Previous Article | Next Article 
Molecular and Cellular Biology, July 2001, p. 4748-4760, Vol. 21, No. 14
Laboratoire de Biologie Moléculaire et Cellulaire de
l'Ecole Normale Supérieure, UMR 5665 CNRS, LA 913 INRA,
69364 Lyon cedex 07,1 and INSERM U369,
Faculté de médecine, RTH Laennec,
Lyon,7 France; ICSM Molecular
Endocrinology Group, Division of Medicine and MRC Clinical Sciences
Centre, Imperial College School of Medicine, Hammersmith Hospital,
London, United Kingdom2; Departments
of Medicine3 and
Pediatrics,4 University of Chicago,
Chicago, Illinois 60637; Department of Psychology,
University of South Florida, Tampa, Florida
336205; and Department of
Psychology, Northern Illinois University, Dekalb, Illinois
601156
Received 27 November 2000/Returned for modification 13 February
2001/Accepted 15 April 2001
Thyroid hormone receptors are encoded by the TR Thyroid hormone receptors (TRs),
encoded by the TR Targeted disruption of TR
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.14.4748-4760.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Genetic Analysis Reveals Different Functions for
the Products of the Thyroid Hormone Receptor
Locus
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
(NR1A1) and TR
(NR1A2) loci. These genes are transcribed
into multiple variants whose functions are unclear. Analysis by gene
inactivation in mice has provided new insights into the functional
complexity of these products. Different strategies designed to modify
the TR locus have led to strikingly different
phenotypes. In order to analyze the molecular basis for these
alterations, we generated mice devoid of all known isoforms produced
from the TR locus (TR0/0). These mice are
viable and exhibit reduced linear growth, bone maturation delay,
moderate hypothermia, and reduced thickness of the intestinal mucosa.
Compounding TR0 and TR
mutations
produces viable TR0/0/ mice, which
display a more severe linear growth reduction and a more profound
hypothermia as well as impaired hearing. A striking phenotypic
difference is observed between TR0/0 and the previously
described TR/ mice, which retain truncated TR
isoforms arising from a newly described promoter in intron 7. The
lethality and severe impairment of the intestinal maturation in
TR/ mice are rescued in TR0/0
animals. We demonstrate that the TR protein isoforms, which are
natural products of the TR locus, are the key
determinants of these phenotypical differences. These data reveal the
functional importance of the non-T3-binding variants encoded by the
TR locus in vertebrate postnatal development and homeostasis.
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
and TR loci, mediate the
action of triiodothyronine (T3) in all vertebrates. These nuclear
proteins activate or repress the transcription of target genes by
recruiting several protein complexes which modify the structure of
chromatin (15). In mammals, T3 exerts homeostatic and
developmental functions. Thyroid hormone (TH) deprivation leads to
developmental (growth retardation, impaired neurogenesis) (8, 23,
36) or metabolic (reduced oxygen consumption, bradycardia, weakness, fatigue) disorders (13). Point mutations in the
TR gene result in syndromes known as resistance to
thyroid hormone (30). Recently, the introduction of
mutations in the genes encoding these receptors in mice has allowed
further understanding of the mechanisms mediating the physiological
actions of T3 (17, 19). The TR locus encodes
the TR1 and TR2 receptors. A new receptor, TR3, and its
non-DNA-binding TR3 variant have recently been described. The
latter isoforms are proposed to arise from a novel promoter located
upstream of the exons encoding the DNA binding domain
(41). Genetic invalidation of the TR2 gene
leads to pituitary resistance to TH with elevated thyrotropin (TSH) and thyroxine (T4) levels in serum (1). Knocking out all
TR1, TR2, and TR3/3 genes
reproduces this phenotype (10, 14) but also induces the
loss of auditory function, due to delayed expression of a potassium
channel in the cochlea (11), and results in impaired
transcriptional response to T3 in liver (38). The TR locus encodes the ubiquitous TR1 receptor and a
splice variant, TR2, which cannot bind T3 and behaves as a weak
inhibitor of TRs in transfection assays (21, 22). We have
previously shown that, in a limited number of tissues, the
TR locus also encodes two transcripts, previously
characterized by Northern blotting, RNase protection, and reverse
transcription (RT)-PCR analysis in embryonic stem (ES) cells, driven by
a promoter located in intron 7, which generate TR1 and TR2
proteins. These proteins do not bind DNA or T3; hence, they are
inhibitors of the activities of TRs and retinoic acid receptors in
transfection assays (6). In vivo genetic modifications of
the TR locus result in different phenotypes, according to
the precise location of the mutation. In TR/ mice,
the expression of TR1 and TR2 transcripts is abolished, but the
TR transcripts are still expressed (12). These mice suffer from hypothyroidism and display several developmental defects, including growth retardation, altered intestinal development
(28), impaired T- and B-lymphocyte maturation
(3), expansion of cartilage regions in long bones, and
finally growth arrest and death shortly after weaning
(12). Mice which lack the TR1 and TR1 products (TR1/) have been reported to exhibit mild
hypothyroxinemia, bradycardia, and lower body temperature, but they
display normal growth and life span (39). The lethal
phenotype of TR/ mice compared to the viability of
TR1/ mice might be attributed to the deeper
hypothyroxinemia of the former. The involvement of TH as the cause of
this phenotypic discrepancy can be ruled out. Indeed, although
TR// and
TR1// mice both lack the known
TRs and have very high serum levels of TH,
TR// mice die upon weaning
(14), whereas TR1//
mice are viable (16). Hence, the phenotypic differences
must be ascribed to structural differences between the TR
mutant alleles. They could be attributed either to the TR2 isoform,
which is expressed in TR1/ but not in
TR/ mice, or to the balance between the TR and
TR isoforms. In an attempt to determine the role of the
non-T3-binding products, we have generated a new mouse strain harboring
a targeted deletion designed to prevent the expression of all
transcripts from the TR locus. In this paper we describe
the phenotype of these TR0/0 mutant mice and point out
similarities and striking differences with previously described
TR1/ and TR/ mice. This
comparative analysis brings a new piece in the genetic analysis of the
complex TR locus and sheds new light on the respective functions of the TR products in body growth, bone
maturation, thermogenesis, audition, and intestinal maturation.
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
gene.
The
TR0-targeting vector was constructed using pGNA as
starting plasmid (gift from P. Brulet, Institut Pasteur, Paris,
France). The 3' arm homologous to TR was amplified by PCR
from ENS ES cell DNA (14), using the Expand High Fi system
(Roche). The 5' arm was cloned from a 
EMBL4 library (gift from J. P
Magaud). The thymidine kinase gene was inserted downstream of the 3' arm.
as a probe. Two positive clones were injected into blastocysts of C57BL/6 recipient mice. TR0/+ animals
were derived in an inbred 129sv background. TR0/0 mice
were obtained by intercrossing heterozygous animals. Mouse breeding and
handling were carried out in a certified animal facility, according to
procedures approved by the local animal care and use committee.
Purification of RNA, Northern blotting RNase protection assay,
and RT-PCR analysis.
Total RNA from distal small intestine or
pituitary was isolated by the improved acid-guanidine-phenol-chloroform
method. For Northern blot analysis, single-stranded DNA probes were
generated by a 30-cycle reaction using Taq DNA polymerase
from Eurobio using 10 ng of TR (exon 8), growth hormone (GH), or
hypoxanthine phosphoribosyltransferase (HPRT) PCR fragments as a
template, and 20 ng of a specific antisense primer: oligonucleotides
15A (CAGCCTGCAGCAGAGCCACTTCCG), GHa (GTCAAACTTGTCATAGGTTTG), and HPRTa
(CACAGGACTAGAACACCTGC) were used as primers to generate the
TR, GH, and HPRT probes, respectively.
cDNA fragments were generated by RT-PCR and inserted into a pGEMt easy
vector (Promega). Oligonucleotides HPRTs (GCTGGTGAAAAGGACCTCT) and HPRTa (see above) were used to generate the HPRT fragment, and TRCs (CTCTGTGATCCTGCTGTTCCACAG) and TR1a
(CGACTTTCATGTGGAGGAAG) were used to generate the TR cDNA.
RT was performed as described in reference 12. cDNA (0.05 µg) was used for each PCR with Eurobio Taq. To allow the
detection of TR gene products (TR1, TR2, TR1,
and TR2) by RT-PCR, we used a sense primer within exon 8 (2',
CTGCCTTGCGAAGACCAGATC) and an antisense primer within exon 9 (3, GCGGTGGTTGACGTAGTGCTC). All the oligonucleotides were
purchased from MWG (Ebersberg, Germany).
Morphological analysis of long bones and growth plate
cartilage.
Skin and muscle were dissected from forelimbs and
hindlimbs of 3-week-old wild-type and TR0/0 null mice.
For anatomical analysis of long bones, one upper and one lower limb
from each animal were fixed in 80% ethanol for 1 to 4 days and
transferred to 95% ethanol for a further 1 to 8 days, followed by
acetone for 1 to 2 days at 4°C. Fixed limbs were stained with
alizarin red and alcian blue 8GX (0.3% alcian blue in 70% ethanol [1
ml]-0.1% alizarin red in 95% ethanol [1 ml]-glacial acetic acid
[1 ml]-70% ethanol [17 ml]) for 2 days at 37°C and transferred
sequentially for 2- to 4-day periods through solutions of 1% KOH, 1%
KOH-20% glycerol, 1% KOH-40% glycerol, 1% KOH-60% glycerol, and
1% KOH-80% glycerol at 4°C until, finally, destained limbs were
stored in 100% glycerol at 4°C prior to analysis and photography
under a dissecting microscope. In these preparations, mineralized bone
is stained by alizarin red and cartilage is stained by alcian blue 8GX.
