
mobility of Chk1 was then monitored by immunoblotting (Fig.
3A). The slower electrophoretic form of
Chk1 was detected in both AT+ (lane 2) and
AT
(lane 5) cells, although reduced levels of
Chk1 protein were observed in both cell lines after HU treatment. We
also monitored the electrophoretic mobility of Chk1 after treatment of
AT+ and AT
cells with
ionizing radiation. As seen in Fig. 3A (lanes 3 and 6), the
electrophoretic mobility of a fraction of Chk1 was found be retarded in
both AT+ and AT
cells,
although to a lesser extent than that observed with HU.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 3.
Checkpoint-induced phosphorylation of Chk1 is ATM
independent but caffeine sensitive. (A) AT+ and
AT cells were untreated (lanes 1 and 4) or were treated
with 3 mM HU (lanes 2 and 5) or irradiated with 10 Gy of IR (lanes 3 and 6). Cellular lysates containing 150 µg of protein were resolved
directly by SDS-PAGE on an 8% polyacrylamide gel. Chk1 was detected by
Western blotting with Chk1-specific polyclonal antibody (SC7898). (B)
HeLa cells were cultured in DMEM lacking caffeine (lanes 1 and 2) or
containing 10 mM caffeine (lanes 3 and 4) for 2.5 h. Cells were
cultured for an additional 20 h in the absence (lanes 1 and 3) or
presence (lanes 2 and 4) of 3 mM HU. Cellular lysates containing 150 µg of protein were resolved directly by SDS-PAGE on an 8%
polyacrylamide gel. Chk1 was detected by Western blotting with
Chk1-specific polyclonal antibody (SC7898).
|
|
We also monitored the effects of caffeine on the HU-induced
phosphorylation of Chk1, because both ATM and ATR are inhibited
by
caffeine (
3,
9,
49,
57,
75). As seen in Fig.
3B,
the
ability of HU to induce the phosphorylation of Chk1 was completely
abrogated when cells were pretreated with 10 mM caffeine (lane
4).
Taken together, these observations suggest that the HU-induced
phosphorylation of Chk1 is independent of ATM, but may be dependent
on
ATR or another caffeine-sensitive
kinase.
Chk1 is phosphorylated on serines 317 and 345 in vivo.
Two-dimensional phosphopeptide mapping of Chk1 was performed to
identify residues that were phosphorylated in response to HU treatment.
HU-treated HeLa cells were incubated with
32P-labeled inorganic phosphate, and endogenous
Chk1 was isolated by immunoprecipitation. In addition, HeLa cells were
transfected with plasmids encoding myc-tagged Chk1. Transfected cells
were incubated with 32P-labeled inorganic
phosphate in the presence of both HU and 1 µM UCN-01. UCN-01 inhibits
the activity of Chk1 kinase, but not the activity of the kinases that
lie upstream of Chk1 (7, 25, 29). We observed enhanced
phosphorylation of ectopically expressed Chk1, but not that of
endogenous Chk1 when UCN-01 was included during the labeling period.
Although the mechanistic basis for this is not known, UCN-01 is
expected to inhibit the kinase activity of ectopically produced Chk1,
thus allowing cells to overproduce Chk1 in a kinase-inactive form.
32P-labeled endogenous Chk1 and myc-tagged Chk1
were digested with trypsin, and peptides were separated in two
dimensions. As seen in Fig. 4, two
predominant phosphospeptides (denoted 1 and 2) were evident in the case
of endogenous (Fig. 4B) and ectopically expressed (Fig. 4C) Chk1. Given
the caffeine sensitivity of Chk1 phosphorylation, we examined the Chk1
protein sequence for the presence of SQ and TQ residues. Serine and
threonine residues followed by glutamine are preferred sites of
phosphorylation for the ATM and ATR kinases (35, 52). As
seen in Fig. 4A, there are five SQ residues located within the C
terminus of Chk1 (serines 317, 345, 357, 366, and 468). A mutant form
of Chk1 containing alanine in place of serine at position 317 was
expressed as a myc-tagged fusion protein in HeLa cells. Two-dimensional
tryptic phosphopeptide mapping demonstrated that mutation of serine 317 resulted in the disappearance of phosphopeptide 1 (Fig. 4D). This indicates that serine 317 is phosphorylated in HU-treated cells.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 4.
Chk1 is phosphorylated on serine 317 in vivo. (A). The
structure of Chk1 is schematically represented to show the location of
the kinase domain (amino acids 9 to 265), the SQ-rich region at the C
terminus, and trypsin and Asp-N cleavage sites relative to potential
phosphorylation sites. (B to D) 293 cells were either mock transfected
or transfected with plasmids expressing myc-Chk1 (wild type) or
myc-Chk1(S317A). Cells were incubated with 32P-labeled
inorganic phosphate in the presence of HU. Radiolabeled Chk1 was
digested with trypsin, and the peptides were subjected to
two-dimensional phosphopeptide mapping. Arrows indicate the direction
of the first and second dimensions, and the origin is located where the
two arrows meet. (E) HeLa cells were untreated (lanes 1 and 5) or were
treated with either 3 mM HU (lanes 2, 3, 6, and 7) or 20 J of UV m2 (lanes 4 and 8). Lysates were prepared and analyzed as
directed by SDS-PAGE (lanes 1 to 4) or were first incubated with the
S317 phosphospecific antibody in the absence (lanes 5, 6, and 8) or
presence (lane 7) of competing phosphopeptide immunogen. Chk1 was
detected by immunoblotting with a monoclonal antibody specific for Chk1
(SC8408).
|
|
To directly monitor the phosphorylation of serine 317 in vivo, we
generated an antibody that recognizes Chk1 when it is phosphorylated
on
serine 317. HeLa cells were either untreated or were treated
with HU or
UV (Fig.
4E). Lysates were prepared and analyzed directed
by SDS-PAGE
(lanes 1 to 4) or were incubated with the S317 phosphospecific
antibody
prior to SDS-PAGE (lanes 5 to 8). As expected, HU and
UV treatments
caused the appearance of the slower electrophoretic
(phosphorylated)
form of Chk1. Interestingly, the phosphospecific
antibody
immunoprecipated only the slower electrophoretic (phosphorylated)
form
of Chk1 found in HU- and UV-treated cells (lanes 6 and 8).
Preincubation of the antibody with the phosphopeptide immunogen
blocked
the immunoprecipitation of S317-phosphorylated Chk1 (lane
7). These
results verify that Chk1 is phosphorylated on serine
317 in vivo in
response to HU and UV
treatments.
Because serines 345, 357, and 366 are contained within a single, large
tryptic peptide (Fig.
4A), we digested myc-tagged Chk1
(wild type and
mutants) with trypsin followed by Asp-N endopeptidase.
As seen in Fig.
5A, five phosphopeptides were visualized
under
these conditions. Mutation of serine 317 resulted in the loss
of
phosphopeptide 1 (Fig.
5B), whereas mutation of serine 345
resulted in
the loss of phosphopeptide 2 (Fig.
5C [and see Fig.
8]). S345 has
previously been shown to be phosphorylated in response
to checkpoint
activation (
44). Replacement of serines 357 and
366 with
alanine did not cause the loss of any of the five phosphopeptides
identified for wild-type Chk1 (Fig.
5D). In addition, replacement
of
serine 468 with alanine did not alter the two-dimensional
phosphopeptide
mapping results, suggesting that this residue is not
phosphorylated
in vivo (data not shown). These findings also indicate
that serines
317 and 345 are sites of Chk1 phosphorylation in vivo.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 5.
Chk1 is also phosphorylated on serine 345 in vivo. 293 cells were transfected with plasmids expressing myc-Chk1 (wild type),
myc-Chk1(S317A), myc-Chk1(S345A), and myc-Chk1(S357A, S366A). Cells
were incubated with 32P-labeled inorganic phosphate in the
presence of HU. Radiolabeled Chk1 (wild type and mutants) was digested
with trypsin followed by Asp-N endopeptidase, and peptides were
subjected to two-dimensional phosphopeptide mapping. Arrows indicate
the direction of the first and second dimensions, and the origin is
located where the two arrows meet.
|
|
HU-induced activation of Chk1 requires phosphorylation of serines
317 and 345.
To address the functional significance of
phosphorylation of serines 317 and 345, recombinant adenoviruses
expressing single- and double-phosphorylation-site mutants of Chk1 were
generated. HeLa cells were infected with wild-type and mutant viruses
in the presence of HU. Lysates were prepared and fractionated by gel
filtration. Selected fractions were analyzed for Chk1 protein and for
Chk1 kinase activity. As seen in Fig. 6
and as shown earlier (Fig. 2), the phosphorylated, activated form of
Chk1 eluted in fractions consistent with a molecular size of ~100 to
158 kDa (fractions 26 to 28). The bulk of the hypo- or
unphosphorylated, inactive Chk1 migrated in fractions 29 to 30, as
expected for monomeric protein. Mutation of either S317 or S345 to
alanine reduced the amount of Chk1 in the fractions eluting earlier
(fractions 26 to 28). In addition, the kinase activity associated with
Chk1(S317A) and Chk1(S345A) in fractions 26 to 28 was markedly reduced
compared with that of wild-type Chk1. Finally, the mutant of Chk1
containing alanine in place of serines 317 and 345 eluted primarily in
fractions 29 and 30 and was poorly activated by HU treatment. Taken
together, these findings suggest that phosphorylation of both S317 and
S345 contributes to the activation of Chk1 and its faster elution on gel filtration columns.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 6.
HU-induced activation of Chk1 requires phosphorylation
of serines 317 and 345. (A) HeLa cells were infected with recombinant
adenovirus encoding Flag-Chk1 (wild type), Flag-Chk1(S317A),
Flag-Chk1(S345A), or Flag-Chk1(S317A, S345A). After 15 h of
infection, cells were incubated with 10 mM HU for 4 h. Clarified
lysates were loaded onto a Superdex 200 10/30 column. Fractions 26 and
27 were pooled. Fractions 26/27, 28, 29, and 30 were incubated with
anti-Flag-agarose. Precipitates were monitored for their ability to
phosphorylate GST-Cdc25C200-25. Kinase reactions were
resolved by SDS-PAGE, and proteins were transferred to nitrocellulose.
