Previous Article | Next Article 
Molecular and Cellular Biology, July 2001, p. 4441-4452, Vol. 21, No. 14
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.14.4441-4452.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Phosphorylation of MafA Is Essential for Its
Transcriptional and Biological Properties
Sofia
Benkhelifa,
Sylvain
Provot,
Eugène
Nabais,
Alain
Eychène,
Georges
Calothy, and
Marie-Paule
Felder-Schmittbuhl*
UMR 146 CNRS-Institut Curie, Centre
Universitaire, 91405 Orsay cedex, France
Received 6 November 2000/Returned for modification 5 January
2001/Accepted 21 April 2001
 |
ABSTRACT |
We previously described the identification of quail MafA, a novel
transcription factor of the Maf bZIP (basic region leucine zipper)
family, expressed in the differentiating neuroretina (NR). In the
present study, we provide the first evidence that MafA is
phosphorylated and that its biological properties strongly rely upon
phosphorylation of serines 14 and 65, two residues located in the
transcriptional activating domain within a consensus for phosphorylation by mitogen-activated protein kinases and which are
conserved among Maf proteins. These residues are phosphorylated by ERK2
but not by p38, JNK, and ERK5 in vitro. However, the contribution of
the MEK/ERK pathway to MafA phosphorylation in vivo appears to be
moderate, implicating another kinase. The integrity of serine 14 and
serine 65 residues is required for transcriptional activity, since
their mutation into alanine severely impairs MafA capacity to activate
transcription. Furthermore, we show that the MafA S14A/S65A mutant
displays reduced capacity to induce expression of QR1, an
NR-specific target of Maf proteins. Likewise, the integrity of serines
14 and 65 is essential for the MafA ability to stimulate expression of
crystallin genes in NR cells and to induce NR-to-lens transdifferentiation. Thus, the MafA capacity to induce differentiation programs is dependent on its phosphorylation.
 |
INTRODUCTION |
Transcription factors of the Maf
family contain a conserved basic region leucine zipper (bZIP) domain,
which is responsible for their dimerization and DNA binding property
and is closely related to the bZIP domain of the AP1 superfamily
members. Accordingly, Maf protein dimers bind to a DNA sequence motif
similar to the tetradecanoyl phorbol acetate (TPA)-responsive and
cyclic AMP-responsive recognition sequences for AP1 proteins: the Maf
recognition element (MARE) TGCTGAC(G)TCAGCA
(29). Three members of the Maf family contain the
bZIP domain only and are collectively referred to as small Mafs: MafG
(28), MafF, and MafK (11). In contrast, the
four large Mafs (c-Maf, MafB, NRL, and MafA [also known as L-Maf])
carry an N-terminal transactivating domain which is extensively conserved and is rich in proline, serine, and threonine residues. The
family prototype, c-maf (45), was
discovered as an oncogene transduced in the avian AS42 retrovirus.
Avian mafB, like the small members, was isolated by homology
screening (27). NRL was identified in both human and
murine retina (61). Finally, mafA (or
L-maf) was recently isolated by two different approaches. We
previously reported the identification of quail mafA by a
neuroretina (NR)-specific cDNA screening based on homologies between
large Maf proteins (2). The same gene, designated
L-maf, was simultaneously cloned by using a functional
screening for chicken proteins able to bind the promoter of the
A-crystallin gene (46). We showed that MafA expression
is developmentally regulated in the NR with its highest levels
coinciding with NR differentiation. MafA synthesis also correlates with
the expression of an NR quiescence and differentiation marker, QR1,
encoded by one of the first genes identified as a target for Maf
transcription factors (52). Accordingly, we showed that
MafA is able to transactivate the QR1 promoter in transient transfection assays. MafA, which is expressed in the lens placode as
early as the onset of lens formation, was suggested, meanwhile, to be a
master gene for lens differentiation. When expressed ectopically in
chick embryos, it is able to enhance expression of the lens-specific
-,
-, and
-crystallin genes, whose promoters contain MARE
sequences, and to promote transdifferentiation of NR cells into lens
fibers (46). Based on genetic analysis, murine c-Maf was
also recently demonstrated to be a key regulator of lens development,
probably at later stages (32, 34, 56). More generally, Maf
proteins are emerging as important regulators of cell differentiation
in various tissues, in particular in the eye. Besides c-Maf and MafA, NRL was suggested to be of crucial importance in the photoreceptor visual function by activating transcription of the rhodopsin gene (35, 54). In addition, MafB was shown to be implicated
both in rhombencephalon development, by regulating expression of
hoxa-3 and hoxb-3 genes (39, 40),
and in monocytic differentiation (33, 58). Maf family
members also seem to play a role in various hematopoietic lineages. One
consistent example is that of the small Maf proteins which, likely as
heterodimers with the p45 NF-E2 bZIP protein, are implicated in the
upregulation of the
-globin locus during erythroid
differentiation (24, 47).
In spite of a clearly established role of Maf family transcription
factors in regulating differentiation processes, regulation of their
activity remains poorly documented. In particular, nothing is known
concerning their posttranslational modifications. It was reported that
the NF-E2 complex is targeted by ERK1/2 mitogen-activated protein (MAP)
kinase (MAPK) and protein kinase A signaling pathways during erythroid
differentiation (12, 44, 62), but the molecular bases of
this effect are still unclear. The activity of many transcription factors is regulated in a rapid and reversible manner by
phosphorylation. Key players responsible for this process are protein
kinases which act in signaling cascades initiated by extracellular
stimuli. Among the pathways frequently used to transduce these signals are the highly conserved MAPK cascades. These cascades are found in all
eukaryotic cells and regulate many crucial processes such as cell
division, differentiation, apoptosis, and response to stress (reviewed
in reference 57). Once activated, the MAPKs can
translocate into the nucleus where they phosphorylate cognate nuclear
targets. Many transcription factors, notably some playing a role in the
eye development, have been shown to be targeted by MAPK pathways. Among
these, Microphthalmia (19) and the Drosophila Yan and
pointed P2 proteins of the Ets family (5) are
phosphorylated by ERKs, c-Jun (21) and ATF2
(16) are phosphorylated by JNKs, and CHOP
(63), Pax6 (41), and MEF2C (17)
are phosphorylated by p38. Various functional consequences of
phosphorylation on transcription factors have been observed, such as
alteration of protein stability (43), cellular
localization (8), DNA binding (64),
interaction with partners (37), and transactivation capacity (3). Thus, phosphorylation cascades, elicited at
the cellular membrane, have the potential to turn extracellular signals into specific and finely tuned nuclear responses.
We report here, for the first time, that the activity of a Maf
transcription factor is strongly dependent on phosphorylation. We show
that the MafA protein is constitutively detected as a phosphoprotein in
both NR and HeLa cells and that serine 14 and serine 65 residues, which
are conserved among all large Maf proteins, constitute the major
phosphorylation sites. Mutation of these residues into alanine severely
affected both phosphorylation of the protein and its transactivating
capacity, suggesting that they are the critical sites for the
functional regulation of MafA. Moreover, we show that phosphorylation
of MafA is crucial for its biological activity, since mutagenesis of
these residues leads to a dramatic decrease in the capacity of MafA to
both activate QR1 expression and induce lens
transdifferentiation of NR cells. Thus, the transcriptional capacity
and, consequently, the biological function of MafA appear to be
directly determined by phosphorylation on serines 14 and 65. Since
these residues fit the consensus motif for phosphorylation by the
kinases of the MAPK subgroup, we also investigated whether members of
this family could be responsible for this regulation. We show that ERK2
but not other MAPK phosphorylated MafA serine 14 and serine 65 residues
in vitro, but that activation or inhibition of the MEK/ERK cascade only
slightly affected the status of MafA phosphorylation in vivo. Taken
together, these results suggest that another kinase(s) is responsible
for the in vivo activation of MafA protein.
 |
MATERIALS AND METHODS |
Plasmids and constructs.
A bacterial expression vector for
wild-type MafA was constructed by subcloning the MafA full-length open
reading frame, obtained by PCR inserting flanking EcoRI
sites and Kozak consensus, into the pBluescript vector (Stratagene).
This plasmid was used as a template for site-directed mutagenesis
(Transformer site-directed mutagenesis kit, Clontech) to substitute
serine 14 and serine 65 with alanine. The following oligonucleotides
were used: GCTGCCCACCGCCCCCCTCGCC for S14 and
CCGTGCCTTCCGCGCCCAGTTTC for S65 (modified bases
are underlined).
pcDNA3-MafA plasmids encoding either wild-type (WT) or mutated MafA
were obtained by subcloning the EcoRI wild-type or mutated inserts of the pBluescript plasmid into the EcoRI site of a
pcDNA3-modified vector, in frame with the HA1 epitope coding sequence.
RCAS-MafA (kindly provided by Marc Castellazzi) and RCAS-S14A/S65A
plasmids were obtained by cloning the
EcoRI MafA open
reading
frame into the Cla12 shuttle vector and subsequent
ClaI insertion
into the RCAS vector (
23).
For the synthesis of glutathione
S-transferase (GST)-MafA
recombinant proteins, the MafA
EcoRI fragment, either WT or
mutated,
was subcloned into the
EcoRI site of the pGex-4T1
vector (Amersham
Pharmacia Biotech). For the synthesis of GST-Nter
proteins, an
EagI deletion, eliminating the bZIP domain, was
performed in the
previous construct. For the synthesis of GST-Cter
proteins, an
EagI fragment corresponding to the MafA bZIP
domain was subcloned
into the
NotI site of pGex-4T2
(Amersham Pharmacia
Biotech).
Reporter constructs, either empty (TK10) or carrying a multimerized A
box (4×Abox) upstream of the thymidine kinase promoter,
were
previously described (
52).
pcDNA3-derived vectors encoding the S222A and S218D/S222D mutants of
MEK1 were previously described (
50).
The expression vector for HA1-ERK2 (
20) was kindly
provided by Michael J. Weber. Expression vectors for HA1-JNK1
(
9)
and HA1-p38

(
4) were kindly provided
by Roger J. Davis. GST-Jun/1-79
(
21) and GST-ATF2/1-109
(
16) recombinant proteins were a kind
gift from Joël
Raingeaud. Expression vectors for HA1-ERK5 and
for the synthesis of
GST-MEF2C were kind gifts from Silvio Gutkind
(
7). The
expression vector for MEK5DD was kindly provided by
Melanie Cobb
(
10).
