INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

The intestinal mucosa is composed of smooth muscle and connective tissues, two mesodermal derivatives, and of epithelial tissue derived from the endoderm (18). The epithelium is characterized by continuous cell renewal from multipotent stem cells within the crypts. The epithelial cells acquire differentiated phenotypes (enterocyte, goblet, or enteroendocrine) during a vertical migration toward the villus tip, and finally they die and are exfoliated into the lumen. The Paneth cells, the other cytotype composing the intestinal epithelium, migrate to the crypt base and represent the only resident differentiated cell type of this compartment (10). Small intestine mucosal thickness depends on the rate of crypt cell division and migration as well as the lifespan of the villus cells. All these parameters change markedly during normal development and in response to various environmental, dietary, and hormonal factors (19). The enterocytes represent the most abundant cell type composing the small intestine epithelium (95% [10]), and their function in nutrient uptake and metabolism takes part in ensuring the organism's homeostasis. Their differentiation is characterized by functional polarization, i.e., the expression of digestive enzymes integrated in the apical brush border membranes (18). At weaning, the passage from milk to solid diet is characterized in rodents by a switch in the expression of lactase to various -glucosidases such as sucrase (13) and increased expression of other brush border enzymes such as alkaline phosphatase (14). Thyroid hormones have been shown to take part in the developmental processes responsible for intestinal postnatal maturation, such as the increase in the number of crypts and proliferating cells as well as the onset of the adult-type digestive enzyme expression (3, 15; reviewed in references 12 and 13). The molecular mechanisms as well as the direct regulation of these processes by the thyroid hormone remain under discussion. It has been shown that cdx1 and cdx2 homeobox genes control intestinal epithelial cell proliferation as well as the expression of enterocyte differentiated markers (reviewed in reference 8). This and a previous work (25) suggest that the thyroid hormone signaling pathway could involve these major regulators of intestinal homeostasis.

The action of T3, the active form of thyroid hormones, is mediated by its binding to thyroid hormone receptors (TR), which belong to the nuclear hormone receptor family of transcription factors (22). The activity of TRs is modulated by the T3 binding that leads to the activation or the repression of target genes (22). The TRs are encoded by two genes, TR and TR (N1RA1 and N1RA2 according to the Nuclear Receptors Nomenclature Committee [1999]) (26, 31). The TR locus encodes the TR1, TR2, and TR3 receptors and the TR3 truncated isoform, generated by different promoter usage and alternative splicing (31, 32). The TR gene has been shown to encode the T3 receptor TR1 and several other isoforms unable to bind T3 (5, 20, 21). The TR2 isoform, produced by alternative splicing of the primary transcript, retains DNA recognition capacity and can act as an antagonist of the T3 receptors, TR1, TR1, and TR2 in vitro (20). Recently, we have demonstrated that the TR gene also produces transcripts from an internal promoter located in intron 7, TR1 and TR2 (5), whose expression is restricted to a few organs including the lung and the small intestine (7). The sequences of these isoforms are identical to the C-terminal sequences of TR1 and TR2, respectively. They lack the DNA binding domain and part of the ligand binding domain, leading to their inability to bind DNA and T3. In vitro experiments showed that they can repress the transactivation activity of TR and retinoic acid receptors (5), suggesting that these truncated isoforms could act as modulators of nuclear hormone receptor activities in the tissues in which the different proteins are coexpressed. However, the molecular basis of their action as well as their physiological role is still unknown. Several in vivo studies aimed at clarifying the functions of the different isoforms encoded by the TR gene have been performed in different laboratories. By using the homologous recombination technology, we and others have generated strains of mice lacking the expression of either TR1 or both TR1 and TR2, as well as the respective double mutants combining the deletion in TR and TR genes (reviewed in reference 6). The TR^/ animals, which lack both the TR1 and TR2 isoforms but still express the TR isoforms, display growth retardation, become progressively hypothyroid by weaning time, and die thereafter. In addition, they show bone and small intestine developmental alterations (7). In contrast, TR^/ mice do not display intestinal development retardation, suggesting that TR is the only locus involved in postnatal small intestine development (25). However, as the TR^/ mice retain the expression of the TR isoforms we cannot exclude that in these animals the unbalanced expression of the TR/TR products is one of the causes of the strong phenotype observed in these animals. To investigate this possibility we have generated new TR mutant mice. The TR⁰ mutation was designed to abolish the expression of all transcripts from the TR locus (9a.). The TR⁷ mutation described here was aimed at selectively suppressing the TR transcripts while retaining the normal expression of the TR transcripts. As all TR products are expressed in the small intestine, our study focused on the morphofunctional comparative analysis between mice harboring different mutations in the TR locus. We demonstrate that (i) removing only the TR1 and TR2 products in TR^/ mice results in a severe alteration of intestinal development and function, (ii) further abolishing of the expression of the TR isoforms in TR^0/0 mice generates a milder phenotype, and (iii) specifically deleting the intronic promoter to prevent the expression of the TR isoforms in TR^7/7 mice results in an enhanced response of the epithelial cells to T3. In conclusion, these data demonstrate that the balance between the TR and TR isoforms is critical to ensure normal postnatal intestinal development.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Construction of TR-targeting vector. To construct the TR⁷ targeting vector, the 5' and 3' homology fragments were generated by PCR, using VIS/PIAS and Pr3S/RevS as primer pairs, respectively, and Expand High Fi reagent, and were successively inserted into pBSKII (Stratagene). The loxP PGKNeo^r PGKTK loxP cassette was inserted between the 5' and 3' arms in sense orientation.