Radiolabeled GST-Cdc25C200-256 was visualized by
autoradiography, Chk1 was visualized by Western blotting with
Chk1-specific polyclonal antibody (SC7898).
|
|
To determine whether the intrinsic protein kinase activity of Chk1 was
altered as a consequence of amino acid substitutions,
we monitored the
kinase activity of bacterially produced Chk1
(wild type and mutants).
Kinase-dead Chk1, wild-type Chk1, Chk1(S317A),
Chk1(S345A), and
Chk1(S317A, S345A) were expressed and purified
from bacteria as
GST-fusion proteins and were tested for their
ability to phosphorylate
GST-Cdc25C
200-256 in vitro. As
seen in
Fig.
7A, each phosphorylation site mutant
of Chk1 had kinase
activity similar to that of wild-type Chk1 in this
assay. Wild-type
and mutant forms of Chk1 expressed in HeLa cells were
also examined
for kinase activity (Fig.
7B). Lysates prepared from
cells infected
with adenoviruses encoding green fluorescent
protein (GFP; lane
1), Flag-Chk1 (lane 2), Flag-Chk1(S317A,
S345A), and kinase-inactive
Flag-Chk1(D130A) were incubated with
anti- Flag-agarose, and precipitates
were tested for their
ability to phosphorylate GST-Cdc25C
200-256 in
vitro. The double-phosphorylation mutant of Chk1 (lane 3) had
kinase
activity similar to that of wild-type Chk1 (lane 2) in
this assay.
These results indicate that the failure of the phosphorylation
site
mutants of Chk1 to be fully activated when cells are treated
with HU
(Fig.
6) reflects an inability of these mutants to be
phosphorylated
rather than intrinsic defects in kinase activity
as a result of amino
acid substitution.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 7.
Phosphorylation site mutants retain intrinsic protein
kinase activity. (A) Chk1, Chk1(D130A), Chk1(S317A), Chk1(S345A), and
Chk1(S317A, S345A) were purified as GST-fusion proteins in bacteria and
tested for their ability to phosphorylate
GST-Cdc25C200-256 in vitro. Reaction products were
resolved by SDS-PAGE, and proteins were transferred to nitrocellulose.
Phosphorylated Cdc25C200-256 was detected by
autoradiography, and levels of GST-Chk1 (wild type and mutants) were
visualized by Western blotting with Chk1-specific polyclonal antibody
(SC7898). (B) HeLa cells were infected with recombinant adenoviruses
encoding GFP (lane 1), Flag-Chk1 (lane 2), Flag-Chk1(S317A, S345A)
(lane 3), and Flag-Chk1(D130A). Lysates were prepared and incubated
with Flag-agarose. Precipitates were tested for their ability to
phosphorylate GST-Cdc25C200-256 in vitro. Reaction
products were resolved by SDS-PAGE, and proteins were transferred to
nitrocellulose. Phosphorylated Cdc25C200-256 was detected
by autoradiography, and levels of GST-Chk1 (wild type and mutants) were
visualized by Western blotting with Chk1-specific polyclonal antibody
(SC7898).
|
|
Phosphorylation of Chk1 by ATR.
We next asked whether Chk1 is
a direct substrate of ATR in vitro. Kinase-active and
-inactive forms of ATR were tested for their ability to phosphorylate
Chk1 in vitro. A kinase-inactive mutant of Chk1(D130A) fused to GST was
used as a substrate in these assays. As seen in Fig.
8A, Chk1 was phosphorylated by
kinase-active (lane 2) but not kinase-inactive (lane 3) ATR.
Radiolabeled Chk1 was isolated and digested with trypsin followed by
Asp-N endopeptidase. Peptides were separated in two dimensions, and
phosphopeptides were visualized by autoradiography. As seen in Fig. 8B,
two predominant phosphopeptides were detected under these conditions.
Mutation of serine 317 caused loss of phosphopeptide 1 (Fig. 8D),
whereas mutation of serine 345 caused loss of phosphopeptide 2 (Fig.
8E). To further confirm that phosphopeptide 2 represented the peptide containing phosphorylated serine 345, we synthesized the phosphopeptide expected after digestion of Chk1 with both trypsin and Asp-N
endopeptidase (LVQGISFpSQPTCP) and monitored its position after
two-dimensional phosphopeptide mapping. As seen in Fig. 8B and C, the
synthetic phosphopeptide comigrated with phosphopeptide 2, confirming
that phosphopeptide 2 contains S345. These results demonstrate that Chk1 is phosphorylated on serines 317 and 345 by ATR in vitro and
indicate that Chk1 may also be a direct target of ATR in vivo.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 8.
Interactions between ATR and Chk1 in vitro and in vivo.
(A) 293 cells were transfected with plasmids encoding kinase-active
(ATR+) and -inactive (ATR ) forms of
Flag-tagged ATR. Lysates were prepared and incubated with
anti-Flag-agarose. Precipitates were monitored for their ability to
phosphorylate bacterially produced kinase-inactive Chk1 fused to GST
(GST-Chk1D130A). Kinase reactions were resolved by SDS-PAGE, proteins
were transferred to nitrocellulose, and radiolabeled Chk1 was
visualized by autoradiography. (B to E) 293 cells were transfected with
plasmid encoding Flag-tagged ATR. Lysates were prepared and incubated
with anti-Flag-agarose. Kinase reactions were carried out in the
presence of bacterially produced GST-Chk1(D130A), GST-Chk1(D130A,
S317A), and GST-Chk1(D130A, S345A). Radiolabeled Chk1 proteins were
digested with trypsin followed by Asp-N endopeptidase, and peptides
were subjected to two-dimensional phosphopeptide mapping. The
first and second dimensions of separation are indicated, and the origin
is located where the two arrows meet. Phosphopeptides from proteolyzed
GST-Chk1(D130A) were mixed with unlabeled phosphopeptide
(LVQGISFpSQPTCP) prior to mapping (B), or the phosphopeptide was
resolved alone (C) and visualized by staining with ninhydrin. The
arrows indicate the position of the unlabeled phosphopeptide. (F) 293 cells were transfected with plasmids encoding kinase-active
(ATR+) and -inactive (ATR ) forms of
Flag-tagged ATR. Transfected cells were untreated (lanes 1, 3, 5, and
7) or were treated with 20 J of UV m2 (lanes 2, 4, 6, and 8). Lysates were prepared and analyzed directed by SDS-PAGE (lanes
1 to 4) or were first incubated with the S317 phosphospecific antibody
prior to SDS-PAGE (lanes 5 to 8). Chk1 was detected by immunoblotting
with a monoclonal antibody specific for Chk1 (SC8408).
|
|
To examine the contribution made by ATR to S317 phosphorylation in
vivo, we expressed either kinase-active or -inactive ATR
in 293 cells
and examined S317 phosphorylation after UV treatment.
As seen in Fig.
8F, UV-induced phosphorylation of Chk1 was attenuated
in cells
expresssing kinase-inactive ATR (lane 4) relative to
kinase-active ATR
(lane 2). Immunoprecipitation with the S317
phosphospecific
antibody demonstrated that phosphorylation of
Chk1 on serine 317 in response to UV was reduced in cells expressing
kinase-inactive ATR
(lane 8). It has previously been reported
that S345 is phosphorylated
in response to HU, UV, and IR in an
ATR-dependent manner in vivo
(
44). Taken together, these results
demonstrate that Chk1
is inducibly phosphorylated on S317 and
S345 in response to various
stimuli that cause checkpoint activation
and that phosphorylation of
Chk1 on both S317 and S345 in vivo
is ATR
dependent.
 |
DISCUSSION |
In this study, regulation of the human Chk1 protein kinase was
examined after exposure of cells to agents that induce various forms of
DNA damage or interfere with DNA replication. There has been
controversy concerning not only what DNA structures human Chk1 responds
to, but also whether the kinase activity of Chk1 is elevated in
response to genotoxic stress. It has been reported that human Chk1 is
inducibly phosphorylated on serine 345 in response to HU and UV and, to
a lesser extent, IR (44). In addition, dominant-negative
forms of ATR interfere with the phosphorylation of Chk1 on serine 345 in vivo (44). However, it has not been determined if human
Chk1 becomes phosphorylated on additional sites in response to
genotoxic stress in vivo, if phosphorylation regulates the kinase
activity of human Chk1, or if human Chk1 is a direct target of ATR.
In this study, serines 317 and 345 were identified as sites of
phosphorylation in vivo and as sites of ATR phosphorylation in vitro.
Furthermore, expression of a kinase-inactive form of ATR interfered
with the UV-induced phosphorylation of Chk1 on serine 317 in vivo. It
has previously been reported that kinase-inactive ATR also interferes
with the UV-induced phosphorylation of Chk1 on serine 345 in vivo.
These findings in conjunction with the role of ATR in regulating
cellular responses to UV and HU argue that human Chk1 may be directly
phosphorylated on serines 317 and 345 by ATR in vivo.
Xenopus Chk1 contains four SQ/TQ consensus sites within its
C terminus, and all four can be phosphorylated by ATR in vitro
(26). Expression of a mutant form of Chk1 lacking all four
phosphorylation sites abrogated checkpoint responses of
Xenopus extracts to replication blocks and UV-damaged DNA
(26). These findings highlight the conserved nature of the
ATR-Chk1 checkpoint pathway in eukaryotic organisms.
Human Chk1 has five ATM or ATR consensus phosphorylation sites (SQ/TQ)
within its C terminus. These include serines 317, 345, 357, 366, and
468, each of which is followed by glutamine. Serines 317 and 345 are
the only two found conserved in Chk1 from other species, including
fission yeast, C. elegans, Xenopus, and
Drosophila. In addition, residues inclusive of and
surrounding serines 317 and 345 in human Chk1 comprise optimal ATM or
ATR consensus phosphorylation sites (35). Interestingly
deletion of the C terminus of human and Xenopus Chk1
potently activates its intrinsic kinase activity, suggesting that the C
terminus functions as a negative regulator (12, 51).
Phosphorylation of Chk1 by ATR may serve to relieve this C-terminal
inhibitory function to activate Chk1 during the cellular response to
genotoxic stress. In addition to activating the protein kinase activity
of Chk1, phosphorylation also caused Chk1 to elute faster on gel
filtration columns. Additional studies will be required to determine if
the faster elution profile of the phosphorylated form of human Chk1 is
a result of Chk1 binding to cellular proteins, multimerizing, or
undergoing conformational changes. In checkpoint-activated extracts,
Xenopus Chk1 has been shown to bind to claspin, a 215-kDa
protein, and the interaction between Xenopus Chk1 and
claspin is required for checkpoint-induced activation of Chk1
(37).