Antibodies.
To identify mafA gene products we
prepared a rabbit polyclonal antiserum raised against a MafA-specific
peptide encompassing residues 131 to 153. The corresponding sequence
was obtained by PCR and subcloned into the pLC24 vector
(55), in frame with the bacteriophage MS2 polymerase. The
bacterially expressed fusion protein was purified and used for
immunization. Antiserums directed against chicken
-,
-, and
-crystallins were kindly provided by Joram Piatigorsky (42,
48). QR1-directed antiserum was previously described
(6).
Cell culture and transfection assays.
HeLa cells were
maintained and transfected in Dulbecco's modified Eagle medium (DMEM)
supplemented with 10% fetal bovine serum (FBS). For TPA stimulation
experiments, cultures were starved for 6 to 8 h in DMEM containing
0.1% FBS and stimulated by the addition of 160 µM TPA (Sigma
Aldrich) for 5 min, in the presence or not of 30 µM PD98059 (Alexis
Biochemicals; added 2 h prior to the addition of TPA).
Quail and chicken NR cells were dissected from 7- and 8-day-old
embryos, respectively, dissociated, and put in culture as
previously
described (
49). NR cell cultures were maintained
and
transfected in basal medium of Eagle supplemented with 10%
FBS. HeLa
and NR cell cultures were transfected according to the
standard calcium
phosphate coprecipitation technique, as previously
described
(
52). Twenty-four hours prior to transfection, NR
and HeLa
cells were seeded at a density of 8 × 10
6 to 10 × 10
6 and 1.5 × 10
6 cells per 100-mm
dish, respectively. Transfection was carried
out with a total of 20 µg of DNA. When pcDNA3-MafA constructs
were cotransfected with
expression vectors for MEK1, a 1/2 MafA/MEK1
ratio was used. For HeLa
cells, the precipitate was left 24 h
and then the medium was
changed and the cells were lysed 24 h
later. For NR cells, the
precipitate was left 5 h, the cultures
were washed 4 to 5 times
with phosphate-buffered saline (PBS),
and new medium was then
added.
Cell extracts were prepared in lysis buffer (140 mM NaCl, 20 mM Tris
[pH 8.0], 2 mM EDTA, 1/10 [vol/vol] glycerol, 1/100 [vol/vol]
NP-40, supplemented with protease and phosphatase inhibitors)
and
centrifuged at 21,000 ×
g (20 min, 4°C). The
concentration
of total soluble proteins in the supernatant was
quantified using
the Bradford reagent (Bio-Rad).
CAT assays.
MafA transcriptional activity was examined in
quail embryo NR cells transfected with tsNY68, a
temperature-sensitive variant of Rous sarcoma virus. We previously
showed that transcription of the QR1 gene is shut down in
infected quail embryo NR cells maintained at 37°C and restored when
the cultures are shifted to 41°C, the temperature at which the v-Src
oncoprotein is inactivated (14, 15). Actively
proliferating cells were seeded at 9 × 105 cells per
100-mm-diameter dish and transfected 48 h later by the calcium
phosphate technique, as described previously (52). Cultures were shifted to 41°C 2 h after transfection. Each
transfection mixture contained 1 µg of the respective reporter
plasmids, 3 µg of MafA expression vectors, and 2 µg of
-actin-lacZ (1) internal control. Cells
were harvested 48 h later, and chloramphenicol acetyltransferase
(CAT) activity was measured (13) after normalization according to
-galactosidase activity. Activity of distinct
chloramphenicol substrate and products, following thin-layer
chromatography, was determined by using the PhosphorImager instrument
(Molecular Dynamics).
Metabolic labeling.
HeLa cultures transfected with
pcDNA3-MafA plasmids were left 4 h in phosphate-free DMEM (ICN)
containing 2% dialyzed newborn calf serum and then labeled for 5 h by adding 1 m Ci of [32P]- or
[33P]orthophosphate (Amersham Pharmacia Biotech)
per ml. The dishes were placed on ice and washed twice in ice-cold PBS,
and the cells were harvested by scrapping in radioimmunoprecipitation
assay (RIPA) buffer (PBS containing 20% sodium dodecyl sulfate
[SDS], 0.5 M EDTA, 1% aprotinine, 250 mM deoxycholic acid, 1 mM
4-(2-aminoethyl)benzenesulfonyl fluoride (AEBSF), 1 mM orthovanadate,
25 mM
-glycerophosphate) and centrifuged at 21,000 × g
(20 min, 4°C). The concentration of total soluble proteins in the
supernatant was quantified using the Bradford reagent (Bio-Rad).
Immunoprecipitation and phosphatase treatment.
Cellular
extract (250 µg of total proteins) was incubated (2 h, 4°C) with 2 µl of anti-MafA or preimmune serum and proteine A-Sepharose (Sigma
Aldrich), centrifuged, washed in RIPA buffer, and resuspended in 2×
SDS-polyacrylamide gel electrophoresis (PAGE) loading buffer.
For

-phosphatase treatment, washed immunoprecipitates were split in
two and washed twice in 10 mM Tris-HCl (pH 7.4)-150 mM
NaCl-1 mM EDTA
buffer and the beads were resuspended in 50 µl
of

-phosphatase
buffer (New England Biolabs). The reaction was
carried out (30 min,
30°C) in one of the tubes by addition of
80 U of

-phosphatase (New
England Biolabs) and stopped by addition
of 2× SDS-PAGE loading
buffer.
Western blot analysis.
Immunoprecipitates resuspended in
loading buffer or samples (100 to 300 µg) of total protein extracts
were run on SDS-10 to 12% polyacrylamide gels and transferred to
Immobilon-p membranes (Millipore). The membranes were incubated with
the following primary antibodies (overnight, 4°C) diluted in blocking
buffer TBST (Tris-buffered saline containing 0.2% Tween 20, supplemented with 5% nonfat dry milk): anti-HA1 12CA5 monoclonal
antibody (Roche; 100 ng/ml), anti-MafA (dilution, 1/1,000), anti-GST
(Amersham Pharmacia Biotech; 500 ng/ml), anti-
-actin (Sigma Aldrich;
1/5,000), anti-ERK1 (Santa Cruz Biotechnology; 1/2,000),
anti-phospho-ERK (New England Biolabs; 1/1,000), anti-
-,
-, or
-crystallin (1/1,000 to 1/2,000), and anti-QR1 (1/8,000). After four
washes in TBST buffer, membranes were incubated with the following
secondary antibodies conjugated to horseradish peroxidase and diluted
in blocking buffer: swine anti-mouse antibody for anti-HA1 and
anti-
-actin (Amersham Pharmacia Biotech; 1/10,000); donkey
anti-rabbit antibody (Amersham Pharmacia Biotech; 1/20,000) for
anti-MafA, anti-ERK1, anti-phospho-ERK, and anti-QR1; rabbit anti-goat
antibody (Sigma Aldrich; 1/8,000) for anti-GST; and monoclonal
anti-goat or -sheep antibody (Sigma Aldrich; 1/10,000) for anti-
-,
-, and
-crystallin antibodies. Membranes were further processed
using the chemiluminescence Super Signal Ultra reagent (Pierce).
Phosphoamino acid analysis.
Phosphoamino acid analysis of
MafA protein excised from Western blot membrane and fixed in methanol
was performed by acid hydrolysis (6 M HCl, 1 h, 110°C). The
hydrolyzed protein was dried out and resuspended in 10/100/1,890
pyridine-acetic acid-H2O (pH 3.5) and subjected to
thin-layer electrophoresis.
In vitro protein kinase assays.
GST fusion recombinant
proteins were purified from Escherichia coli DH5
extracts
using glutathione-Sepharose beads according to the manufacturer's
recommendations (Amersham Pharmacia Biotech). Proteins were eluted by
addition of 50 mM glutathione and stored at
80°C. HeLa cells were
transiently transfected with expression vectors encoding either
HA1-tagged ERK2, JNK1, or p38
MAPKs or cotransfected with expression
vectors for MEK5DD and HA1-tagged ERK5. Twenty-four hours after
transfection, ERK2-expressing cells were starved for 2 h and were
treated for 10 min with TPA (160 µM) prior to lysis. JNK1- and
p38
-expressing cells were starved for 2 h and left untreated or
treated for 30 s with UV-C (80 J/m2) and then
incubated another 40 min at 37°C prior to lysis. HA1-tagged MAPKs
were immunoprecipitated from cell extracts by incubation for 2 h
at 4°C with 12CA5 anti-HA1 antibody (Roche) bound to protein A-Sepharose beads (Sigma Aldrich). The immune complexes were washed in
kinase buffer (25 mM HEPES [pH 7.4], 25 mM
-glycerophosphate, 25 mM MgCl2, 2 mM dithiothreitol, 1 mM orthovanadate), and equal amounts
were added to 0.5 µg of recombinant proteins, 1 mM ATP and 10 µCi
of [
-32P]ATP. The reaction was carried out 30 min at
30°C, stopped by addition of 2× SDS-PAGE loading buffer, and
subjected to Western blot analysis and autoradiography. Kinase assays
(see Fig. 4B) were carried out with 5 U of recombinant activated ERK2
(New England Biolabs).
Gel shift analysis.
MafA proteins encoded by the pcDNA3
vector were obtained by in vitro transcription and translation in
reticulocyte lysates (TNT-coupled reticulocyte lysate system; Promega)
and used in electrophoretic mobility shift assays. Double-stranded
oligonucleotide corresponding to the 48-bp A box region was labeled
with polynucleotide kinase and [
-32P]ATP and incubated
with MafA proteins 20 min at 20°C in binding buffer. Complexes were
resolved on 5% polyacrylamide gels and subjected to autoradiography.
RT-PCR.
Total RNA was prepared using the RNA Now extraction
kit (In Vitrogen). Reverse transcription (RT) was carried out with 1 µg of total RNA by using the Promega reverse transcription system. PCR was performed with Taq DNA polymerase (Promega) in the
presence of 200 µM deoxynucleoside triphosphate and 1 µM primers.