For mineralization analysis, tibias were dissected out, fixed in 70%
alcohol, embedded in paraffin, and cut (7 µm), and undecalcified
sections were stained according to the standard protocol
(26). For histological analyses, the paired limbs were fixed in 10% neutral buffered formalin for 4 to 6 days and
subsequently decalcified for 2 days in 10% formic acid-10% neutral
buffered formalin at 20°C. Limbs were embedded in paraffin and 3-µm
sections were cut, deparaffinized in xylene, and rehydrated. Sections
were stained with hematoxylin and eosin or alcian blue 8GX and van Gieson to visualize cartilage matrix mucopolysaccharides in blue and
collagen-containing bone osteoid in red, according to standard histological protocols.
Body temperature. The system we used, ELAMS (Electronic Laboratory Animal Monitoring System by BioMedic Data Systems, Inc., Seaford, Del.), consisted of implantable programmable temperature transponders (IPTT-100) and a portable data scanner (DAS-5007). The transponders were implanted subcutaneously in the backs of three 8- to 12-week-old males from each genotype. Animals were maintained under anesthesia with midazolam. All animals were kept in a climate-controlled room with 12-h alternating light and dark cycles. Temperature measurements were initiated 3 days after the implantation and were recorded in duplicate at 10 a.m., while the animals were moving freely in their cage with the lid removed, and the scanner was placed within 5 cm of the transponder. Body temperature monitoring continued for up to 7 days.
Temperature was measured rectally at the same time in TR0/0/ by means of a digital
recording with a thermistor system. Values were not significantly
different from those recorded by the transponder (data not shown).
Growth measurements.
Male mice anesthetized with
methoxyflurane were weighed and measured (nose to tail base) weekly
from 2 to 9 weeks of age. Mice were housed five per cage, and food and
water were provided ad libitum. The numbers of mice used from each
genotype were as follows: wild type, 19 to 29; TR/,
6 to 17; and TR0/0, 10 to 22.
Hormone measurements. Serum T4 and TSH were measured by radioimmunoassays as previously described (29).
Hearing tests.
The auditory brainstem response (ABR) was
used to assess the auditory sensitivity by a procedure that has been
described in detail elsewhere (35). Tucker-Davis
Technologies (Gainesville, Fla.) hardware and software (AeP and Siggen
packages) were employed. Briefly, mice were anesthetized with sodium
pentobarbital (Nembutal, 1.2 µl per g of body weight
intraperitoneally [i.p.]) and chlorprothixene (Taractan, 0.5 µl/g
i.p.) and kept warm with a heating pad. The average response (waveform)
per 100 presentations of tone bursts (1 ms rise and fall; 3 ms
duration; rate, 21 Hz; frequencies of 4, 8, 12, 16, and 24 kHz) was
recorded using a subdermal needle electrode placed in the scalp. Each
tone frequency was presented in descending intensity steps beginning at
80-dB sound pressure level and ending when a visually discernible ABR
waveform could no longer be detected. Thresholds were then determined
to within 5 dB for each frequency (35). The numbers of
mice (60 to 90 days old) tested from each genotype were as follows:
wild type, 7; TR/, 9; TR0/0, 7; and
combined TR/TR0/0, 4.
Morphological staining and immunohistochemistry. Three-week-old mice were killed by cervical dislocation and the small intestines were immediately removed. Proximal jejunums and distal ilea were collected separately and fixed in Carson's solution overnight at 4°C. They were then embedded in paraffin and 5-µm sections were applied on polylysine-coated slides. For morphological observations, after dewaxing and rehydration, the slides were stained with hematoxylin and eosin.
Immunochemistry experiments were performed with a monoclonal antibody (Novocastra Laboratories) for Ki-67 detection. Polyclonal antibody PAI-211 (Affinity Bioreagents, Inc.) for TR1 and TR1 protein
localization and another recognizing the N-terminal part of both TR1
and TR2 proteins (generous gift of D. Baas [4]) were
used in combination with secondary biotinylated antibody and
streptavidin-peroxidase detection system (Histomouse; Zymed). The
tissue was counterstained lightly with hematoxylin. Before incubation
with the primary antibody, the slides were immersed in 0.01 M citrate
buffer, pH 6, and microwaved for 15 min.
Cells, plasmids, transfections, and Western blotting.
HeLa
cells were maintained in Dulbecco modified Eagle medium supplemented
with 10% fetal calf serum. The plasmids containing the cDNAs of human
TR1 (pSG5hTR1), rat TR1 (pSG5rTR1), mouse TR1
(pSG5mTR1), FlagTR1 (CMV-FmTR1), and mouse TR2
(pSG5mTR2) have been described previously (6). HeLa
cells were transfected using a calcium phosphate procedure as
previously described (7) and harvested after 48 h.
Lactacystin was a gift from Satoshi Omura (Tokyo, Japan). Western
blotting was performed as previously described (6). We
used the no. 21 polyclonal antibody (gift of J. Ghysdael) as described
in reference 5 to detect TR1 and TR1 proteins and
the M2 anti-Flag antibody (IBI) to detect the Flag-TR1 protein.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
The TR0/0 mutation abolishes the production of all
products from the TR locus.
To generate mice deprived of any
TR gene product (TR1 and TR2 and their truncated
counterparts TR1 and TR2), a lacZ neor cassette (12) was introduced by
homologous recombination between exon 4 and exon 8 of the
TR gene (Fig. 1A) to generate the
TR0 allele (Fig.
1B). This removed the DNA binding region
of TR1 and TR2, preventing the production of a chimeric protein
that could act in a dominant-negative manner upon TR. It also
removed the internal promoter in intron 7 which has been shown to drive the transcription of TR1 and TR2 (6). The
TR0 mutated allele was introduced into ES
cells by homologous recombination. The structure of the modified allele
was checked by Southern blotting (Fig. 1C). Two independent positive
clones were injected into host blastocysts. Heterozygous mice were
derived from an inbred 129Sv genetic background. They were then
intercrossed to obtain TR0/0 mice.
|
transcripts in wild-type,
TR0/0, and previously described TR/
mice (12). This analysis was performed on intestine RNA
where the four TR isoforms have been shown to be expressed. Northern blot analysis (Fig. 2A) showed that all
four transcripts could be identified in the distal ileum of wild-type
mice. In TR/ mice, TR1 and TR2 RNAs were
undetectable, whereas the TR1 and TR2 transcripts were
still detected. In TR0/0 mice, neither TR nor
TR transcripts were detected. In agreement with these data,
RT-PCR did not allow the detection of transcripts containing exons 8 and 9 in the intestines of TR0/0 mice (Fig. 2B). RNase
protection analysis (Fig. 2C) revealed that the TR1 and TR2
isoforms, which are highly expressed in wild-type samples, are almost
undetectable in TR/ and TR0/0
samples. Occasionally, the 448- and 386-nucleotide fragments were
detected in the mutant mice, corresponding to transcription reading
through the stop sites within the lacZ neor
cassette. It is noteworthy that RNase protection showed that wild-type
ileum contained similar amounts of TR1 and TR2 transcripts. Underrepresentation of the large TR1 transcript in Northern blot experiments may have been caused by poor transfer onto nylon membranes. Two protected fragments, whose sizes correspond to the TR1 and TR2 isoforms, were detected in wild-type and
TR/ but not in TR0/0 samples. It is
thus concluded that in the distal ileum of wild-type mice, four TR
isoforms are expressed, including TR1 and TR2, which are
expressed at much lower levels than TR1 and TR2. The TR0 mutation completely abolishes the
transcription from the TR locus, in contrast with the
TR mutation which still allows the production of TR
transcripts, as previously described (Fig. 2D).
|
TR0/0 and TR0/0/
mice display normal embryonic development and are viable.
It has
previously been shown that TR/ and
TR// mice were born in Mendelian
proportions but died after weaning (12, 14). Lethality was
found in 129SV, BALB/c, and C57BL/6 genetic backgrounds after eight
backcrosses. When TR0/+ mice were intercrossed, among
346 born pups, 98 (28.3%), 170 (49%), and 78 (22.5%) were,
respectively, wild-type, heterozygous, and homozygous mutant progenies.
Unlike the TR/ mice, all TR0/0 mice
survived over the weaning period and the mortality in the adult
population was not different from that observed in the wild type. Male
and female TR0/0 mice were fertile. Viability and
fertility were observed in C57BL/6 and 129SV backgrounds.
TR0/0 mice were crossed with TR/ mice
to obtain TR0/+/ progenies. These
mice were then intercrossed and their progenies contained
TR0/0/+ and
TR0/+/ animals that were all viable.
Because of the low fertility displayed by
TR0/+/ animals, only
TR0/0/+ mice were used to further
generate double-homozygous TR mutants (TR0/0/). The proportion of
TR0/0/ progenies was 19.5%. This
slight deviation from Mendelian ratios may reflect marginal embryonic
lethality or occasional improper maternal care for
TR0/0/ newborn mice. However, this
result indicates that TRs are not absolutely required for embryonic
viability. TR0/0/ mice survived
beyond weaning time and were viable for at least six months. Only
occasionally were progenies obtained from
TR0/0/ intercrossings or from
TR0/0/ males or females mated with
wild-type partners, suggesting that these animals have a very low fertility.