Although Chk1 is highly conserved throughout evolution, the signals
that Chk1 responds to have diverged in eukaryotic organisms. In fission
yeast, Chk1 responds to DNA damage induced by either IR or methyl
methanesulfonate as well as UV (66, 67). In
Xenopus, Chk1 is activated by DNA replication blocks and
UV-damaged DNA, but not by double-stranded DNA breaks of the type
induced by IR. In this study, we report that human Chk1 is activated by
HU, UV, etoposide, cisplatin and ara-C, but poorly by IR. HU blocks DNA replication by inhibiting ribonuceotide reductase, but may subsequently induce DNA damage. ara-C is a nucleoside analog that incorporates into
DNA and interferes with DNA polymerases, which in turn interferes with
DNA chain elongation during both DNA replication and DNA repair
(48, 64). UV and cisplatin perturb the helical
structure of the DNA duplex and as such inhibit DNA replication
(19). Etoposide is a DNA topoisomerase II inhibitor that
causes double-stranded DNA breaks (11). IR also induces
double-stranded DNA breaks, but does not signal efficiently to human
Chk1. One function of DNA topoisomerase II is to disentangle
intertwined daughter chromatids after DNA replication and prior to
mitosis. Thus, inhibition of topoisomerase II by etoposide also leads
to activation of the chromatid catenation checkpoint (18),
and this may explain in part why etoposide but not IR leads to Chk1
activation. Thus, human Chk1 is activated when DNA replication is
directly blocked (i.e., by agents such as HU) or disabled (ara-C, UV,
cisplatin), but is poorly activated by double-stranded DNA breaks
induced by IR. In addition, Chk1 may be activated when cells recognize mismatches that result from attempted replication across modified or
damaged bases. An essential role for Chk1 in genome surveillance during
DNA replication may explain why disruption of Chk1 results in early
embryonic lethality in mice (44, 61).
Data reported in this study and elsewhere indicate that ATR lies
directly upstream of Chk1 in pathways that respond to unreplicated DNA
and certain forms of DNA damage. There are likely to be several downstream cellular targets of Chk1 in these pathways as well. In
humans, fission yeast, and Xenopus, Chk1 has been shown to phosphorylate Cdc25 on a residue or residues that facilitate the binding of 14-3-3 proteins (38, 54, 56, 72, 73). The functional significance of 14-3-3-Cdc25 interactions has been demonstrated in several organisms by expression of mutants of Cdc25
that cannot bind to 14-3-3 proteins. Perturbations in the DNA
replication checkpoint and/or the G2-DNA damage
checkpoint have been observed in cells expressing the non-14-3-3
binding mutants of Cdc25 (39, 54, 72, 73). Loss of 14-3-3 binding leads to the nuclear accumulation of Cdc25 in fission yeast,
Xenopus, and human tissue culture cells (16, 24, 25,
36, 45, 70, 73). Thus, one function of Chk1 may be to keep
Cdc25C out of the nucleus as part of the cellular response to
checkpoint activation. The Cdc25A protein phosphatase has also been
proposed to be a target of human Chk1. A recent study reported that the G1 cell cycle arrest induced by UV-damaged DNA
requires ubiquitin-mediated proteolysis of Cdc25A, and this in turn
requires Chk1 (46). Chk1 has also been shown to directly
phosphorylate Cdc25A in vitro, although the functional significance was
not examined (56). Further studies will be required to
identify additional substrates of human Chk1.
 |
ACKNOWLEDGMENTS |
We are grateful to J. Schwarz and C. Ryan for assistance with
production of recombinant adenoviruses and J. Gales for production and
purification of antibodies. We thank K. Cimprich and R. Abraham for
providing ATR reagents and M. Linder for helpful discussions. We thank
J. Hurov, C. Lovly, and M.-S. Chen for comments on the manuscript.
This work was supported by a grant from the National Institutes of
Health. H.P.-W. is an Investigator of the Howard Hughes Medical Institute.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Cell Biology and Physiology and Howard Hughes Medical Institute,
Washington University School of Medicine, Box 8228, 660 South Euclid
Ave., St. Louis, MO 63110. Phone: (314) 362-6812. Fax: (314) 362-3709. E-mail: hpiwnica{at}cellbio.wustl.edu.
 |
REFERENCES |
| 1.
|
Al-Khodairy, F.,
E. Fotou,
K. S. Sheldrick,
D. J. F. Griffiths,
A. R. Lehmann, and A. M. Carr.
1994.
Identification and characterization of new elements involved in checkpoint and feedback controls in fission yeast.
Mol. Biol. Cell
5:147-160[Abstract].
|
| 2.
|
Banin, S.,
L. Moyal,
S. Shieh,
Y. Taya,
C. W. Anderson,
L. Chessa,
N. I. Smorodinsky,
C. Prives,
Y. Reiss,
Y. Shiloh, and Y. Ziv.
1998.
Enhanced phosphorylation of p53 by ATM in response to DNA damage.
Science
281:1674-1677[Abstract/Free Full Text].
|
| 3.
|
Blasina, A.,
B. D. Price,
G. A. Turenne, and C. H. McGowan.
1999.
Caffeine inhibits the checkpoint kinase ATM.
Curr. Biol.
9:1135-1138[CrossRef][Medline].
|
| 4.
|
Boddy, M. N.,
B. Furnari,
O. Mondesert, and P. Russell.
1998.
Replication checkpoint enforced by kinases Cds1 and Chk1.
Science
280:909-912[Abstract/Free Full Text].
|
| 5.
|
Brown, A.,
C.-H. Lee,
J. K. Schwarz,
N. Mitiku,
D. Griffith,
H. Piwnica-Worms, and J. H. Chung.
1999.
A human Cds1-related kinase that functions downstream of ATM in the cellular response to DNA damage.
Proc. Natl. Acad. Sci. USA
96:3745-3750[Abstract/Free Full Text].
|
| 6.
|
Brown, E. J., and D. Baltimore.
2000.
ATR disruption leads to chromosomal fragmentation and early embryonic lethality.
Genes Dev.
14:397-402[Abstract/Free Full Text].
|
| 7.
|
Busby, E. C.,
D. F. Leistritz,
R. T. Abraham,
L. M. Karnitz, and J. N. Sarkaria.
2000.
The radiosensitizing agent 7-hydroxystaurosporine (UCN-01) inhibits the DNA damage checkpoint kinase hChk1.
Cancer Res.
60:2108-2212[Abstract/Free Full Text].
|
| 8.
|
Canman, C. E.,
D. S. Lim,
K. A. Cimprich,
Y. Taya,
K. Tamai,
K. Sakaguchi,
E. Appella,
M. B. Kastan, and J. D. Siliciano.
1998.
Activation of the ATM kinase by ionizing radiation and phosphorylation of p53.
Science
281:1677-1689[Abstract/Free Full Text].
|
| 9.
|
Chaturvedi, P.,
W. K. Eng,
Y. Zhu,
M. R. Mattern,
R. Mishra,
M. R. Hurle,
X. Zhang,
R. S. Annan,
Q. Lu,
L. F. Faucette,
G. F. Scott,
X. Li,
S. A. Carr,
R. K. Johnson,
J. D. Winkler, and B.-B. S. Zhou.
1999.
Mammalian Chk2 is a downstream effector of the ATM-dependent DNA damage checkpoint pathway.
Oncogene
18:4047-4054[CrossRef][Medline].
|
| 10.
|
Chehab, N. H.,
A. Malikzay,
E. S. Stavridi, and T. D. Halazonetis.
1999.
Phosphorylation of Ser-20 mediates stabilization of human p53 in response to DNA damage.
Proc. Natl. Acad. Sci. USA
96:13777-13782[Abstract/Free Full Text].
|
| 11.
|
Chen, A. Y., and L. F. Liu.
1994.
DNA topoisomerases: essential enzymes and lethal targets.
Annu. Rev. Pharmacol. Toxicol.
34:191-218[CrossRef][Medline].
|
| 12.
|
Chen, P.,
C. Luo,
Y. Deng,
K. Ryan,
J. Register,
S. Margosiak,
A. Tempczyk-Russell,
B. Nguyen,
P. Myers,
K. Lundgren,
C. C. Kan, and P. M. O'Connor.
2000.
The 1.7 A crystal structure of human cell cycle checkpoint kinase Chk1: implications for Chk1 regulation.
Cell
100:681-692[CrossRef][Medline].
|
| 13.
|
Cimprich, K. A.,
T. B. Shin,
C. T. Keith, and S. L. Schreiber.
1996.
cDNA cloning and gene mapping of a candidate human cell cycle checkpoint protein.
Proc. Natl. Acad. Sci. USA
93:2850-2855[Abstract/Free Full Text].
|
| 14.
|
Cliby, W. A.,
C. J. Roberts,
K. A. Cimprich,
C. M. Stringer,
J. R. Lamb,
S. L. Schreiber, and S. H. Friend.
1998.
Overexpression of a kinase-inactive ATR protein causes sensitivity to DNA-damaging agents and defects in cell cycle checkpoints.
EMBO J.
17:159-169[CrossRef][Medline].
|
| 15.
|
Cortez, D.,
Y. Wang,
J. Qin, and S. J. Elledge.
1999.
Requirement of ATM-dependent phosphorylation of brca1 in the DNA damage response to double-strand breaks.
Science
286:1162-1166[Abstract/Free Full Text].
|
| 16.
|
Dalal, S. N.,
C. M. Schweitzer,
J. Gan, and J. A. DeCaprio.
1999.
Cytoplasmic localization of human cdc25C during interphase requires an intact 14-3-3 binding site.
Mol. Cell. Biol.
19:4465-4479[Abstract/Free Full Text].
|
| 17.
|
de Klein, A.,
M. Muijtjens,
R. van Os,
Y. Verhoeven,
B. Smit,
A. M. Carr,
A. R. Lehmann, and J. H. Hoeijmakers.
2000.
Targeted disruption of the cell-cycle checkpoint gene ATR leads to early embryonic lethality in mice.
Curr. Biol.
10:479-482[CrossRef][Medline].
|
| 18.
|
Downes, C. S.,
D. J. Clarke,
A. M. Mullinger,
J. F. Gimenez-Abian,
A. M. Creighton, and R. T. Johnson.
1994.