Primer pairs, number of cycles, and annealing temperatures were as
follows: MafA (5'TTCCACCCCTCTCAGCAC and
5'CTCCCGAACCGACATACT; 26 cycles; 58°C);
A-crystallin
(5'GCCTTTGTTCTCCTCCACTATCAG and
5'GTGGAACTCACGAGAGATGTAGC; 26 cycles; 56°C);
B1-crystallin (5'AGCAGCTGCCCAGACCCGAG and
5'GCTGACGATGACACTGCCCAC; 26 cycles; 60°C);
1-crystallin
(5'CTGAGCTGGAGAAGATCCTGAG and 5'TCCACCAGGGTCTTGATGAGC;
23 cycles; 56°C); and S17 (5'TACACCCGTCTGGGCAACGAC and 5'CCGCTGGATGCGCTTCATCAG; 23 cycles; 58°C).
Immunofluorescence.
Chicken NR cells or HeLa cells were
transfected, respectively, with RCAS- or pcDNA3-derived plasmids
encoding WT or mutant MafA proteins and were seeded on coverslips
precoated with poly-L-lysine. Forty-eight hours (HeLa
cells) or 6 days (NR cells) after transfection, cells were fixed in 4%
paraformaldehyde for 20 min and permeabilized in 0.25% Triton X-100
for 15 min. Coverslips were then blocked with 5% PBS-FBS for 1 h
and incubated with primary antibodies (1/1,000) for 1 h at room
temperature. After washing with PBS, cells were incubated with
secondary antibodies for 1 h at room temperature: rhodamine-conjugated
donkey anti-rabbit antibody for MafA (Jackson ImmunoResearch
Laboratories, Inc.; 1/150), fluorescein isothiocyanate-conjugated
donkey anti-goat antibody for crystallins (Sigma Aldrich; 1/150) and
fluorescein isothiocyanate-conjugated goat anti-mouse antibody for HA1
epitope (Sigma Aldrich; 1/200). Preparations were then washed in
PBS and mounted in Vectashield containing 4',6-diamidino-2-phenylindole
(DAPI) (Vector Laboratories).
 |
RESULTS |
MafA is a phosphoprotein.
To investigate the
phosphorylation status of MafA, we transfected HeLa cells with a
pcDNA3-derived vector encoding an HA1 epitope-tagged MafA
and labeled the cells with [32P]orthophosphate. Cellular
lysates, prepared 48 h after transfection, were immunoprecipitated
with an antiserum raised against a MafA-specific region located between
the two histidine repeats (see Materials and Methods) and analyzed by
Western blotting with anti-HA1 antibody (Fig.
1A). MafA products could be resolved into
four major bands: two upper ones of apparent molecular mass of 40 and
43 kDa and two lower ones of 35 and 37 kDa. Autoradiography of the same
blot showed that only the two upper bands contained
[32P]phosphate, whereas we could not detect a radioactive
signal in the lower ones. To confirm that the distinct MafA migrating bands visualized by Western blot were due to phosphorylation, we
treated MafA immunoprecipitates with
phage phosphatase. In this
case only one band, comigrating with the 35-kDa lower band, could be
detected (Fig. 1B). Thus, at least the 37-, 40-, and 43-kDa migrating
forms of MafA appear to be generated by phosphorylation. Phosphoamino acid analysis showed that MafA immunoprecipitated from
HeLa cells is phosphorylated predominantly on serine and, to a
lesser extent, on threonine but not on tyrosine residues (Fig.
1C). These results indicated that overexpressed MafA protein was
phosphorylated in HeLa cells. Phosphorylation markedly affected its
electrophoretic mobility and presumably involved serine/threonine kinases.

View larger version (63K):
[in this window]
[in a new window]
|
FIG. 1.
MafA is phosphorylated in HeLa cells. (A) HeLa cells
transfected with pcDNA3-MafA were metabolically labeled with
[32P]orthophosphate, and cellular extracts were
immunoprecipitated with either preimmune (P) or MafA-specific (I)
serum. Immunoprecipitates were analyzed by Western blotting followed
either by incubation with anti-HA1 antibody (left panel) or by direct
autoradiography (right panel). (B)MafA immunoprecipitates from HeLa
cells were treated with phosphatase (+) or left untreated ( ) and
analyzed by Western blotting with anti-HA1 antibody. Apparent molecular
masses (kDa) of MafA bands are indicated. (C) Phosphoamino acid
analysis of 32P-labeled MafA immunoprecipitated from HeLa
cells. The migration of phosphoamino acid standards is indicated.
|
|
Serine 14 and serine 65 are the major MafA phosphorylation
sites.
The N-terminal region of the large Maf proteins is
remarkably conserved and rich in proline, serine, and threonine
residues. Two putative phosphorylation sites (serine 14 and serine 65 in MafA) for proline-directed kinases, fitting the PXS/TP consensus (60), were conserved among all large Maf amino-terminal
regions (Fig. 2A), raising the
interesting possibility that they could be targeted by common
regulatory mechanisms. To assess whether these two sites were
phosphorylated in MafA, we mutated the serines individually or together
into alanine residues. WT or mutated (S14A, S65A, or S14A/S65A)
HA1-tagged proteins were expressed in HeLa cells, and their
phosphorylation status was examined on the basis of their
electrophoretic mobility. The three MafA mutants were differentially
affected in their migration, since each of them specifically generated
one major band or doublet (Fig. 2B). Thus, the S14A mutant essentially
migrated as a major 40-kDa band and a minor 35-kDa one, whereas the
S65A mutant generated a major band at 37 kDa and a minor one at 43 kDa.
In contrast, the S14A/S65A double mutant essentially migrated as a 35- to 37-kDa doublet with a minor 40-kDa form. Noteworthily, the major
bands generated by the S14A/S65A double mutant migrated at the lowest
apparent molecular mass, a pattern comparable to that of
phosphatase-treated WT MafA. We then examined the phosphorylation
status of the S14A/S65A mutant by metabolic labeling in comparison to
that of WT MafA protein. Immunoprecipitated S14A/S65A protein generated
a faint radioactive signal, at an apparent molecular mass of 40 kDa,
that was barely detectable compared to that of the 40- to 43-kDa
doublet of WT MafA (Fig. 2C). Moreover, the major bands generated by
S14A/S65A MafA, migrating with an apparent molecular mass of 35 to 37 kDa in immunoblots, could not be detected following metabolic labeling. Phosphatase treatment of immunoprecipitated S14A/S65A protein further
generated a unique 35-kDa band, similar to that of WT MafA, indicating
that part of the S14A/S65A protein was still phosphorylated, but to a
much lower level since the mutant protein was barely detectable upon
32P labeling. These results show that integrity of serine
14 and serine 65 residues is necessary to achieve full MafA
phosphorylation in HeLa cells. They also suggest that phosphorylation
generates major conformational changes of MafA protein leading to
substantial shifts in electrophoretic mobility and which could support
functional modifications.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 2.
MafA serine 14 and serine 65 are major phosphorylation
sites. (A) Amino acid sequence comparison of the TAD of large Maf
proteins (quail MafA, chicken MafB and c-Maf, and human NRL). Conserved
sequences fitting the proline-directed sequence consensus and
surrounding serines 14 and 65 in MafA are highlighted. (B) Western blot
analysis of WT and mutated MafA. pcDNA3-derived vectors encoding either
WT, S14A, S65A, or S14A/S65A MafA were transfected into HeLa cells, and
cellular extracts were analyzed by immunoprecipitation with
MafA-directed serum and Western blotting with anti-HA1 antibody. (C)
HeLa cells transfected with either pcDNA3-WT or pcDNA3-S14A/S65A
were metabolically labeled with
[32P]orthophosphate, and cellular extracts were
immunoprecipitated with MafA-directed serum. Immune complexes were
analyzed by Western blotting followed by either incubation with
anti-HA1 antibody (left panel) or direct autoradiography (right panel).
In the lower panel, S14A/S65A MafA immunoprecipitates were treated with
phosphatase (+) or left untreated ( ) and analyzed by Western
blotting with anti-HA1 antibody.
|
|
MafA is phosphorylated in vitro by MAPKs ERK2 and p38
but not by
JNK1 and ERK5.
Since serine 14 and serine 65 residues were lying
in a proline-directed kinase consensus, we considered the possibility
that MafA could be a substrate for serine/threonine kinases of the MAPK
family, a subgroup of proline-directed kinases known to phosphorylate transcription factors of the AP1/bZIP family (26). We
first examined the ability of MafA to be phosphorylated in vitro by MAPKs ERK2, JNK1, p38
, and ERK5. Therefore, we transfected HeLa cells with expression vectors encoding each of the HA1-tagged kinases,
and we activated the different kinases with their appropriate stimuli.
Activated kinases were then immunoprecipitated with HA1-specific antibody and incubated with either GST-MafA protein or with their cognate control substrates in the presence of
[
-32P]ATP. ERK2 displayed a strong ability to
phosphorylate MafA upon activation by TPA (Fig.
3A). Likewise, activated p38
was able to substantially phosphorylate MafA. In contrast, JNK1 or ERK5 had no
effect on MafA phosphorylation compared to their respective effects on
GST-Jun and GST-MEF2C positive controls. To further characterize the
region of MafA that was phosphorylated by ERK2, we performed similar
experiments with GST fusion proteins containing either the
transactivating domain (TAD) of MafA (GST-Nter) or its bZIP domain
(GST-Cter). The MafA N-terminal part could be efficiently
phosphorylated by MAPK ERK2 whereas the C-terminal domain was not
phosphorylated (Fig. 3B). Since serine 14 and serine 65 residues were
located in the TAD, we performed kinase assays with activated ERK2 on
GST-MafA fusion proteins carrying the S14A and/or the S65A mutation in
order to map the phosphorylation sites in MafA. Each of the single
mutants showed reduced phosphorylation when compared to the WT protein.
Moreover, phosphorylation of the S14A/S65A mutant by ERK2 was no longer
detectable (Fig. 3B). Taken together, these results demonstrated that
activated ERK2 phosphorylated MafA TAD in vitro and that the S14 and
S65 residues were its major and specific targets. We performed similar
experiments to determine if the same residues were phosphorylated by
p38
(Fig. 3C). GST-MafA recombinant proteins, either WT or carrying the S14A/S65A mutation, appeared to be similarly phosphorylated by
activated p38
, indicating that S14 and S65 residues were not the
major targets for MafA phosphorylation by p38. In conclusion, although
both ERK2 and p38 MAPKs phosphorylate MafA in vitro, only ERK2 appears
to be able to phosphorylate MafA on S14 and S65.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 3.