Deregulation of the pituitary-thyroid axis in
TR0/0/ mice.
The serum levels of
T3 and T4 are strictly controlled by the direct hormonal feedback on
TSH-releasing hormone (TRH) and TSH secretion, in the hypothalamus and
the pituitary, respectively (20, 24, 29). We and others
have previously demonstrated that TR plays a key role in this
feedback loop since TR/ mice display high T3, T4,
and TSH levels (11, 14, 1). The role of TR in this
regulation has not been clearly established. TR1/
mice demonstrated only a slight decrease of T4 and TSH concentrations in males (39), whereas TR/ mice
presented a progressive but severe reduction of circulating T4 and T3
between the third and the fourth week after birth (12). In
TR0/0 adult males, basal concentration of T4, but not T3
or TSH, is slightly but significantly reduced compared to wild-type
mice. Furthermore, TSH and T4 suppression by increasing doses of T3 is
more profound in TR0/0 than in wild-type mice
(25). In adult TR0/0/
mice, the concentrations of serum T4, T3, and TSH were increased 14-fold, 13-fold, and more than 200-fold respectively, compared to
those of wild-type mice. These levels are comparable with those previously reported for TR1//
animals (11-, 30-, and 60- to 160-fold, respectively) (16) or 3-week-old TR// mice (7-, 20-, and more than 100-fold, respectively) (14).
Reduced growth rate and delayed bone maturation in
TR0/0 and TR0/0/
mice.
The growth of TR0/0 males and their wild-type
littermates was monitored over a two-month period. TR0/0
mice showed a reduced increase of body weight compared to wild-type animals, at all ages analyzed, in both 129Sv (not shown) and C57BL/6 genetic backgrounds (Fig. 3A). The time
course of linear growth displayed similar differences (Fig. 3B),
showing that alteration of body growth fully accounts for the weight
differences and that the TR0 mutation does
not result in an abnormal weight-to-length ratio. TR/ mice displayed no difference in weight or length
growth compared to that of the wild type (Fig. 3A and B)
|
0/0/ mice was further
reduced compared to the TR0/0 mutants, though no
difference could be observed at birth. Weight reductions of 50 and 30%
were observed in mice at weaning time and in adult mice, respectively,
compared to wild-type mice (Fig. 3C).
The synthesis of GH has been shown to be regulated by TH and to be
decreased in TR1// mice
(16), which display marked growth retardation. We compared the expressions of the GH mRNA in the pituitary glands of wild-type, TR0/0, and TR0/0/
mice. As shown in Fig. 3D, the amount of GH RNA was not altered in
TR0/0 mice but was markedly reduced in double-knockout
animals. These data suggest that the reduced growth observed in
TR0/0 mice may not be due to a reduced production of GH.
Since linear growth was affected in TR0/0 mice, we
studied endochondral ossification in their long bones. For this
purpose, anatomical and histological analyses were performed. In
3-week-old TR0/0 animals at weaning, the ends of
metatarsals and phalanges of the foot, the condyles and growth plate of
the femur, and the growth plates of the tibia and fibula stained
positively for cartilage with alcian blue (Fig.
4A). In wild-type mice, alcian blue
staining was markedly diminished and replaced by alizarin red staining in these areas, indicating that bone formation and mineralization were
more advanced than in TR0/0 animals. Furthermore,
ossification of the patella was delayed in TR0/0 mice
relative to that in wild-type mice (Fig. 4A). Similar evidence of
delayed bone formation and mineralization was seen in the upper limbs
of 3-week-old TR0/0 mice (data not shown). Goldner
staining of undecalcified longitudinal sections of tibias revealed that
the ossification of the epiphyses was delayed in TR0/0
mice, and the density of trabecular bone in the metaphyses was markedly
lower than in control mice (Fig. 4B). Histological analyses demonstrated that tibial growth plates from TR0/0 mice
were grossly disorganized compared to those of wild-type animals (Fig.
4B, C, and D), and similar findings were observed in other growth
plates throughout the upper and lower limbs of TR0/0
mice (data not shown). In particular, proliferating growth plate chondrocytes failed to form discrete columns and the hypertrophic zone
was markedly diminished and morphologically indistinct in TR0/0 mice compared to wild-type mice, suggesting that
hypertrophic chondrocyte differentiation failed to progress normally in
TR0/0 mice. Furthermore, the degree of alcian blue
staining of the growth plate cartilage matrix in TR0/0
mice was diminished and patchy compared to that in wild-type animals,
supporting the view that epiphyseal growth plate architecture is
disorganized and endochondral ossification is disrupted in TR0/0 mice (Fig. 4C and D). In
TR0/0/ mice, a similar phenotype
was observed (data not shown). These alterations were similar to those
described previously for TR/ and
TR// mice (12, 14)
and are reminiscent of abnormalities in epiphyseal growth plates of
hypothyroid rats (34).
|
TR0/0/ mice display severe
hypothermia.
TH plays a crucial role in the control of
thermogenesis, and hypothyroidism results in decreased oxygen
consumption and heat production (13). We examined the
temperatures of adult wild-type and mutant mice, using both a rectal
probe and a temperature-sensitive probe implanted under the skin. The
two techniques provided similar data. The mean body temperature of
TR/ mice was similar to that of wild-type mice, but
it was 0.4°C lower in TR0/0 mice (Fig.
5). Interestingly, the mean body
temperature of TR0/0/ animals was
dramatically decreased (
4°C) relative to that of the wild type
(Fig. 5). These data suggest functional redundancy between the TR
and the TR loci in the control of basal body temperature.
|
Decrease of auditory sensitivity in TR0/0 mice and
deafness in TR0/0/ mice.
Several
authors have described deafness in mice lacking both TR1 and TR2,
but not in mice lacking TR2 only or TR1 (1, 11),
suggesting that TR1 is the only mediator of this T3-dependent function. However, the role of TR2 and the effect of the double knockout on the integrity of hearing have not been documented. We
therefore measured the ABR threshold in TR0/0 and
TR0/0/ mice. Whereas at low or middle
frequencies TR0/0 mice had a normal hearing threshold,
they exhibited a marked loss of sensitivity at high tone frequencies
(Fig. 6). In
TR0/0/ mice, the loss of hearing
threshold was significantly more severe than that observed in
TR/ animals. These data suggest that, although the
TR1 receptor is the major mediator of T3 action, in addition the
integrity of the TR gene is required to achieve full
function of the auditory apparatus.
|
The intestinal phenotype is mildly altered in TR0/0
mice compared to that of TR/ mice.
In mammals,
the small intestine is lined by a continuously renewable population of
epithelial cells. The pluripotent crypt stem cells give rise to
immature cells that migrate and differentiate in the villus compartment
and die after exfoliation at the villus tip. It was previously
demonstrated that TR/ mice displayed a strong
impairment of postnatal intestinal development (14, 28).
It is noteworthy that the intestine is one of the few organs where the
TR and the TR isoforms are coexpressed. In order to
differentiate functions of the TR1/2 and TR1/2 isoforms in the intestine epithelium, we carried out a comparative investigation of morphofunctional parameters in TR0/0,
TR/, and wild-type mice.
0/0 mutants compared to that of wild-type animals.
This was mainly due to the reduced lengths of the villi, resulting from
a decreased number of epithelial cells per crypt-villus axis (Fig. 7A
and B). These features were more strongly
affected in the TR/ mice (Fig. 7C). The
proliferation and differentiation parameters of the epithelial cells
also indicated a stronger impairment in TR/ than in
TR0/0 mice (27a). In contrast to the
TR/ mutant animals that displayed a thinning of the
smooth muscular layers (12, 28), TR0/0
mutants appeared normal in this respect. Taken together, these data
strongly suggest that the severity of the intestinal phenotype correlates mostly with the persistence of the TR transcripts and
not with the absence of TR1 and TR2 isoforms.
|
The intestinal phenotype is more severe in
TR// than in
TR0/0/ mice.
It was previously
shown that combining the TR and
TR mutations in
TR// mice results in a more
dramatic alteration of the structure of the distal ileum than that
observed in TR/ mice (14, 28). When we
analyzed the distal ilea of TR0/0/
versus those of TR0/0 mice, no obvious morphological
difference was observed (Fig. 7B and D) and no statistically
significant difference was found in the number of epithelial cells per
crypt-villus axis. In contrast, in the ilea of
TR// mice, the number of
epithelial cells was further decreased compared with that of
TR/ mice (Fig. 7C and E) and the morphology was
dramatically altered (Fig. 7E), in agreement with previous
observations. The number of proliferating cells in the crypts of
TR0/0/ mice (8 ± 1) was
decreased to the same extent as in TR0/0 animals (7 ± 1). In contrast, this number was more reduced in TR// (2 ± 1) than in
TR/ animals (5 ± 1). The analysis of
epithelial cell differentiation markers also demonstrated similar
features in TR0/0 and
TR0/0/ animals but showed a stronger
impairment in TR// than in
TR/ mice. In summary, the knockout of the
TR gene does not worsen the phenotype observed in
TR0/0 mice, but clearly enhances the alterations
observed in TR/ mice. These data rule out functional
redundancy between TRs in the control of postnatal development of the
intestine. They suggest instead that the expression of the TR
isoforms, which is deleterious in the absence of TR1 and TR2, has
even more toxic effects in the absence of all TRs.