A topoisomerase II-dependent G2 cycle checkpoint in mammalian cells.
Nature
372:467-470[CrossRef][Medline].
|
| 19.
|
Eastman, A.
1987.
The formation, isolation and characterization of DNA adducts by the anti-cancer platinum complexes.
Pharmacol. Ther.
34:155-166[CrossRef][Medline].
|
| 20.
|
Flaggs, G.,
A. W. Plug,
K. M. Dunks,
K. E. Mundt,
J. C. Ford,
M. R. E. Quiggle,
E. M. Taylor,
C. H. Westphal,
T. Ashley,
M. F. Hoekstra, and A. M. Carr.
1997.
ATM-dependent interactions of a mammalian Chk1 homolog with meiotic chromosomes.
Curr. Biol.
7:977-986[CrossRef][Medline].
|
| 21.
|
Fogarty, P.,
S. D. Campbell,
R. Abu-Shumays,
B. S. Phalle,
K. R. Yu,
G. L. Uy,
M. L. Goldberg, and W. Sullivan.
1997.
The Drosophila grapes gene is related to checkpoint gene chk1/rad27 and is required for late syncytial division fidelity.
Curr. Biol.
7:418-426[CrossRef][Medline].
|
| 22.
|
Francesconi, S.,
M. Grenon,
D. Bouvier, and G. Baldacci.
1997.
p56chk1 protein kinase is required for the DNA replication checkpoint at 37oC in fission yeast.
EMBO J.
16:1332-1341[CrossRef][Medline].
|
| 23.
|
Gatei, M.,
S. P. Scott,
I. Filippovitch,
N. Soronika,
M. F. Lavin,
B. Weber, and K. K. Khanna.
2000.
Role for ATM in DNA damage-induced phosphorylation of BRCA1.
Cancer Res.
60:3299-3304[Abstract/Free Full Text].
|
| 24.
|
Graves, P. R.,
C. M. Lovly,
G. L. Uy, and H. Piwnica-Worms.
2001.
Localization of human Cdc25C is regulated both by nuclear export and 14-3-3 binding.
Oncogene
20:1839-1851[CrossRef][Medline].
|
| 25.
|
Graves, P. R.,
L. Yu,
J. K. Schwarz,
J. Gales,
E. A. Sausville,
P. M. O'Connor, and H. Piwnica-Worms.
2000.
The Chk1 protein kinase and the Cdc25C regulatory pathways are targets of the anticancer agent UCN-01.
J. Biol. Chem.
275:5600-5605[Abstract/Free Full Text].
|
| 26.
|
Guo, Z.,
A. Kumagai,
S. X. Wang, and W. G. Dunphy.
2000.
Requirement for atr in phosphorylation of chk1 and cell cycle regulation in response to DNA replication blocks and UV-damaged DNA in Xenopus egg extracts.
Genes Dev.
14:2745-2756[Abstract/Free Full Text].
|
| 27.
|
Hartwell, L. H., and T. A. Weinert.
1989.
Checkpoints: controls that ensure the order of cell cycle events.
Science
246:629-634[Abstract/Free Full Text].
|
| 28.
|
He, T. C.,
S. Zhou,
L. T. da Costa,
J. Yu,
K. W. Kinzler, and B. Vogelstein.
1998.
A simplified system for generating recombinant adenoviruses.
Proc. Natl. Acad. Sci. USA
95:2509-2514[Abstract/Free Full Text].
|
| 29.
|
Jackson, J. R.,
A. Gilmartin,
C. Imburgia,
J. D. Winkler,
L. A. Marshall, and A. Roshak.
2000.
An indolocarbazole inhibitor of human checkpoint kinase (Chk1) abrogates cell cycle arrest caused by DNA damage.
Cancer Res.
60:566-572[Abstract/Free Full Text].
|
| 30.
|
Kaneko, Y. S.,
N. Watanabe,
H. Morisaki,
H. Akita,
A. Fujimoto,
K. Tominaga,
M. Terasawa,
A. Tachibana,
K. Ikeda,
M. Nakanishi, and Y. Kaneko.
1999.
Cell-cycle-dependent and ATM-independent expression of human Chk1 kinase.
Oncogene
18:3673-3681[CrossRef][Medline].
|
| 31.
|
Kastan, M. B., and D.-S. Lim.
2000.
The many substrates and functions of ATM.
Nat. Rev.
1:179-186.
|
| 32.
|
Keegan, K. S.,
D. A. Holtzman,
A. W. Plug,
E. R. Christenson,
E. E. Brainerd,
G. Flaggs,
N. J. Bentley,
E. M. Taylor,
M. S. Meyn,
S. B. Moss,
A. M. Carr,
T. Ashley, and M. F. Hoekstra.
1996.
The Atr and Atm protein kinases associate with different sites along meiotically pairing chromosomes.
Genes Dev.
10:2423-2437[Abstract/Free Full Text].
|
| 33.
|
Khanna, K. K.,
K. E. Keating,
S. Kozlov,
S. Scott,
M. Gatei,
K. Hobson,
Y. Taya,
B. Gabrielli,
D. Chan, and S. P. Lees-Miller.
1999.
ATM associates with and phosphorylates p53: mapping the region of interaction.
Nat. Genet.
20:398-400.
|
| 34.
|
Khosravi, R.,
R. Maya,
T. Gottlieb,
M. Oren,
Y. Shiloh, and D. Shkedy.
2000.
Rapid ATM-dependent phosphorylation of MDM2 precedes p53 accumulation in response to DNA damage.
Proc. Natl. Acad. Sci. USA
96:14973-14977[Abstract/Free Full Text].
|
| 35.
|
Kim, S. T.,
D. S. Lim,
C. E. Canman, and M. B. Kastan.
1999.
Substrate specificities and identification of putative substrates of ATM kinase family members.
J. Biol. Chem.
274:37538-37543[Abstract/Free Full Text].
|
| 36.
|
Kumagai, A., and W. G. Dunphy.
1999.
Binding of 14-3-3 proteins and nuclear export control the intracellular localization of the mitotic inducer Cdc25.
Genes Dev.
13:1067-1072[Abstract/Free Full Text].
|
| 37.
|
Kumagai, A., and W. G. Dunphy.
2000.
Claspin, a novel protein required for the activation of Chk1 during a DNA replication checkpoint response in Xenopus egg extracts.
Mol. Cell
6:839-849[CrossRef][Medline].
|
| 38.
|
Kumagai, A.,
Z. Guo,
K. H. Emami,
S. X. Wang, and W. G. Dunphy.
1998.
The Xenopus Chk1 protein kinase mediates a caffeine-sensitive pathway of checkpoint control in cell-free extracts.
J. Cell Biol.
142:1559-1569[Abstract/Free Full Text].
|
| 39.
|
Kumagai, A.,
P. S. Yakowec, and W. G. Dunphy.
1998.
14-3-3 proteins act as negative regulators of the mitotic inducer Cdc25 in Xenopus egg extracts.
Mol. Biol. Cell
9:345-354[Abstract/Free Full Text].
|
| 40.
|
Lakin, N. D.,
B. C. Hann, and S. P. Jackson.
1999.
The ataxia-telangiectasia related protein ATR mediates DNA-dependent phosphorylation of p53.
Oncogene
18:3989-3995[CrossRef][Medline].
|
| 41.
|
Li, S.,
N. S. Ting,
L. Zheng,
P. L. Chen,
Y. Ziv,
Y. Shiloh,
E. Y. Lee, and W. H. Lee.
2000.
Functional link of BRCA1 and ataxia telangiectasia gene product in DNA damage response.
Nature
406:210-215[CrossRef][Medline].
|
| 42.
|
Lim, D. S.,
S. T. Kim,
B. Xu,
R. S. Maser,
J. Lin,
J. H. Petrini, and M. B. Kastan.
2000.
ATM phosphorylates p95/nbs1 in an S-phase checkpoint pathway.
Nature
404:613-617[CrossRef][Medline].
|
| 43.
|
Lindsay, H. D.,
D. J. Griffiths,
R. J. Edwards,
P. U. Christensen,
J. M. Murray,
F. Osman,
N. Walworth, and A. M. Carr.
1998.
S-phase-specific activation of Cds1 kinase defines a subpathway of the checkpoint response in Schizosaccharomyces pombe.
Genes Dev.
12:382-395[Abstract/Free Full Text].
|
| 44.
|
Liu, Q.,
S. Guntuku,
X. S. Cui,
S. Matsuoka,
D. Cortez,
K. Tamai,
G. Luo,
S. Carattini-Rivera,
F. DeMayo,
A. Bradley,
L. A. Donehower, and S. J. Elledge.
2000.
Chk1 is an essential kinase that is regulated by Atr and required for the G(2)/M DNA damage checkpoint.
Genes Dev.
14:1448-1459[Abstract/Free Full Text].
|
| 45.
|
Lopez-Girona, A.,
B. Furnari,
O. Mondesert, and P. Russell.
1999.
Nuclear localization of Cdc25 is regulated by DNA damage and a 14-3-3 protein.
Nature
397:172-175[CrossRef][Medline].
|
| 46.
|
Mailand, N.,
J. Falck,
C. Lukas,
R. G. Syljuasen,
M. Welcker,
J. Bartek, and J. Lukas.
2000.
Rapid destruction of human Cdc25A in response to DNA damage.
Science
288:1425-1429[Abstract/Free Full Text].
|
| 47.
|
Matsuoka, S.,
G. Rotman,
A. Ogawa,
Y. Shiloh,
K. Tamai, and S. J. Elledge.
2000.
Ataxia telangiectasia-mutated phosphorylates Chk2 in vivo and in vitro.
Proc. Natl. Acad. Sci. USA
97:10389-10394[Abstract/Free Full Text].
|
| 48.
|
Mikita, T., and G. P. Beardsley.
1988.
Functional consequences of the arabinosylcytosine structural lesion in DNA.
Biochemistry
27:4698-4705[CrossRef][Medline].
|
| 49.
|
Moser, B. A.,
J.-M. Brondello,
B. Baber-Furnari, and P. Russell.
2000.
Mechanism of caffeine-induced checkpoint override in fission yeast.
Mol. Cell. Biol.
20:4288-4294[Abstract/Free Full Text].
|
| 50.
|
Nakajo, N.,
T. Oe,
K. Uto, and N. Sagata.
1999.
Involvement of Chk1 kinase in prophase I arrest of Xenopus oocytes.