Differential phosphorylation of MafA by members of the
MAPK family in vitro. (A) HeLa cells were transfected with expression
vectors for ERK2, p38 , JNK1, or ERK5 HA1-tagged MAPKs and
stimulated, respectively, with TPA, UV, UV, or by cotransfection with
an expression plasmid for MEK5DD, an activated version of MEK5. Kinases
were immunoprecipitated with anti-HA1 antibody and incubated with
[ -32P]ATP and GST-MafA recombinant protein, followed
by Western blot and either direct autoradiography or incubation with
anti-GST antibody. Positive controls (myelin basic protein [MBP] for
ERK2, GST-ATF2 for p38 , GST-Jun for JNK1, and GST-MEF2C for ERK5)
were treated likewise. (B) GST-MafA fusion proteins containing either
truncated (left panels) or mutated (right panels) forms of MafA were
subjected to kinase assay with recombinant activated ERK2. MafA, GST
fused to full-length MafA; Nter, GST fused to the N-terminal half of
MafA; Cter, GST fused to the C-terminal half of MafA; S14A, S65A, and
S14A/S65A, GST fused to full-length MafA carrying the respective
mutations. In vitro kinase assays were analyzed as described for panel
A. (C) GST-MafA, either WT or carrying the S14A/S65A mutation, was
subjected to in vitro kinase assay with activated p38
immunoprecipitated from HeLa cells as described for panel A.
|
|
MafA can be phosphorylated by the ERK1/2 MAPKs in vivo.
To
investigate whether MafA could also be a target for ERK1/2 kinases in
vivo, we transfected HeLa cells with an expression vector encoding WT
HA1-tagged MafA protein and examined changes in mobility following
stimulation or inhibition of the MEK/ERK cascade. Transfected cultures
were maintained in medium containing 0.1% FBS during 8 h and
subsequently treated with TPA in the presence or absence of PD98059, a
specific inhibitor of the MEK/ERK pathway. Cellular lysates were then
immunoprecipitated with MafA-specific antiserum and subjected to
HA1-specific imunoblot. Serum-deprived HeLa cells predominantly
contained the MafA 40- to 43-kDa forms and, in lower amounts, the
35- and 37-kDa forms (Fig. 4A). These two
lower bands were no longer observed after TPA treatment and became
again detectable when cells were treated with TPA in the presence of
PD98059, indicating that activated ERK1/2 could phosphorylate the lower
migrating forms. To confirm these results, we transfected the
MafA expression vector together with plasmids encoding
dominant negative (S222A) or constitutively activated
(S218D/S222D) MEK1, the upstream specific activator of ERK1/2. Again,
the lower 35- to 37-kDa bands were no longer detectable when the ERK1/2
pathway was activated in the presence of S218D/S222D MEK1 (Fig. 4B).
However, cotransfection with S222A MEK1 did not affect MafA
electrophoretic mobility, indicating that MafA phosphorylation could
not be significantly altered by inhibiting the MEK/ERK cascade (Fig.
4B). Activation or inhibition of the ERK cascade had no effect on the
S14A/S65A mutant MafA (Fig. 4B). Thus, MafA could be phosphorylated in
response to activation of the MEK/ERK cascade in vivo, presumably on
S14 and S65 residues. However, contribution of this pathway to MafA phosphorylation in vivo appears to be moderate.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 4.
MafA serines 14 and 65 can be phosphorylated in vivo in
response to activation of the MEK/ERK pathway. (A) HeLa cells were
transiently transfected with pcDNA3-derived vectors encoding WT MafA
and either serum-starved ( ), treated with TPA (TPA), or treated with
TPA in the presence of PD98059 (PD98059). Cellular extracts were
immunoprecipitated with MafA-directed antiserum and analyzed by Western
blotting with anti-HA1 antibody. The status of ERK activation was
controlled as follows: protein extracts from identical cultures were
analyzed by Western blotting with anti-phospho-ERK antibody, stripping
of the membranes, and reprobing with anti-ERK antibody. (B) HeLa cells
were transiently transfected with pcDNA3-derived vectors encoding
either WT MafA (WT) or S14A/S65A MafA (S14A/S65A) and with
expression vectors for MEK1S218D/S222D (MEK-DD), MEK1S222A
(MEK-SA), or empty vector ( ). Cell lysates were treated as described
for panel A. (C) Control of the constitutively active and dominant
negative property of the respective S218D/S222D and S222A MEK1
mutants. Cultures of HeLa cells were transfected as described for panel
B, with the addition of an HA-ERK2 expression plasmid in the
transfection mix. The status of ERK activation in the presence of
either MEK-DD or MEK-SA was analyzed under two experimental
conditions. In the first three lanes (left side), serum-starved
cultures were stimulated for 10 min by addition of medium
containing 20% FBS. In the last three lanes (right side), cells
were maintained in culture without any additional stimulation, as
in panel B. Cellular extracts were immunoprecipitated with HA1-directed
antibody and analyzed by Western blotting with anti-phospho-ERK
antibody, stripping of the membranes, and reprobing with anti-ERK
antibody.
|
|
Mutation of S14 and S65 residues severely impairs MafA
transcriptional activity.
To evaluate the functional importance of
MafA phosphorylation, we examined the transactivating capacity of MafA
proteins mutated at S14, S65, or at both residues. We previously
reported that the promoter of the NR-specific QR1 gene
carries a Maf responding sequence, the A box, which contains two
hemipalindromes of the Maf recognition element (52). We
showed that the QR1 promoter, as well as the multimerized A
box alone, is transactivated by members of the large Maf protein
subfamily, such as c-Maf, MafB, and MafA (2, 52).
Therefore, we compared the transcriptional capacity of WT and mutant
MafA proteins by using a reporter construct containing four copies of
the A box sequence cloned upstream of the tk promoter and
CAT reporter gene (52). Quail NR cells infected with a
temperature-sensitive mutant of Rous sarcoma virus were transfected
with reporter constructs and pcDNA3-derived expression vectors for
mafA alleles and transferred to 41°C, the nonpermissive temperature for cell division, at which QR1 expression is
induced in response to v-Src inactivation (14, 51).
Forty-eight hours later, cellular extracts were assayed for CAT
activity. In contrast to the strong transactivating potential of WT
MafA on the A box-containing reporter, the S14A, S65A, and S14A/S65A
mutant proteins all displayed a significant decrease (by 30, 55, and
75%, respectively) in transcriptional activating capacity (Fig.
5A). Similar effects were observed when we used the QR1 promoter reporter plasmid (data not shown).
Thus, the transcriptional capacity of MafA strongly relies upon the integrity of the S14 and S65 phosphorylation sites.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 5.
Serines 14 and 65 are required for MafA transcriptional
activity. (A) Quail NR cells infected with tsNY68 virus were
transiently transfected with the TK10/4×Abox reporter or empty TK10
plasmid and pcDNA3-derived vectors either empty or encoding WT, S14A,
S65A, or S14A/S65A versions of MafA. CAT activity was measured at
41°C and expressed as a relative value with respect to the
TK10/4×Abox and pcDNA3-WT transfection. Results represent mean values
from four experiments. Expression levels for WT and mutant MafA
proteins were controlled by Western blotting in each experiment (data
not shown). (B) Serine 14 and serine 65 residues are not required for
MafA DNA binding. WT or mutated MafA proteins encoded by pcDNA3-derived
plasmids were obtained by in vitro transcription and translation in
reticulocyte lysates and subjected to gel-shift analysis with a
32P-labeled A box probe. MafA + PPase indicates
that the WT MafA-containing lysate was incubated with phosphatase
prior to DNA binding. MafA/MafA indicates MafA homodimers bound to the
probe. ns, nonspecific bands. (C) Integrity of serine 14 and serine 65 residues is not required for MafA nuclear localization. HeLa cells were
transiently transfected with pcDNA3-derived vectors encoding WT, S14A,
S65A, or S14A/S65A forms of MafA and analyzed by immunofluorescence
with anti-HA1 antibody.
|
|
The marked reduction in transcriptional activity of the MafA mutants
was not due to their decreased ability to form homodimers
and to bind
DNA, since these proteins synthesized in vitro retained
their ability
to bind the A box fragment (Fig.
5B). Furthermore,
the binding capacity
of all Maf proteins was unaffected by phosphatase
treatment (Fig.
5B
and data not shown), suggesting that phosphorylation
was not an
absolute requirement for dimer formation and interaction
with the
target DNA
sequence.
To assess whether the mutation of S14 and S65 residues affected MafA
subcellular localization, we expressed HA1-tagged MafA
proteins in HeLa
cells and analyzed their localization by immunofluorescence
with
HA1-specific antibody. WT and each MafA mutant protein were
detected
exclusively in the nucleus (Fig.
5C), indicating that
mutation of
serines 14 and 65 and subsequent protein underphosphorylation
did not
impair nuclear localization. In conclusion, our results
show that S14
and S65, the major determinants of MafA phosphorylation,
are also major
determinants of its transcriptional property. Since
mutation of these
sites severely impaired transactivating potential
without affecting DNA
binding and nuclear localization, it is
likely that their
phosphorylation controls the activity of the
TAD per
se.
Integrity of S14 and S65 residues is required to activate
QR1 expression in NR cells.
The QR1 gene
product is a secreted glycoprotein, associated with the extracellular
matrix, that belongs to the SPARC family. It is specifically expressed
in Müller glial cells of postmitotic and differentiating NR and
could play a role in the differentiation of photoreceptor cells
(6, 14). To investigate the importance of MafA
phosphorylation in regulating the expression of NR-specific target
genes, we first examined whether MafA was also phosphorylated in these
cells. Therefore, we transfected quail embryonic NR cells with an RCAS-derived retroviral vector encoding WT MafA
(RCAS-MafA). After three passages, we metabolically labeled the cells
with [33P]orthophosphate and immunoprecipitated cellular
lysates with MafA-specific serum. The presence of a protein with an
apparent molecular mass of 41 kDa specifically recognized by MafA but
not by preimmune serum was detected by autoradiography, indicating that
MafA was also phosphorylated in NR cells (Fig.