Identification of the TR proteins in the distal ileum by
immunohistochemistry.
The intestinal epithelium is composed of
proliferating and undifferentiated cells which form the crypt
compartment and of mature cells located in the villi. In order to
analyze the presence of the TR proteins in the intestinal mucosa
and their pattern of expression along the crypt-villus axis, we
performed immunocytochemical analysis. Since TR proteins do not
contain any peptide sequence which would differentiate them from their
complete TR counterpart, we had to compare the patterns in distal
ilea from wild-type, TR/, and TR0/0
mice, using the following antisera: anti-C1 raised against the common C-terminal part of TR1 and TR1, anti-C2 raised
against the common C-terminal part of TR2 and TR2 but
different from TR1, and anti-N raised against the N-terminal part
common to TR1 and TR2. No staining was obtained with the
anti-C2 antibody in any genotypes (data not shown), whereas the
expression of TR2 and TR2 mRNAs has been demonstrated by
semiquantitative RT-PCR (28), Northern blotting, and RNase
protection (this study) in wild-type mice. As this antiserum was used
successfully in immunocytochemical detection of TR2 and TR2
proteins in transfected cells (data not shown), the failure to detect
these proteins in the small intestine probably results from their very
low concentration in this tissue.
antiserum, we observed a nuclear labeling in muscle
layers of wild-type mice (Fig. 8A to D),
but no staining was observed in the epithelium or mesenchyme (Fig. 8B
and C). No positive cells were detected in TR0/0 or
TR/ mice (Fig. 8E to H and I to L). By
semiquantitative RT-PCR, it was previously shown that in smooth muscle
layers only the TR1 RNA was detected (28).
Consequently, the signal detected with the anti-N antibody in this
tissue can be attributed to TR1. In the same experiment, the TR1
mRNA was found in the epithelium and connective tissues, whereas the
TR2 mRNA was found only in the epithelium (28);
therefore, we assume that the corresponding proteins are expressed in
these tissue regions but at levels undetectable by this technique.
|
1 antibody, we detected a strong nuclear signal in
the differentiated epithelial cells of the villi in wild-type mice
(Fig. 9A and B). Only a faint signal
could be detected in the undifferentiated epithelial cells of crypts,
in the lamina propria, and in smooth muscle cells (Fig. 9C and D).
However, unlike the signal detected with the anti-N reagent, this
staining persisted in TR/ mice (Fig. 9I to L), which
retain the expression of TR transcripts, and disappeared in
TR0/0 mice (Fig. 9E to H). These observations
demonstrate that the protein labeled by the anti-C1 reagent is
TR1. They also suggest that, unlike the anti-N antibody, the
anti-C1 antibody is unable to recognize the TR1 protein,
presumably due to the small amount of this protein in the distal ileum,
and to the reduced accessibility of the target epitope in the tight
conformation of the ligand binding domain. Altogether, these data
indicate that in wild-type mice, the TR1 protein is mainly located
in the nuclei of smooth muscle cells, whereas the TR1 protein is
mainly present in the nuclei of differentiated epithelial cells. It is
worth noting that in TR/ undifferentiated and
differentiated epithelial cells have similar nuclear labeling.
|
The activity of TR proteins is down-regulated by TR1 via
the proteasome pathway.
Our data show that the deleterious
activity of the TR isoforms is triggered by the inactivation of
the TR1 and TR2 genes. To clarify the
molecular mechanisms which could account for this gene
inactivation-dependent activity, we tested the possibility that TR1
and TR2 could interfere with the synthesis or degradation of the
TR isoforms, thereby modulating their activity. For this purpose,
we measured the expression of the TR1 protein in HeLa cells after
cotransfection of a TR1 expression vector together with either an
empty vector or a vector expressing either TR1 or TR2. Figure 10
shows that, while the amount of TR1 transcripts was unaffected by
the coexpression of the TR1 protein (Fig.
10C), the amount of TR1 protein
was reduced by increasing amounts of TR1 (Fig. 10A). This effect was
independent of the presence of T3 (data not shown). In contrast to
these data, the expression of small amounts of TR2 did not produce
any decrease in the amount of TR1 protein (Fig. 10B). It is
noteworthy that expression of TR1 did not change the amount of
TR1 (data not shown). In order to show that degradation, and not
the rate of protein synthesis, accounted for the reduction in the
amount of the TR1 protein, we tested the abilities of different
permeant protease inhibitors to prevent this effect. When cotransfected
cells were treated with lactacystin, a potent inhibitor of the
proteasome pathway (9), the amount of TR1 protein was
not changed, but the amount of TR1 protein was considerably
increased, reaching levels higher than those observed in the absence of
TR1 (Fig. 10D). These data suggest that TR1 triggers the
degradation of the TR1 protein through a proteasome-dependent
pathway.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
The TR locus encodes the TR1 receptor, whose
targeted inactivation results in bradycardia and a slight decrease in
body temperature (39). This locus also generates the
TR2 variant, which cannot bind T3, poorly heterodimerizes with RXRs,
and does not contain any transactivation domain. Transfection studies
have shown that the TR2 protein can inhibit the transcriptional
activity of TRs. The TR2 transcript is present in all mammalian
tissues and is generally more abundant than the TR1 transcript, at
least at the level of whole organ analysis (22). Despite
these many data, the in vivo function of the TR2 protein remains
unknown. In addition to TR1 and TR2, we have identified the
TR1 and TR2 transcripts, which are expressed in murine
embryonic stem cells and in intestine, lung, and brain tissues of adult
mice. The proteins encoded by these transcripts do not bind T3 or DNA but inhibit the transcriptional activity of several nuclear receptors when they are associated with RXR partners (6). Their in
vivo function is unknown. Several genetic modifications of the
TR locus which have been generated in a mouse now provide
tools with which to obtain insights into the functions of these
different products. The goal of this discussion is to draw some
conclusions from the comparison of the phenotypes observed in the
different TR gene knockout mice. For the sake of clarity, we have
indicated in Fig. 2C the TR isoforms which are expressed or
abolished in the different knockout strains.
TR1 and TRs cooperate to regulate TSH production.
Abolishing a TR1, TR2, TR3 and TR3, or TR2 only has
been shown to result in altered TH-dependent feedback regulation of TSH
production by T3 (1, 37). In contrast, abolishing the
TR1/1 isoforms in TR1/ mice (R. E. Weiss, O. Chassande, P. E. Macchia, K. Cua, J. Samarut, and
S. E. Refetoff, submitted for publication), TR1/2 in
TR/ mice (12), or
TR1/2/1/2 in TR0/0 mice
(25) results in mild alterations in the serum
concentrations of TH and TSH, indicating that the TR isoforms may
play minor roles in this feedback control. However,
TR1/ mice display decreased T4 and TSH levels,
suggestive of secondary hypothyroidism, while TR0/0 mice
have decreased T4 but normal TSH levels, indicating increased sensitivity of the pituitary to TH. Moreover, careful examination of
central responses to varying doses of T3 in TR0/0 mice
reveals increased sensitivity to TH (25). Altogether, these data suggest that the TR2 isoform weakly antagonizes the activity of TRs in thyrotroph cells. In the absence of any true TRs,
in TR1// (16),
TR// (14), and
TR0/0/ mice, TSH reaches very high
levels despite large amounts of TH, independently of the presence of
non-T3-binding TR isoforms. This shows that in thyrotroph cells, TR2
could modulate TSH production only in the presence of a TR-mediated
T3 response.
TR1, TR2, and TRs cooperate to maintain basal body
temperature.
Mice lacking the TR1/1 isoforms
(TR1/) have a body temperature 0.5°C lower than
that of wild-type mice (18). We show here that
TR0/0 mice display a similar deficit, suggesting that
abolishing TR2 does not alter thermogenesis, at least under basal
conditions. TR/ mice have normal body temperatures
suggesting that the contribution of the TR isoforms in the
T3-dependent basal thermogenesis is minor or compensated for by TR1.
Surprisingly, the comparison between body temperature deficits observed
in TR1// ( 0.5°C) and
TR0/0/ (4°C) mice reveals
potentially important thermogenic functions for the TR2 isoform.
Since no difference in body temperature is observed between
TR1/ and TR0/0 mice, this function is
unraveled only in the absence of functional TR. The above data lead to
the conclusion that the effects of TH on basal body temperature are
mediated by the TR and TR nuclear receptors, that TR1, TRs,
and TR2 isoforms exercise redundant functions in the control of
thermogenesis, and that the persistence of only one of these isoforms
is sufficient to maintain body temperature within a physiologic range.
TR2 is essential for normal body growth and bone
maturation.
Previous publications and our data have shown that in
TR//,
TR1//, and
TR0/0/ mice, the total absence of
functional TH receptors results in a reduced growth rate and delayed
bone maturation, independently of the presence of non-TH-binding
isoforms from the TR locus. This consensus is in agreement with the
bone maturation delay observed in hypothyroid rats (34).
This simple observation contrasts with the complexity resulting from
the analysis of the functions of individual TR and TR isoforms.
