Previous Article | Next Article 
Molecular and Cellular Biology, August 2001, p. 4985-4995, Vol. 21, No. 15
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.15.4985-4995.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Analysis of smu-1, a Gene That Regulates the
Alternative Splicing of unc-52 Pre-mRNA in
Caenorhabditis elegans
Caroline A.
Spike,
Jocelyn E.
Shaw, and
Robert K.
Herman*
Department of Genetics, Cell Biology, and
Development, University of Minnesota, St. Paul, Minnesota 55108
Received 29 March 2001/Accepted 4 May 2001
 |
ABSTRACT |
Mutations in the smu-1 gene of Caenorhabditis
elegans were previously shown to suppress mutations in the
genes mec-8 and unc-52. mec-8 encodes a putative RNA binding protein that
affects the accumulation of specific alternatively spliced mRNA
isoforms produced by unc-52 and other genes.
unc-52 encodes a set of basement membrane proteins,
homologs of mammalian perlecan, that are important for body wall muscle
assembly and attachment to basement membrane, hypodermis, and cuticle.
We show that a presumptive null mutation in smu-1
suppresses nonsense mutations in exon 17 but not exon 18 of
unc-52 and enhances the phenotype conferred by an
unc-52 splice site mutation in intron 16. We have used
reverse transcription-PCR and RNase protection to show
that loss-of-function smu-1 mutations enhance
accumulation in larvae of an alternatively spliced isoform that
skips exon 17 but not exon 18 of unc-52. We have
identified smu-1 molecularly; it encodes a
nuclearly localized protein that contains five WD motifs and is
ubiquitously expressed. The SMU-1 amino acid sequence is more than 60%
identical to a predicted human protein of unknown function. We propose
that smu-1 encodes a trans-acting factor
that regulates the alternative splicing of the pre-mRNA of
unc-52 and other genes.
 |
INTRODUCTION |
Alternative splicing of
pre-mRNA is a complex but common mechanism of regulating gene
function in multicellular eukaryotes. Current estimates suggest that at
least one-third of all genes in humans (17) are
alternatively spliced. Patterns of alternative splicing are in some
cases known to be cell type specific or developmentally regulated
(16, 24). Regulated alternative splicing of pre-mRNA most often results in the synthesis of multiple (functional) proteins from the same pre-mRNA, but alternative splicing can also
function as an on-off switch for gene function (1).
Analysis of a genetic interaction in C. elegans has led to
the proposal that the mec-8 gene encodes an RNA binding
protein that regulates alternative splicing of unc-52
pre-mRNA (26). The unc-52 gene encodes, via
alternative splicing and alternative 3'-end usage, homologs of
perlecan, the core protein of the mammalian basement membrane heparan
sulfate proteoglycan (39, 40). A subset of UNC-52 isoforms
is present in the basement membrane adjoining body wall muscle
(12, 30, 33, 39) and is important both for initiation of
myofilament lattice assembly and for maintaining anchorages of body
wall muscle to basement membrane, hypodermis, and cuticle. Null
mutations in unc-52 lead to paralysis and arrest at the
twofold stage of embryonic elongation (19, 39, 46); the
muscle cells in these mutants have severely disorganized thick and thin
filaments. Viable unc-52 mutants exhibit normal
embryogenesis but suffer from a progressive disruption of body wall
muscle and progressive paralysis during larval development
(15). The unc-52 viable mutations are located
in a region of unc-52 that when transcribed is alternatively
spliced; most are nonsense mutations in alternatively spliced exons
that prematurely truncate some of the UNC-52 protein isoforms
(40). Null alleles of mec-8, which are viable
by themselves, are lethal in combination with viable alleles of
unc-52 (25). The accumulation of two
alternatively spliced unc-52 mRNA isoforms that skip all
of the unc-52(viable) mutations is severely reduced in
mec-8 mutants (26). As a consequence, mutations
in mec-8 reduce the amount of functional UNC-52 protein
detected in embryos of unc-52(viable) mutants (26,
33), and mec-8; unc-52(viable) embryos are
arrested in their development, with a phenotype resembling that of
unc-52 null mutants (25).
