Using an immobilized template assay, we observed two steps in
assembly of the yeast RNA polymerase I (Pol I) preinitiation complex:
stable binding of upstream activating factor (UAF) followed by
recruitment of Pol I-Rrn3p and core factor (CF). Pol I is required for
stable association of CF with the promoter and can be recruited in the
absence of Rrn3p. Upon transcription initiation, Pol I-Rrn3p and CF
dissociate from the promoter while UAF remains behind. These findings
support a novel model in which the Pol I basal machinery cycles on and
off the promoter with each round of transcription. This model accounts
for previous observations that rRNA synthesis may be controlled by
regulating both promoter accessibility and polymerase activity.
 |
INTRODUCTION |
Transcription of the rRNA genes in
the yeast Saccharomyces cerevisiae requires the TATA binding
protein (TBP), Rrn3p, and three multiprotein complexes: upstream
activating factor (UAF), core factor (CF), and RNA polymerase I (Pol
I). Their arrangement within the ribosomal gene preinitiation complex
(PIC) is shown schematically in Fig. 1.
CF contains three polypeptides, Rrn6p, Rrn7p, and Rrn11p (16, 17,
18), binds to the core promoter element, and is able to direct a
basal level of Pol I transcription. UAF interacts with the upstream
promoter element and is a complex of six polypeptides including Rrn5p,
Rrn9p, Rrn10p, the two histones H3 and H4, and an uncharacterized p30
(13, 15). UAF is not absolutely required for specific
initiation but stimulates CF-directed transcription both in vivo and in
vitro. Although TBP is required for Pol I transcription (6,
32), its function remains unclear. An in vitro system
reconstituted from purified components was shown to direct specific
initiation by Pol I in the apparent absence of either UAF or TBP
(14). On the other hand, TBP interacts with both UAF and
CF in vitro (18, 34) and is essential for transcription
activation in vivo (35).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1.
Immobilized templates and experimental design. The WT
template contains yeast rDNA sequence from 200 to +41 relative to the
site of transcription initiation (indicated by an arrow). The upstream
promoter element (upe) and core promoter element (core) are shown by
open boxes; vector DNA is shown as a thick line. Template  42 has a
deletion extending from 200 to 42, while template  2 has a
further deletion extending to 2. All templates are shown attached to
a Dynal magnetic bead. In control experiments (data not shown), the
 42 template had the same transcription activity whether or not it
was beaded. Thus, at this distance the bead does not interfere with
factor binding.
|
|
Pol I, the largest component of the system, consists of 14 polypeptides
(5, 11) and has been shown to exist in two forms (19): one population which contains an additional
polypeptide, Rrn3p (37), and a larger fraction which lacks
Rrn3p. Only the Rrn3p-containing fraction is capable of
promoter-specific transcription. Rrn3p dissociates from Pol I during
transcription and is not associated with Pol I in extracts from cells
grown to stationary phase (19). These results suggest that
Rrn3p regulates rRNA production by reversible association with the polymerase.
A homolog of yeast Rrn3p has been identified and cloned from human
cells (21). Remarkably, human Rrn3p functions at nearly wild-type (WT) levels when expressed in yeast, indicating that its
function has been strongly conserved in evolution. By several criteria,
human Rrn3p was proposed to be the same as transcription initiation
factor IA (TIF-IA) (3, 21), a Pol I regulatory factor
previously purified from mouse and human cells (30, 31). Recently it has been shown that Rrn3p interacts both genetically and
biochemically with the Rpa43p subunit of Pol I as well as with the
Rrn6p subunit of CF (25). These interactions suggest that
Rrn3p may act as a bridge between Pol I and CF to promote productive
integration of Pol I into the PIC.
In this paper we have used in vitro transcription on immobilized
templates to explore the roles of UAF, CF, Pol I, and Rrn3p in PIC
formation and to examine the fate of these factors upon initiation of
transcription. Contrary to our expectation, we found that Pol I can be
recruited to the promoter in the absence of Rrn3p; however, PICs formed
by this route are transcriptionally inactive. We also found that CF is
not recruited to the PIC in the absence of Pol I, suggesting that Pol I
is required for its stable association. Most surprising, we found that
CF and TBP are released from the PIC upon transcription initiation,
along with Pol I and Rrn3p. Based on these results we propose a model in which Pol I-Rrn3p, CF, and TBP cycle on and off the promoter with
each round of transcription.
 |
MATERIALS AND METHODS |
Yeast strains.
Except as noted, strain W303-1a (with the
rad5 mutation repaired [40]) and its
derivatives were the source of all transcription extracts. For
immunodetection of CF (Rrn7p, Rrn11p), UAF (Rrn5p, Rrn9p), Pol I
(Rpa43p, Rpa34p, or Rpa135p) or Rrn3p, a separate W303-1a derivative
was created in which the relevant open reading frame was tagged at the
C terminus with a triple FLAG epitope tag by using homologous
recombination (9). The WT (RRN3) strain used
was RLY302 (rrn3::HIS3) carrying a 2µm
plasmid expressing polyomavirus and FLAG epitope-tagged Rrn3p from its
own promoter (plasmid yPyWT) (see Fig. 3). The RRN3ts strain is the
same except that the plasmid-expressed Rrn3p carries a
temperature-sensitive mutation (L143P). The strains RLY302
(RRN3), RRN3ts, and RLY303 (
RRN3) have been
described previously (21). RPA190 was deleted by
replacement of the entire open reading frame with LEU2 in strains carrying FLAG epitope-tagged versions of either RRN3, RRN7,
or RRN9. Strains with RRN7 or RRN5
deleted as well as a strain carrying a temperature-sensitive mutation
in RPA190 have been previously described (2).
Note that strains deleted for essential Pol I transcription factors all
contain a multicopy plasmid, pNOY103, which produces rRNA under control
of a galactose-dependent RNA polymerase II promoter (GAL7 promoter)
(23).
Immobilized template preparation and purification of Rrn3p.