Previous reports indicate that TR/ and
TR1/ mice have normal growth rates and bone
maturation (10, 14, 16, 39). In contrast, combining some
of the TR mutations results in a profound disruption of these
processes, revealing functional redundancies between TR isoforms. One
redundancy clearly occurs with TR1 and TR, which are both
expressed in bone (2, 5, 31, 34) and which in combined but
not individual knockouts result in bone maturation delay. The selective
abolishing of TR1 in TR1/ mice does not result in
obvious impairment of linear growth or bone maturation. However, in
TR/ (12) and TR0/0 (this
paper) mice, devoid of both TR1 and TR2 isoforms, growth retardation and delayed skeletal development are observed. The skeletal
phenotype of TR0/0 mice includes retarded ossification,
failure of progression of hypertrophic chondrocyte differentiation, and
disorganization of epiphyseal growth plate architecture, all features
similar to those seen in hypothyroidism (34). Importantly,
circulating basal TH concentrations in TR0/0 mice were
only mildly impaired and GH concentrations were unchanged compared to
those of wild-type mice, supporting the notion that the deletion of the
TR gene fully accounts for this phenotype. On consideration of the
TR isoforms that are expressed in the different knockout strains (Fig.
2C), the skeletal phenotypes described can be proposed to result
primarily from the abolishing of TR2, or the concomitant abolishing
of both TR1 and TR2. Only when data concerning the
TR2-specific mutation are available will it be possible to test this
hypothesis further. Nevertheless, our data reveal the important role of
TR2 in body growth and maturation of long bones. An interesting
observation is that in bone, abolishing TR2, an isoform that is
known to weakly inhibit T3 responses in vitro, paradoxically results in
a phenotype which is similar to the skeletal consequences of profound
hypothyroidism. This situation contrasts with the increased T3 response
observed in the pituitary of TR0/0 mice
(25). The alteration of growth and bone maturation
observed in TR1// and
TR0/0/ mice could be attributed to
impaired GH synthesis since these animals exhibit decreased amounts of
GH transcripts in pituitary (reference 16 and the present
study). In TR0/0 and TR/ mice,
however, the GH transcript is expressed at a normal level; therefore,
the bone phenotype may be the direct consequence of the TR mutation
within bone cells.
Deafness caused by loss of the TR gene is not
rescued by deletion of the TR gene.
In addition to
confirming the importance of TR in achieving normal hearing
function, the present studies demonstrate that TR may also play a
role in the development of normal hearing. In fact, a reduced hearing
ability was observed in TR0/0 mice compared to that of
wild-type mice at higher frequencies. Although some elevation of ABR
thresholds at 24 kHz is typical of C57BL/6J mice older than 2 to 3 months, the observed hearing loss in the TR0/0 mice is
highly significant. Moreover, the
TR0/0/ mouse was more severely deaf
than the TR/ mouse. While these observations confirm
the important role of TR for the development of auditory function
(12), they have also identified a contribution of TR to
the full integrity of hearing.
Unbalanced expression of TR isoforms results in improper
intestinal development and precocious lethality.
We have
previously described the lethal phenotype of TR/
mice. The TR mutation abolishes the TR1
and TR2 transcripts but retains TR transcripts. We show in
this study that TR transcripts are expressed in the small
intestines of wild-type and TR/ but not of
TR0/0 mice. Accordingly, using anti-1 C-terminal
antibody, we detect the TR isoforms in the intestinal epithelial
cells of wild-type and TR/ but not
TR0/0 mice. This is the first time that the specificity
of the staining observed in an immunocytochemical analysis of TRs is
assessed by genetic arguments. Therefore, analysis of the products of
the TR locus reveals that the only molecular difference
between the TR/ and TR0/0 mutations
is the expression of the TR isoforms. Immunocytochemical analysis
further shows that the expression of the TR1 protein is expanded
in the TR/ mice, extending all along the crypt and
the villus. In vivo observations show that abolishing TR1 and TR2
in TR/ mice confers deleterious effects on the
TR isoforms, suggesting that, under normal conditions (wild-type
mice), the TR products down-modulate the activity of the TR
isoforms. Transfection experiments suggest that one mechanism by which
TRs could control the activity of TR proteins is by triggering
their rapid removal from the cells through the proteasome-mediated
degradation. This mechanism would explain the increased intensity and
extended expression domain of the TR1 protein in the absence of
TR1 in the intestines of TR/ mice. The mechanism
by which TR proteins exert their toxic effects in the developing
intestine is unclear. The persistence of a severe intestinal phenotype
upon inactivation of the TR gene in
TR// mice implies that the
molecular targets of the TR proteins are not only the TRs. We
have previously suggested that other nuclear receptors, such as
retinoic acid receptors, could be antagonized by TR products.
/ and TR//
mice is indeed due to the persistence of TR isoforms since it can
be rescued by their abolition in TR0/0 and
TR0/0/ mice. Thus, the severe
intestinal abnormalities and the lethality observed in
TR/ and TR//
mice are consequences of the persistence of TR isoforms, which are no longer under the control of the TR1 protein. These genetic and molecular analyses suggest that the TR isoforms have
powerful, dose-dependent toxic effects and that their level of
expression must be tightly controlled. Altogether, these genetic
analyses show that the non-T3-binding isoforms encoded from the TR
locus have important developmental and homeostatic functions.
In addition, our present and previously published data allow the
prediction that a potential homozygous mutation in the TR locus in humans, which would abolish all TR isoforms, would be expected to result in a mild phenotype mainly characterized by (i)
increased sensitivity to TH in the thyrotroph and liver and (ii)
reduced sensitivity to TH in heart and bone, manifested as bradycardia,
growth retardation, and bone maturation delay. Mutations restricted to
the N-terminal moiety of the gene, sparing the TR isoforms, are
expected to have severe pathologic consequences.
| |
ACKNOWLEDGMENTS |
|---|
We thank Christelle Morin, Nadine Aguilera, and Djamel Belgarbi for animal handling, J. P. Magaud, J. Ghysdael, P. Brulet, and S. Omura for kindly providing genomic libraries, antibodies, plasmids, and lactacystin, respectively. We thank F. Flamant and J. M. Vanacker for helpful advice.
This work was supported in part by CNRS and grants from Fondation pour la Recherche Médicale and Human Frontier Scientific Program, and by grants from NIH (DK 15070 [S.R.], AG07554 [J.F.W.], MH61090 [J.F.W.]) and the Seymour J. Abrams Thyroid Research Center. G.R.W. was supported by an MRC Career Establishment grant (G9803002) and a Wellcome Trust Project grant (050570). M. Hara was supported by an FRM fellowship.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Laboratoire de Biologie Moléculaire et Cellulaire, CNRS UMR 5665 ENS LA 913 INRA, Ecole Normale Supérieure, 46 allée d'Italie, 69364 Lyon Cedex 07, France. Phone: 33 4 72 72 81 71. Fax: 33 4 72 72 85 36. E-mail: Jacques.Samarut{at}enslyon.fr.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. |
Abel, E. D.,
M.-E. Boers,
C. Pazos-Moura,
E. Moura,
H. Kaulbach,
M. Zakaria,
B. Lowell,
S. Radovick,
M. C. Liberman, and F. Wondisford.
1999.
Divergent roles for thyroid hormone receptor isoforms in the endocrine axis and auditory system.
J. Clin. Investig.
104:291-300[Medline].
|
| 2. | Abu, E. O., S. Bord, A. Horner, V. K. K. Chatterjee, and J. E. Compston. 1997. The expression of thyroid hormone receptors in human bone. Bone 21:137-142[Medline]. |
| 3. |
Arpin, C.,
M. Pihlgren,
A. Fraichard,
D. Aubert,
J. Samarut,
O. Chassande, and J. Marvel.
2000.
Effects of T3R1 and T3R2 gene deletion on T and B lymphocyte development.
J. Immunol.
164:152-160 |
| 4. | Baas, D., C. Fressinaud, M. E. Ittel, A. Reeber, D. Dalençon, J. Puymirat, and I. L. Sarlièvre. 1994. Expression of thyroid hormone receptor isoforms in rat oligodendrocyte cultures. Effect of 3,5,3'-triiodo-L-thyronine. Neurosci. Lett. 176:47-51[CrossRef][Medline]. |
| 5. | Ballock, R. T., B. C. Mita, X. Zhou, D. H.-C. Chen, and L. M. Mink. 1999. Expression of thyroid hormone receptors isoforms in rat growth plate cartilage in vivo. J. Bone Miner. Res. 14:1550-1556[CrossRef][Medline]. |
| 6. |
Chassande, O.,
A. Fraichard,
K. Gauthier,
F. Flamand,
C. Legrand,
P. Savatier,
V. Laudet, and J. Samarut.
1997.
Identification of transcripts initiated from an internal promoter in the c-erbA locus that encode inhibitors of retinoic acid receptor- and triiodothyronine receptor activities.
Mol. Endocrinol.
11:1278-1290 |
| 7. | Desbois, C., D. Aubert, C. Legrand, B. Pain, and J. Samarut. 1991. A novel mechanism of action for v-erbA: abrogation of the inactivation of transcription factor AP-1 by retinoic acid and thyroid hormone receptors. Cell 67:731-740[CrossRef][Medline]. |
| 8. | Dussault, J. H., and J. Ruel. 1987. Thyroid hormones and brain development. Annu. Rev. Physiol. 49:321-334[CrossRef][Medline]. |
| 9. |
Fenteany, G.,
R. F. Standaert,
W. S. Lane,
S. Choi,
E. J. Corey, and S. L. Schreiber.
1995.