Mutations in mec-8 by themselves lead to mechanosensory
(6) and chemosensory (36) defects that appear
to be unrelated to unc-52 function (26),
suggesting that MEC-8 may affect the processing of multiple
pre-mRNAs. Null alleles of mec-8 also display an
incompletely penetrant cold-sensitive lethality that is correlated with
defects in body muscle attachment to adjacent hypodermis and cuticle
(25). This phenotype also seems to be unrelated to
unc-52 function. A mutation, unc-52(ra515),
that deletes the region of unc-52 in which
mec-8-dependent splicing occurs (33) has been
identified. Homozygous unc-52(ra515) animals have an essentially wild-type phenotype, and the mec-8;
unc-52(ra515) double mutant shows no synthetic lethality but
exhibits the same cold-sensitive, incompletely penetrant lethality as
the mec-8 single mutant (33).
The interaction between mutations in a gene that regulates splicing
(mec-8) and hypomorphic alleles of an essential
alternatively spliced gene (unc-52) provides a starting
point for powerful genetic screens directed at finding new genes that
regulate splicing in vivo. Recessive, loss-of-function mutations in the
gene smu-1 were identified as suppressors of the synthetic
lethal interaction between mec-8(u218ts) and
unc-52(e669su250ts) at a restrictive temperature
(25). The smu-1 mutations also promote a weak
bypass suppression of the other mec-8 mutant phenes and
suppress the muscular dystrophy conferred by specific
unc-52(viable) alleles.
We have found that smu-1 mutations affect the accumulation
of a specific alternatively spliced unc-52 transcript,
resulting in enhanced skipping of unc-52 mutations
suppressed by smu-1. smu-1 encodes a highly
conserved nuclear protein predicted to have five WD repeats, a motif
associated with protein-protein interactions. WD repeats are found in
proteins involved in diverse cellular processes, including splicing and
other aspects of RNA metabolism (34). We propose
that SMU-1 interacts with one or more additional factors to
regulate the alternative splicing of unc-52 and other transcripts.
 |
MATERIALS AND METHODS |
Strains and culture.
Nematodes were cultured as described
previously (5, 43). RW7000 was the source of the
dimorphism bnP1, formerly called TCbn2
(47). In this paper, mec-8(ts) refers to
mec-8(u218ts) I and unc-52(ts) refers to
unc-52(e669su250ts) II. Other alleles unspecified in the
text were (18) unc-101(m1) I,
unc-59(e261) I, smu-2(mn416) II,
unc-36(e251) III, mut-6(st702) IV, and
him-5(e1467) V. Using the previously described screen
(25), we identified smu-1(mn602),
smu-1(mn609), smu-2(mn610), and
smu-2(mn611) following gamma irradiation;
smu-1(mn615) arose spontaneously in a mut-6 mutator genetic background (31).
Genetic and physical mapping of smu-1.
Unc-101 non-Unc-59 and Unc-59 non-Unc-101 recombinants were picked from
the self progeny of unc-101 smu-1 + unc-59/+ + bnP1 + hermaphrodites. Each recombinant chromosome
was made homozygous and scored with respect to bnP1 using
PCR (47): 41 of 43 unc-101 unc-59(+) and 2 of
35 unc-101(+) unc-59 chromosomes were bnP1. Recombinant chromosomes were tested for the presence of
smu-1 by crossing hermaphrodites to smu-1(mn415);
unc-52(ts); him-5 males. F1 cross
progeny were picked and allowed to self at 25°C. The absence
of Unc-52 F2 progeny indicated that the
recombinant chromosome was smu-1. Six of 20 unc-101
bnP1 chromosomes and two of nine unc-59 chromosomes
were smu-1.
Analysis of genetic interactions between smu-1 and
unc-52.
Double-mutant combinations of
smu-1(mn415) and viable alleles of unc-52 other
than unc-52(ts) were created by picking many non-Unc-52
non-Unc-101 progeny from unc-101 +/+ smu-1; unc-52/+ hermaphrodite parents. Progeny that failed to segregate Unc-101 animals
were assumed to be homozygous for smu-1, and Unc-52 progeny from these plates were picked; multiple lines were analyzed for each
unc-52 allele. The time at which the larvae became paralyzed was determined by creating a synchronized population of L1 larvae which
was observed throughout larval development. The frequencies of
embryonic arrest and abnormal larvae in the smu-1;
unc-52(e1421) strain were determined 24 h after removal
of egg-laying hermaphrodites from a growth plate. After an additional
72 h, 8 of 33 severely abnormal larvae and 21 of 21 mildly
abnormal larvae had developed into adults. In control experiments, less
than 3% of smu-1(mn415) or unc-52(e1421)
self progeny from homozygous parents were arrested during embryogenesis.