Templates were prepared by PCR using a 5'-biotinylated primer, PCRITA5B
(5'CGCCAGGGTTTTCCCAGTCAC3') and a nonbiotinylated primer,
PCRITA3 (5'CTTTACACTTTATGCTTCCGGCTC3'). Templates for PCR,
pUCWT, pUC
-42, and pUC
-2 have been described elsewhere (2). Biotinylated templates were purified with an S-300
spin column (Pharmacia) and attached to Dynal magnetic beads
essentially as described elsewhere (26). Immobilized
templates were stored in transcription buffer at a concentration of 30 ng of DNA/µl.
Yeast Rrn3p was purified from a
RPA190 strain expressing
FLAG-tagged Rrn3p (see Fig. 3). An S-100 whole-cell extract was loaded
onto a column of DEAE-Sepharose CL6B (Pharmacia), washed with two bed
volumes of CB100 (18), and eluted with CB400. Fractions showing maximum transcription activity when mixed with a
RRN3 extract were further purified by binding to
anti-FLAG affinity resin and elution with FLAG peptide.
In vitro transcription using an immobilized template.
Yeast
whole-cell transcription extracts were prepared as described previously
(2). Extracts from strains with temperature-sensitive transcription factors were not heat treated, since experience has shown
that most temperature-sensitive factors are inactive in extracts (for
example, see reference 32). Extracts were titrated to
determine the amount of extract yielding the maximum level of specific
Pol I transcription activity. In a typical reaction mixture, 30 to 45 µg of extract was incubated in 50 µl of YTB (20 mM HEPES [pH
7.9], 5 mM MgCl2, 100 mM KCl, 5 mM EGTA, 0.05 mM EDTA, 2.5 mM dithiothreitol, 10% glycerol, 0.5% Tween 20, 10 µg of
-amanitin/ml, and 10 µg of plasmid pUC19/ml as nonspecific competitor). After 10 min at 25°C, 0.5 µl of immobilized template (15 ng of DNA) was added and incubated for a further 45 min with gentle
agitation to prevent settling of the beads. Transcription was initiated
by addition of nucleoside triphosphates (NTPs) to concentrations of
0.25 mM each. Alternatively, templates were washed three times with 300 µl of YTB by magnetic concentration and resuspension followed by
suspension in 50 µl of YTB with NTPs. Transcription was stopped after
15 to 20 min by addition of 250 µl of stop mix (0.1 M sodium acetate,
10 mM EDTA, 10 µg of tRNA/ml), extraction with phenol-chloroform, and
ethanol precipitation. RNA products were analyzed by primer extension
as described at the Hahn Laboratory website
(http://www.fhcrc.org/labs/hahn/), using oligonucleotide PR75
(5'ATGACCATGATTACGCCAAG3').
Western blotting.
To analyze proteins bound to immobilized
templates or released during transcription, standard transcription
reaction mixtures were scaled up twofold. After incubation for 45 min,
immobilized templates were washed four times with 300 µl of YTB,
suspended in 20 µl of sodium dodecyl sulfate (SDS) loading buffer,
boiled 5 min, and resolved by electrophoresis on SDS-4 to 12%
polyacrylamide gels (Novex). For proteins released during
transcription, PICs were formed and washed by the standard
preincubation protocol. Transcription was then initiated by suspension
of templates in 15 µl of YTB supplemented with NTPs. After incubation
for 15 min at 25°C, the factors released to the supernatant were
separated from the factors that remained on the template by using a
magnetic concentrator. Released and bound fractions were resuspended in the same volume of the SDS loading buffer and resolved by gel electrophoresis. Resolved proteins were transferred to nitrocellulose and detected by luminescence (Pierce ECL kit). Monoclonal antibody M2
(Sigma) used to detect the FLAG epitope, and polyclonal antibodies raised in rabbits were used to detect either TBP (18) or
the Rpa190p.
 |
RESULTS |
Formation of the Pol I PIC is promoter dependent.
To study the
role of Pol I transcription factors in PIC formation, we have developed
an in vitro transcription system using immobilized templates coupled to
magnetic beads. The basic protocol outlined in Fig. 1 is similar to one
previously used to study initiation by RNA polymerase II (26, 38,
39). Also shown in Fig. 1 are the three DNA templates used in
this study. The WT template contains the yeast ribosomal DNA (rDNA)
promoter region from
200 to +41 relative to the site of transcription
initiation that is flanked by vector DNA. These sequences include both
the upstream and core promoter elements. Also shown in Fig. 1 are two
mutant templates used as specificity controls to monitor PIC formation
and transcription initiation. The 
42 template is similar to the WT
template except that the upstream promoter element has been removed by
deletion of the
200 to
42 region, eliminating the binding site for
UAF. The 
2 template has been further deleted to position
2,
removing both the upsteam and core promoter elements.
We monitored PIC formation and compared the transcription activity of
all three templates (Fig. 2). Immobilized
templates were incubated with WT whole-cell extract for 45 min, the
time required for maximal complex assembly (data not shown).
Immobilized PICs were then washed and either subjected to Western blot
analysis to determine their protein composition or were resuspended in buffer with NTPs to measure their ability to direct Pol I initiation. As shown in Fig. 2, PICs formed on the WT template support high levels
of transcription and contain the full complement of transcription factors, including UAF (Rrn5p and Rrn9p), CF (Rrn7p and Rrn11p), TBP,
Pol I (Rpa43p and Rpa34p), and Rrn3p. PICs formed on the 
42
template contain all of the Pol I machinery except UAF and support a
much-reduced level of transcription. PICs formed on the 
2 template
are transcriptionally inactive and contain none of the Pol I factors
except for trace amounts of Pol I and TBP. This residual binding most
likely reflects the ability of both factors to bind DNA
nonspecifically.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 2.
PIC formation is promoter dependent. PICs were formed by
incubation of WT whole-cell extracts with immobilized templates (either
WT,  42, or  2) for 45 min. PICs were then washed and analyzed
either for specific Pol I transcription (by addition of NTPs followed
by primer extension) or for bound proteins (by Western blotting).
|
|
We also asked if the system supports single- or multiple-round
transcription. PICs were formed on the WT template by preincubation in
extract without NTPs for 45 min and then split into two portions. Triphosphates were added to one portion to initiate transcription, while the other portion was washed before triphosphate addition. The
same level of transcription was obtained from either washed or unwashed
complexes (data not shown), and in both cases maximal transcription was
obtained within 5 min of triphosphate addition. These data indicate
that our system supports one or at most a few rounds of transcription
and establish that PIC formation under these conditions is promoter dependent.