Dev. Biol.
207:432-444[CrossRef][Medline].
|
| 51.
|
Oe, T.,
N. Nakajo,
Y. Katsuragi,
K. Okazaki, and N. Sagata.
2001.
Cytoplasmic occurrence of the Chk1/Cdc25 pathway and regulation of Chk1 in Xenopus oocytes.
Dev. Biol.
229:250-261[CrossRef][Medline].
|
| 52.
|
O'Neill, T.,
A. J. Dwyer,
Y. Ziv,
D. W. Chan,
S. P. Lees-Miller,
R. H. Abraham,
J. H. Lai,
D. Hill,
Y. Shiloh,
L. C. Cantley, and G. A. Rathbun.
2000.
Utilization of orientated peptide libraries to identify substrate motifs selected by ATM.
J. Biol. Chem.
275:22719-22727[Abstract/Free Full Text].
|
| 53.
|
Peng, C. Y.,
P. R. Graves,
S. Ogg,
R. S. Thoma,
M. J. Byrnes III,
Z. Wu,
M. T. Stephenson, and H. Piwnica-Worms.
1998.
C-TAK1 protein kinase phosphorylates human Cdc25C on serine 216 and promotes 14-3-3 protein binding.
Cell Growth Differ.
9:197-208[Abstract].
|
| 54.
|
Peng, C. Y.,
P. R. Graves,
R. S. Thoma,
Z. Wu,
A. S. Shaw, and H. Piwnica-Worms.
1997.
Mitotic and G2 checkpoint control: regulation of 14-3-3 protein binding by phosphorylation of Cdc25C on serine-216.
Science
277:1501-1505[Abstract/Free Full Text].
|
| 55.
|
Sanchez, Y.,
J. Bachant,
H. Wang,
F. Hu,
D. Liu,
M. Tetzlaff, and S. J. Elledge.
1999.
Control of the DNA damage checkpoint by chk1 and rad53 protein kinases through distinct mechanisms.
Science
286:1166-1171[Abstract/Free Full Text].
|
| 56.
|
Sanchez, Y.,
C. Wong,
R. S. Thoma,
R. Richman,
Z. Wu,
H. Piwnica-Worms, and S. J. Elledge.
1997.
Conservation of the Chk1 checkpoint pathway in mammals: linkage of DNA damage to Cdk regulation through Cdc25.
Science
277:1497-1501[Abstract/Free Full Text].
|
| 57.
|
Sarkaria, J. N.,
E. C. Busby,
R. S. Tibbetts,
P. Roos,
Y. Taya,
L. M. Karnitz, and R. T. Abraham.
1999.
Inhibition of ATM and ATR kinase activities by the radiosensitizing agent, caffeine.
Cancer Res.
59:4375-4382[Abstract/Free Full Text].
|
| 58.
|
Savitsky, K.,
A. Bar-Shira,
S. Gilad,
G. Rotman,
Y. Ziv,
L. Vanagaite,
D. A. Tagle,
S. Smith,
T. Uziel,
S. Sfez,
M. Ashkenazi,
I. Pecker,
M. Frydman,
R. Harnik,
S. R. Patanjali,
A. Simmons,
G. A. Clines,
A. Sartiel,
R. A. Gatti,
L. Chessa,
O. Sanal,
M. F. Lavin,
N. G. J. Jaspers,
A. M. R. Taylor,
C. F. Arlett,
T. Miki,
S. M. Weissman,
M. Lovett,
F. S. Collins, and Y. Shiloh.
1995.
A single ataxia telangiectasia gene with a product similar to PI-3 kinase.
Science
268:1749-1753[Abstract/Free Full Text].
|
| 59.
|
Scheffner, M.,
B. A. Werness,
J. M. Huibregtse,
A. J. Levine, and P. M. Howley.
1990.
The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53.
Cell
63:1129-1136[CrossRef][Medline].
|
| 60.
|
Sibon, O. C. M.,
V. A. Stevenson, and W. E. Theurkauf.
1997.
DNA-replication checkpoint control at the Drosophila midblastula transition.
Nature
388:93-97[CrossRef][Medline].
|
| 61.
|
Takai, H.,
K. Tominaga,
N. Motoyama,
Y. A. Minamishima,
H. Nagahama,
T. Tsukiyama,
K. Ikeda,
K. Nakayama,
M. Nakanishi, and K. Nakayama.
2000.
Aberrant cell cycle checkpoint function and early embryonic death in Chk1( / ) mice.
Genes Dev.
14:1439-1447[Abstract/Free Full Text].
|
| 62.
|
Tibbetts, R. S.,
K. M. Brumbaugh,
J. M. Williams,
J. N. Sarkaria,
W. A. Cliby,
S. Y. Shieh,
Y. Taya,
C. Prives, and R. T. Abraham.
1999.
A role for ATR in the DNA damage-induced phosphorylation of p53.
Genes Dev.
13:152-157[Abstract/Free Full Text].
|
| 63.
|
Tibbetts, R. S.,
D. Cortez,
K. M. Brumbaugh,
R. Scully,
D. Livingston,
S. J. Elledge, and R. T. Abraham.
2000.
Functional interactions between BRCA1 and the checkpoint kinase ATR during genotoxic stress.
Genes Dev.
14:2989-3002[Abstract/Free Full Text].
|
| 64.
|
Townsend, A. J., and Y.-C. Cheng.
1987.
Sequence-specific effects of ara-5-aza-CTP and ara-CTP on DNA synthesis by purified human DNA polymerases in vitro: visualization of chain elongation on a defined template.
Mol. Pharmacol.
32:330-339[Abstract].
|
| 65.
|
van der Geer, P., and T. Hunter.
1994.
Phosphopeptide mapping and phosphoamino acid analysis by electrophoresis and chromatography on thin-layer cellulose plates.
Electrophoresis
15:544-554[CrossRef][Medline].
|
| 66.
|
Walworth, N.,
S. Davey, and D. Beach.
1993.
Fission yeast chk1 protein kinase links the rad checkpoint pathway to cdc2.
Nature
363:368-371[CrossRef][Medline].
|
| 67.
|
Walworth, N. C., and R. Bernards.
1996.
rad-dependent response of the chk1-encoded protein kinase at the DNA damage checkpoint.
Science
271:353-356[Abstract].
|
| 68.
|
Wright, J. A.,
K. S. Keegan,
D. R. Herendeen,
N. J. Bentley,
A. M. Carr,
M. F. Hoekstra, and P. Concannon.
1998.
Protein kinase mutants of human ATR increase sensitivity to UV and ionizing radiation and abrogate cell cycle checkpoint control.
Proc. Natl. Acad. Sci. USA
95:7445-7450[Abstract/Free Full Text].
|
| 69.
|
Wu, X.,
V. Ranganathan,
D. S. Weisman,
W. F. Heine,
D. N. Ciccone,
T. B. O'Neil,
K. E. Crick,
K. S. Pierce,
W. S. Lane,
G. Rathbun,
D. M. Livingston, and D. T. Weaver.
2000.
ATM phosphorylation of Nijmegen breakage syndrome protein is required in a DNA damage response.
Nature
405:477-482[CrossRef][Medline].
|
| 70.
|
Yang, J.,
K. Wonkler,
M. Yoshida, and S. Kornbluth.
1999.
Maintenance of G2 arrest in the Xenopus oocyte: a role for 14-3-3-mediated inhibition of Cdc25 nuclear import.
EMBO J.
18:2174-2183[CrossRef][Medline].
|
| 71.
|
Yin, M. B.,
B. Guo,
U. Vanhoefer,
R. G. Azrak,
H. Minderman,
C. Frank,
C. Wrzosek,
H. K. Slocum, and Y. M. Rustum.
2000.
Characterization of protein kinase chk1 essential for the cell cycle checkpoint after exposure of human head and neck carcinoma A253 cells to a novel topoisomerase I inhibitor BNP1350.
Mol. Pharmacol.
57:453-459[Abstract/Free Full Text].
|
| 72.
|
Zeng, Y.,
K. C. Forbes,
Z. Wu,
S. Moreno,
H. Piwnica-Worms, and T. Enoch.
1998.
Replication checkpoint requires phosphorylation of the phosphatase Cdc25 by Cds1 or Chk1.
Nature
395:507-510[CrossRef][Medline].
|
| 73.
|
Zeng, Y., and H. Piwnica-Worms.
1999.
DNA damage and replication checkpoints in fission yeast require nuclear exclusion of the Cdc25 phosphatase via 14-3-3 binding.
Mol. Cell. Biol.
19:7410-7419[Abstract/Free Full Text].
|
| 74.
|
Zhao, S.,
Y.-C. Weng,
S.-S. F. Yuan,
Y.-T. Lin,
H. C. Hsu,
S.-C. Lin,
E. Gerbino,
M.-H. Song,
M. Z. Zdzienicka,
R. A. Gatti,
J. W. Shay,
Y. Ziv,
Y. Shiloh, and E. Y.-H. P. Lee.
2000.
Functional link between ataxia-telangiectasia and Nijmegen breakage syndrome gene products.
Nature
405:473-477[CrossRef][Medline].
|
| 75.
|
Zhou, B. B.,
P. Chaturvedi,
K. Spring,
S. P. Scott,
R. A. Johanson,
R. Mishra,
M. R. Mattern,
J. D. Winkler, and K. K. Khanna.
2000.
Caffeine abolishes the mammalian G(2)/M DNA damage checkpoint by inhibiting ataxia-telangiectasia-mutated kinase activity.
J. Biol. Chem.
275:10342-10348[Abstract/Free Full Text].
|
| 76.
|
Zhou, B. B., and S. J. Elledge.
2000.
The DNA damage response: putting checkpoints in perspective.
Nature
408:433-439[CrossRef][Medline].
|
| 77.
|
Ziv, Y.,
A. Bar-Shira,
I. Pecker,
P. Russell,
T. J. Jorgensen,
I. Tsarfati, and Y. Shiloh.
1997.
Recombinant ATM protein complements the cellular A-T phenotype.
Oncogene
15:159-167[CrossRef][Medline].
|
Molecular and Cellular Biology, July 2001, p. 4129-4139, Vol. 21, No. 13
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.13.4129-4139.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zhang, F., Wu, J., Yu, X.
(2009). Integrator3, a Partner of Single-stranded DNA-binding Protein 1, Participates in the DNA Damage Response. J. Biol. Chem.