Molecular biology and cloning of smu-1.
Standard molecular biology techniques (41) were used. All
plasmid subcloning was done with pBluescript SK(
) (Stratagene) unless
otherwise indicated.
smu-1(mn415); unc-52(ts); unc-36 hermaphrodites were
transformed with yeast artificial chromosomes (YACs) or cosmids
containing C. elegans genomic DNA (provided by A. Coulson).
DNA was coinjected with R1p16, a clone that rescues unc-36
(obtained from L. Lobel), at 50 ng/µl. Non-Unc-36
F1 or F2 animals were
placed at 25°C, and their progeny were inspected for non-Unc-36
Unc-52 animals. smu-1 rescue in a mec-8(ts)
background was assayed by similar methods. Yeast genomic DNA containing
YACs was prepared as described (9), except that DNA was
purified over a Genomic-tip 100/G column (Qiagen) and not by
CsCl-ethidium bromide density ultracentrifugation. This DNA was
injected at 80 to 100 ng/µl; all other DNAs were injected at 20 ng/µl. Long PCR products were generated from CC4 DNA using the Expand
long-template PCR system (Boehringer Mannheim). Primers CC4.3F
(TTAAAAAGGGGGACGAATAGAGGTC) and CC4.3R
(ATACGAACACAAGTACCGGTGTGC) amplified the predicted gene
CC4.3; this PCR product rescued smu-1 in four of four lines
and was cloned to create pCS212.
In addition to allele-specific DNA sequence changes, a GC-to-AT base
substitution predicted to cause an amino acid substitution
was found in
all
smu-1 mutants and named
mn621. We recovered
mn621 from the original strain used to generate
smu-1 mutants and determined
that
mn621 does not
suppress
mec-8(ts) and does not affect the
developmental
timing of larval paralysis or embryonic development
in any of the
unc-52 mutants. For clarity, we have omitted
mn621 from
smu-1 genotypes.
RT-PCR.
RNA was isolated (26) and treated with
RNase-free DNase (RQ1; Promega). Reverse transcription (RT)
reaction mixtures contained 5 µg of RNA, 100 ng of random hexamers,
40 U of RNasin, 500 µM concentrations of each deoxynucleoside
triphosphate, and 10 U of avian myeloblastosis virus reverse
transcriptase in 20 µl of avian myeloblastosis virus-RT buffer
(Promega). Reaction mixtures were incubated at 42°C for 2 h
followed by 5 min at 95°C and diluted with 60 µl of TE buffer
(41). Primers for unc-52 PCR included 18/19R
(GAGGCTCTTGGTCCTCAG) and others described previously
(26). Primers for ama-1 PCR were A3
(CCCGGAGGAGATTAAACGCATG), A2
(CAGTGGCTCATGTCGAGTTTCCAGA), and B2
(CGACCTTCTTTCCATCATTCATCGG). To assess linearity, PCR was performed on 1 µl of template for various numbers of cycles and at 25 cycles for multiple-template dilutions. PCR was performed in 25 µl of
PCR buffer A (Fisher) with 250 µM concentrations of each
deoxynucleoside triphosphate, 1 U of RedTaq (Sigma), 25 pmol of each
unc-52 PCR primer, and 5 pmol of each ama-1 PCR
primer. Two combinations of primers were used, with similar results:
(i) 16F plus 18/19R and A3 plus B2 or (ii) 16F plus 19R and A2 plus B2.
All cDNA samples were tested in two independent RT-PCR experiments, with similar results. 16-18-19 PCR products generated from
smu-1(mn415); unc-52(ts) and mec-8(ts) smu-1;
unc-52(ts) RNAs were cloned; all 14 of the clones isolated had
normal 16-18 splice junctions. Reactions were cycled for 30 s at
94°C, 1 min at 54°C, and 1 min at 72°C. Gels were blotted and
hybridized with end-labeled primer 16F-B (TGATCCAGATACCGGAGCGCCAATCG), 18R, or A2. Data were
collected and analyzed using a PhosphorImager and ImageQuant
software (Molecular Dynamics).
RNase protection.
RNA for RNase protection and
Northern analysis was isolated with Trizol (Life Technologies).