Targeted disruption of TR gene. ENS embryonic stem (ES) cells were electroporated with 40 µg of linearized targeting vector and then selected with 250 µg of G418 (Gibco-BRL) per ml and 0.2 µM ganciclovir. The TR⁷ allele was obtained in two steps. Upon electroporation with the recombination vector and selection with G418, the cells containing the targeted [loxP NeoTK loxP] cassette were identified by PCR-based screening using 6S1 and pT102AS as oligonucleotide primers. Positive clones were subsequently transfected with a Cre-expressing vector. To identify clones having excised the loxP flanked selection cassette among the ganciclovir-resistant colonies, DNA was cut by PstI and submitted to Southern blot analysis, using a probe hybridizing to the 3' end of intron 7 and to exon 8. To determine the promoter activities of the 270 to +237, 114 to +237, and 51 to +237 portions of intron 7, the corresponding fragments were inserted upstream of a chloramphenicol acetyltransferase (CAT) reporter gene into a BAS-CAT vector (Promega). Cells were cotransfected with the CAT-expressing vector and a plasmid containing the beta-galactosidase gene under the control of the PGK promoter.

Animals and tissues. The small intestine was dissected from the ligament of Treitz to the rectum. We collected the first (proximal jejunum) and the last (distal ileum) fourths of the small intestine as well as the proximal part of the colon. The intestinal segments were immediately fixed for morphological analysis or frozen in liquid nitrogen and stored at 80°C until they were used for enzymatic analysis or RNA extraction.

Experimental hypothyroidism and hyperthyroidism. TH deficiency was induced in wild-type, TR^0/0, and TR^7/7 mice by a low-iodine diet supplemented with 0.15% propylthiouracil (PTU) purchased from Harlan/Teklad. The animals were treated from birth until they were sacrificed. Hyperthyroidism was induced in one-half of PTU-treated animals by daily injection of 0.25 µg of L-T3 per mouse for 2 days. For each experimental condition at least three animals per genotype were used. The levels of free T4 and T3 in serum were measured using a VIDAS enzyme-linked immunosorbent assay kit (Biomérieux).

Purification of RNAs, RNase protection assay, and RT-PCR analysis. Total RNA from intestine was isolated by the improved acid-guanidine-phenol-chloroform method. The RNase protection assay was performed as described in reference 9a.

Sequences of oligonucleotides used. All the primers are from MWG (Ebersberg, Germany) and have the following sequences: VIS, GGAGATGATTCGCTCACTGCAG; PIAS, GTCATGCTGCCTGCAGATAG; Pr3S, GGTGTGGAGAGGATGCACTGAAG; RevS, GGAGGTGGTAGAGTTTGCCAAAC; 7S, GTGTGGAGAGGATGCACTGAAGT; 6S1, GGTTCTAGATGATTCGAAGCGG; 1A, CGACTTTCATGTGGAGGAAG; 2A, CCTGAACAACATGCATTCCGA; 15A, CAGCCTGCAGCAGAGCCACTTCCGT; pT102AS, CCTCGAGCGGCCATAACTTCG.

Morphological staining and immunohistochemistry. Three-week-old mice were killed by cervical dislocation, and their small intestines were immediately removed. Proximal jejunums and distal ilea were collected separately and fixed in 4% paraformaldehyde overnight at 4°C. They were then embedded in paraffin, and 5-µm sections were applied to polylysine-coated slides. For morphological observations, after dewaxing and rehydration, the slides were stained with Schiff's reagent or hematoxylin and eosin. Immunohistochemistry experiments were performed with a monoclonal antibody (Novocastra Laboratories) for Ki67 detection in proliferating cells (27), a polyclonal PA1-211 (Affinity Bioreagents, Inc.) for TR1 and TR1 protein localization, and a polyclonal antibody recognizing the N-terminal part of both TR1 and TR2 proteins (generous gift of D. Baas [1]). These antibodies were used in combination with secondary biotinylated antibody and a streptavidin-peroxidase detection system (Histomouse; Zymed). The tissue was counterstained lightly with hematoxylin. Before incubation with the primary antibody, the slides were immersed in 0.01 M citrate buffer, pH 6, and microwaved for 15 min.