Inhibition of proteasome activities and subunit-specific amino-terminal threonine modification by lactacystin.
Science
268:726-731 |
| 10. | Forrest, D., E. Hanebuth, R. J. Smeyne, N. Everds, C. L. Stewart, J. M. Wehner, and T. Curran. 1996. Recessive resistance to thyroid hormone in mice lacking thyroid hormone receptor beta: evidence for tissue-specific modulation of receptor function. EMBO J. 15:3006-3015[Medline]. |
| 11. | Forrest, D., L. C. Erway, L. Ng, R. Altschuler, and T. Curran. 1996. Thyroid hormone receptor beta is essential for development of auditory function. Nat. Genet. 13:354-357[CrossRef][Medline]. |
| 12. |
Fraichard, A.,
O. Chassande,
M. Plateroti,
J. P. Roux,
J. Trouillas,
C. Dehay,
C. Legrand,
K. Gauthier,
M. Kedinger,
L. Malaval,
B. Rousset, and J. Samarut.
1997.
The TR gene encoding a thyroid hormone receptor is essential for post-natal development and thyroid hormone production.
EMBO J.
16:4412-4420[CrossRef][Medline].
|
| 13. | Franklyn, J. A. 2000. Metabolic changes in hypothyroidism, p. 833-836. In L. E. Braverman, and R. D. Utiger (ed.), The thyroid. Lippincott, Williams and Wilkins, Philadelphia, Pa. |
| 14. |
Gauthier, K.,
O. Chassande,
M. Plateroti,
J. P. Roux,
C. Legrand,
B. Pain,
B. Rousset,
R. Weiss,
J. Trouillas, and J. Samarut.
1999.
Different functions for the thyroid hormone receptors TR and TR in the control of thyroid hormone production and post-natal development.
EMBO J.
18:623-631[CrossRef][Medline].
|
| 15. |
Glass, C. K., and M. G. Rosenfeld.
2000.
The coregulator exchange in transcriptional functions of nuclear receptors.
Genes Dev.
14:121-141 |
| 16. |
Göthe, S.,
Z. Wang,
L. Ng,
J. M. Kindblom,
A. Campos Barros,
C. Ohlsson,
B. Vennström, and D. Forrest.
1999.
Mice devoid of all known thyroid hormone receptors are viable but exhibit disorders of pituitary-thyroid axis, growth, and bone maturation.
Genes Dev.
13:1329-1341 |
| 17. |
Hashimoto, K.,
F. H. Curty,
P. P. Borges,
C. E. Lee,
E. D. Abel,
J. K. Elmquist,
R. N. Cohen, and F. E. Wondisford.
2001.
An unliganded thyroid hormone receptor causes severe neurological dysfunction.
Proc. Natl. Acad. Sci. USA
98:3998-4003 |
| 18. |
Johansson, C.,
S. Gothe,
D. Forrest,
B. Vennstrom, and P. Thoren.
1999.
Cardiovascular phenotype and temperature control in mice lacking thyroid hormone receptor-beta or both alpha1 and beta.
Am. J. Physiol.
276:H2006-H2012 |
| 19. |
Kaneshige, M.,
K. Kaneshige,
X.-G. Zhu,
A. Dace,
L. Garrett,
T. A. Carter,
R. Kazlauskaite,
D. G. Pankratz,
A. Wynshaw-Boris,
S. Refetoff,
B. Weintraub,
M. C. Willinham,
C. Barlow, and S.-Y. Cheny.
2000.
Mice with a targeted mutation in the thyroid hormone receptor gene exhibit impaired growth and resistance to thyroid hormone.
Proc. Natl. Acad. Sci. USA
97:13209-13214 |
| 20. |
Langlois, M.-F.,
K. Zanger,
T. Monden,
J. D. Safer,
A. N. Hollenberg, and F. E. Wondisford.
1997.
A unique role of the b2 thyroid hormone receptor isoform in negative regulation by thyroid hormone.
J. Biol. Chem.
272:24927-24933 |
| 21. |
Lazar, M. A.,
R. A. Hodin, and W. W. Chin.
1989.
Human carboxyl-terminal variant of -type c-erbA inhibit trans-activation by thyroid hormone receptors without binding thyroid hormone.
Proc. Natl. Acad. Sci. USA
86:7771-7774 |
| 22. |
Lazar, M. A.
1993.
Thyroid hormone receptors: multiple forms, multiple possibilities.
Endocr. Rev.
14:184-193 |
| 23. | Legrand, J. 1986. Thyroid hormone effects on growth and development, p. 503-534. In G. Hennemann (ed.), Thyroid hormone metabolism. Dekker, Rotterdam, The Netherlands. |
| 24. |
Lezoualc'h, F.,
A. H. Hassan,
P. Giraud,
J. P. Loeffler,
S. L. Lee, and B. Demeneix.
1992.
Assignment of the -thyroid hormone receptor to 3,5,3'-triiodothyronine-dependent inhibition of transcription from the thyrotropin-releasing hormone promoter in chick hypothalamic neurons.
Mol. Endocrinol.
6:1797-1804 |
| 25. |
Macchia, P. E.,
Y. Takeuchi,
T. Kawai,
K. Cua,
K. Gauthier,
O. Chassande,
H. Seo,
Y. Hayashi,
J. Samarut,
Y. Murata,
R. E. Weiss, and S. Refetoff.
2001.
Increased sensitivity to thyroid hormone in mice with complete deficiency of thyroid hormone receptor .
Proc. Natl. Acad. Sci. USA
98:349-354 |
| 26. | Meunier, P. J. 1983. A yearly survey of developments in the field of bone and mineral metabolism. W. A. Peck, Amsterdam, The Netherlands. |
| 27. | Nuclear Receptors Committee. 1999. A unified nomenclature system for the nuclear receptor superfamily. Cell 97:161-163[CrossRef][Medline]. |
| 27a. |
Plateroti, M.,
K. Gauthier,
C. Domon-Dell,
J.-N. Freund,
J. Samarut, and O. Chassande.
2001.
Functional interference between thyroid hormone receptor (TR) and natural truncated TR isoforms in the control of intestine development.
Mol. Cell. Biol.
21:4761-4772 |
| 28. |
Plateroti, M.,
O. Chassande,
A. Fraichard,
K. Gauthier,
J.-N. Freund,
J. Samarut, and M. Kedinger.
1999.
Involvement of T3R- and -receptor subtypes in mediation of T3 functions during post-natal murine intestinal development.
Gastroenterology
116:1367-1378[CrossRef][Medline].
|
| 29. | Pohlenz, J., A. Maqueem, K. Cua, R. E. Weiss, J. Van Sande, and S. Refetoff. 1999. Improved radioimmunoassay for measurement of mouse TSH in serum: strain differences in TSH concentration and thyrotroph sensitivity to thyroid hormone. Thyroid 9:1265-1271[Medline]. |
| 30. | Refetoff, S. 2000. Resistance to thyroid hormone, p. 1028-1043. In L. E. Braverman, and R. D. Utiger (ed.), The thyroid. Lippincott, Williams and Wilkins, Philadelphia, Pa. |
| 31. |
Robson, H.,
T. Siebler,
D. A. Stevens,
S. M. Shalet, and G. R. Williams.
2000.
Thyroid hormone acts directly on growth plate chondrocytes to promote hypertrophic differentiation and inhibit clonal expansion and cell proliferation.
Endocrinology
141:3887-3897 |
| 32. | Savatier, P., H. Lapillonne, L. van Grunsven, B. B. Rudkin, and J. Samarut. 1996. Withdrawal of differentiation of inhibitory activity/leukemia inhibitory factor up-regulates D-type cyclins and cyclin-dependent kinase inhibitors in mouse embryonic stem cells. Oncogene 12:309-322[Medline]. |
| 33. | Scanlon, M. F., and A. D. Toft. 1996. Regulation of thyrotropin secretion, p. 220-240. In L. E. Braverman, and R. D. Utiger (ed.), Werner and Ingbar's the thyroid: a fundamental and clinical text, 7th ed. Lippincott-Raven, New York, N.Y. |
| 34. | Stevens, D. A., R. P. Hasserjian, H. Robson, T. Siebler, S. M. Shalet, and G. R. Williams. 2000. Thyroid hormones regulate hypertrophic chondrocyte differentiation and expression of parathyroid hormone-related protein and its receptor during endochondral bone formation. J. Bone Miner. Res. 15:2431-2442[CrossRef][Medline]. |
| 35. | Turner, J. G., and J. F. Willott. 1998. Exposure to an augmented acoustic environment alters progressive hearing loss in DBA/2J mice. Hear. Res. 118:101-113[CrossRef][Medline]. |
| 36. | Weiss, R. E., and S. Refetoff. 1996. Effect of thyroid hormone on growth: lessons from the syndrome of resistance of thyroid hormone. Endocrinol. Metab. Clin. N. Am. 25:719-730[CrossRef][Medline]. |
| 37. |
Weiss, R. E.,
D. Forrest,
J. Pohlenz,
K. Cua,
T. Curran, and S. Refetoff.
1997.