Role of Rrn3 in PIC formation and transcription.
Rrn3p is
essential for specific initiation by Pol I (37), and it
has been shown to interact with both the Pol I subunit Rpa43p and CF
subunit Rrn6p (25). Because these data suggest that Rrn3p
may facilitate Pol I recruitment by mediating its interactions with
promoter-bound CF, we wished to examine the role of Rrn3p in PIC
formation. PICs were formed on either WT or 
2 templates by using
extracts made from either a WT strain (RRN3), a strain carrying a temperature-sensitive mutant of RRN3 (RRN3ts), or
a strain in which the RRN3 gene is deleted
(
RRN3) (21). After the PICs were washed,
they were examined for the presence of Rrn3p, Pol I (Rpa190p), and TBP
by Western blotting (Fig. 3A). As
expected, all three factors were present in PICs formed using WT
extract on a WT template (lane 1) but were not observed on the 
2
control template (lane 2). To our surprise, Pol I was recruited in the absence of Rrn3p when either the RRN3ts extract (lane 3) or the
RRN3 extract (lane 5) was assayed. The RRN3ts extract is
transcriptionally inactive (Fig. 3C, lanes 8 and 11) even though the
inactive Rrn3p is still present, as revealed by Western blotting
(reference 21 and data not shown). However, activity can be rescued by
adding either purified yeast Rrn3p (lane 12) or by adding extracts
specifically deficient for either Pol I (lane 2), Rrn7p (lane 9), or
Rrn5p (lane 10) activities (these extracts rescue activity because they all presumably contain active Rrn3p). Similar transcription
complementation results were also observed when using the
RRN3 extract (data not shown).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 3.
Pol I is recruited in the absence of Rrn3p. (A) PIC
formation in the absence of Rrn3p. PICs were formed on either WT or
 2 templates in extract containing WT Rrn3p (RRN3, lanes 1 and 2),
temperature-sensitive Rrn3p (RRN3ts, lanes 3 and 4), or in an extract
lacking Rrn3p ( RRN3, lanes 5 and 6). After washing, bound proteins
were detected by Western blotting. (B) Rescue of transcription activity
on PICs lacking Rrn3p. PICs were formed on WT template by incubation
with 2 µl of the RRN3ts extract for 45 min. After washing, PICs were
incubated either with buffer alone (lanes 2 and 11), a WT extract (2 µl; lane 1), an RPA190ts extract (1, 2, and 4 µl; lanes 3 to 5),
affinity-purified yeast Rrn3p (1, 2, and 4 µl; lanes 6 to 8), a
RPA190 extract (0.5, 1, and 2 µl; lanes 12 to 14), a
RRN7 extract (2 µl; lanes 9 and 15) or a
RRN5 extract (5 µl; lanes 10 and 16). Second
incubations were also for 45 min followed by washing and resuspension
in YTB with NTPs. After 15 min of incubation, transcripts were assayed
by primer extension. Partial rescue was obtained with a second extract
containing both Pol I and Rrn3p ( RRN7; lanes 9 and 15),
while an extract containing Pol I, Rrn3p, and CF ( RRN5;
lanes 10 and 16) rescued fully. (C) Complementation activity of mutant
extracts. Extracts were premixed and incubated for 10 min before
addition of template. The WT template was added and incubation
continued for 45 min followed by NTP addition. Transcription was
stopped after 30 min and assayed by primer extension. Volumes of
extracts tested were as follows: RPA190, 0.5 µl;
RRN3ts, 2 µl; RRN7, 2 µl; RRN5, 5 µl;
yRrn3p, 2 µl.
|
|
The data in Fig. 3A show that Rrn3p is not required for recruitment of
Pol I to the PIC, even though it is required for initiation of
transcription by Pol I. To address its requirement for PIC activity, we
attempted to restore transcription activity of PICs formed in the
RRN3ts extract by addition of purified Rrn3p. As shown in Fig. 3B, PICs
were formed by incubating the WT template in RRN3ts extract for 45 min
and subsequently washing and incubating it with either purified Rrn3p
or various mutant extracts. After the second incubation, PICs were
again washed and resuspended in buffer with triphosphates, and
transcription activity was monitored by primer extension. As expected,
the PICs formed by the RRN3ts extract were unable to support
transcription in the absence of further addition (lanes 2 and 11). To
our surprise, the transcriptional activity of the PICs formed in the
absence of Rrn3p was not restored upon addition of either the RPA190ts
extract, the
RPA190 extract, or purified yeast Rrn3p (lanes 2 to 8 and 12 to 14). In contrast, addition of a CF knockout extract
(
RRN7) partially restored transcription activity (lanes 9 and 15), while addition of a UAF knockout extract (
RRN5)
complemented the Rrn3ts extract to the same level as that observed with a WT extract (lane 1). The difference in the
abilities of the
RRN7 and
RRN5
extracts to restore transcription in these assays is not due to
differences in the specific transcription activity of the extracts, as
both knockout extracts restored the RRN3ts extract to full activity if
they were added before PIC formation (Fig. 3C).
Overall, the data presented in Fig. 3 show that Pol I can be recruited
to the PIC in the absence of Rrn3p but that the resulting complex is
transcriptionally inactive. Rrn3p alone is not sufficient to reactivate
a Rrn3p-deficient PIC, but it is capable of a modest level of
reactivation when complexed with Pol I, presumably by displacing Pol I
lacking Rrn3p from the complex. When Rrn3p, Pol I, and CF are all
present, transcription can be restored to WT levels. This raises the
possibility that Rrn3p, Pol I, and CF may enter the PIC in a concerted fashion.
PIC formation in the absence of Pol I.
It has been proposed
that Pol I PIC assembly in yeast proceeds in a stepwise manner in which
UAF recruits CF to form a stable complex that in turn recruits Pol
I-Rrn3p (34). To test this model we have examined PIC
assembly on a WT template by using extracts from cells lacking Pol I
(
RPA190) and carrying an epitope-tagged genomic copy of
either RRN3, RRN7 (CF), or RRN9 (UAF). Western analysis revealed that the PICs formed by each of these extracts contained UAF (Rrn9p) but lacked Rrn3p (Fig.