6A). Interestingly, Western blot analysis
of NR cells transfected by RCAS-MafA or by a retroviral vector
expressing S14A/S65A MafA (RCAS-S14A/S65A) showed a protein migration
pattern similar to that observed in HeLa cells (Fig. 6B): a major 38- to 41-kDa doublet for WT and a major 33- to 35-kDa doublet and minor
38-kDa band for S14A/S65A. Thus, MafA phosphorylation in NR cells
appears also to principally rely on the integrity of serine 14 and
serine 65 residues.

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 6.
MafA phosphorylation is required to activate
QR1 expression in NR cells. (A) MafA is phosphorylated in NR
cells. Quail embryo NR cells were transfected with an RCAS-derived
vector encoding WT MafA and metabolically labeled with
[33P]orthophosphate. Cellular lysates were
immunoprecipitated with either preimmune (P) or MafA-directed (I) serum
and subjected to Western blotting and autoradiography. (B) Chicken
embryo NR cells were transfected with RCAS-derived vectors encoding WT
or S14A/S65A MafA. Cell extracts were analyzed by direct Western
blotting with MafA-directed serum. (C) Integrity of serines 14 and 65 is required for activation of QR1 expression by MafA.
Chicken embryo NR cells were transfected with empty RCAS (RCAS),
RCAS-MafA (WT), or RCAS-S14A/S65A (S14A/S65A), and cellular lysates
were analyzed by direct Western blotting with anti-QR1 serum (upper
panel) and with anti- -actin antibody as a loading control (lower
panel).
|
|
To further correlate MafA phosphorylation with transcriptional
stimulation of its
QR1 target gene, we compared the levels
of endogenous QR1 protein 6 days after transfection of chicken
embryonic NR cells with either RCAS-MafA or RCAS-S14A/S65A. We
found
that the amount of detected QR1 protein was significantly
increased in
RCAS-MafA infected cells compared to that of cells
infected with the
RCAS control virus (Fig.
6C). In contrast, we
did not detect a
variation in the level of QR1 in NR cells expressing
the S14A/S65A
protein. Thus, the ability of MafA to activate
QR1 transcription and subsequent protein expression in NR cells was
dependent on the integrity of S14 and S65 residues, demonstrating
that
phosphorylation of MafA was required for this biological
property.
Impairment of lens-inductive properties in the S14A/S65A MafA
mutant.
MafA was previously reported to be a major inducer of lens
differentiation, since it was able to induce NR cells to acquire a
number of phenotypic characteristics of lens fiber cells, a process
termed neuroretina-to-lens transdifferentiation that occurred spontaneously in culture, albeit with slower kinetics (46,
59). Therefore, we examined the importance of MafA
phosphorylation at S14 and S65 residues for its ability to induce lens
differentiation in NR cells based on two criteria: the short-term
induction of crystallin expression as monitored by RT-PCR, Western
blotting, and cellular immunofluorescence, and the long-term formation
of lentoid bodies. The level of specific crystallin mRNAs (
A-,
1-, and, to a lesser extent,
B1-crystallin), detectable by
RT-PCR, was significantly reduced in S14A/S65A-expressing NR cells
compared to that detected in WT MafA-containing cultures (Fig.
7A). In addition, the overall levels of
crystallin proteins detected by Western blot analysis were strikingly
reduced in cells containing S14A/S65A MafA (Fig. 7B). This was
correlated with a critical decrease in the number of cells that were
positive for both S14A/S65A MafA and crystallin expression, compared to
that of cultures expressing WT MafA, in immunofluorescence experiments
(Fig. 8). Thus, only a minority of
S14A/S65A MafA-positive cells were doubly stained, whereas doubly
stained cells represented 65 to 95% of WT MafA-positive cells (Table
1). The functional implication of MafA
phosphorylation in this process was further revealed when we examined
the formation of lentoid bodies in long-term-transfected NR cultures.
We observed the presence of abundant and large lentoid bodies in WT
MafA-containing cultures, passaged two or three times, whereas only a
few and small ones could be seen in S14A/S65A MafA chronically infected cells (Fig. 9). Typically, we found a
50:1 ratio of lentoid bodies between the two types of cultures. These
results demonstrate that MafA phosphorylation strongly determines its
capacity to initiate genetic programs leading to lens differentiation
in NR cells.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 7.
Activation of crystallin expression by MafA requires the
integrity of serines 14 and 65. Chicken embryo NR cells were
transfected with empty RCAS (RCAS), RCAS-MafA (WT), or RCAS-S14A/S65A
(S14A/S65A) plasmids. (A) Transcription of A-, B1-, and
1-crystallin genes was analyzed 6 days after transfection by RT-PCR.
MafA- and ribosomal s17-specific PCR were performed as controls. (B)
Cellular lysates prepared 6 days after transfection were analyzed by
Western blotting with -crystallin-, -crystallin-,
-crystallin-, or MafA-directed sera. Relative amounts of proteins
expressed in the WT versus S14A/S65A MafA-containing cultures were
determined according to densitometry of autoradiograms and are
indicated on the right. A -actin Western blot was performed as
a loading control.
|
|

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 8.
Analysis of crystallin expression in MafA-containing
cells by immunofluorescence. Chicken embryo NR cells were transfected
with empty RCAS (RCAS), RCAS-MafA (WT), or RCAS-S14A/S65A (S14A/S65A)
plasmids. Induction of crystallin expression was analyzed 6 days after
transfection by double staining with -, -, or
-crystallin-directed antibodies and anti-MafA serum. Quantification
of the results is presented in Table 1.
|
|

View larger version (98K):
[in this window]
[in a new window]
|
FIG. 9.
NR-to-lens transdifferentiation induced by MafA requires
the integrity of serine 14 and serine 65 residues. Formation of lentoid
bodies was examined, after three passages, in chicken NR cultures
transfected by RCAS-derived vectors encoding WT or S14A/S65A MafA.
Lentoid bodies are indicated by white arrowheads.
|
|
 |
DISCUSSION |
Previous studies have suggested that Maf proteins are involved in
regulation of various developmental processes and that their function
is modulated by interaction with heterologous proteins through the
formation of leucine zipper dimers or distinct complexes (22, 30,
38, 58). Unexpectedly, little is known about their regulation by
covalent posttranslational modifications, such as phosphorylation,
unlike the numerous reports on other bZIP proteins of the AP1
superfamily. In this work we show, for the first time, that MafA (also
known as L-Maf), a member of the large Maf protein subgroup, undergoes
functional regulation by phosphorylation. We have identified two serine
residues (S14 and S65) located in the MafA TAD that are of critical
importance not only for overall MafA phosphorylation but also for its
transcriptional capacity and potential to control expression of
differentiation programs in NR cells. Interestingly, these serine
residues and their neighboring amino acids are conserved between all
large Mafs. Significantly, the MafA serine 65 corresponds in NRL to serine 50, whose mutation was implicated in the occurrence of retinitis
pigmentosa (D. A. Bessant, A. M. Payne, K. P. Mitton, Q. L. Wang, P. K. Swain, C. Plant, A. C. Bird, D. J. Zack, A. Swaroop, and S. S. Bhattacharya, Letter, Nat. Genet.
21:355-356), suggesting that these conserved residues are
important for biological function of Maf proteins.
MafA is a phosphoprotein.
In this study we present evidence
that MafA is phosphorylated in two different cell types, HeLa and NR
cells. Metabolic labeling, Western blotting, and phosphatase treatment
experiments performed with HeLa cell extracts show that the multiple
MafA bands detected in Western blots reflect various levels of MafA
phosphorylation. Surprisingly, the high level of basal protein
phosphorylation under standard culture conditions in HeLa cells could
not be efficiently modified by extracellular changes such as serum
starvation, suggesting that the kinase(s) that phosphorylates MafA is
constitutively active in these cells. We identified serine 14 and
serine 65 as the major determinants of MafA phosphorylation.
Mutagenesis of these two sites into alanine leads to dramatic changes
in the overall distribution of migrating forms, with a significant
increase in underphosphorylated forms, as could be concluded from the
decrease in the in vivo phosphate content of mutant proteins. This
strongly suggests that phosphorylation of S14 and S65 residues
determines the overall phosphorylation state of MafA in vivo, either
because they are the most efficiently phosphorylated sites or because the protein undergoes sequential phosphorylation. For example the
phosphorylation, or at least integrity, of S14 and S65 could be
required to ensure proper docking or recognition of other kinases which
are responsible for the phosphorylation of distinct sites. In addition,
our data show that the S14A/S65A MafA mutant remains slightly
phosphorylated and phosphoamino acid analysis indicates that WT MafA is
also phosphorylated on threonine residues. Thus, MafA is likely to
undergo multiple phosphorylations and could be regulated by various
signaling networks.
It is interesting to note that the migration patterns of WT and
S14A/S65A MafA are very similar in HeLa and NR cells, as well
as in
other cell types tested (data not shown), suggesting that
the
phosphorylation process of MafA is essentially similar in
these cell
types and that phosphorylation implicating S14 and
S65 residues
constitutes a general mechanism for regulating
MafA.
The biological properties of MafA strongly depend on
phosphorylation.
We evaluated the importance of MafA
phosphorylation at two distinct levels: by its capacity to activate
transcription of reporter genes and its ability to activate expression
of an NR-specific target gene and to drive a complete gene expression
program. The MafA capacity to activate transcription of a promoter
containing a MARE-related sequence was strongly affected by the double
mutation. Thus, the presence of underphosphorylated MafA clearly
correlates with a sharp decrease in transcriptional capacity,
demonstrating that this activity is strictly dependent on MafA
phosphorylation. This could not be explained by a change in subcellular
localization, since all MafA mutants were localized in the nucleus.
Similarly, we found that these mutations did not alter the binding of
MafA to DNA, although we cannot exclude that MafA phosphorylation could influence its interaction with target sequences. Likewise, our results
indicated that MafA phosphorylation did not significantly affect the
stability of the protein, since the amounts of WT and S14A/S65A MafA
proteins did not markedly differ in Western blots (Fig. 2B and C and
data not shown). Thus, MafA phosphorylation is likely to control the
transactivating capacity of MafA per se. It could either modulate
MafA's ability to interact with the basal transcription machinery or
affect its capacity to interact with critical partners, as was
demonstrated in the case of the MyoD transcription factor
(37). Likewise, phosphorylation of JunB, on threonine 102 and threonine 104, by JNK was suggested to favor interaction with c-Maf
dimers and to consequently elicit synergistic activation of the
interleukin-4 promoter by both transcription factors (38).