Cells, plasmids, and transfections. The Caco2-TC7 cell line (kindly gift of A. Zweibaum, Paris, France [4]) corresponds to a highly differentiated subclone of the human colonic adenocarcinoma Caco2 cell line that exhibits spontaneous enterocyte-like differentiation in culture (11). The cells were maintained in Dulbecco's modified Eagle medium (Biomedia) supplemented with 10% of heat inactivated fetal calf serum (Biomedia). The reporter pCdx1-4Luc and pCdx2-1Luc plasmids containing promoter fragments of the murine Cdx1 and Cdx2 genes have already been described (23). The plasmids containing the cDNA coding for human TR1 (pSG5hTR1), for mouse TR1 (pSG5mTR1), and for mouse TR2 (pSG5mTR2) have already been reported (5). Caco2TC7 cells have been transfected as described (23) using the Exgen transfection reagent (Euromedex). Luciferase activity was measured 48 h after transfection using the luciferase assay system (Promega).

Enzymatic activities. Sucrase and lactase enzymatic activities were measured in the purified brush border membrane as previously described (28). The samples were incubated with the appropriate substrate in 0.1-mol/liter maleate buffer (0.056 mol of sucrose per liter, pH 6.25; 0.056 mol of lactose per liter, pH 5.8), and liberated glucose was measured. Enzyme activities were expressed as milliunits per milligram of brush border protein. One unit hydrolyzes 1 mmol of substrate per min at 37°C.

Statistics. Numerical results are presented as means ± standard deviations (SD). Groups were compared using the Student t test, with P values of <0.05 considered significant.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Generation of the TR^7/7 mutant mice. To introduce the TR⁷ mutation in the TR locus (Fig. 1A), we deleted a limited portion of intron 7 in order to abolish the activity of the internal promoter. The extent of this deletion was determined after assaying the transcriptional activities of different truncated fragments of intron 7 following transfection in HeLa and ES cells (Fig. 1E). We thereby identified a 234-bp fragment whose deletion abolished 80% of the transcriptional activity in this assay and designed a vector in which this fragment was replaced by a Neo^r-TK cassette flanked by loxP sites. ES cell clones screened for homologous recombination of this construct (Fig. 1B) were transfected with a vector expressing the Cre recombinase fused to a nuclear localization signal under the control of a PGK promoter. ES cells which had excised the loxP-Neo^R-TK-loxP fragment (Fig. 1C) were selected by ganciclovir resistance and identified by Southern blot screening (Fig. 1D). Mice homozygous for the TR⁷ mutation were named TR^7/7.

View larger version (32K): [in this window] [in a new window]   FIG. 1.   Targeted mutagenesis of the TR gene by homologous recombination. (A) Structure of the TR gene. The upper arrows indicate the two transcription start sites. The differential splice site in exon 9 is indicated by a vertical bar. Exons are numbered starting downstream to the distal promoter. Grey-shaded areas represent the coding regions. Structures of the transcripts are shown at the top. (B) TR mutated locus in which the loxP Neor TK loxP cassette replaces a 257-bp fragment of intron 7. Cells expressing this construct have then been transfected with a plasmid encoding the Cre recombinase to obtain the TR7 locus. (C) Structure of the targeted allele TR7 containing a 257-bp deletion of intron 7, corresponding to the active portion of the internal promoter. The probe used for Southern blot analysis and the size of the fragment detected after digestion with PstI are indicated. (D) Southern blot analysis showing wild-type (+/+), heterozygous (+/7), and homozygous (7/7) littermates. (E) Promoter activities of the 270 to +237, 114 to +237 and 51 to +237 fragments of intron 7 have been tested in HeLa and ES cells. Results are mean values ± SD of two independent experiments conducted in duplicate.

TR

View larger version (56K): [in this window] [in a new window]   FIG. 2.   Expression of the different transcripts encoded by the TR locus in the distal ilea of wild-type and TR7/7 mutant mice. (A) An RNase protection assay was performed using RNA isolated from the distal ilea of animals carrying the indicated genotypes. The protected fragments are indicated on the left. (B) Semiquantitative RT-PCR analysis to selectively detect TR1 and TR2 mRNAs in the distal ilea of wild-type (WT) and TR7/7 mice. For the semiquantitative RT-PCR, a preliminary assay was conducted to define the appropriate range of cycles consistent with an exponential increase of the amount of the PCR products in each experimental condition. For both panels, HPRT was used as internal control.