Thyrotropin regulation by thyroid hormone in thyroid hormone receptor beta-deficient mice.
Endocrinology
138:3624-3629 |
| 38. |
Weiss, R. E.,
Y. Murata,
K. Cua,
Y. Hayashi,
H. Seo, and S. Refetoff.
1998.
Thyroid hormone action on liver, heart and energy expenditure in thyroid hormone receptor deficient mice.
Endocrinology
139:4945-4952 |
| 39. |
Wikström, L.,
C. Johansson,
C. Salto,
C. Barlow,
A. Campos Barros,
F. Baas,
D. Forrest,
P. Thoren, and B. Vennström.
1998.
Abnormal heart rate and body temperature in mice lacking thyroid hormone receptor 1.
EMBO J.
17:455-461[CrossRef][Medline].
|
| 40. | Williams, G. R., H. Robson, and S. M. Shalet. 1998. Thyroid hormone actions on cartilage and bone: interactions with other hormones at the epiphyseal plate and effects on linear growth. J. Endocrinol. 157:391-403[CrossRef][Medline]. |
| 41. |
Williams, G. R.
2000.
Cloning and characterization of two novel thyroid hormone receptor isoforms.
Mol. Cell. Biol.
20:8329-8342 |
Molecular and Cellular Biology, July 2001, p. 4748-4760, Vol. 21, No. 14
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.14.4748-4760.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Chan, I. H., Privalsky, M. L.
(2009). Isoform-Specific Transcriptional Activity of Overlapping Target Genes that Respond to Thyroid Hormone Receptors {alpha}1 and {beta}1. Mol. Endocrinol.
23: 1758-1775
[Abstract] [Full Text] -
Bassett, J H D., Williams, G. R
(2009). The skeletal phenotypes of TR{alpha} and TR{beta} mutant mice. J Mol Endocrinol
42: 269-282
[Abstract] [Full Text] -
Kress, E., Rezza, A., Nadjar, J., Samarut, J., Plateroti, M.
(2009). The Frizzled-related sFRP2 Gene Is a Target of Thyroid Hormone Receptor {alpha}1 and Activates {beta}-Catenin Signaling in Mouse Intestine. J. Biol. Chem.
284: 1234-1241
[Abstract] [Full Text] -
Pelletier, P., Gauthier, K., Sideleva, O., Samarut, J., Silva, J. E.
(2008). Mice Lacking the Thyroid Hormone Receptor-{alpha} Gene Spend More Energy in Thermogenesis, Burn More Fat, and Are Less Sensitive to High-Fat Diet-Induced Obesity. Endocrinology
149: 6471-6486
[Abstract] [Full Text] -
Kress, E., Rezza, A., Nadjar, J., Samarut, J., Plateroti, M.
(2008). The Thyroid Hormone Receptor-{alpha} (TR{alpha}) Gene Encoding TR{alpha}1 Controls Deoxyribonucleic Acid Damage-Induced Tissue Repair. Mol. Endocrinol.
22: 47-55
[Abstract] [Full Text] -
Bassett, J. H. D., Nordstrom, K., Boyde, A., Howell, P. G. T., Kelly, S., Vennstrom, B., Williams, G. R.
(2007). Thyroid Status during Skeletal Development Determines Adult Bone Structure and Mineralization. Mol. Endocrinol.
21: 1893-1904
[Abstract] [Full Text] -
Liu, G., Kawaguchi, H., Ogasawara, T., Asawa, Y., Kishimoto, J., Takahashi, T., Chung, U.-i., Yamaoka, H., Asato, H., Nakamura, K., Takato, T., Hoshi, K.
(2007). Optimal Combination of Soluble Factors for Tissue Engineering of Permanent Cartilage from Cultured Human Chondrocytes. J. Biol. Chem.
282: 20407-20415
[Abstract] [Full Text] -
Quignodon, L., Grijota-Martinez, C., Compe, E., Guyot, R., Allioli, N., Laperriere, D., Walker, R., Meltzer, P., Mader, S., Samarut, J., Flamant, F.
(2007). A combined approach identifies a limited number of new thyroid hormone target genes in post-natal mouse cerebellum. J Mol Endocrinol
39: 17-28
[Abstract] [Full Text] -
Bassett, J. H. D., O'Shea, P. J., Sriskantharajah, S., Rabier, B., Boyde, A., Howell, P. G. T., Weiss, R. E., Roux, J.-P., Malaval, L., Clement-Lacroix, P., Samarut, J., Chassande, O., Williams, G. R.
(2007). Thyroid Hormone Excess Rather Than Thyrotropin Deficiency Induces Osteoporosis in Hyperthyroidism. Mol. Endocrinol.
21: 1095-1107
[Abstract] [Full Text] -
Villicev, C. M, Freitas, F. R S, Aoki, M. S, Taffarel, C., Scanlan, T. S, Moriscot, A. S, Ribeiro, M. O, Bianco, A. C, Gouveia, C. H A
(2007). Thyroid hormone receptor {beta}-specific agonist GC-1 increases energy expenditure and prevents fat-mass accumulation in rats. J Endocrinol
193: 21-29
[Abstract] [Full Text] -
Harvey, C. B., Bassett, J. H. D., Maruvada, P., Yen, P. M., Williams, G. R.
(2007). The Rat Thyroid Hormone Receptor (TR) {Delta}{beta}3 Displays Cell-, TR Isoform-, and Thyroid Hormone Response Element-Specific Actions. Endocrinology
148: 1764-1773
[Abstract] [Full Text] -
Flamant, F., Gauthier, K., Samarut, J.
(2007). Thyroid Hormones Signaling Is Getting More Complex: STORMs Are Coming. Mol. Endocrinol.
21: 321-333
[Abstract] [Full Text] -
Flamant, F., Baxter, J. D., Forrest, D., Refetoff, S., Samuels, H., Scanlan, T. S., Vennstrom, B., Samarut, J.
(2006). International Union of Pharmacology. LIX. The Pharmacology and Classification of the Nuclear Receptor Superfamily: Thyroid Hormone Receptors. Pharmacol. Rev.
58: 705-711
[Full Text] -
Rabier, B., Williams, A. J, Mallein-Gerin, F., Williams, G. R, Chassande, O
(2006). Thyroid hormone-stimulated differentiation of primary rib chondrocytes in vitro requires thyroid hormone receptor {beta}.. J Endocrinol
191: 221-228
[Abstract] [Full Text] -
Shin, D.-J., Plateroti, M., Samarut, J., Osborne, T. F.
(2006). Two uniquely arranged thyroid hormone response elements in the far upstream 5' flanking region confer direct thyroid hormone regulation to the murine cholesterol 7{alpha} hydroxylase gene. Nucleic Acids Res
34: 3853-3861
[Abstract] [Full Text] -
Farwell, A. P., Dubord-Tomasetti, S. A., Pietrzykowski, A. Z., Leonard, J. L.
(2006). Dynamic Nongenomic Actions of Thyroid Hormone in the Developing Rat Brain. Endocrinology
147: 2567-2574
[Abstract] [Full Text] -
Fugier, C., Tousaint, J.-J., Prieur, X., Plateroti, M., Samarut, J., Delerive, P.
(2006). The Lipoprotein Lipase Inhibitor ANGPTL3 Is Negatively Regulated by Thyroid Hormone. J. Biol. Chem.
281: 11553-11559
[Abstract] [Full Text] -
Plateroti, M., Kress, E., Mori, J. I., Samarut, J.
(2006). Thyroid Hormone Receptor {alpha}1 Directly Controls Transcription of the {beta}-Catenin Gene in Intestinal Epithelial Cells. Mol. Cell. Biol.
26: 3204-3214
[Abstract] [Full Text] -
Bassett, J. H. D., Swinhoe, R., Chassande, O., Samarut, J., Williams, G. R.
(2006). Thyroid Hormone Regulates Heparan Sulfate Proteoglycan Expression in the Growth Plate. Endocrinology
147: 295-305
[Abstract] [Full Text] -
(2005). Genetically Modified Animals in Endocrinology. Endocr. Rev.
26: 985-993
[Abstract] [Full Text] -
O'Shea, P. J., Bassett, J. H. D., Sriskantharajah, S., Ying, H., Cheng, S.-y., Williams, G. R.
(2005). Contrasting Skeletal Phenotypes in Mice with an Identical Mutation Targeted to Thyroid Hormone Receptor {alpha}1 or {beta}. Mol. Endocrinol.
19: 3045-3059
[Abstract] [Full Text] -
Barnard, J. C., Williams, A. J., Rabier, B., Chassande, O., Samarut, J., Cheng, S.-y., Bassett, J. H. D., Williams, G. R.
(2005). Thyroid Hormones Regulate Fibroblast Growth Factor Receptor Signaling during Chondrogenesis. Endocrinology
146: 5568-5580
[Abstract] [Full Text] -
Kahaly, G. J., Dillmann, W. H.
(2005). Thyroid Hormone Action in the Heart. Endocr. Rev.
26: 704-728
[Abstract] [Full Text] -
Mittag, J., Friedrichsen, S., Heuer, H., Polsfuss, S., Visser, T. J., Bauer, K.
(2005). Athyroid Pax8-/- Mice Cannot Be Rescued by the Inactivation of Thyroid Hormone Receptor {alpha}1. Endocrinology
146: 3179-3184
[Abstract] [Full Text] -
Marrif, H., Schifman, A., Stepanyan, Z., Gillis, M.-A., Calderone, A., Weiss, R. E., Samarut, J., Silva, J. E.