RNase protection was performed using an RPAIII kit (Ambion) on 4 to
20 µg of total RNA. The probe for RNase protection was generated
using XhoI-linearized pCS168, a T7 MAXIscript in vitro
transcription kit (Ambion) and 2.5 µl of
[32P]CTP (800 Ci/mmol, 20 mCi/ml) in 10 µl.
Each RNase protection reaction mixture contained 2.5 × 105 cpm of gel-isolated probe that was hybridized
to RNA for at least 14 h at 42°C prior to RNase digestion
(37°C for 30 min; supplied enzyme mix at 1:100 to 1:250). Protected
fragments were resolved on a 5% polyacrylamide-urea gel. Plasmid
pCS168 was generated by cloning the PCR product amplified from N2
cDNA template by the unc-52 16F and 16/18R
(TGGAGTGCCTTGAGCTTC) primers into the EcoRV site
of pBluescript KS(
) (Stratagene) in the reverse orientation. Positive
controls to confirm the identities of the protected 16-18 and 16-17 fragments were performed by conducting RNase protection experiments
with unc-52 sense RNAs generated in vitro from the appropriate cDNAs; these RNAs produced fragments of the expected sizes. Quantitative data were collected and analyzed as for RT-PCR. Linearity was verified in each experiment using multiple concentrations of two or more total RNAs.
smu-1 expression constructs.
pCS167 is a
full-length translational fusion of smu-1 with the green
fluorescent protein (GFP) gene, gfp (7). A
PstI site that replaced the endogenous stop codon was
created, and a PCR-generated gfp-containing fragment with
PstI sites at each end was cloned into this site. The
remainder of smu-1 came from pCS212 (3.8-kb XhoI-XbaI fragment) and CC4 (5.5-kb
ApaI-XhoI fragment). pCS175, a smu-1
construct tagged with hemagglutinin (HA) epitopes (45), was created in the same manner. pCS167 and pCS175 rescued
smu-1 in 7 of 10 and 1 of 6 independently generated lines,
respectively. Chromosomal integration of the
smu-1::gfp array was induced by gamma irradiation
(28). Fixation and antibody staining of embryos and larvae
were as described previously (4, 10). Dilutions of the
antibodies were 1:50 for anti-GFP (Clontech), 1:500 for anti-HA
(Boehringer Mannheim), and 1:500 for fluorescein
isothiocyanate-conjugated goat anti-rabbit or goat anti-rat
secondary antibodies (Cappel).
Nucleotide sequence accession number.
The sequence of the
nearly full-length cDNA yk449d4 has been deposited in GenBank with
accession no. AF330595.
 |
RESULTS |
smu-1 suppresses unc-52 nonsense
mutations in exon 17 but not exon 18.
Loss-of-function mutations
in smu-1 were originally shown (25) to be
strong suppressors of the adult-onset paralysis seen in the viable and
temperature-sensitive allele unc-52(e669su250ts), which
was derived as a spontaneous, intragenic suppressor of the stronger
viable allele e669 (27) and contains the
e669 nonsense mutation in exon 17 as well as a single base
change, su250, in the intron immediately upstream of exon 17 (40). We asked if smu-1(mn415), a probable
null allele of smu-1, is able to suppress stronger but still
viable alleles of unc-52, even weakly. The developmental
stage during which body paralysis was seen in a majority of the larvae
was determined for unc-52 and smu-1(mn415); unc-52 strains. We found that smu-1(mn415)
suppressed unc-52(e669) and unc-52(e1012)
in addition to unc-52(e669su250) (Fig.
1A). Paralysis was delayed by
approximately 24 h for both e669 and e1012.
The suppressed alleles contain nonsense mutations in exon 17 of
unc-52 (40). smu-1(mn415) did
not suppress nonsense mutations in exon 18, represented by
unc-52(e444) and unc-52(e998).