284: 30408-30415
[Abstract]
[Full Text]
-
Zhang, J., Song, Y.-H., Brannigan, B. W., Wahrer, D. C.R., Schiripo, T. A., Harris, P. L., Haserlat, S. M., Ulkus, L. E., Shannon, K. M., Garber, J. E., Freedman, M. L., Henderson, B. E., Zou, L., Sgroi, D. C., Haber, D. A., Bell, D. W.
(2009). Prevalence and Functional Analysis of Sequence Variants in the ATR Checkpoint Mediator Claspin. Mol Cancer Res
7: 1510-1516
[Abstract]
[Full Text]
-
Lau, E., Chiang, G. G., Abraham, R. T., Jiang, W.
(2009). Divergent S Phase Checkpoint Activation Arising from Prereplicative Complex Deficiency Controls Cell Survival. Mol. Biol. Cell
20: 3953-3964
[Abstract]
[Full Text]
-
Yoshizawa-Sugata, N., Masai, H.
(2009). Roles of Human AND-1 in Chromosome Transactions in S Phase. J. Biol. Chem.
284: 20718-20728
[Abstract]
[Full Text]
-
Beckerman, R., Donner, A. J., Mattia, M., Peart, M. J., Manley, J. L., Espinosa, J. M., Prives, C.
(2009). A role for Chk1 in blocking transcriptional elongation of p21 RNA during the S-phase checkpoint. Genes Dev.
23: 1364-1377
[Abstract]
[Full Text]
-
Cui, B., Johnson, S. P., Bullock, N., Ali-Osman, F., Bigner, D. D., Friedman, H. S.
(2009). Bifunctional DNA Alkylator 1,3-Bis(2-chloroethyl)-1-nitrosourea Activates the ATR-Chk1 Pathway Independently of the Mismatch Repair Pathway. Mol. Pharmacol.
75: 1356-1363
[Abstract]
[Full Text]
-
Yoo, H. Y., Kumagai, A., Shevchenko, A., Shevchenko, A., Dunphy, W. G.
(2009). The Mre11-Rad50-Nbs1 Complex Mediates Activation of TopBP1 by ATM. Mol. Biol. Cell
20: 2351-2360
[Abstract]
[Full Text]
-
Peddibhotla, S., Lam, M. H., Gonzalez-Rimbau, M., Rosen, J. M.
(2009). From the Cover: The DNA-damage effector checkpoint kinase 1 is essential for chromosome segregation and cytokinesis. Proc. Natl. Acad. Sci. USA
106: 5159-5164
[Abstract]
[Full Text]
-
Leung-Pineda, V., Huh, J., Piwnica-Worms, H.
(2009). DDB1 Targets Chk1 to the Cul4 E3 Ligase Complex in Normal Cycling Cells and in Cells Experiencing Replication Stress. Cancer Res.
69: 2630-2637
[Abstract]
[Full Text]
-
Razidlo, G. L., Johnson, H. J., Stoeger, S. M., Cowan, K. H., Bessho, T., Lewis, R. E.
(2009). KSR1 Is Required for Cell Cycle Reinitiation Following DNA Damage. J. Biol. Chem.
284: 6705-6715
[Abstract]
[Full Text]
-
Danielsen, J. M. R., Larsen, D. H., Schou, K. B., Freire, R., Falck, J., Bartek, J., Lukas, J.
(2009). HCLK2 Is Required for Activity of the DNA Damage Response Kinase ATR. J. Biol. Chem.
284: 4140-4147
[Abstract]
[Full Text]
-
Wilsker, D., Petermann, E., Helleday, T., Bunz, F.
(2008). Essential function of Chk1 can be uncoupled from DNA damage checkpoint and replication control. Proc. Natl. Acad. Sci. USA
105: 20752-20757
[Abstract]
[Full Text]
-
Leonard, J. M., Ye, H., Wetmore, C., Karnitz, L. M.
(2008). Sonic Hedgehog signaling impairs ionizing radiation-induced checkpoint activation and induces genomic instability. JCB
183: 385-391
[Abstract]
[Full Text]
-
Tang, Y., Simoneau, A. R., Xie, J., Shahandeh, B., Zi, X.
(2008). Effects of the Kava Chalcone Flavokawain A Differ in Bladder Cancer Cells with Wild-type versus Mutant p53. Cancer Prevention Research
1: 439-451
[Abstract]
[Full Text]
-
Morgan, M. A., Parsels, L. A., Maybaum, J., Lawrence, T. S.
(2008). Improving Gemcitabine-Mediated Radiosensitization Using Molecularly Targeted Therapy: A Review. Clin. Cancer Res.
14: 6744-6750
[Abstract]
[Full Text]
-
Kosoy, A., O'Connell, M. J.
(2008). Regulation of Chk1 by Its C-terminal Domain. Mol. Biol. Cell
19: 4546-4553
[Abstract]
[Full Text]
-
Matsuura, K., Wakasugi, M., Yamashita, K., Matsunaga, T.
(2008). Cleavage-mediated Activation of Chk1 during Apoptosis. J. Biol. Chem.
283: 25485-25491
[Abstract]
[Full Text]
-
Tozluoglu, M., Karaca, E., Haliloglu, T., Nussinov, R.
(2008). Cataloging and organizing p73 interactions in cell cycle arrest and apoptosis. Nucleic Acids Res
36: 5033-5049
[Abstract]
[Full Text]
-
Martin, S. A., Ouchi, T.
(2008). Cellular commitment to reentry into the cell cycle after stalled DNA is determined by site-specific phosphorylation of Chk1 and PTEN. Molecular Cancer Therapeutics
7: 2509-2516
[Abstract]
[Full Text]
-
Jamil, S., Mojtabavi, S., Hojabrpour, P., Cheah, S., Duronio, V.
(2008). An Essential Role for MCL-1 in ATR-mediated CHK1 Phosphorylation. Mol. Biol. Cell
19: 3212-3220
[Abstract]
[Full Text]
-
Yan, Y., Black, C. P., Cao, P. T., Haferbier, J. L., Kolb, R. H., Spieker, R. S., Ristow, A. M., Cowan, K. H.
(2008). {gamma}-Irradiation-Induced DNA Damage Checkpoint Activation Involves Feedback Regulation between Extracellular Signal-Regulated Kinase 1/2 and BRCA1. Cancer Res.
68: 5113-5121
[Abstract]
[Full Text]
-
Campregher, C, Luciani, M G, Gasche, C
(2008). Activated neutrophils induce an hMSH2-dependent G2/M checkpoint arrest and replication errors at a (CA)13-repeat in colon epithelial cells. Gut
57: 780-787
[Abstract]
[Full Text]
-
Huang, M., Miao, Z.-H., Zhu, H., Cai, Y.-J., Lu, W., Ding, J.
(2008). Chk1 and Chk2 are differentially involved in homologous recombination repair and cell cycle arrest in response to DNA double-strand breaks induced by camptothecins. Molecular Cancer Therapeutics
7: 1440-1449
[Abstract]
[Full Text]
-
Petermann, E., Helleday, T., Caldecott, K. W.
(2008). Claspin Promotes Normal Replication Fork Rates in Human Cells. Mol. Biol. Cell
19: 2373-2378
[Abstract]
[Full Text]
-
Kulkarni, A., Das, K. C.
(2008). Differential roles of ATR and ATM in p53, Chk1, and histone H2AX phosphorylation in response to hyperoxia: ATR-dependent ATM activation. Am. J. Physiol. Lung Cell. Mol. Physiol.
294: L998-L1006
[Abstract]
[Full Text]
-
Pabla, N., Huang, S., Mi, Q.-S., Daniel, R., Dong, Z.
(2008). ATR-Chk2 Signaling in p53 Activation and DNA Damage Response during Cisplatin-induced Apoptosis. J. Biol. Chem.
283: 6572-6583
[Abstract]
[Full Text]
-
Guervilly, J.-H., Mace-Aime, G., Rosselli, F.
(2008). Loss of CHK1 function impedes DNA damage-induced FANCD2 monoubiquitination but normalizes the abnormal G2 arrest in Fanconi anemia. Hum Mol Genet
17: 679-689
[Abstract]
[Full Text]
-
Sivasubramaniam, S., Sun, X., Pan, Y.-R., Wang, S., Lee, E. Y.-H.P.
(2008). Cep164 is a mediator protein required for the maintenance of genomic stability through modulation of MDC1, RPA, and CHK1. Genes Dev.
22: 587-600
[Abstract]
[Full Text]
-
Zheng, L., Asprodites, N., Keene, A. H., Rodriguez, P., Brown, K. D., Davila, E.
(2008). TLR9 engagement on CD4 T lymphocytes represses {gamma}-radiation-induced apoptosis through activation of checkpoint kinase response elements. Blood
111: 2704-2713
[Abstract]
[Full Text]
-
Kim, H.-S., Hwang, J.-T., Yun, H., Chi, S.-G., Lee, S.-J., Kang, I., Yoon, K.-S., Choe, W.-J., Kim, S.-S., Ha, J.
(2008). Inhibition of AMP-activated Protein Kinase Sensitizes Cancer Cells to Cisplatin-induced Apoptosis via Hyper-induction of p53. J. Biol. Chem.
283: 3731-3742
[Abstract]
[Full Text]
-
Wang, H., Zhao, Y., Li, L., McNutt, M. A., Wu, L., Lu, S., Yu, Y., Zhou, W., Feng, J., Chai, G., Yang, Y., Zhu, W.-G.
(2008). An ATM- and Rad3-related (ATR) Signaling Pathway and a Phosphorylation-Acetylation Cascade Are Involved in Activation of p53/p21Waf1/Cip1 in Response to 5-Aza-2'-deoxycytidine Treatment. J. Biol. Chem.
283: 2564-2574
[Abstract]
[Full Text]
-
Jorgensen, S., Elvers, I., Trelle, M. B., Menzel, T., Eskildsen, M., Jensen, O. N., Helleday, T., Helin, K., Sorensen, C. S.
(2007). The histone methyltransferase SET8 is required for S-phase progression. JCB
179: 1337-1345
[Abstract]
[Full Text]
-
Stokes, M. P., Rush, J., MacNeill, J., Ren, J. M., Sprott, K., Nardone, J., Yang, V., Beausoleil, S. A., Gygi, S. P., Livingstone, M., Zhang, H., Polakiewicz, R. D., Comb, M. J.