Analysis of the TR1 and TR2 expression patterns in the intestinal mucosa. (i) mRNA expression. We performed RT-PCR analysis to evaluate the longitudinal expression of the TR truncated isoforms on separated epithelia, laminae propriae, and muscle layers of 12-day-old wild-type mice (Fig. 3A and B). TR1 mRNA is expressed in almost all tissues in each region analyzed, with a higher expression in the epithelium and lamina propria of the distal ileum and a very faint expression in the muscular layers of the distal ileum and proximal colon. These data are in agreement with the data concerning the protein immunostaining using specific antibody (see below). TR2 mRNA shows a distribution similar to that of TR1 except that the maximal expression is in the lamina propria of the proximal jejunum.

View larger version (32K): [in this window] [in a new window]   FIG. 3.   Expression of TR1 and TR2 in the gut. (A) Semiquantitative RT-PCR analysis was performed to study the longitudinal expression of the two transcripts in the different tissue compartments of 12-day-old wild-type mice. 36-B4 was used as internal control. Standard molecular masses for DNA size are in the first lane. (B) Summary of the expression pattern of the four mRNAs encoded by the TR gene in the different tissues composing the distal ileum mucosa. E, epithelium; LP, lamina propria; M, muscle; PJ, proximal jejunum; DI, distal ileum; PC, proximal colon: *, described in reference 25.

(ii) Protein expression. We used specific antisera to analyze the expression pattern of the TR locus products in mice carrying different TR mutations. Using the anti-N antiserum, which recognizes the N-terminal region common to TR1 and TR2 proteins, we observed a similar nuclear labeling in muscle layers of TR^7/7 and wild-type distal ileum (Fig. 4D and H), consistent with the unmodified mRNA expression of these two isoforms in TR^7/7 animals. In contrast, when using the anti-C1 antibody, which recognizes the C-terminal part common to TR1 and TR1 proteins, the signals in these two mouse strains were very different. While a strong nuclear signal in the differentiated epithelial cells of the villi and a fainter signal in the laminae propriae and muscle layers were detected in wild-type mice (Fig. 4J to L), no labeling was observed in TR^7/7 mice (Fig. 4N to P). The loss of staining in TR^7/7 mice definitely shows that the protein labeled by the anti-C1 reagent in wild-type mice is TR1. These data also demonstrate that even though a small amount of TR1 mRNA can be revealed by RNase protection assay in the distal ilea of TR^7/7 mice, the amount of TR1 protein is strongly reduced to below the detection limit. Using specific antibodies against TR2 and TR2 proteins, we could not reveal any staining (not shown). Table 1 summarizes the data concerning the expression of the proteins produced by the TR locus in the intestinal mucosae of mice with different mutations in the TR gene.

View larger version (99K): [in this window] [in a new window]   FIG. 4.   Immunolocalization of TR1/TR2 and TR1 proteins. We analyzed the expression patterns of TR and TR1 proteins on distal ileum paraffin-embedded sections (5 µm) of wild-type (A through D and I through L) and TR7/7 (E through H and M through P) intestines from 3-week-old mice. Two different antibodies were used, one (anti-N) recognizing the N-terminal part common to TR1 and TR2 on wild-type (A through D) and TR7/7 (E through H) mouse tissues and the other (anti-C1) recognizing the C-terminal part common to TR1 and TR1 on wild-type (I through L) and TR7/7 (M through P) mouse tissues. Technical controls included the use of phosphate-buffered saline or the antibody preincubated with an excess of the recognized peptide. Phase contrast low magnification (A, E, I, M) bar, 30 µm; bright field high magnification (B to D, F to H, J to L, N to P) bar, 70 µm; ce, crypt epithelium; ve, villus epithelium; ct, connective tissue; cml, circular muscle layer; 1ml, longitudinal muscle layer. The open arrow in K indicates the stronger nuclear staining of epithelial cells above the crypt-villus junction.

View this table: [in this window] [in a new window]   TABLE 1.   Expression of the TR isoforms in the different tissues composing the distal small intestine mucosa

Morphological and functional parameters of the small intestine are more affected in TR^/ mice than in TR^0/0 and TR^7/7 mice. It has previously been shown that the morphology of the small intestine, the proliferation of crypt epithelial cells, and their differentiation were altered in mice lacking TR1 and TR2 expression (TR^/) and that this impairment was more severe in the distal part of the small intestine (25). Interestingly, mice lacking the expression of all the products of the TR locus (TR^0/0) display a milder alteration of the intestinal mucosa than the TR^/ mice (9a). In order to determine the molecular basis of these differences, we examined morphofunctional parameters in the distal small intestines of TR^0/0 and TR^7/7 mice and compared them to those described for wild-type and TR^/ mice.