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 1.
smu-1(mn415) suppresses
unc-52 alleles e669,
e669su250, and e1012 in larvae and
enhances unc-52(e1421) in embryos. (A) Developmental
stage of phenotypic onset for various strains containing
unc-52 mutations and smu-1(+) or
smu-1(mn415). (B) A representation of the
alternatively spliced region of unc-52. Exons are
represented by boxes, introns by horizontal lines. The
unc-52 mutations e669,
e1012, e444, and e998 are
premature stop codons; e1421 changes a splice donor site
from GTAAG to GTAAA; and su250 is a single
base-pair change within intron 16 (40). Some of the
alternatively spliced unc-52 transcripts are shown below
the exons as thin lines. The splice form increased by
smu-1 (16-18) is shown as a thick line. Arrows above the
exons represent the RT-PCR primers used to detect the 16-18 and
16-17-18-19 splice forms. (C) smu-1(mn415);
unc-52(e1421) animals with defects in embryonic elongation
and development. On the left is an animal that hatched with hypodermal
constrictions and bulges; on the right is an arrested embryo that has
elongated just over twofold. The arrow points to the well-developed
pharynx characteristic of fully developed embryos, and the arrowheads
point to hypodermal bulges. (D) Wild-type newly hatched L1 larva and
embryo elongated just over twofold for comparison. Bar, 17 µm
(magnifications in panels C and D are identical).
|
|
smu-1 enhances the phenotype of
unc-52(e1421).
The unc-52(e1421)
allele alters the exon 16 splice donor site in the alternatively
spliced region of unc-52 (40). We found that
25% of the self progeny (n = 464) of
smu-1(mn415); unc-52(e1421) hermaphrodites were
arrested as embryos, and an additional 28% exhibited hypodermal
constrictions and bulges at hatching (Fig. 1C). The arrested embryos
had defects in embryonic elongation. Wild-type embryos
elongate to approximately 3.5 times the length of the egg before
hatching (37); arrested smu-1(mn415);
unc-52(e1421) embryos elongated only 2 to 3 times the
length of the egg (Fig. 1C). The arrested embryos showed normal
pharyngeal development but had hypodermal constrictions and bulges. The
most severely affected larvae grew slowly or not at all, but the less
affected larvae recovered and often appeared to be relatively normal
until the onset of paralysis at the early adult stage, which is
characteristic of unc-52(e1421) animals. The strongest
defects seen in the smu-1(mn415); unc-52(e1421)
embryos and larvae were similar to, but weaker than, those seen in
unc-52(null) mutations and in mec-8;
unc-52(viable) double mutants (25).
smu-1 mutations cause an increase in the
accumulation of the 16-18-19 alternatively spliced transcript of
unc-52 in larvae.
The observation that mutations in
smu-1 could suppress the adult-onset paralysis of
unc-52 alleles with nonsense mutations in exon 17 but not
exon 18 suggested that smu-1 mutations might increase the
amount of a splice form that skips exon 17 but not exon 18 (Fig. 1).
Experiments were therefore designed to monitor the relative level of
such unc-52 mRNA in L2-L4 larvae.
Initially, we measured the relative amount of the 16-18-19 mRNA
isoform found in
unc-52(e669su250ts) and
smu-1(mn415); unc-52(e669su250ts) mutants raised at
25°C, where loss of
smu-1 function had a very
obvious
phenotypic effect (Fig.
2A).
Semiquantitative RT-PCR was
performed on larval RNAs isolated from
these strains using primers
designed to amplify both
unc-52 (diagrammed in Fig.
1) and
ama-1 cDNAs. In
unc-52(e669) and
unc-52(e669su250) larvae, the
unc-52 PCR
primers amplified both the 16-17-18-19 and 16-18-19 isoforms,
but the
16-18-19 isoform was more abundant.
ama-1 encodes the
large
subunit of RNA polymerase II (
3) and was used to control
for variation in the amount of total cDNA because its
message
is expressed at a relatively constant level during
postembryonic
development (
20,
21). The data for two
independent RNA isolations
from these strains are plotted in the left
half of Fig.
2A, which
shows about a fourfold increase in the relative
amount of the
16-18-19 isoform in the strains carrying
smu-1(mn415). The magnitude
of the relative increase in
the 16-18-19 isoform in all repetitions
of this experiment ranged
between two- and fivefold (Fig.
2 and
data not shown).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 2.
RT-PCR analysis of the unc-52 16-18-19 transcript in larvae. (A and B) Animals with the indicated genotypes
were raised at 25°C until the L3 larval stage. The amount of the
unc-52 16-18-19 isoform detected in each strain,
normalized with respect to the amount of ama-1 mRNA
amplified in the same RT-PCR, is shown on the y axis. In
panel A, film exposures are shown below the graph. The graphs in panel
C are similar, but the amount of the unc-52 16-18-19 isoform detected was normalized with respect to the
unc-52 16-17-18-19 isoform instead of
ama-1 transcript. These strains were mec-8(+);
unc-52(+) and were raised at 20°C until either the L2 or
L4 larval stage.
|
|
The same type of semiquantitative PCR experiment was performed on
cDNA prepared from strains containing
mec-8(u218ts) in
addition
to
unc-52(e669su250ts). The results (right half
of Fig.