(2007). Profiling of UV-induced ATM/ATR signaling pathways. Proc. Natl. Acad. Sci. USA
104: 19855-19860
[Abstract]
[Full Text]
-
Kim, W.-J., Rajasekaran, B., Brown, K. D.
(2007). MLH1- and ATM-dependent MAPK Signaling Is Activated through c-Abl in Response to the Alkylator N-Methyl-N'-nitro-N'-nitrosoguanidine. J. Biol. Chem.
282: 32021-32031
[Abstract]
[Full Text]
-
Garate, M., Campos, E. I., Bush, J. A., Xiao, H., Li, G.
(2007). Phosphorylation of the tumor suppressor p33ING1b at Ser-126 influences its protein stability and proliferation of melanoma cells. FASEB J.
21: 3705-3716
[Abstract]
[Full Text]
-
Errico, A., Costanzo, V., Hunt, T.
(2007). Tipin is required for stalled replication forks to resume DNA replication after removal of aphidicolin in Xenopus egg extracts. Proc. Natl. Acad. Sci. USA
104: 14929-14934
[Abstract]
[Full Text]
-
Marusyk, A., Wheeler, L. J., Mathews, C. K., DeGregori, J.
(2007). p53 Mediates Senescence-Like Arrest Induced by Chronic Replicational Stress. Mol. Cell. Biol.
27: 5336-5351
[Abstract]
[Full Text]
-
Yamane, K., Schupp, J. E., Kinsella, T. J.
(2007). BRCA1 Activates a G2-M Cell Cycle Checkpoint following 6-Thioguanine-Induced DNA Mismatch Damage. Cancer Res.
67: 6286-6292
[Abstract]
[Full Text]
-
Zhang, S., Zhou, Y., Trusa, S., Meng, X., Lee, E. Y. C., Lee, M. Y. W. T.
(2007). A Novel DNA Damage Response: RAPID DEGRADATION OF THE p12 SUBUNIT OF DNA POLYMERASE {delta}. J. Biol. Chem.
282: 15330-15340
[Abstract]
[Full Text]
-
Wang, X., Kennedy, R. D., Ray, K., Stuckert, P., Ellenberger, T., D'Andrea, A. D.
(2007). Chk1-Mediated Phosphorylation of FANCE Is Required for the Fanconi Anemia/BRCA Pathway. Mol. Cell. Biol.
27: 3098-3108
[Abstract]
[Full Text]
-
Tomimatsu, N., Tahimic, C. G. T., Otsuki, A., Burma, S., Fukuhara, A., Sato, K., Shiota, G., Oshimura, M., Chen, D. J., Kurimasa, A.
(2007). Ku70/80 Modulates ATM and ATR Signaling Pathways in Response to DNA Double Strand Breaks. J. Biol. Chem.
282: 10138-10145
[Abstract]
[Full Text]
-
Niida, H., Katsuno, Y., Banerjee, B., Hande, M. P., Nakanishi, M.
(2007). Specific Role of Chk1 Phosphorylations in Cell Survival and Checkpoint Activation. Mol. Cell. Biol.
27: 2572-2581
[Abstract]
[Full Text]
-
Ray, S., Shyam, S., Fraizer, G. C., Almasan, A.
(2007). S-phase checkpoints regulate Apo2 ligand/TRAIL and CPT-11-induced apoptosis of prostate cancer cells. Molecular Cancer Therapeutics
6: 1368-1378
[Abstract]
[Full Text]
-
Tse, A. N., Carvajal, R., Schwartz, G. K.
(2007). Targeting Checkpoint Kinase 1 in Cancer Therapeutics. Clin. Cancer Res.
13: 1955-1960
[Abstract]
[Full Text]
-
Herman-Antosiewicz, A., Stan, S. D., Hahm, E.-R., Xiao, D., Singh, S. V.
(2007). Activation of a novel ataxia-telangiectasia mutated and Rad3 related/checkpoint kinase 1-dependent prometaphase checkpoint in cancer cells by diallyl trisulfide, a promising cancer chemopreventive constituent of processed garlic. Molecular Cancer Therapeutics
6: 1249-1261
[Abstract]
[Full Text]
-
Stauffer, D., Chang, B., Huang, J., Dunn, A., Thayer, M.
(2007). p300/CREB-binding Protein Interacts with ATR and Is Required for the DNA Replication Checkpoint. J. Biol. Chem.
282: 9678-9687
[Abstract]
[Full Text]
-
Li, G., Elder, R. T., Qin, K., Park, H. U., Liang, D., Zhao, R. Y.
(2007). Phosphatase Type 2A-dependent and -independent Pathways for ATR Phosphorylation of Chk1. J. Biol. Chem.
282: 7287-7298
[Abstract]
[Full Text]
-
Yao, Q., Weigel, B., Kersey, J.
(2007). Synergism between Etoposide and 17-AAG in Leukemia Cells: Critical Roles for Hsp90, FLT3, Topoisomerase II, Chk1, and Rad51. Clin. Cancer Res.
13: 1591-1600
[Abstract]
[Full Text]
-
Yoshizawa-Sugata, N., Masai, H.
(2007). Human Tim/Timeless-interacting Protein, Tipin, Is Required for Efficient Progression of S Phase and DNA Replication Checkpoint. J. Biol. Chem.
282: 2729-2740
[Abstract]
[Full Text]
-
Tse, A. N., Rendahl, K. G., Sheikh, T., Cheema, H., Aardalen, K., Embry, M., Ma, S., Moler, E. J., Ni, Z. J., Lopes de Menezes, D. E., Hibner, B., Gesner, T. G., Schwartz, G. K.
(2007). CHIR-124, a Novel Potent Inhibitor of Chk1, Potentiates the Cytotoxicity of Topoisomerase I Poisons In vitro and In vivo. Clin. Cancer Res.
13: 591-602
[Abstract]
[Full Text]
-
Mallette, F. A., Gaumont-Leclerc, M.-F., Ferbeyre, G.
(2007). The DNA damage signaling pathway is a critical mediator of oncogene-induced senescence. Genes Dev.
21: 43-48
[Abstract]
[Full Text]
-
Levesque, A. A., Eastman, A.
(2007). p53-based cancer therapies: is defective p53 the Achilles heel of the tumor?. Carcinogenesis
28: 13-20
[Abstract]
[Full Text]
-
Takami, Y., Ono, T., Fukagawa, T., Shibahara, K.-i., Nakayama, T.
(2007). Essential Role of Chromatin Assembly Factor-1-mediated Rapid Nucleosome Assembly for DNA Replication and Cell Division in Vertebrate Cells. Mol. Biol. Cell
18: 129-141
[Abstract]
[Full Text]
-
Kedde, M., le Sage, C., Duursma, A., Zlotorynski, E., van Leeuwen, B., Nijkamp, W., Beijersbergen, R., Agami, R.
(2006). Telomerase-independent Regulation of ATR by Human Telomerase RNA. J. Biol. Chem.
281: 40503-40514
[Abstract]
[Full Text]
-
Agarwal, C., Tyagi, A., Agarwal, R.
(2006). Gallic acid causes inactivating phosphorylation of cdc25A/cdc25C-cdc2 via ATM-Chk2 activation, leading to cell cycle arrest, and induces apoptosis in human prostate carcinoma DU145 cells. Molecular Cancer Therapeutics
5: 3294-3302
[Abstract]
[Full Text]
-
Gastwirt, R. F., Slavin, D. A., McAndrew, C. W., Donoghue, D. J.
(2006). Spy1 Expression Prevents Normal Cellular Responses to DNA Damage: INHIBITION OF APOPTOSIS AND CHECKPOINT ACTIVATION. J. Biol. Chem.
281: 35425-35435
[Abstract]
[Full Text]
-
Fikaris, A. J., Lewis, A. E., Abulaiti, A., Tsygankova, O. M., Meinkoth, J. L.
(2006). Ras Triggers Ataxia-telangiectasia-mutated and Rad-3-related Activation and Apoptosis through Sustained Mitogenic Signaling. J. Biol. Chem.
281: 34759-34767
[Abstract]
[Full Text]
-
Lovejoy, C. A., Lock, K., Yenamandra, A., Cortez, D.
(2006). DDB1 Maintains Genome Integrity through Regulation of Cdt1. Mol. Cell. Biol.
26: 7977-7990
[Abstract]
[Full Text]
-
Leung-Pineda, V., Ryan, C. E., Piwnica-Worms, H.
(2006). Phosphorylation of Chk1 by ATR Is Antagonized by a Chk1-Regulated Protein Phosphatase 2A Circuit. Mol. Cell. Biol.
26: 7529-7538
[Abstract]
[Full Text]
-
Takemura, H., Rao, V. A., Sordet, O., Furuta, T., Miao, Z.-H., Meng, L., Zhang, H., Pommier, Y.
(2006). Defective Mre11-dependent Activation of Chk2 by Ataxia Telangiectasia Mutated in Colorectal Carcinoma Cells in Response to Replication-dependent DNA Double Strand Breaks. J. Biol. Chem.
281: 30814-30823
[Abstract]
[Full Text]
-
Joe, Y., Jeong, J.-H., Yang, S., Kang, H., Motoyama, N., Pandolfi, P. P., Chung, J. H., Kim, M. K.
(2006). ATR, PML, and CHK2 Play a Role in Arsenic Trioxide-induced Apoptosis. J. Biol. Chem.
281: 28764-28771
[Abstract]
[Full Text]
-
Colton, S. L., Xu, X. S., Wang, Y. A., Wang, G.
(2006). The Involvement of Ataxia-telangiectasia Mutated Protein Activation in Nucleotide Excision Repair-facilitated Cell Survival with Cisplatin Treatment. J. Biol. Chem.
281: 27117-27125
[Abstract]
[Full Text]
-
Chu, P.-C., Yang, Y.-C., Lu, Y.-T., Chen, H.-T., Yu, L.-C., Chang, M.-S.
(2006). Silencing of p29 Affects DNA Damage Responses with UV Irradiation.. Cancer Res.
66: 8484-8491
[Abstract]
[Full Text]
-
Rodriguez-Bravo, V., Guaita-Esteruelas, S., Florensa, R., Bachs, O., Agell, N.
(2006). Chk1- and Claspin-Dependent but ATR/ATM- and Rad17-Independent DNA Replication Checkpoint Response in HeLa Cells.. Cancer Res.