4A). Unexpectedly, the PICs also lacked
CF (Rrn7p), despite the facts that mixing the
RPA190
extract with a
RRN7 extract restored transcription (Fig.
3C, lane 3), demonstrating that active CF was present in the
RPA190 extract, and that CF was readily detected by
Western blotting (Fig. 4A, lane 1). This result shows that UAF cannot stably recruit CF in the absence of Pol I.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 4.
CF is not recruited in the absence of Pol I. (A) PIC
formation in the absence of Pol I. PICs were formed on either the WT or
 2 template (lanes 2 and 3) using RPA190 extracts
where either RRN9, RRN7, or RRN3 were epitope
tagged. After washing, proteins were detected by Western blotting. The
presence of intact proteins in each extract is shown in lane 1. In the
absence of Pol I, UAF binds to the promoter but not to CF or Rrn3p
(lane 2). (B) Complementation of Pol I-free PICs with mutant extracts.
WT template was first incubated either with buffer (lanes 1, 3, 5, and
7) or RPA190 extract (lanes 2, 4, 6, 8, and 9) for 45 min
and washed. Templates were then incubated for 45 min with a second
extract, either WT (lanes 1 and 2), RRN5 (lanes 3 and 4),
RRN7 (lanes 5 and 6), RRN3ts (lanes 7 and 8), or buffer
alone (lane 9), washed, and incubated in YTB with NTPs. After a 15-min
incubation, transcripts were assayed by primer extension. PICs formed
in the absence of Pol I were only rescued by a second extract lacking
UAF ( RRN5; lane 4) or the WT extract (lane 2).
|
|
To further investigate this result, we attempted to rescue PICs formed
in the
RPA190 extract by incubating them with extracts deficient in either UAF (
RRN5), CF (
RRN7),
or RRN3 (RRN3ts). As shown in Fig. 4B, PICs formed in the absence of
Pol I are not rescued by incubation with extracts lacking either Rrn3p
(lane 8) or CF (lane 6). However, they are rescued to WT levels by
incubation in a UAF-deficient extract (lane 4). This result further
supports the observation that CF is not associated at the promoter when PICs are formed in the absence of Pol I. Taken together, the results shown in Fig. 4 indicate that Pol I is absolutely required for stable
association of the CF with the promoter during PIC formation, while UAF
can bind stably to the promoter in the absence of both Pol I and CF.
Fate of PIC components after transcription initiation.
The
current model of Pol I transcription predicts that polymerase and Rrn3p
exit the promoter upon initiation, leaving behind UAF and CF as a
scaffold for the next round of transcription (19, 34). To
test this model we examined the fate of Pol I transcription factors
during transcription initiation. PICs were formed on the WT template
using WT extracts containing epitope-tagged components, and
transcription was initiated by resuspending the washed PICs in
transcription buffer containing NTPs. Factors which either remained
bound to the template or were released to the supernatant during
transcription were separated and analyzed by Western blotting. Figure
5 shows a comparison of the factors
released during transcription with factors that remained associated
with the templates. As expected, Pol I (RPA34, RPA43) and Rrn3p were
found in the released fraction, which additionally contained not only
the CF subunits (RRN7, RRN11) but also TBP. In contrast, the UAF
complex (RRN5, RRN9) remained tightly associated with promoter template
throughout the transcription cycle. Moreover, Fig. 5 shows that nearly
all of the Rrn3p dissociates from the promoter template during
transcription, while only a small fraction of Pol I, CF, and TBP are
released upon NTP addition.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 5.
Release of Pol I factors during transcription. PICs were
formed for 45 min on either the WT or  2 template using WT extract.
After washing, PICs were resuspended in YTB with NTPs for 15 min.
Factors that remain bound to the immobilized template were separated
from released factors with a magnetic separator, resolved on an
SDS-polyacrylamide gel, and identified by using Western blotting. Note
that essentially all of Rrn3p releases from the WT template, a small
fraction of Pol I (RPA34, RPA43), CF (RRN7, RRN11) and TBP release, and
no UAF releases during transcription.
|
|
These results show that both active and inactive PICs are assembled on
the WT promoter template in our extracts and that the presence of Rrn3p
is the distinguishing feature of the transcriptionally active class,
since it is quantitatively released from the promoter complex when
transcription is initiated by addition of NTPs. Furthermore, the factor
composition of inactive PICs is identical to that of PICs formed in the
absence of Rrn3p (Fig. 3). UAF is not released upon triphosphate
addition, in agreement with previous demonstrations that UAF is the
primary stabilizing element of the PIC (34, 37).
Nucleotide requirements for factor release.
The factor release
shown in Fig. 5 was obtained in the presence of all four NTPs. To
confirm that the observed factor release was the result of
transcription initiation, we tried adding various subsets of
triphosphates to the assembled PICs (Fig.
6). With the exception of a small amount
of Pol I which dissociated in the absence of any triphosphate addition,
Pol I, Rrn3p, and CF were released only in the presence of all four
triphosphates. Since Rrn3 is not released in the absence of NTPs, the
minor Pol I fraction released under these conditions probably
corresponds to the fraction of Pol I which is nonspecifically
associated with the immobilized template. In contrast, the amount of
TBP released upon addition of all four NTPs is identical to the amount
released when only the first three nucleotides of the transcript are
added (the sequence of the Pol I transcript begins
5'-AUGCGAAAGCAGUUGAAGAC). Further work is needed to
understand the role of TBP and to define exactly when CF and Rrn3p
leave the template.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 6.
Nucleotide requirements for factor release. PICs were
formed on the WT template, washed, and incubated for 15 min in YTB with
either all four NTPs (AUGC), triphosphates corresponding to the first
three nucleotides of the transcript (AUG), GTP alone, a nonhydrolyzable
ATP analog (AMPPCP), or buffer alone. After separation into bound and
released fractions, factors were identified by Western blotting. As
expected from Fig. 5, UAF does not release under any conditions. Pol I,
Rrn3p, and CF release only in the presence of all four NTPs (AUGC)
except for a small nonspecific release of Pol I that occurs in buffer
alone. TBP releases in the presence of only AUG as well as in the
presence of AUGC.
|
|
 |
DISCUSSION |
A model for the Pol I transcription cycle.