(i) Morphology. As shown in Fig. 5, the thickness of the mucosa in TR^0/0 mice was decreased compared to that of wild-type mice (Fig. 5B versus A), with a reduction of the villus height, resulting from a reduction of the number of epithelial cells per crypt-villus axis. This phenotype was milder than but comparable to the one observed in the TR^/ ileum (Fig. 5C). No obvious morphological alteration was observed in the TR^7/7 distal ileum (Fig. 5D) compared to that of the wild type. A previous study described a decreased number of goblet cells in the distal ileum of 3-week-old TR^/ mice compared to the wild type (25). In order to investigate whether the other TR mutants also show this alteration, we determined the number of mucus-producing goblet cells stained by Schiff's reagent as previously described (25). The TR^/ and TR^0/0 mice show similar significant decreases in the number of goblet cells compared to that of the wild type (TR^/, 4 ± 1 [mean ± SD]; TR^0/0, 6 ± 1; wild type, 14 ± 2); in contrast, the TR^7/7 mice displayed an increased amount (20 ± 3) statistically significantly different from that of the wild type (P < 0.05). The Paneth cells, a differentiated epithelial cytotype located in the intestinal crypts, displayed no altered proportions as demonstrated by specific staining or morphological criteria (data not shown).

View larger version (60K): [in this window] [in a new window]   FIG. 5.   (A through D) Morphological appearance of distal small intestine in 3-week-old animals. Five-micrometer histological sections of wild-type (A), TR0/0 (B), TR/ (C), and TR7/7 (D) mice were stained with hematoxylin and eosin. Bar, 30 µm. The numbers at the right of each picture indicate the number of epithelial cells per crypt-villus axis. (E) Analysis of proliferation of epithelial cells. The number of proliferating cells per crypt was evaluated after immunolabeling of cells expressing Ki67 antigen on distal ileum paraffin-embedded sections (5 µm). The Student t test indicated that in TR0/0 and TR/ mice the number of Ki67-positive cells is significantly decreased compared to the number in wild-type animals. For each pair a P value of <0.0001 (***) was obtained (n = 15). (F) Functional analysis of the differentiation markers of small intestine epithelial cells. Lactase and sucrase brush border activities were analyzed at the proximal jejunum level in 3-week-old wild-type and mutant animals. Enzymatic activities are represented as percentages of the respective wild-type levels. Statistical analysis was performed using the Student t test by comparing each group of mutant animals and the control. *, P < 0.05; **, P < 0.001 (n = 4).

(ii) Epithelial proliferation. We then checked the effects of the TR mutations on cell proliferation by determining the number of Ki67-positive cells per crypt (Fig. 5E). In TR^0/0 mice the number of Ki67-positive cells was significantly reduced, consistent with the reduction in the number of cells per axis described above. This decrease was more important in TR^/ mice. The proliferation in TR^7/7 mice was also slightly decreased, although this difference did not reach statistical significance compared to wild-type mice. This is consistent with the absence of obvious intestinal morphological alteration in TR^7/7 mice.

(iii) Epithelial differentiation. In order to analyze whether the functional polarization typical of differentiated enterocytes and the ontogenetic rise in sucrase expression occurring in mature enterocytes at weaning were affected by the different mutations of the TR gene, we measured the enzymatic activities of lactase and sucrase in 3-week-old mutant mice (Fig. 5F). This study was conducted on brush border preparations from the proximal jejunal epithelium, as these enzymes are mainly expressed in this region of the small intestine (13). In TR^0/0 mice, both enzymatic activities were moderately decreased. In TR^/ mice, the reduction of both activities was more dramatic. Interestingly, in TR^7/7 mice the lactase activity was not affected but the sucrase activity was considerably decreased, to less than 35% of that of the wild type.