(2005). Temperature Homeostasis in Transgenic Mice Lacking Thyroid Hormone Receptor-{alpha} Gene Products. Endocrinology
146: 2872-2884
[Abstract] [Full Text] -
Vallejo, C. G., Seguido, A. M., Testillano, P. S., Risueno, M.-C.
(2005). Thyroid hormone regulates tubulin expression in mammalian liver. Effects of deleting thyroid hormone receptor-{alpha} or -{beta}. Am. J. Physiol. Endocrinol. Metab.
289: E87-E94
[Abstract] [Full Text] -
Bonnelye, E., Aubin, J. E.
(2005). Estrogen Receptor-Related Receptor {alpha}: A Mediator of Estrogen Response in Bone. J. Clin. Endocrinol. Metab.
90: 3115-3121
[Abstract] [Full Text] -
Angelin-Duclos, C., Domenget, C., Kolbus, A., Beug, H., Jurdic, P., Samarut, J.
(2005). Thyroid hormone T3 acting through the thyroid hormone {alpha} receptor is necessary for implementation of erythropoiesis in the neonatal spleen environment in the mouse. Development
132: 925-934
[Abstract] [Full Text] -
Liu, Y.-Y., Brent, G. A.
(2005). Thyroid Hormone-Dependent Gene Expression in Differentiated Embryonic Stem Cells and Embryonal Carcinoma Cells: Identification of Novel Thyroid Hormone Target Genes by Deoxyribonucleic Acid Microarray Analysis. Endocrinology
146: 776-783
[Abstract] [Full Text] -
Quignodon, L, Legrand, C, Allioli, N, Guadano-Ferraz, A, Bernal, J, Samarut, J, Flamant, F
(2004). Thyroid hormone signaling is highly heterogeneous during pre- and postnatal brain development. J Mol Endocrinol
33: 467-476
[Abstract] [Full Text] -
Mai, W., Janier, M. F., Allioli, N., Quignodon, L., Chuzel, T., Flamant, F., Samarut, J.
(2004). Thyroid hormone receptor {alpha} is a molecular switch of cardiac function between fetal and postnatal life. Proc. Natl. Acad. Sci. USA
101: 10332-10337
[Abstract] [Full Text] -
Ng, L., Goodyear, R. J., Woods, C. A., Schneider, M. J., Diamond, E., Richardson, G. P., Kelley, M. W., Germain, D. L. St., Galton, V. A., Forrest, D.
(2004). Hearing loss and retarded cochlear development in mice lacking type 2 iodothyronine deiodinase. Proc. Natl. Acad. Sci. USA
101: 3474-3479
[Abstract] [Full Text] -
Golozoubova, V., Gullberg, H., Matthias, A., Cannon, B., Vennstrom, B., Nedergaard, J.
(2004). Depressed Thermogenesis but Competent Brown Adipose Tissue Recruitment in Mice Devoid of All Hormone-Binding Thyroid Hormone Receptors. Mol. Endocrinol.
18: 384-401
[Abstract] [Full Text] -
Ruau, D., Duarte, J., Ourjdal, T., Perriere, G., Laudet, V., Robinson-Rechavi, M.
(2004). Update of NUREBASE: nuclear hormone receptor functional genomics. Nucleic Acids Res
32: D165-167
[Abstract] [Full Text] -
Manzano, J., Morte, B., Scanlan, T. S., Bernal, J.
(2003). Differential Effects of Triiodothyronine and the Thyroid Hormone Receptor {beta}-Specific Agonist GC-1 on Thyroid Hormone Target Genes in the Brain. Endocrinology
144: 5480-5487
[Abstract] [Full Text] -
Freitas, F. R. S., Moriscot, A. S., Jorgetti, V., Soares, A. G., Passarelli, M., Scanlan, T. S., Brent, G. A., Bianco, A. C., Gouveia, C. H. A.
(2003). Spared bone mass in rats treated with thyroid hormone receptor TR{beta}-selective compound GC-1. Am. J. Physiol. Endocrinol. Metab.
285: E1135-E1141
[Abstract] [Full Text] -
Stevens, D. A., Harvey, C. B., Scott, A. J., O'Shea, P. J., Barnard, J. C., Williams, A. J., Brady, G., Samarut, J., Chassande, O., Williams, G. R.
(2003). Thyroid Hormone Activates Fibroblast Growth Factor Receptor-1 in Bone. Mol. Endocrinol.
17: 1751-1766
[Abstract] [Full Text] -
Abel, E. D., Moura, E. G., Ahima, R. S., Campos-Barros, A., Pazos-Moura, C. C., Boers, M.-E., Kaulbach, H. C., Forrest, D., Wondisford, F. E.
(2003). Dominant Inhibition of Thyroid Hormone Action Selectively in the Pituitary of Thyroid Hormone Receptor-{beta} Null Mice Abolishes the Regulation of Thyrotropin by Thyroid Hormone. Mol. Endocrinol.
17: 1767-1776
[Abstract] [Full Text] -
O'Shea, P. J., Harvey, C. B., Suzuki, H., Kaneshige, M., Kaneshige, K., Cheng, S.-Y., Williams, G. R.
(2003). A Thyrotoxic Skeletal Phenotype of Advanced Bone Formation in Mice with Resistance to Thyroid Hormone. Mol. Endocrinol.
17: 1410-1424
[Abstract] [Full Text] -
Sadow, P. M., Koo, E., Chassande, O., Gauthier, K., Samarut, J., Xu, J., O'Malley, B. W., Seo, H., Murata, Y., Weiss, R. E.
(2003). Thyroid Hormone Receptor-Specific Interactions with Steroid Receptor Coactivator-1 in the Pituitary. Mol. Endocrinol.
17: 882-894
[Abstract] [Full Text] -
Sadow, P. M., Chassande, O., Gauthier, K., Samarut, J., Xu, J., O'Malley, B. W., Weiss, R. E.
(2003). Specificity of thyroid hormone receptor subtype and steroid receptor coactivator-1 on thyroid hormone action. Am. J. Physiol. Endocrinol. Metab.
284: E36-E46
[Abstract] [Full Text] -
Weiss, R. E., Korcarz, C., Chassande, O., Cua, K., Sadow, P. M., Koo, E., Samarut, J., Lang, R.
(2002). Thyroid hormone and cardiac function in mice deficient in thyroid hormone receptor-alpha or -beta : an echocardiograph study. Am. J. Physiol. Endocrinol. Metab.
283: E428-E435
[Abstract] [Full Text] -
Onda, M., Li, D., Suzuki, S., Nakamura, I., Takenoshita, S., Brogren, C.-H., Stampanoni, S., Rampino, N.
(2002). Expansion of Microsatellite in the Thyroid Hormone Receptor-{alpha}1 Gene Linked to Increased Receptor Expression and Less Aggressive Thyroid Cancer. Clin. Cancer Res.
8: 2870-2874
[Abstract] [Full Text] -
Gullberg, H., Rudling, M., Salto, C., Forrest, D., Angelin, B., Vennstrom, B.
(2002). Requirement for Thyroid Hormone Receptor {beta} in T3 Regulation of Cholesterol Metabolism in Mice. Mol. Endocrinol.
16: 1767-1777
[Abstract] [Full Text] -
Forrest, D.
(2002). Editorial: Twists in the Tail--Change-of-Function Mutations in Thyroid Hormone Receptors. Endocrinology
143: 2466-2468
[Full Text] -
Morte, B., Manzano, J., Scanlan, T., Vennstrom, B., Bernal, J.
(2002). Deletion of the thyroid hormone receptor alpha 1 prevents the structural alterations of the cerebellum induced by hypothyroidism. Proc. Natl. Acad. Sci. USA
99: 3985-3989
[Abstract] [Full Text] -
Flamant, F., Poguet, A.-L., Plateroti, M., Chassande, O., Gauthier, K., Streichenberger, N., Mansouri, A., Samarut, J.
(2002). Congenital Hypothyroid Pax8-/- Mutant Mice Can Be Rescued by Inactivating the TR{alpha} Gene. Mol. Endocrinol.
16: 24-32
[Abstract] [Full Text] -
Ng, L., Rusch, A., Amma, L. L., Nordstrom, K., Erway, L. C., Vennstrom, B., Forrest, D.
(2001). Suppression of the deafness and thyroid dysfunction in Thrb-null mice by an independent mutation in the Thra thyroid hormone receptor {alpha} gene. Hum Mol Genet
10: 2701-2708
[Abstract] [Full Text] -
Plateroti, M., Gauthier, K., Domon-Dell, C., Freund, J.-N., Samarut, J., Chassande, O.
(2001). Functional Interference between Thyroid Hormone Receptor {alpha} (TR{alpha}) and Natural Truncated TR{Delta}{alpha} Isoforms in the Control of Intestine Development. Mol. Cell. Biol.
21: 4761-4772
[Abstract] [Full Text] -
Baas, D., Legrand, C., Samarut, J., Flamant, F.
(2002). Persistence of oligodendrocyte precursor cells and altered myelination in optic nerve associated to retina degeneration in mice devoid of all thyroid hormone receptors. Proc. Natl. Acad. Sci. USA
99: 2907-2911
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»