The data reported
in this paper suggest a new model for the Pol I transcription cycle;
this model illustrated in Fig. 7. The cycle begins with formation of the Pol I PIC in two discernible steps:
sequence-specific localization of the promoter by the UAF complex,
followed by the recruitment of CF, Pol I-Rrn3, and possibly TBP. Upon
addition of NTPs, CF, Pol I-Rrn3, and TBP dissociate from the template
while UAF remains stably bound to the promoter, presumably serving as a
scaffold for reinitiation.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 7.
Model of the Pol I transcription cycle. We define two
steps in formation of the Pol I PIC. In the first step, UAF locates the
promoter and binds stably in a sequence-specific manner. In the second
step, Pol I-Rrn3p and CF are recruited by UAF. TBP is required for this
recruitment, but whether it enters with CF and Pol I-Rrn3p or is
separately recruited by UAF is not yet determined. Upon initiation of
transcription, CF, Pol I/Rrn3p, and TBP all leave the promoter. UAF
remains bound as a scaffold for further rounds of recruitment and
transcription.
|
|
It has been previously suggested that UAF is the factor that first
binds the promoter to initiate the process of PIC assembly (34). This is supported both by in vitro studies showing
that UAF alone can bind stably to the rDNA promoter in the absence of
CF (15) as well as by in vivo footprint analyses of the
rRNA genes, which revealed that UAF remains stably associated with the
upstream promoter element (36). The results presented in Fig. 4, showing that UAF can bind stably to the rDNA promoter in the
absence of both CF and Pol I, agree with these studies. We therefore
favor the notion that UAF binding initiates transcription complex
formation at rRNA genes.
The next step in PIC formation is the recruitment of CF and Pol I. The
data presented in Fig. 4 demonstrate that CF does not remain stably
associated with the promoter in the absence of polymerase. Western
blotting revealed that CF is not associated with the PIC in extracts
lacking Pol I (Fig. 4A), even though it contains transcriptionally competent CF, and in vitro transcription assays demonstrated that extracts lacking CF cannot direct transcription from a complex formed
in the absence of active Pol I (Fig. 4B). Thus, Pol I is essential for
stable association of CF with the rDNA promoter.
Although Pol I appears to be required for formation of a stable PIC, it
can be specifically recruited to the promoter in the absence of Rrn3p
(Fig. 3A). In vitro, this results in the formation of a
transcriptionally inactive complex. These inactive complexes cannot be
rendered transcriptionally competent by adding purified Rrn3p (Fig.
3B). In fact, the data shown in Fig. 3B suggest that an Rrn3p-Pol I
complex is required to direct transcription from PICs assembled in the
absence of Rrn3p, as only those extracts containing both Rrn3p and Pol
I were capable of restoring transcription activity. This result was
unexpected, since it has previously been suggested that Rrn3p is
required for recruitment of Pol I, based on its ability to interact
with both Pol I (Rpa43p) and the core factor subunit Rrn6p
(25). In addition, recent experiments in human cell
systems have been interpreted to mean that human Rrn3 (hRrn3) is
essential for Pol I recruitment (20).
The present finding that Rrn3p can be dispensable for Pol I recruitment
suggests that it is required, in combination with Pol I-CF
interactions, to induce an active conformation of the polymerase within
the PIC. This may be similar to what has been reported for Pol III
transcription, where TFIIIB appears to participate actively in
initiation by possibly changing the conformation of the polymerase
(12).
Upon transcription initiation, Pol I-Rrn3p, CF, and TBP all escape the
promoter while UAF remains bound (Fig. 5). The fractions of Pol I, CF,
and TBP that escape are relatively small while almost all of Rrn3p is
released. This suggests that two types of PICs are formed in vitro:
transcriptionally competent PICs containing Rrn3p and transcriptionally
inactive PICs lacking Rrn3p. At present we do not understand what
limits the fraction of PICs that contain Rrn3p. Overexpression of Rrn3p
leads to extracts with greatly increased in vitro transcription
activity but does not materially increase the fraction of
Rrn3p-containing PICs (B. Moorefield and P. Aprikian, unpublished
results). Thus, some other as-yet-unidentified factor is probably limiting.
The role of TBP in PIC formation is currently unclear. TBP has been
shown to bind to both CF and UAF in vitro (18, 34, 35) and
is required for transcriptional activation by UAF in vivo
(34). Using the immobilized template assay, we have
observed that TBP can be recruited in the absence of UAF, presumably by binding to CF (Fig. 2). Conversely, TBP can be recruited to the promoter in the absence of CF, presumably by binding to UAF subunits (P. Aprikian, unpublished results). However, we do not know if TBP
recruited to these partial complexes can participate in the formation
of transcriptionally active PICs. Since TBP as well as CF and Pol
I-Rrn3p dissociate from promoter following transcription initiation, we
favor the notion that all these components enter the PIC in the same
step. Further experiments are needed to test this possibility.
Comparison with previous models of PIC formation.
Stepwise
models of Pol I PIC formation have been proposed for both yeast
(34) and mammals (30). In these earlier
models an activator (yeast UAF, mammalian upstream binding factor)
recruits a basal complex (yeast CF, mammalian SL1-TIF-IB) which in turn recruits Pol I plus Rrn3p (yeast) or Pol I plus hRrn3-TIF-IA (mammals). These stepwise models are now being reconsidered in view of multiple reports of Pol I "holoenzymes" in plants and mammals (1, 10, 20, 29, 33). While the composition of these various complexes is
not yet well defined, they all share the property of containing Pol I
along with enough other factors to support specific initiation in
vitro. Although a Pol I holoenzyme has yet to be identified in yeast,
the model shown in Fig. 7 could readily accommodate the existence of a
complex containing Pol I-Rrn3 and CF.