/

TR

cdx1 and cdx2 gene expression is controlled by the TR isoforms. In an attempt to identify the molecular mechanisms responsible for the impaired proliferation and differentiation of the epithelial cells in TR mutant mice, we examined the levels of expression of the Cdx1 and Cdx2 transcripts, which encode key homeoproteins involved in the control of intestinal epithelium homeostasis (reviewed in reference 8). The amounts of Cdx1 and Cdx2 mRNAs were estimated by semiquantitative RT-PCR analysis along the proximodistal intestinal axis. Figure 6A and a previous report (25) show that the increasing gradient of expression of these genes along the proximodistal axis is maintained in mice of each genotype. Moreover, the amounts of both transcripts were specifically decreased in each region of TR^/ mice but unchanged in TR^0/0 and TR^7/7 mice compared to the amounts in wild-type mice. These data suggest that the TR products, which are still expressed in TR^/ mice, could have a negative regulatory role on the transcription of the cdx genes in the absence of TR1. To challenge this assumption, we investigated the effects of TR1 and TR2 products on the activities of the cdx1 and cdx2 promoters by transient transfection assays in the human colonic cell line Caco2-TC7, using 5' regulatory regions previously described (23). Figure 6 shows that both TR1 and TR2 repressed the activities of the cdx1 (Fig. 6B) and cdx2 (Fig. 6D) promoters in a dose-dependent manner. TR1 did not affect the activity of a mouse -actin promoter in Caco2-TC7 cells (data not shown) and has been previously shown to have no effect on various promoters in HeLa cells (5). TR2 repressed the -actin promoter activity by 50% when 1 µg of vector was transfected. TR2 has previously been shown to exert transcriptional inhibition towards several promoters (5). Therefore, we assume that while the specificity of the TR1 isoform appears tight, TR2 can inhibit a wider spectrum of promoters. However, since TR1 but not TR2 was detected in the epithelium of distal ilea of wild-type and TR^/ mice, this protein is likely to be responsible for the decreased levels of cdx transcripts observed in mutant mice. In vivo, the amount of cdx transcripts is reduced in TR^/ mice, which lack the TR1 and TR2 isoforms. We have shown that TR1 accelerated the degradation of the TR1 protein in transfected HeLa cells (9a). We examined whether the expression of TR1 in Caco2-TC7 cells was able to counteract the activity of the TR isoforms. In the absence of T3, TR1 did not affect the activity of the cdx1 promoter but inhibited the cdx2 promoter by 60% (Fig. 6C and E). The addition of T3 resulted in a slightly increased activity of the cdx1 promoter and did not affect the cdx2 promoter activity (data not shown). Remarkably, TR1 in the absence (Fig. 6C) or in the presence (data not shown) of T3 partly alleviated the repression exerted by TR1 and TR2 on the activity of the cdx1 promoter. The coexpression of TR1 and TR1 or TR2 resulted in the alleviation of the inhibitory activity of each product taken separately and led to at least partial restoration of full transcriptional activity of the cdx2 promoter (Fig. 6E). The TR2 cotransfection did not modify the inhibitory activity of the TR isoforms on the cdx promoters (data not shown). The modulation of the activity of the TR products by TR1 in transient transfection assays is consistent with the decreased levels of Cdx transcripts observed in vivo in the absence of TRs in TR^/ mice (Fig. 6A). We conclude that transfection experiments and in vivo observations support the existence of reciprocal interactions between TR products and the TR1 protein. We propose that TR products can alter the transcription of specific genes when they are not "buffered" by TR1.

View larger version (36K): [in this window] [in a new window]   FIG. 6.   Expression and transcriptional regulation of cdx1 and cdx2 homeobox genes. (A) Representative results of RT-PCR analysis of cdx1 and cdx2 gene expression along the intestinal proximo-distal axis of knockout and wild-type (WT) animals. 36-B4 was used as an internal control. (B) Relative levels of luciferase activity triggered by the cdx1 promoter (1 µg of the pCdx1-4luc plasmid) in Caco2-TC7 cells cotransfected with increasing amounts of the expression vector pSG5mTR1 or pSG5mTR2 (10 ng, 100 ng, and 1 µg). (C) Relative levels of luciferase activity triggered by the cdx1 promoter as in panel B in Caco2-TC7 cells cotransfected or not with 900 ng of the expression vector pSG5hTR1 and 100 ng of either the pSG5mTR1 or the pSG5mTR2 plasmid. (D) Relative levels of luciferase activity triggered by the cdx2 promoter (1 µg of the pCdx2-1luc plasmid) in Caco2-TC7 cells cotransfected with increasing amounts of the expression vector pSG5mTR1 or pSG5mTR2 (10 ng, 100 ng, and 1 µg). (E) Relative levels of luciferase activity triggered by the cdx2 promoter as in panel D in Caco2-TC7 cells cotransfected or not with 900 ng of the expression vector pSG5hTR1 and 100 ng of either the pSG5mTR1 or the pSG5mTR2 plasmid. The cells were transiently transfected with a total of 2 µg of DNA/well; when necessary, the empty vector pSG5 was added. Cells were lysed 48 h after transfection. Results are mean values ± SD of three independent experiments conducted in triplicate.