The presence of these phosphorylated residues could also be required
for the recruitment of more general coactivators, such as histone
acetylases of the p300/CBP family, as in the case of the CREB bZIP
(36) and the melanocyte-specific Mi (53) transcription factors.
In a second set of experiments we established that MafA
underphosphorylation could be correlated with the loss of its property
to activate endogenous
QR1 expression. This result is in
agreement
with the failure of S14A/S65A MafA to transactivate both the
A
box and the complete promoter of
QR1 in transcription
assays.
We further showed that the mutation also impaired MafA capacity
to induce lens phenotypic transformation in NR cells, as concluded
from
the activation of target crystallin genes expression and
the formation
of lentoid bodies. These results clearly demonstrate
that MafA
phosphorylation is of critical importance in the context
of these
biological processes. Moreover, they underline that lens
differentiation may be induced by signaling cascades targeting
the MafA
transcription factor. Signals originating from the contiguous
optic
vesicle have been suggested to drive the transformation
of the lens
placode during embryonic development (for review,
see reference
25). It is possible that MafA is involved in this
process,
since its expression could be detected in the lens placode
at the stage
of embryonic development at which the optic vesicle
contacts the head
ectoderm (
46). Thus, phosphorylation of MafA
in response
to such signals could strongly enhance its function.
Likewise, NRL was
suggested to play a key role in the terminal
differentiation of retina
photoreceptors by turning on expression
of specific genes, including
that encoding rhodopsin (
18). It
is noteworthy that
mutation of NRL serine 50, which is equivalent
to MafA serine 65, was
implicated in a genetic disease affecting
photoreceptors (Bessant et
al., letter). Thus, it would be interesting
to determine whether a
phosphorylation process similar to the
one regulating MafA function
also accounts for NRL and, more generally,
for other Maf
proteins.
ERK2 phosphorylates MafA in vitro but is not responsible for its
high basal phosphorylation in vivo.
Localization of MafA S14 and
S65 residues in a perfect MAPK consensus strongly suggested that they
might be targeted by kinases of this family. Indeed, we show that MafA
can be phosphorylated in vitro by ERK2 and p38
but not by JNK1 or
ERK5. We also show that p38
phosphorylates MafA, likely on residues
distinct from S14 and S65. Interestingly, the control of rat
B-crystallin gene expression by stress-related signals involving p38
has been reported (31). Thus, the p38 MAPK cascade could
affect expression of crystallins through an effect on MafA. Several
putative sites for proline-directed kinases, in addition to serines 14 and 65, are present in MafA. It should be noted, moreover, that MafA is phosphorylated on threonine residues in HeLa cells. Thus, further studies are required to identify the residues phosphorylated by p38 and
to determine whether their phosphorylation is involved in regulating
transcriptional activity.
While activated ERK2 phosphorylates MafA on S14 and S65 residues in
vitro, the MEK/ERK pathway appears to contribute only
partially to MafA
phosphorylation in vivo. Indeed, either transient
or constitutive
activation of the MEK/ERK pathway leads to detectable
modification of
MafA electrophoretic mobility, an effect which
was correlated with an
increase in MafA phosphate content (data
not shown). Implication of the
MEK/ERK pathway in the control
of MafA activity appears relevant
regarding several physiological
aspects. Thus, differentiation of lens
fibers during eye development
was reported to be controlled by
fibroblast growth factor signaling
(for review, see reference
25), which notably targets the ERK/MAPK
pathway. However,
we could not significantly decrease the level
of MafA background
phosphorylation by using dominant negative
alleles or inhibitors of the
MEK1 kinase. Furthermore, attempts
to modulate MafA transcriptional
activity on reporter genes by
activating the MEK/ERK cascade did not
yield significant results
(data not shown), probably because of the
high basal phosphorylation
of S14 and S65 residues. Taken together, our
results indicate
that while stimulation of the MEK/ERK cascade can lead
to phosphorylation
of MafA at S14 and S65 sites, it does not appear to
be responsible
for the basal phosphorylation of the protein. Thus, the
actual
kinase(s), likely a proline-directed kinase, responsible for the
extensive phosphorylation of S14 and S65 residues remains to be
identified. Because of the importance of Maf proteins in regulating
various differentiation processes, identification of this kinase(s)
should prove essential to our understanding of the signals that
regulate Maf protein
activity.
 |
ACKNOWLEDGMENTS |
We thank Melanie Cobb, Marc Castellazzi, Roger Davis, Silvio
Gutkind, Joram Piatigorsky, Joël Raingeaud, and Mike Weber for providing reagents used in this study. We also thank Joël
Raingeaud for helpful discussion and Odile Lecoq for preparing the
MafA-directed antiserum.
This work was supported by the Centre National de la Recherche
Scientifique, the Institut Curie, the Association pour la Recherche sur
le Cancer (grant 5276), and Retina France. S.B. and S.P. were supported
by fellowships from Retina France, the Ligue Nationale Contre le Cancer
(Comité de l'Essonne), the Ministère de l'Education Nationale de la Recherche et de la Technologie, the Fondation pour la
Recherche Médicale, and the Société Française
du Cancer.
S. Benkhelifa and S. Provot contributed equally to this work.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: UMR 146 CNRS-Institut Curie, Bâtiment 110, Centre Universitaire, 91405 Orsay cedex, France. Phone: 33 1 69 86 30 73. Fax: 33 1 69 07 45 25. E-mail: Marie-Paule.Felder{at}curie.u-psud.fr.
 |
REFERENCES |
| 1.
|
Beddington, R. S.,
J. Morgernstern,
H. Land, and A. Hogan.
1989.
An in situ transgenic enzyme marker for the midgestation mouse embryo and the visualization of inner cell mass clones during early organogenesis.
Development
106:37-46[Abstract].
|
| 2.
|
Benkhelifa, S.,
S. Provot,
O. Lecoq,
C. Pouponnot,
G. Calothy, and M. P. Felder-Schmittbuhl.
1998.
mafA, a novel member of the maf proto-oncogene family, displays developmental regulation and mitogenic capacity in avian neuroretina cells.
Oncogene
17:247-254[CrossRef][Medline].
|
| 3.
|
Binetruy, B.,
T. Smeal, and M. Karin.
1991.
Ha-Ras augments c-Jun activity and stimulates phosphorylation of its activation domain.
Nature
351:122-127[CrossRef][Medline].
|
| 4.
|
Brunet, A., and J. Pouyssegur.
1996.
Identification of MAP kinase domains by redirecting stress signals into growth factor responses.
Science
272:1652-1655[Abstract].
|
| 5.
|
Brunner, D.,
K. Ducker,
N. Oellers,
E. Hafen,
H. Scholz, and C. Klambt.
1994.
The ETS domain protein pointed-P2 is a target of MAP kinase in the sevenless signal transduction pathway.
Nature
370:386-389[CrossRef][Medline].
|
| 6.
|
Casado, F. J.,
C. Pouponnot,
J. C. Jeanny,
O. Lecoq,
G. Calothy, and A. Pierani.
1996.
QRI, a retina-specific gene, encodes an extracellular matrix protein exclusively expressed during neural retina differentiation.
Mech. Dev.
54:237-250[CrossRef][Medline].
|
| 7.
|
Chiariello, M.,
M. J. Marinissen, and J. S. Gutkind.
2000.
Multiple mitogen-activated protein kinase signaling pathways connect the Cot oncoprotein to the c-jun promoter and to cellular transformation.
Mol. Cell. Biol.
20:1747-1758[Abstract/Free Full Text].
|
| 8.
|
Chow, C. W.,
M. Rincon,
J. Cavanagh,
M. Dickens, and R. J. Davis.
1997.
Nuclear accumulation of NFAT4 opposed by the JNK signal transduction pathway.
Science
278:1638-1641[Abstract/Free Full Text].
|
| 9.
|
Derijard, B.,
M. Hibi,
I. H. Wu,
T. Barrett,
B. Su,
T. Deng,
M. Karin, and R. J. Davis.
1994.
JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylated the c-Jun activation domain.
Cell
76:1025-1037[CrossRef][Medline].
|
| 10.
|
English, J. M.,
G. Pearson,
T. Hockenberry,
L. Shivakumar,
M. A. White, and M. H. Cobb.
1999.
Contribution of the ERK5/MEK5 pathway to Ras/Raf signaling and growth control.
J. Biol. Chem.
274:31588-31592[Abstract/Free Full Text].
|
| 11.
|
Fujiwara, K. T.,
K. Kataoka, and M. Nishizawa.
1993.
Two new members of the maf oncogene family, mafK and mafF, encode nuclear b-Zip proteins lacking putative trans-activator domain.
Oncogene
8:2371-2380[Medline].
|
| 12.
|
Garingo, A. D.,
M. Suhasini,
N. C. Andrews, and R. B. Pilz.
1995.
cAMP-dependent protein kinase is necessary for increased NF-E2.DNA complex formation during erythroleukemia cell differentiation.
J. Biol. Chem.
270:9169-9177[Abstract/Free Full Text].
|
| 13.
|
Gorman, C. M.,
L. F. Moffat, and B. H. Howard.
1982.
Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells.
Mol. Cell. Biol.
2:1044-1051[Abstract/Free Full Text].
|
| 14.
|
Guermah, M.,
P. Crisanti,
D. Laugier,
P. Dezelee,
L. Bidou,
B. Pessac, and G. Calothy.
1991.
Transcription of a quail gene expressed in embryonic retinal cells is shut off sharply at hatching.
Proc. Natl. Acad. Sci. USA
88:4503-4507[Abstract/Free Full Text].
|
| 15.
|
Guermah, M.,
G. Gillet,
D. Michel,
D. Laugier,
G. Brun, and G. Calothy.
1990.
Down regulation by p60v-src of genes specifically expressed and developmentally regulated in postmitotic quail neuroretina cells.
Mol. Cell. Biol.
10:3584-3590[Abstract/Free Full Text].
|
| 16.
|
Gupta, S.,
D. Campbell,
B. Derijard, and R. J. Davis.
1995.