However, all of the models of Pol I PIC formation proposed so far
envision either SL1 or CF remaining at the promoter upon transcription
initiation (20, 30, 34). A major novelty of our results is
the demonstration that this is not so, at least in yeast. Transcription
initiation involves the release of both CF and TBP in addition to Pol
I-Rrn3.
There is precedent for assembly pathways that have been worked out with
purified factors to differ from those observed with crude extracts. For
example, a stepwise pathway for Pol II PIC formation has been proposed
on the basis of order-of-addition experiments with purified factors
(see review in reference 24). In this stepwise model, TBP
binding to the TATA box is a prerequisite for TFIIB recruitment. Pol II
and TFIIF are subsequently recruited, followed by TFIIE and TFIIH, and
TFIIA can enter the PIC at any point after TBP binding. This stepwise
model has been challenged by discovery of a Pol II holoenzyme which is
stably associated with a subset of general transcription factors
(reviewed in reference 22). In agreement with the
holoenzyme model, studies of Pol II PIC assembly using immobilized
templates and unfractionated nuclear extracts suggest that the assembly
pathway consists of only two major steps (26). In the
first step, TFIIA and the TBP-containing factor TFIID are recruited in
a sequence-specific manner that is stimulated by activators. The second
step is concerted recruitment of TFIIB plus Pol II holoenzyme and is
also stimulated by activators. Subsequent studies indicate that
initiation of transcription results in Pol II, TFIIB, and TFIIF leaving
the PIC (39). This leaves behind a scaffold consisting of
TFIID, TFIIA, TFIIH, TFIIE, and a subcomplex of the holoenzyme called mediator which apparently serves as a platform for subsequent rounds of reinitiation.
Our model for Pol I resembles the Pol II holoenzyme recruitment model
in that polymerase plus a subset of factors dissociates from the
template upon transcription initiation while activator(s) remain
behind. Our model appears to differ from the Pol II situation in that
the factors dissociating from the promoter include the entire basal machinery.
Relevance of our model to Pol I transcription in vivo.
In vivo
footprinting has been utilized to examine the binding of Pol I
transcription factors to the ribosomal gene promoter in living yeast
(4) and has been able to detect binding of both UAF and CF
to the promoters of WT cells. UAF binding at WT levels was also
detected in cells lacking either CF (
RRN7) or Pol I
(
RPA43), while CF binding was not detected in cells
lacking UAF (
RRN5) or Pol I (
RPA43). The
authors interpreted these results to mean that UAF binding did not
depend upon either CF or Pol I and that CF binding was dependent upon
both UAF and Pol I. These in vivo data are in complete agreement with
the model in Fig. 7 which was derived from our in vitro experiments.
Bordi et al. further found that UAF binding was present in a strain
lacking Rrn3p (
RRN3), but CF binding was absent
(4). This indicates that the inactive, Rrn3p-lacking
complexes which formed in our experiments are due to some deficiency in
the in vitro system and do not form in vivo. Despite some optimistic calculations in the literature, it is our impression that this is a
feature of most eukaryotic in vitro systems, in which only a fraction
of the complexes that form are transcriptionally active (for example,
see reference 26). In our case we were able to measure the
active fraction and distinguish it from the inactive fraction.
Implications of the Pol I transcription cycle for regulation of
rRNA synthesis.
We have previously proposed that eukaryotic rRNA
transcription has the potential of being regulated on two levels that
are mechanistically distinct (27, 28). One level of
regulation appears to control whether or not a given promoter is open
and capable of directing transcription. Evidence for regulation of promoter opening in yeast comes from psoralen cross-linking experiments which show that only a fraction of the ribosomal genes are active during exponential cell growth (7). Electron micrographs
of ribosomal genes from rapidly growing cells typically show genes that
are tightly packed with elongating polymerase. This suggests that under
some circumstances the factor(s) required to open genes are rate
limiting while the components needed for transcription initiation are
in excess. Regulation at the level of promoter opening is further
supported by the observation that the number of open, transcriptionally
active ribosomal genes varies in proportion to yeast cellular growth
rate (7).
Based on work presented in this and in previous papers, the UAF complex
has the characteristics expected of a factor that might regulate Pol I
promoter opening. UAF is capable of binding to the promoter in the
absence of other factors (15) (Fig. 4A), does not readily
exchange once it is bound, and remains behind after transcription
initiation (Fig. 5 and 6). In addition, UAF is tightly associated with
histones H3 and H4 (13), suggesting that it may be
particularly suited for altering histone interactions in the process of
alleviating repressive chromatin structures.
Each repeating unit of yeast rDNA also contains an enhancer element
located just downstream of the Pol I terminator site. When a Pol I
promoter on an extrachromosomal plasmid is placed in competition with
the Pol I promoters in the chromosome, the presence of an adjacent
enhancer element is essential for transcriptional activity of the
plasmid-borne promoter (8). Thus, it is possible that the
enhancer elements also influence Pol I promoter opening. However, the
mechanism of enhancer-dependent activation is unknown at present.
Once a Pol I promoter is open, the rate of Pol I loading is controlled
by a secondary mechanism. Regulation at this level is likely to involve
Rrn3p or its mammalian homolog, TIF-IA. Rrn3p appears to determine the
fraction of active Pol I (19) and is necessary to form a
transcriptionally competent PIC (Fig. 3 and 5). Regulation at the level
of promoter loading has been monitored during the rapid down regulation
of rRNA gene transcription which occurs when yeast undergo the
transition from log-phase growth to stationary phase. This
transcriptional shutoff is accompanied by a marked decline in the
levels of Rrn3p-associated Pol I (19), while the number of
psoralen-accessible, presumably open genes decreases very little
(7). Thus, rRNA gene transcription may be regulated at the
level of promoter opening or at the level of polymerase loading in
response to different physiological conditions.
At present much attention is focused on the possibility that Rrn3p
activity is controlled by a regulatory cycle in which it dissociates
from Pol I during initiation, is inactivated, and must be reactivated
before it can direct initiation by a second polymerase. The observation
that CF and TBP also leave the PIC upon initiation raises the
possibility that they too may undergo a similar cycle of inactivation
and reactivation during successive rounds of transcription.