2A) were
essentially identical to those seen in the previous
experiments,
suggesting that
mec-8 does not affect the level
of this particular
isoform. This experiment also demonstrated that
three different
alleles of
smu-1 had the same effect on the
levels of the 16-18-19
isoform produced by
unc-52. To assess
the contribution of the
su250 mutation on the altered
abundance of the 16-18-19 isoform,
we compared the relative
levels of this isoform among (i)
unc-52(e669),
(ii)
smu-1(mn415); unc-52(e669), (iii)
unc-52(e669su250), and
(iv)
smu-1(mn415);
unc-52(e669su250) larvae raised at 25°C (Fig.
2B). This
experiment demonstrated that the loss of
smu-1 function
results in an increase in the amount of the 16-18-19 isoform in
an
unc-52(e669) mutant background. The magnitude of this
increase
was approximately 3.5-fold. This experiment also
showed that the
e669 intragenic suppressor mutation
su250 located in intron 16
(Fig.
1) causes a four- to
sevenfold increase in the amount of
the 16-18-19 isoform (Fig.
2B).
When both
su250 and a
smu-1 mutation
are present,
the level of the 16-18-19 isoform is apparently high
enough to suppress
completely the paralysis conferred by
e669.
Instead of normalizing the 16-18-19 isoform to
ama-1
mRNA, which does not distinguish altered abundance of all
unc-52 transcripts
from changes in just the specific isoform
measured, we compared
the ratio of the 16-18-19
unc-52
mRNA to the 16-17-18-19 isoform
in wild-type and
smu-1
larvae (Fig.
2C). In contrast to the experiments
involving
unc-52(e669) mutations, we found a high level of the
16-17-18-19 isoform and a relatively low level of the 16-18-19
isoform.
This altered proportion is probably due to mRNA surveillance
(
38), which would be expected to reduce the abundance of
the
16-17-18-19 isoform containing the
e669 nonsense
mutation in exon
17. We compared the 16-18-19/16-17-18-19 ratio in
wild-type and
smu-1 larvae (Fig.
2C) and found that there is
roughly a twofold
increase in the ratio in
smu-1 mutants. To
confirm that there
was a similar increase in
smu-1; unc-52
strains, we compared the
relative proportions of the 16-18-19 and 16-19 isoforms in larvae
from
unc-52(e669) and
unc-52(e669su250) strains with and without
smu-1. The ratio of 16-18-19 isoform to 16-19 isoform was
about
twofold higher in the
smu-1 strains and was much
higher in
unc-52(e669su250) animals than in
unc-52(e669) animals (data not
shown).
RNase protection experiments were performed to confirm the results
of the RT-PCR experiments. We used the antisense
unc-52 RNA
probe diagrammed in Fig.
3A. In this
experiment, the proportions
of the 16-18 to 16-17 plus 16-19
unc-52 mRNA isoforms in wild-type
and
smu-1
larvae were compared. We saw an approximately two- to
threefold
increase in the ratio of the 16-18 to 16-17 plus 16-19
isoforms in
smu-1 mutants, consistent with an overall increase
in the
level of the 16-18 mRNA isoform (Fig.
3B). The experiment
performed
on the L4 stage RNA also confirmed that this increase
is a common
property of three different alleles of
smu-1. We repeated
this experiment once more with the L4-stage RNA from N2,
smu-1(mn415) animals, and
smu-1(mn417)
animals with essentially identical results.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 3.
RNase protection analysis of the 16-18 transcript in
wild-type and smu-1 mutant larvae. (A) The antisense
probe used for RNase protection and the unc-52 RNAs
protected by this probe. (B) Data collected from experiments using this
probe. The amount of the 16-18 isoform detected in each strain is
normalized with respect to the other unc-52 isoforms
detected by the antisense probe and is plotted on the y
axis. The RNA came from larval populations grown at 20°C to the L2
and L4 stages.
|
|
Molecular identification of smu-1.