Transcription factor ATF2 regulation by the JNK signal transduction pathway.
Science
267:389-393[Abstract/Free Full Text].
|
| 17.
|
Han, J.,
Y. Jiang,
Z. Li,
V. V. Kravchenko, and R. J. Ulevitch.
1997.
Activation of the transcription factor MEF2C by the MAP kinase p38 in inflammation.
Nature
386:296-299[CrossRef][Medline].
|
| 18.
|
He, L.,
M. L. Campbell,
D. Srivastava,
Y. S. Blocker,
J. R. Harris,
A. Swaroop, and D. A. Fox.
1998.
Spatial and temporal expression of AP-1 responsive rod photoreceptor genes and bZIP transcription factors during development of the rat retina.
Mol. Vision
4:32[Medline].
|
| 19.
|
Hemesath, T. J.,
E. R. Price,
C. Takemoto,
T. Badalian, and D. E. Fisher.
1998.
MAP kinase links the transcription factor Microphthalmia to c-Kit signalling in melanocytes.
Nature
391:298-301[CrossRef][Medline].
|
| 20.
|
Her, J. H.,
S. Lakhani,
K. Zu,
J. Vila,
P. Dent,
T. W. Sturgill, and M. J. Weber.
1993.
Dual phosphorylation and autophosphorylation in mitogen-activated protein (MAP) kinase activation.
Biochem. J.
296:25-31.
|
| 21.
|
Hibi, M.,
A. Lin,
T. Smeal,
A. Minden, and M. Karin.
1993.
Identification of an oncoprotein- and UV-responsive protein kinase that binds and potentiates the c-Jun activation domain.
Genes Dev.
7:2135-2148[Abstract/Free Full Text].
|
| 22.
|
Ho, I. C.,
M. R. Hodge,
J. W. Rooney, and L. H. Glimcher.
1996.
The proto-oncogene c-maf is responsible for tissue-specific expression of interleukin-4.
Cell
85:973-983[CrossRef][Medline].
|
| 23.
|
Hughes, S. H.,
J. J. Greenhouse,
C. J. Petropoulos, and P. Sutrave.
1987.
Adaptor plasmids simplify the insertion of foreign DNA into helper-independent retroviral vectors.
J. Virol.
61:3004-3012[Abstract/Free Full Text].
|
| 24.
|
Igarashi, K.,
K. Kataoka,
K. Itoh,
N. Hayashi,
M. Nishizawa, and M. Yamamoto.
1994.
Regulation of transcription by dimerization of erythroid factor NF-E2 p45 with small Maf proteins.
Nature
367:568-572[CrossRef][Medline].
|
| 25.
|
Jean, D.,
K. Ewan, and P. Gruss.
1998.
Molecular regulators involved in vertebrate eye development.
Mech. Dev.
76:3-18[CrossRef][Medline].
|
| 26.
|
Karin, M., and T. Hunter.
1995.
Transcriptional control by protein phosphorylation: signal transmission from the cell surface to the nucleus.
Curr. Biol.
5:747-757[CrossRef][Medline].
|
| 27.
|
Kataoka, K.,
K. T. Fujiwara,
M. Noda, and M. Nishizawa.
1994.
MafB, a new Maf family transcription activator that can associate with Maf and Fos but not with Jun.
Mol. Cell. Biol.
14:7581-7591[Abstract/Free Full Text].
|
| 28.
|
Kataoka, K.,
K. Igarashi,
K. Itoh,
K. T. Fujiwara,
M. Noda,
M. Yamamoto, and M. Nishizawa.
1995.
Small Maf proteins heterodimerize with Fos and may act as competitive repressors of the NF-E2 transcription factor.
Mol. Cell. Biol.
15:2180-2190[Abstract].
|
| 29.
|
Kataoka, K.,
M. Noda, and M. Nishizawa.
1994.
Maf nuclear oncoprotein recognizes sequences related to an AP-1 site and forms heterodimers with both Fos and Jun.
Mol. Cell. Biol.
14:700-712[Abstract/Free Full Text].
|
| 30.
|
Kataoka, K.,
M. Noda, and M. Nishizawa.
1996.
Transactivation activity of Maf nuclear oncoprotein is modulated by Jun, Fos and small Maf proteins.
Oncogene
12:53-62[Medline].
|
| 31.
|
Kato, K.,
H. Ito,
K. Kamei, and I. Iwamoto.
1999.
Selective stimulation of Hsp27 and alphaB-crystallin but not Hsp70 expression by p38 MAP kinase activation.
Cell Stress Chaperones
4:94-101[Medline].
|
| 32.
|
Kawauchi, S.,
S. Takahashi,
O. Nakajima,
H. Ogino,
M. Morita,
M. Nishizawa,
K. Yasuda, and M. Yamamoto.
1999.
Regulation of lens fiber cell differentiation by transcription factor c-Maf.
J. Biol. Chem.
274:19254-19260[Abstract/Free Full Text].
|
| 33.
|
Kelly, L. M.,
U. Englmeier,
I. Lafon,
M. H. Sieweke, and T. Graf.
2000.
MafB is an inducer of monocytic differentiation.
EMBO J.
19:1987-1997[CrossRef][Medline].
|
| 34.
|
Kim, J. I.,
T. Li,
I. C. Ho,
M. J. Grusby, and L. H. Glimcher.
1999.
Requirement for the c-Maf transcription factor in crystallin gene regulation and lens development.
Proc. Natl. Acad. Sci. USA
96:3781-3785[Abstract/Free Full Text].
|
| 35.
|
Kumar, R.,
S. Chen,
D. Scheurer,
Q. L. Wang,
E. Duh,
C. H. Sung,
A. Rehemtulla,
A. Swaroop,
R. Adler, and D. J. Zack.
1996.
The bZIP transcription factor Nrl stimulates rhodopsin promoter activity in primary retinal cell cultures.
J. Biol. Chem.
271:29612-29618[Abstract/Free Full Text].
|
| 36.
|
Kwok, R. P.,
J. R. Lundblad,
J. C. Chrivia,
J. P. Richards,
H. P. Bachinger,
R. G. Brennan,
S. G. Roberts,
M. R. Green, and R. H. Goodman.
1994.
Nuclear protein CBP is a coactivator for the transcription factor CREB.
Nature
370:223-226[CrossRef][Medline].
|
| 37.
|
Lenormand, J. L.,
B. Benayoun,
M. Guillier,
M. Vandromme,
M. P. Leibovitch, and S. A. Leibovitch.
1997.
Mos activates myogenic differentiation by promoting heterodimerization of MyoD and E12 proteins.
Mol. Cell. Biol.
17:584-593[Abstract].
|
| 38.
|
Li, B.,
C. Tournier,
R. J. Davis, and R. A. Flavell.
1999.
Regulation of IL-4 expression by the transcription factor JunB during T helper cell differentiation.
EMBO J.
18:420-432[CrossRef][Medline].
|
| 39.
|
Manzanares, M.,
S. Cordes,
L. Ariza-McNaughton,
V. Sadl,
K. Maruthainar,
G. Barsh, and R. Krumlauf.
1999.
Conserved and distinct roles of kreisler in regulation of the paralogous Hoxa3 and Hoxb3 genes.
Development
126:759-769[Abstract].
|
| 40.
|
Manzanares, M.,
S. Cordes,
C. T. Kwan,
M. H. Sham,
G. S. Barsh, and R. Krumlauf.
1997.
Segmental regulation of Hoxb-3 by kreisler.
Nature
387:191-195[CrossRef][Medline].
|
| 41.
|
Mikkola, I.,
J. A. Bruun,
G. Bjorkoy,
T. Holm, and T. Johansen.
1999.
Phosphorylation of the transactivation domain of Pax6 by extracellular signal-regulated kinase and p38 mitogen-activated protein kinase.
J. Biol. Chem.
274:15115-15126[Abstract/Free Full Text].
|
| 42.
|
Milstone, L. M., and J. Piatigorsky.
1975.
Rates of protein synthesis in explanted embryonic chick lens epithelia: differential stimulation of delta-crystallin synthesis.
Dev. Biol.
43:91-100[CrossRef][Medline].
|
| 43.
|
Musti, A. M.,
M. Treier, and D. Bohmann.
1997.
Reduced ubiquitin-dependent degradation of c-Jun after phosphorylation by MAP kinases.
Science
275:400-402[Abstract/Free Full Text].
|
| 44.
|
Nagai, T.,
K. Igarashi,
J. Akasaka,
K. Furuyama,
H. Fujita,
N. Hayashi,
M. Yamamoto, and S. Sassa.
1998.
Regulation of NF-E2 activity in erythroleukemia cell differentiation.
J. Biol. Chem.
273:5358-5365[Abstract/Free Full Text].
|
| 45.
|
Nishizawa, M.,
K. Kataoka,
N. Goto,
K. T. Fujiwara, and S. Kawai.
1989.
v-maf, a viral oncogene that encodes a "leucine zipper" motif.
Proc. Natl. Acad. Sci. USA
86:7711-7715[Abstract/Free Full Text].
|
| 46.
|
Ogino, H., and K. Yasuda.
1998.
Induction of lens differentiation by activation of a bZIP transcription factor, L-Maf.
Science
280:115-118[Abstract/Free Full Text].
|
| 47.
|
Onodera, K.,
J. A. Shavit,
H. Motohashi,
M. Yamamoto, and J. D. Engel.
2000.
Perinatal synthetic lethality and hematopoietic defects in compound mafG::mafK mutant mice.
EMBO J.
19:1335-1345[CrossRef][Medline].
|
| 48.
|
Ostrer, H.,
D. C. Beebe, and J. Piatigorsky.
1981.
Beta-crystallin mRNAs: differential distribution in the developing chicken lens.
Developmental Biology (Orlando)
86:403-408.
|
| 49.
|
Pessac, B., and G. Calothy.
1974.
Transformation of chick embryo neuroretinal cells by Rous sarcoma virus in vitro: induction of cell proliferation.
Science
185:709-710[Abstract/Free Full Text].
|
| 50.
|
Peyssonnaux, C.,
S. Provot,
M. Felder-Schmittbuhl,
G. Calothy, and A. Eychène.
2000.
Induction of postmitotic neuroretina cell proliferation by distinct Ras downstream signaling pathways.
Mol. Cell. Biol.