TR products control responsiveness to T3. We have shown that the TR^0/0 animals displayed a decreased number of proliferating crypt cells and that TR^7/7 mice had a lower sucrase activity than did the wild type. To check whether altered T3 responsiveness could account for these phenotypes, we analyzed several morphological and functional parameters in wild-type, TR^0/0, and TR^7/7 mice in which experimental hypothyroidism or hyperthyroidism had been induced. Wild-type and TR^7/7 animals following a low-iodine diet supplemented with PTU (hypothyroid) displayed a reduction of the mucosa thickness related to a reduction of the crypt-villus height. This correlates with a decrease in the number of the epithelial cells per crypt-villus axis compared to the respective euthyroid 3-week-old mice (data not shown). It is noteworthy that hypothyroid TR^0/0 animals displayed the same morphological appearance as euthyroid animals of the same age. Indeed, the number of epithelial cells was not significantly decreased in TR^0/0 hypothyroid animals compared to that in euthyroid animals (data not shown). Upon administration of T3, which induced a hyperthyroid status, the number of epithelial cells did not change significantly in any of the strains analyzed. This is not surprising as the complete renewal of the epithelium is accomplished in 3 to 4 days (10), whereas T3 was administered only 48 h before the animals were sacrificed. Instead, we measured the number of proliferating crypt cells in the same experimental conditions (Fig. 7C). It is worth noting that hypothyroidism strongly reduced the numbers of proliferating cells in wild-type and TR^7/7 mice but was ineffective in TR^0/0 mice compared to euthyroid animals of the corresponding genotypes (Fig. 7C). Administration of T3 stimulated the proliferation in wild-type but not in TR^0/0 mice despite higher levels of serum T3 (Fig. 7B), demonstrating that the proliferative response to T3 is mediated by the TR1 receptor. Surprisingly, T3-induced stimulation of proliferation was much larger in TR^7/7 mice (threefold increase) than in wild-type animals (twofold increase), although similar blood concentrations of T3 were measured in both sets of mice (Fig. 7B). In order to check whether the hypothyroid or hyperthyroid status modified TR1 and TR2 mRNA expression in wild-type and TR^7/7 animals, we quantified the relative abundance of the two mRNAs by RNase protection assay and densitometric analysis in both strains (Fig. 7A and B). The results clearly indicate that the relative amounts of TR1 and TR2 were not dependent on the thyroid hormone status.

View larger version (29K): [in this window] [in a new window]   FIG. 7.   Effects of hypothyroidism and hyperthyroidism induction on the small intestine. (A) Analysis of TR1 and TR2 expression by RNase protection assay on wild-type and TR7/7 hypothyroid and hyperthyroid animals. The protected fragments are indicated on the left; HPRT was used as internal control. (B) Free T3 (FT3) blood concentrations (in picomoles per liter) in hypothyroid, euthyroid, and hyperthyroid animals of the indicated genotypes and densitometric analysis of the protected bands in the RNase protection assay. The study was performed to quantify the relative amounts of TR1 and TR2 in animals of different thyroid hormone statuses. Results are mean values ± SD; n = 3 or 4. ND*, not determined. The total T3 concentration has been shown not to be different in TR0/0 and wild-type mice (24). (C) Analysis of epithelial proliferation. The numbers of proliferating cells per crypt in hypothyroid and hyperthyroid animals were evaluated after immunolabeling of cells expressing Ki67 antigen on distal ileum paraffin-embedded sections (5 µm). The Student t test indicated that in TR7/7 T3-treated animals the number of proliferating cells was significantly increased compared to that in wild-type T3-treated animals. **, P < 0.001.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Thyroid hormone has long been suggested to be a regulator of the intestine developmental changes occurring at weaning (reviewed in reference 13). Indeed, the thyroid hormone-dependent intestinal remodeling during amphibian metamorphosis is well characterized (17, 29). The actions of the thyroid hormones are mediated by the TRs acting as transcription factors. Previous work and our more recent findings have led to the identification of four transcripts generated by the TR locus. As all the isoforms produced by the TR locus are expressed in the intestine, we analyzed morphofunctional parameters of this organ in mice with different TR gene mutations. This enabled us to assign specific functions to the different TR products. We demonstrated that the TR1 receptor mediates the T3-dependent functions in the small intestine. We provide genetic evidence for the functions exercised by the TR products in the postnatal intestinal development as well as in the control of T3 responsiveness.

The unbalanced expression of TR and TR products accounts for the strong intestinal phenotype of TR^/ mutants. It has been shown that in TR^/ mice the expression of the TR transcripts was maintained in the absence of the TR transcripts and that severe alterations occurred, particularly in the distal small intestine (25). The intestinal phenotype is characterized by impairment of cell proliferation and differentiation, associated with the downregulation of cdx1 and cdx2 homeobox gene expression. In contrast, in the TR^0/0 mice, which lack all TR and TR isoforms, only the proliferation of the epithelial cells is affected. These data establish that the TR and the TR⁰ mutations generate very different phenotypes. Theoretically, the severity of the phenotype in TR^/ mice could be attributed either to the low concentration of thyroid hormones associated with this mutation (7) or to the unbalanced expression of the TR and TR products. The former hypothesis can be definitely ruled out since intestinal impairment is already observed in 2-week-old TR^/ mice which retain normal TH concentrations at this preweaning age (25). Ruling out the difference in the thyroid hormone status as the factor accounting for the discrepancies between the phenotypes observed in TR^/ and TR^0/0 mice implies that the cause must be the altered balance between the TR and TR products of the TR locus.