We
identified the smu-1 gene by positional cloning. Genetic
mapping placed smu-1 between unc-101 I and an
insertional dimorphism due to the transposable element Tc1, called
bnP1 (Fig. 4A). We were able
to rescue smu-1 by transformation with a YAC and a cosmid located in this physical interval (Fig. 4B), and a small rescuing region was defined using long PCR products (Fig. 4C).

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 4.
Genetic and physical locations of the
smu-1 gene. (A) Genetic map position of
smu-1. (B) Data from rescue experiments using the YAC
Y102H4 and three cosmids in the physical interval between
unc-101 and bnP1. The number of rescuing
lines is expressed as a proportion of the total number of lines
generated. (C) Structure of the smu-1 gene and a partial
restriction map of the smu-1 genomic sequence. The
structure of CC4.2 was derived from ESTs and partial sequencing of the
cDNA clone yk384h4. Clones and PCR products tested for
smu-1 rescue are shown in the lower portion of the
figure.
|
|
We confirmed that
smu-1 was the predicted gene CC4.3 by
identifying allele-specific lesions in the exons of this gene in five
of the six
smu-1 alleles (Fig.
5A). Southern blot analysis following
HindIII and
EcoRI digestion identified a
rearrangement associated
with the remaining allele (
mn615)
near exon 4 of CC4.3. The molecular
characterizations of
mn415 and
mn609 indicate that they are probably
null mutations.
mn415 changes a glutamine codon to a stop
codon
(CAA to TAA) at amino acid position 255 of the predicted
protein.
mn609 is a 247-bp deletion in exon 4 that alters
the reading frame
of the predicted gene at amino acid position 106.

View larger version (69K):
[in this window]
[in a new window]
|
FIG. 5.
smu-1 encodes a highly conserved gene
with five predicted WD repeats. (A) Alignment of the amino acid
sequence of C. elegans (Ce) SMU-1 with a predicted human
(Homo sapiens [Hs]) protein. Amino acid identities are
boxed in black, and amino acid similarities are boxed in gray.
Predicted WD repeat sequences are underlined, and the positions of
amino acid changes found in the mutant alleles are indicated with
arrows. (B) Alignment of the cores of the WD repeats with the published
consensus sequence (34). Residues in bold match the
consensus sequence.
|
|
Analysis of the smu-1 transcript.
The predicted
exon-intron structure of smu-1 was confirmed by sequencing
the nearly full-length cDNA yk449d4 (Fig. 4C). Many cDNA clones
derived from smu-1 are represented as expressed sequence tags (ESTs) in sequence databases and confirm this exon-intron structure. A probe made from yk449d4 detects a single transcript of
approximately 1.9 kb on Northern blots of total RNA extracted from
wild-type embryos or L4 larvae (data not shown). The yk449d4 cDNA
does not begin with any of the spliced-leader sequences found in
C. elegans, so we performed 5' rapid amplification of
cDNA ends (5' RACE) (13). Eight clones from two
independent 5' RACE experiments indicated that the smu-1
transcript is not trans spliced and that the transcriptional
start site is 16 to 25 nucleotides upstream of the beginning of
yk449d4. The 5' untranslated region of the smu-1 mRNA
contains a 3' splice consensus site (TTTTCAG/C) upstream of the
predicted translation initiation site and 24 nucleotides downstream of
the first predicted transcriptional start site. We did RT-PCR using the
spliced leaders SL1 and SL2 as forward primers and found that this
consensus site can be trans spliced to SL1. However,
since yk449d4 and the 5' RACE clones leave this predicted 3' splice
site intact, we conclude that SL1 trans splicing to
this site is rare. These data are consistent with the observation that
trans splicing to SL1 is inefficient when the length of the AU-rich sequence upstream of the 3' splice site is 41 nucleotides or
fewer (8).
The predicted SMU-1 protein contains five WD repeats and is 62%
identical to a predicted mammalian protein.
Database homology
searches with the predicted SMU-1 protein revealed similarities with a
large family of proteins that contain a repeated motif known as a WD
(or WD-40 or
-transducin) repeat (34). SMU-1 contains
five predicted WD repeats at its C-terminal end. The WD repeats were
identified by a hidden Markov model search against the Pfam database
(2) with the predicted SMU-1 amino acid sequence. Each WD
motif is underlined in Fig. 5A, and the core of each WD repeat is
aligned with the published consensus sequence (34) in Fig.