We thank J. Roan and K. Johnson for excellent technical
assistance and T. Tsukiyama for review of the manuscript. S. Hahn and
members of his laboratory helped us adapt the immobilized template
assay for Pol I transcription and also offered critical comments on the manuscript.
This work was partially supported by a grant to R.H.R. (GM26624).
| 1.
|
Albert, A. C.,
M. Denton,
M. Kermekchiev, and C. S. Pikaard.
1999.
Histone acetyltransferase and protein kinase activities copurify with a putative Xenopus RNA polymerase I holoenzyme self-sufficient for promoter-dependent transcription.
Mol. Cell. Biol.
19:796-806[Abstract/Free Full Text].
|
| 2.
|
Aprikian, P.,
B. Moorefield,
C.-W. Lin, and R. H. Reeder.
2000.
TATA binding protein can stimulate core-directed transcription by yeast RNA polymerase I.
Mol. Cell. Biol.
20:5269-5275[Abstract/Free Full Text].
|
| 3.
|
Bodem, J.,
G. Dobreva,
U. Hoffmann-Rohrer,
S. Iben,
H. Zentgraf,
H. Delius,
M. Vingron, and I. Grummt.
2000.
TIF-IA, the factor mediating growth-dependent control of ribosomal RNA synthesis, is the mammalian homolog of yeast Rrn3p.
EMBO Rep.
1:171-175[CrossRef][Medline].
|
| 4.
|
Bordi, L.,
F. Cioci, and G. Camilloni.
2001.
In vivo binding and hierarchy of assembly of the yeast RNA polymerase I transcription factors.
Mol. Biol. Cell
12:753-760[Abstract/Free Full Text].
|
| 5.
|
Carles, C., and M. Riva.
1998.
Yeast RNA polymerase I subunits and genes.
In
I. Paule (ed.), Transcription of ribosomal RNA genes by eukaryotic RNA polymerase. Springer Verlag, Berlin, Germany.
|
| 6.
|
Cormack, B. P., and K. Struhl.
1992.
The TATA-binding protein is required for transcription by all three nuclear RNA polymerases in yeast cells.
Cell
69:685-696[CrossRef][Medline].
|
| 7.
|
Dammann, R.,
R. Lucchini,
T. Koller, and J. M. Sogo.
1993.
Chromatin structures and transcription of rDNA in yeast Saccharomyces cerevisiae.
Nucleic Acids Res.
21:2331-2338[Abstract/Free Full Text].
|
| 8.
|
Elion, E., and J. R. Warner.
1986.
An RNA polymerase I enhancer in Saccharomyces cerevisiae.
Mol. Cell. Biol.
6:2089-2097[Abstract/Free Full Text].
|
| 9.
|
Goldmark, J. P.,
T. G. Fazzio,
P. W. Estep,
G. M. Church, and T. Tsukiyama.
2000.
The Isw2 chromatin remodeling complex represses early meiotic genes upon recruitment by Ume6p.
Cell
103:423-433[CrossRef][Medline].
|
| 10.
|
Hannan, R. D.,
A. Cavanaugh,
W. M. Hempel,
T. Moss, and L. Rothblum.
1999.
Identification of a mammalian RNA polymerase I holoenzyme containing components of the DNA repair/replication system.
Nucleic Acids Res.
27:3720-3727[Abstract/Free Full Text].
|
| 11.
|
Ishihama, A.,
M. Kimura, and H. Mitsuzawa.
1998.
Subunits of yeast RNA polymerases: structure and function.
Curr. Opin. Microbiol.
1:190-196[CrossRef][Medline].
|
| 12.
|
Kassavetis, G. A.,
A. Kumar,
G. A. Letts, and E. P. Geiduschek.
1998.
A post-recruitment function for the RNA polymerase III transcription-initiation factor IIIB.
Proc. Natl. Acad. Sci. USA
95:9196-9201[Abstract/Free Full Text].
|
| 13.
|
Keener, J.,
J. A. Dodd,
D. Lalo, and M. Nomura.
1997.
Histones H3 and H4 are components of upstream activation factor required for the high-level transcription of yeast rDNA by RNA polymerase I.
Proc. Natl. Acad. Sci. USA
94:13458-13462[Abstract/Free Full Text].
|
| 14.
|
Keener, J.,
C. A. Josaitis,
J. A. Dodd, and M. Nomura.
1998.
Reconstitution of yeast RNA polymerase I transcription in vitro from purified components.
J. Biol. Chem.
173:33795-33802.
|
| 15.
|
Keys, D. A.,
B.-S. Lee,
J. A. Dodd,
T. T. Nguyen,
L. Vu,
E. Fantino,
L. M. Burson,
Y. Nogi, and M. Nomura.
1996.
Multiprotein transcription factor UAF interacts with the upstream element of the yeast RNA polymerase I promoter and forms a stable preinitiation complex.
Genes Dev.
10:887-903[Abstract/Free Full Text].
|
| 16.
|
Keys, D. A.,
J. S. Steffan,
J. A. Dodd,
R. T. Yamamoto,
Y. Nogi, and M. Nomura.
1994.
RRN6 and RRN7 encode subunits of a multiprotein complex essential for the initiation of rDNA transcription by RNA polymerase I in Saccharomyces cerevisiae.
Genes Dev.
8:2349-2362[Abstract/Free Full Text].
|
| 17.
|
Lalo, D.,
J. S. Steffan,
J. A. Dodd, and M. Nomura.
1996.
RRN11 encodes the third subunit of the complex containing Rrn6p and Rrn7p that is essential for the initiation of rDNA transcription by yeast RNA polymerase I.
J. Biol. Chem.
271:21062-21067[Abstract/Free Full Text].
|
| 18.
|
Lin, C.-W.,
B. Moorefield,
J. Payne,
P. Aprikian,
K. Mitomo, and R. H. Reeder.
1996.
A novel 66-kilodalton protein complexes with Rrn6, Rrn7, and TATA-binding protein to promote polymerase I transcription initiation in Saccharomyces cerevisiae.
Mol. Cell. Biol.
16:6436-6443[Abstract].
|
| 19.
|
Milkereit, P., and H. Tschochner.
1998.