66: 8672-8679
[Abstract]
[Full Text]
-
Liu, S., Bekker-Jensen, S., Mailand, N., Lukas, C., Bartek, J., Lukas, J.
(2006). Claspin Operates Downstream of TopBP1 To Direct ATR Signaling towards Chk1 Activation.. Mol. Cell. Biol.
26: 6056-6064
[Abstract]
[Full Text]
-
Tatsumi, Y., Sugimoto, N., Yugawa, T., Narisawa-Saito, M., Kiyono, T., Fujita, M.
(2006). Deregulation of Cdt1 induces chromosomal damage without rereplication and leads to chromosomal instability. J. Cell Sci.
119: 3128-3140
[Abstract]
[Full Text]
-
Faour, W. H., He, Q., Mancini, A., Jovanovic, D., Antoniou, J., Di Battista, J. A.
(2006). Prostaglandin E2 Stimulates p53 Transactivational Activity through Specific Serine 15 Phosphorylation in Human Synovial Fibroblasts: ROLE IN SUPPRESSION OF c/EBP/NF-{kappa}B-MEDIATED MEKK1-INDUCED MMP-1 EXPRESSION. J. Biol. Chem.
281: 19849-19860
[Abstract]
[Full Text]
-
Shiromizu, T., Goto, H., Tomono, Y., Bartek, J., Totsukawa, G., Inoko, A., Nakanishi, M., Matsumura, F., Inagaki, M.
(2006). Regulation of mitotic function of Chk1 through phosphorylation at novel sites by cyclin-dependent kinase 1 (Cdk1).. GENES CELLS
11: 477-485
[Abstract]
[Full Text]
-
Bekker-Jensen, S., Lukas, C., Kitagawa, R., Melander, F., Kastan, M. B., Bartek, J., Lukas, J.
(2006). Spatial organization of the mammalian genome surveillance machinery in response to DNA strand breaks. JCB
173: 195-206
[Abstract]
[Full Text]
-
Myers, J. S., Cortez, D.
(2006). Rapid Activation of ATR by Ionizing Radiation Requires ATM and Mre11. J. Biol. Chem.
281: 9346-9350
[Abstract]
[Full Text]
-
Sturgeon, C. M., Knight, Z. A., Shokat, K. M., Roberge, M.
(2006). Effect of combined DNA repair inhibition and G2 checkpoint inhibition on cell cycle progression after DNA damage.. Molecular Cancer Therapeutics
5: 885-892
[Abstract]
[Full Text]
-
Yoo, H. Y., Jeong, S.-Y., Dunphy, W. G.
(2006). Site-specific phosphorylation of a checkpoint mediator protein controls its responses to different DNA structures. Genes Dev.
20: 772-783
[Abstract]
[Full Text]
-
Lupardus, P. J., Cimprich, K. A.
(2006). Phosphorylation of Xenopus Rad1 and Hus1 Defines a Readout for ATR Activation That Is Independent of Claspin and the Rad9 Carboxy Terminus. Mol. Biol. Cell
17: 1559-1569
[Abstract]
[Full Text]
-
Sampath, D., Cortes, J., Estrov, Z., Du, M., Shi, Z., Andreeff, M., Gandhi, V., Plunkett, W.
(2006). Pharmacodynamics of cytarabine alone and in combination with 7-hydroxystaurosporine (UCN-01) in AML blasts in vitro and during a clinical trial. Blood
107: 2517-2524
[Abstract]
[Full Text]
-
Teer, J. K., Machida, Y. J., Labit, H., Novac, O., Hyrien, O., Marheineke, K., Zannis-Hadjopoulos, M., Dutta, A.
(2006). Proliferating Human Cells Hypomorphic for Origin Recognition Complex 2 and Pre-replicative Complex Formation Have a Defect in p53 Activation and Cdk2 Kinase Activation. J. Biol. Chem.
281: 6253-6260
[Abstract]
[Full Text]
-
Dodson, G. E., Tibbetts, R. S.
(2006). DNA Replication Stress-induced Phosphorylation of Cyclic AMP Response Element-binding Protein Mediated by ATM. J. Biol. Chem.
281: 1692-1697
[Abstract]
[Full Text]
-
Campbell, K. J., Witty, J. M., Rocha, S., Perkins, N. D.
(2006). Cisplatin Mimics ARF Tumor Suppressor Regulation of RelA (p65) Nuclear Factor-{kappa}B Transactivation. Cancer Res.
66: 929-935
[Abstract]
[Full Text]
-
Niida, H., Nakanishi, M.
(2006). DNA damage checkpoints in mammals. Mutagenesis
21: 3-9
[Abstract]
[Full Text]
-
Lai, M., Zimmerman, E. S., Planelles, V., Chen, J.
(2005). Activation of the ATR Pathway by Human Immunodeficiency Virus Type 1 Vpr Involves Its Direct Binding to Chromatin In Vivo. J. Virol.
79: 15443-15451
[Abstract]
[Full Text]
-
Kim, J.-E., McAvoy, S. A., Smith, D. I., Chen, J.
(2005). Human TopBP1 Ensures Genome Integrity during Normal S Phase. Mol. Cell. Biol.
25: 10907-10915
[Abstract]
[Full Text]
-
Shi, Y., Dodson, G. E., Shaikh, S., Rundell, K., Tibbetts, R. S.
(2005). Ataxia-telangiectasia-mutated (ATM) Is a T-antigen Kinase That Controls SV40 Viral Replication in Vivo. J. Biol. Chem.
280: 40195-40200
[Abstract]
[Full Text]
-
Gaiddon, C., Jeannequin, P., Bischoff, P., Pfeffer, M., Sirlin, C., Loeffler, J. P.
(2005). Ruthenium (II)-Derived Organometallic Compounds Induce Cytostatic and Cytotoxic Effects on Mammalian Cancer Cell Lines through p53-Dependent and p53-Independent Mechanisms. J. Pharmacol. Exp. Ther.
315: 1403-1411
[Abstract]
[Full Text]
-
Karnitz, L. M., Flatten, K. S., Wagner, J. M., Loegering, D., Hackbarth, J. S., Arlander, S. J. H., Vroman, B. T., Thomas, M. B., Baek, Y.-U., Hopkins, K. M., Lieberman, H. B., Chen, J., Cliby, W. A., Kaufmann, S. H.
(2005). Gemcitabine-Induced Activation of Checkpoint Signaling Pathways That Affect Tumor Cell Survival. Mol. Pharmacol.
68: 1636-1644
[Abstract]
[Full Text]
-
Itakura, E., Sawada, I., Matsuura, A.
(2005). Dimerization of the ATRIP Protein through the Coiled-Coil Motif and Its Implication to the Maintenance of Stalled Replication Forks. Mol. Biol. Cell
16: 5551-5562
[Abstract]
[Full Text]
-
Kim, S.-M., Kumagai, A., Lee, J., Dunphy, W. G.
(2005). Phosphorylation of Chk1 by ATM- and Rad3-related (ATR) in Xenopus Egg Extracts Requires Binding of ATRIP to ATR but Not the Stable DNA-binding or Coiled-coil Domains of ATRIP. J. Biol. Chem.
280: 38355-38364
[Abstract]
[Full Text]
-
Zhang, J., Bao, S., Furumai, R., Kucera, K. S., Ali, A., Dean, N. M., Wang, X.-F.
(2005). Protein Phosphatase 5 Is Required for ATR-Mediated Checkpoint Activation. Mol. Cell. Biol.
25: 9910-9919
[Abstract]
[Full Text]
-
Tyagi, A., Singh, R. P., Agarwal, C., Siriwardana, S., Sclafani, R. A., Agarwal, R.
(2005). Resveratrol causes Cdc2-tyr15 phosphorylation via ATM/ATR-Chk1/2-Cdc25C pathway as a central mechanism for S phase arrest in human ovarian carcinoma Ovcar-3 cells. Carcinogenesis
26: 1978-1987
[Abstract]
[Full Text]
-
Clarke, C. A. L., Bennett, L. N., Clarke, P. R.
(2005). Cleavage of Claspin by Caspase-7 during Apoptosis Inhibits the Chk1 Pathway. J. Biol. Chem.
280: 35337-35345
[Abstract]
[Full Text]
-
Dahl, J., You, J., Benjamin, T. L.
(2005). Induction and Utilization of an ATM Signaling Pathway by Polyomavirus. J. Virol.
79: 13007-13017
[Abstract]
[Full Text]
-
Hu, B., Wang, H., Wang, X., Lu, H.-R., Huang, C., Powell, S. N., Huebner, K., Wang, Y.
(2005). Fhit and CHK1 Have Opposing Effects on Homologous Recombination Repair. Cancer Res.
65: 8613-8616
[Abstract]
[Full Text]
-
Beardsley, D. I., Kim, W.-J., Brown, K. D.
(2005). N-Methyl-N'-nitro-N-nitrosoguanidine Activates Cell-Cycle Arrest through Distinct Mechanisms Activated in a Dose-Dependent Manner. Mol. Pharmacol.
68: 1049-1060
[Abstract]
[Full Text]
-
Santiago-Walker, A. E., Fikaris, A. J., Kao, G. D., Brown, E. J., Kazanietz, M. G., Meinkoth, J. L.
(2005). Protein Kinase C {delta} Stimulates Apoptosis by Initiating G1 Phase Cell Cycle Progression and S Phase Arrest. J. Biol. Chem.
280: 32107-32114
[Abstract]
[Full Text]
-
Zhong, H., Bryson, A., Eckersdorff, M., Ferguson, D. O.
(2005). Rad50 depletion impacts upon ATR-dependent DNA damage responses. Hum Mol Genet
14: 2685-2693
[Abstract]
[Full Text]
-
Shirata, N., Kudoh, A., Daikoku, T., Tatsumi, Y., Fujita, M., Kiyono, T., Sugaya, Y., Isomura, H., Ishizaki, K., Tsurumi, T.
(2005). Activation of Ataxia Telangiectasia-mutated DNA Damage Checkpoint Signal Transduction Elicited by Herpes Simplex Virus Infection. J. Biol. Chem.
280: 30336-30341
[Abstract]
[Full Text]
-
Herman-Antosiewicz, A., Singh, S. V.
(2005). Checkpoint Kinase 1 Regulates Diallyl Trisulfide-induced Mitotic Arrest in Human Prostate Cancer Cells. J. Biol. Chem.
280: 28519-28528
[Abstract]
[Full Text]