20:7068-7079[Abstract/Free Full Text].
|
| 51.
|
Pierani, A.,
C. Pouponnot, and G. Calothy.
1993.
Transcriptional downregulation of the retina-specific QR1 gene by pp60v-src and identification of a novel v-src-responsive unit.
Mol. Cell. Biol.
13:3401-3414[Abstract/Free Full Text].
|
| 52.
|
Pouponnot, C.,
M. Nishizawa,
G. Calothy, and A. Pierani.
1995.
Transcriptional stimulation of the retina-specific QR1 gene upon growth arrest involves a Maf-related protein.
Mol. Cell. Biol.
15:5563-5575[Abstract].
|
| 53.
|
Price, E. R.,
H. F. Ding,
T. Badalian,
S. Bhattacharya,
C. Takemoto,
T. P. Yao,
T. J. Hemesath, and D. E. Fisher.
1998.
Lineage-specific signaling in melanocytes. C-kit stimulation recruits p300/CBP to microphthalmia.
J. Biol. Chem.
273:17983-17986[Abstract/Free Full Text].
|
| 54.
|
Rehemtulla, A.,
R. Warwar,
R. Kumar,
X. Ji,
D. J. Zack, and A. Swaroop.
1996.
The basic motif-leucine zipper transcription factor Nrl can positively regulate rhodopsin gene expression.
Proc. Natl. Acad. Sci. USA
93:191-195[Abstract/Free Full Text].
|
| 55.
|
Remaut, E.,
P. Stanssens, and W. Fiers.
1981.
Plasmid vectors for high-efficiency expression controlled by the PL promoter of coliphage lambda.
Gene
15:81-93[CrossRef][Medline].
|
| 56.
|
Ring, B.,
S. Cordes,
P. Overbeek, and G. Barsh.
2000.
Regulation of mouse lens fiber cell development and differentiation by the Maf gene.
Development
127:307-317[Abstract].
|
| 57.
|
Schaeffer, H. J., and M. J. Weber.
1999.
Mitogen-activated protein kinases: specific messages from ubiquitous messengers.
Mol. Cell. Biol.
19:2435-2444[Free Full Text].
|
| 58.
|
Sieweke, M. H.,
H. Tekotte,
J. Frampton, and T. Graf.
1996.
MafB is an interaction partner and repressor of Ets-1 that inhibits erythroid differentiation.
Cell
85:49-60[CrossRef][Medline].
|
| 59.
|
Simonneau, L.,
P. Crisanti,
A. M. Lorinet,
F. Alliot,
Y. Courtois,
G. Calothy, and B. Pessac.
1986.
Crystallin gene expression and lentoid body formation in quail embryo neuroretina cultures transformed by the oncogenic retrovirus Mill Hill 2 or Rous sarcoma virus.
Mol. Cell. Biol.
6:3704-3710[Abstract/Free Full Text].
|
| 60.
|
Songyang, Z.,
K. P. Lu,
Y. T. Kwon,
L. H. Tsai,
O. Filhol,
C. Cochet,
D. A. Brickey,
T. R. Soderling,
C. Bartleson,
D. J. Graves,
A. J. DeMaggio,
M. F. Hoekstra,
J. Blenis,
T. Hunter, and L. C. Cantley.
1996.
A structural basis for substrate specificities of protein Ser/Thr kinases: primary sequence preference of casein kinases I and II, NIMA, phosphorylase kinase, calmodulin-dependent kinase II, CDK5, and Erk1.
Mol. Cell. Biol.
16:6486-6493[Abstract].
|
| 61.
|
Swaroop, A.,
J. Z. Xu,
H. Pawar,
A. Jackson,
C. Skolnick, and N. Agarwal.
1992.
A conserved retina-specific gene encodes a basic motif/leucine zipper domain.
Proc. Natl. Acad. Sci. USA
89:266-270[Abstract/Free Full Text].
|
| 62.
|
Versaw, W. K.,
V. Blank,
N. M. Andrews, and E. H. Bresnick.
1998.
Mitogen-activated protein kinases enhance long-range activation by the beta-globin locus control region.
Proc. Natl. Acad. Sci. USA
95:8756-8760[Abstract/Free Full Text].
|
| 63.
|
Wang, X. Z., and D. Ron.
1996.
Stress-induced phosphorylation and activation of the transcription factor CHOP (GADD153) by p38 MAP Kinase.
Science
272:1347-1349[Abstract].
|
| 64.
|
Yang, S. H.,
P. Shore,
N. Willingham,
J. H. Lakey, and A. D. Sharrocks.
1999.
The mechanism of phosphorylation-inducible activation of the ETS-domain transcription factor Elk-1.
EMBO J.
18:5666-5674[CrossRef][Medline].
|
Molecular and Cellular Biology, July 2001, p. 4441-4452, Vol. 21, No. 14
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.14.4441-4452.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Shao, C., Cobb, M. H.
(2009). Sumoylation Regulates the Transcriptional Activity of MafA in Pancreatic {beta} Cells. J. Biol. Chem.
284: 3117-3124
[Abstract]
[Full Text]
-
Guo, S., Burnette, R., Zhao, L., Vanderford, N. L., Poitout, V., Hagman, D. K., Henderson, E., Ozcan, S., Wadzinski, B. E., Stein, R.
(2009). The Stability and Transactivation Potential of the Mammalian MafA Transcription Factor Are Regulated by Serine 65 Phosphorylation. J. Biol. Chem.
284: 759-765
[Abstract]
[Full Text]
-
Lawrence, M. C., McGlynn, K., Shao, C., Duan, L., Naziruddin, B., Levy, M. F., Cobb, M. H.
(2008). Chromatin-bound mitogen-activated protein kinases transmit dynamic signals in transcription complexes in {beta}-cells. Proc. Natl. Acad. Sci. USA
105: 13315-13320
[Abstract]
[Full Text]
-
Provot, S., Nachtrab, G., Paruch, J., Chen, A. P., Silva, A., Kronenberg, H. M.
(2008). A-Raf and B-Raf Are Dispensable for Normal Endochondral Bone Development, and Parathyroid Hormone-Related Peptide Suppresses Extracellular Signal-Regulated Kinase Activation in Hypertrophic Chondrocytes. Mol. Cell. Biol.
28: 344-357
[Abstract]
[Full Text]
-
Han, S.-i., Aramata, S., Yasuda, K., Kataoka, K.
(2007). MafA Stability in Pancreatic {beta} Cells Is Regulated by Glucose and Is Dependent on Its Constitutive Phosphorylation at Multiple Sites by Glycogen Synthase Kinase 3. Mol. Cell. Biol.
27: 6593-6605
[Abstract]
[Full Text]
-
Kataoka, K.
(2007). Multiple Mechanisms and Functions of Maf Transcription Factors in the Regulation of Tissue-Specific Genes. J Biochem
141: 775-781
[Abstract]
[Full Text]
-
Lawrence, M. C., McGlynn, K., Park, B.-H., Cobb, M. H.
(2005). ERK1/2-dependent Activation of Transcription Factors Required for Acute and Chronic Effects of Glucose on the Insulin Gene Promoter. J. Biol. Chem.
280: 26751-26759
[Abstract]
[Full Text]
-
Wang, J., Feng, H., Huang, X.-Q., Xiang, H., Mao, Y.-W., Liu, J.-P., Yan, Q., Liu, W.-B., Liu, Y., Deng, M., Gong, L., Sun, S., Luo, C., Liu, S.-J., Zhang, X.-J., Liu, Y., Li, D. W.-C.
(2005). Human Telomerase Reverse Transcriptase Immortalizes Bovine Lens Epithelial Cells and Suppresses Differentiation through Regulation of the ERK Signaling Pathway. J. Biol. Chem.
280: 22776-22787
[Abstract]
[Full Text]
-
Zhao, L., Guo, M., Matsuoka, T.-a., Hagman, D. K., Parazzoli, S. D., Poitout, V., Stein, R.
(2005). The Islet {beta} Cell-enriched MafA Activator Is a Key Regulator of Insulin Gene Transcription. J. Biol. Chem.
280: 11887-11894
[Abstract]
[Full Text]
-
Friedman, J. S., Khanna, H., Swain, P. K., DeNicola, R., Cheng, H., Mitton, K. P., Weber, C. H., Hicks, D., Swaroop, A.
(2004). The Minimal Transactivation Domain of the Basic Motif-Leucine Zipper Transcription Factor NRL Interacts with TATA-binding Protein. J. Biol. Chem.
279: 47233-47241
[Abstract]
[Full Text]
-
Chauhan, B. K., Yang, Y., Cveklova, K., Cvekl, A.
(2004). Functional interactions between alternatively spliced forms of Pax6 in crystallin gene regulation and in haploinsufficiency. Nucleic Acids Res
32: 1696-1709
[Abstract]
[Full Text]
-
Li, D. W.-C., Liu, J.-P., Wang, J., Mao, Y.-W., Hou, L.-H.
(2003). Expression and Activity of the Signaling Molecules for Mitogen-Activated Protein Kinase Pathways in Human, Bovine, and Rat Lenses. IOVS
44: 5277-5286
[Abstract]
[Full Text]
-
Ochi, H., Ogino, H., Kageyama, Y., Yasuda, K.
(2003). The Stability of the Lens-specific Maf Protein is Regulated by Fibroblast Growth Factor (FGF)/ERK Signaling in Lens Fiber Differentiation. J. Biol. Chem.
278: 537-544
[Abstract]
[Full Text]
-
Kataoka, K., Han, S.-i., Shioda, S., Hirai, M., Nishizawa, M., Handa, H.
(2002). MafA Is a Glucose-regulated and Pancreatic beta -Cell-specific Transcriptional Activator for the Insulin Gene. J. Biol. Chem.
277: 49903-49910
[Abstract]
[Full Text]
-
Olbrot, M., Rud, J., Moss, L. G., Sharma, A.
(2002). Identification of beta -cell-specific insulin gene transcription factor RIPE3b1 as mammalian MafA. Proc. Natl. Acad. Sci. USA
99: 6737-6742
[Abstract]
[Full Text]
-
Civil, A., van Genesen, S. T., Lubsen, N. H.
(2002). c-Maf, the {gamma}D-crystallin Maf-responsive element and growth factor regulation. Nucleic Acids Res
30: 975-982
[Abstract]
[Full Text]