A specialized form of RNA polymerase I, essential for initiation and growth-dependent regulation of rRNA synthesis, is disrupted during transcription.
EMBO J.
17:3692-3703[CrossRef][Medline].
|
| 20.
|
Miller, G.,
K. I. Panov,
J. K. Friedrich,
L. Trinkle-Mulcahy, and J. C. B. M. Zomerdijk.
2001.
hRRN3 is essential in the SL1-mediated recruitment of RNA polymerase I to rRNA gene promoters.
EMBO J.
20:1373-1382[CrossRef][Medline].
|
| 21.
|
Moorefield, B.,
E. A. Greene, and R. H. Reeder.
2000.
RNA polymerase I transcription factor Rrn3 is functionally conserved between yeast and human.
Proc. Natl. Acad. Sci. USA
97:4724-4729[Abstract/Free Full Text].
|
| 22.
|
Myer, V. E., and R. A. Young.
1998.
RNA polymerase II holoenzymes and subcomplexes.
J. Biol. Chem.
273:27757-27760[Free Full Text].
|
| 23.
|
Nogi, Y.,
R. Yano, and M. Nomura.
1991.
Synthesis of large rRNAs by RNA polymerase II in mutants of Saccharomyces cerevisiae defective in RNA polymerase I.
Proc. Natl. Acad. Sci. USA
88:3962-3966[Abstract/Free Full Text].
|
| 24.
|
Orphanides, G.,
T. Lagrange, and D. Reinberg.
1996.
General initiation factors of RNA polymerase II.
Genes Dev.
10:2657-2683[Free Full Text].
|
| 25.
|
Peyroche, G.,
P. Milkereit,
N. Bischler,
H. Tschochner,
P. Schultz,
A. Sentenac,
C. Carles, and M. Riva.
2000.
The recruitment of RNA polymerase I on rDNA is mediated by the interaction of the A43 subunit with Rrn3.
EMBO J.
19:5473-5482[CrossRef][Medline].
|
| 26.
|
Ranish, J. A.,
N. Yudkovsky, and S. Hahn.
1999.
Intermediates in formation and activity of the RNA polymerase II preinitiation complex: holoenzyme recruitment and a postrecruitment role for the TATA box and TFIIB.
Genes Dev.
13:49-63[Abstract/Free Full Text].
|
| 27.
|
Reeder, R. H.
1989.
Regulatory elements of the generic ribosomal gene.
Curr. Opin. Cell Biol.
1:466-474[CrossRef][Medline].
|
| 28.
|
Reeder, R. H.
1992.
The regulation of transcription by RNA polymerase I.
In
K. Yamamoto, and S. McKnight (ed.), Transcriptional regulation. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 29.
|
SaezVasquez, J., and C. S. Pikaard.
1997.
Extensive purification of a putative RNA polymerase I holoenzyme from plants that accurately initiates rRNA gene transcription in vitro.
Proc. Natl. Acad. Sci. USA
94:11869-11874[Abstract/Free Full Text].
|
| 30.
|
Schnapp, A., and I. Grummt.
1991.
Transcription complex formation at the mouse rDNA promoter involves the stepwise association of four transcription factors and RNA polymerase I.
J. Biol. Chem.
266:24588-24595[Abstract/Free Full Text].
|
| 31.
|
Schnapp, A.,
G. Schnapp,
B. Erny, and I. Grummt.
1993.
Function of the growth-regulated transcription initiation factor TIF-IA in initiation complex formation at the murine ribosomal gene promoter.
Mol. Cell. Biol.
13:6723-6732[Abstract/Free Full Text].
|
| 32.
|
Schultz, M. C.,
R. H. Reeder, and S. Hahn.
1992.
Variants of the TATA binding protein can distinguish subsets of RNA polymerase I, II, and III promoters.
Cell
69:697-702[CrossRef][Medline].
|
| 33.
|
Seither, P.,
S. Iben, and I. Grummt.
1998.
Mammalian RNA polymerase I exists as a holoenzyme with associated basal transcription factors.
J. Mol. Biol.
275:43-53[CrossRef][Medline].
|
| 34.
|
Steffan, J. S.,
D. A. Keys,
J. A. Dodd, and M. Nomura.
1996.
The role of TBP in rDNA transcription by RNA polymerase I in Saccharomyces cerevisiae: TBP is required for upstream activation factor-dependent recruitment of core factor.
Genes Dev.
10:2551-2563[Abstract/Free Full Text].
|
| 35.
|
Steffan, J. S.,
D. A. Keys,
L. Vu, and M. Nomura.
1998.
Interaction of TATA-binding protein with upstream activation factor is required for activated transcription of ribosomal DNA by RNA polymerase I in Saccharomyces cerevisiae in vivo.
Mol. Cell. Biol.
18:3752-3761[Abstract/Free Full Text].
|
| 36.
|
Vogelauer, M.,
F. Cioci, and G. Camilloni.
1998.
DNA protein-interactions at the Saccharomyces cerevisiae 35S rRNA promoter and in its surrounding region.
J. Mol. Biol.
275:197-209[CrossRef][Medline].
|
| 37.
|
Yamamoto, R. T.,
Y. Nogi,
J. A. Dodd, and M. Nomura.
1996.
RRN3 gene of Saccharomyces cerevisiae encodes an essential RNA polymerase I transcription factor which interacts with the polymerase independently of DNA template.
EMBO J.
15:3964-3973[Medline].
|
| 38.
|
Yudkovsky, N.,
C. Logie,
S. Hahn, and C. L. Peterson.
1999.
Recruitment of the SWI/SNF chromatin remodeling complex by transcriptional activators.
Genes Dev.
13:2369-2374[Abstract/Free Full Text].
|
| 39.
|
Yudkovsky, N.,
J. A. Ranish, and S. Hahn.
2000.
A transcription reinitiation intermediate that is stabilized by activator.
Nature
408:225-229[CrossRef][Medline].
|
| 40.
|
Zhao, X.,
E. G. Muller, and R. Rothstein.
1998.
A suppressor of two essential checkpoint genes identified a novel protein that negatively affects dNTP pools.
Mol. Cell
2:329-340[CrossRef][Medline].
|