TR1 mediates T3-dependent functions in intestinal epithelial cells. The data reported in the present study clearly show that the proliferation of epithelial cells in the crypts of the small intestine, which was shown to be enhanced at weaning (30, 33), is modulated by T3 through a TR1-dependent pathway. The further deletion of the TR genes does not worsen this phenotype (9a), demonstrating that it is exclusively mediated by the TR1 receptor. Moreover, the experiment of induced hypothyroidism and hyperthyroidism in TR^0/0 mice confirms that TR1 is the only receptor which mediates the T3-dependent control of crypt cell proliferation, at least during the weaning period. We also showed that the numbers of mucus-producing goblet cells are decreased in similar proportions in TR^/ and TR^0/0 animals, indicating that the TR1 receptor is indeed involved in the previously described role of T3 on goblet cell maturation (2). Finally, we show that in TR^0/0 mice the epithelial differentiation is slightly but not significantly impaired, suggesting that the T3-TR1 pathway is not a major regulator of intestinal epithelial differentiation.

Functional interference between TR1 and TR isoforms. In TR^7/7 mice, the levels of expression of the TR1 and TR2 transcripts are unchanged, but the production levels of TR1 and TR2 transcripts and of the TR1 protein are reduced. Despite the persistence of small amounts of TR transcripts, a clear alteration in the intestinal epithelium is observed in these mice. This emphasizes the physiological importance of these proteins in wild-type animals. The enhancement of T3-stimulated proliferation as well as the increase in the number of goblet cells in untreated TR^7/7 mice compared to wild-type mice suggests that TR products down modulate the activity of T3. Since we have shown that the proliferation of crypt epithelial cells and the goblet cell maturation depend on T3-TR1, this implies that TR products regulate the activity of TR1, in agreement with our previous observations in transient transfection experiments (5). Another striking feature of TR^7/7 mice is the low specific activity of sucrase. In contrast to what is observed with TR^/ mice, this is not the consequence of an impaired differentiation since lactase activity (this paper) and the number of sucrase-expressing cells, as assessed by immunohistochemical staining using antisucrase antisera (our unpublished data), are not affected in TR^7/7 mice. Instead, it may reflect a delay in the maturation process at weaning. The colocalization of the TR1 and sucrase proteins in the epithelial cells (13) of the villi in wild-type mice is consistent with a potential regulatory effect of TR isoforms on sucrase gene expression. Since no significant reduction of sucrase activity is observed in the small intestines of TR^0/0 mice, lacking not only TR but also TR products, the down-regulation of sucrase expression observed in TR^7/7 mice is not due to an autonomous activity of TR isoforms but might be the result of interference with the other TR gene products, although the mechanisms involved are unknown. Altogether, our data support the assumption that TR products modulate the activity of TR proteins in vivo and that this modulation is essential to ensure the normal maturation of the small intestine.

Genetic and biochemical evidence for TR functions. TR^0/0 mice, which have lost both the TR and TR genes, do not exhibit the very severe phenotype shown by TR^/ mice. We conclude that this phenotype is the consequence of the unbalanced expression of the TR versus the TR gene in TR^/ mutants. We have demonstrated that the stability of the TR1 protein is negatively controlled by the 1 receptor (9a), and that the inhibitory activity of TR1 over the transcription of the cdx1 and cdx2 promoters was alleviated by the expression of TR1. This suggests that, when TR1 is present, the amount and hence the activity of TR1 are blunted. In contrast, in the absence of the 1 receptor (i.e., in TR^/ mice), the stability and thus the amount of TR1 protein are increased, leading to deleterious effects. Careful examination of the expression pattern of the TR1 protein in the intestinal epithelium supports this assumption. In wild-type mice, this protein is detected as a faint signal in the crypts compared to the stronger staining in the villi. In TR^/ mice, the staining reaches the same intensity in both compartments, revealing increased amounts of the TR1 protein in the crypts of these animals compared to amounts in the wild type. In striking correlation with this altered expression pattern, the cell proliferation in crypts and their further differentiation are obviated in TR^/ mice. Interestingly, in vitro and in vivo in the absence of TR1, the products of the TR genes can repress the transcription of cdx1 and cdx2, two genes which control intestinal cell proliferation and differentiation (8). The molecular mechanisms of such repression are not yet clear. The TR products may act on the cdx promoters or may interfere in vivo with other nuclear receptors such as retinoic acid receptors, as suggested by transfection experiments (5; our unpublished observations) and by the direct activation of the cdx1 promoter by retinoic acid (16). They may, however, also affect other signaling pathways.

TR

TR