5B. The last (most C-terminal) WD repeat is a poorer match to the
consensus sequences than are the other WD repeats (the logarithm of the
odds [LOD] score from the hidden Markov model search is only
3.9, where 15 is generally considered significant). A predicted homolog
of smu-1 found in humans encodes a predicted protein with a
stronger match to the WD repeat consensus sequence in an equivalent
position (Fig. 5; this repeat has a LOD score of 27.7). This protein is
predicted to have five WD repeats in exactly the same positions as
SMU-1. The amino acid sequence of the predicted human homolog of SMU-1
is based on the sequence of cDNA AK001667. The completely sequenced
cDNA was isolated from an NT2 teratocarcinoma cell line, but human
EST sequences suggest that the corresponding gene is expressed in many
different tissues and organs.
SMU-1 is 62% identical and 78% similar to its predicted human
homolog. The amino acid sequence similarity extends throughout
the lengths of these proteins (Fig.
5A). We searched EST and
protein
databases using the unique N-terminal region of SMU-1 to
determine
what other organisms had potential
smu-1
homologs. Highly conserved
smu-1 homologs were found
in other invertebrates (
Drosophila melanogaster)
and
in vertebrates (
Mus musculus,
Danio rerio, and
Xenopus laevis)
and plants (
Arabidopsis thaliana)
but not in the yeasts
Saccharomyces cerevisiae and
Schizosaccharomyces pombe.
Rescuing SMU-1::GFP and SMU-1::3HA fusion
proteins are nuclearly localized and widely expressed.
To
determine the expression and subcellular localization patterns of
smu-1 in C. elegans embryos and larvae, we
created expression constructs in which smu-1 was fused to
either the gene for GFP or sequence encoding three tandem HA tags (Fig.
4C). The expression patterns of these two full-length rescuing
transgenes were analyzed by direct visualization of GFP or by antibody
staining with anti-GFP or anti-HA antibodies. The transgenes were
ubiquitously expressed throughout development, and the protein products
were found localized to nuclei (Fig. 6).

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 6.
smu-1 transgenes are widely expressed.
(A) L3 worm carrying the smu-1::3HA transgene
stained with an anti-HA antibody. (B) GFP expression in the intestine
and germ line of an adult hermaphrodite carrying the rescuing
smu-1::gfp transgene. (C) Differential
interference contrast image of the worm shown in panel B. The large
nuclei at the tops of panels B and C are intestinal (black arrows), and
the smaller nuclei below (white arrows) are germ line. The punctate
pattern in the intestine is autofluorescence unrelated to GFP. (D)
Expression of smu-1::gfp in a nine-cell embryo
stained with an anti-GFP antibody. The arrow points to a mitosis. (E)
DAPI image of the embryo shown in panel D.
|
|
In hermaphrodite larvae, we saw expression of the rescuing transgenes
in all types of somatic nuclei (Fig.
6A) and in the
nuclei of the
female germ line (Fig.
6B). Germ line expression
was surprising because
most transgenic arrays seem to be subject
to germ line silencing
(
22). Occasionally neuronal nuclei identified
by DAPI
(4',6'-diamidino-2-phenylindole) failed to stain with
anti-GFP
antibodies in integrated lines containing the rescuing
smu-1::gfp transgene. This was a very small
proportion of the
neurons, and lack of staining in these cases could
have been due
either to technical aspects of the antibody staining
protocol
or to incomplete expression of the integrated transgene
(
28).
Nuclei of the other major tissue types (hypodermis,
intestine,
and muscle) always stained under the same
conditions.
In mid- to late-stage embryos, autofluorescing GFP was visible in all
or most nuclei. In embryos of less than about 200 cells,
we were unable
to detect GFP directly, but fixation and staining
with anti-GFP
antibodies indicated that GFP was present in all
of the nuclei of early
embryos that were not in the process of
dividing (Fig.
6C). Tiny foci
of anti-GFP staining within these
nuclei were often seen (Fig.
6C), but
it is not clear whether
they represent a pattern of subnuclear
localization or are due
to fixation or staining artifacts. Obvious foci
were not seen
in the cells of other developmental stages, although in
some cases
the fluorescence had a rough or uneven appearance when
studied
closely.
 |
DISCUSSION |
We have demonstrated that mutations in smu-1, a highly
conserved gene predicted by genetic analysis to be involved in
alternative splicing, affect the pattern of transcript accumulation
from the unc-52 gene in larvae. Since smu-1 does
not encode a protein predicted to have RNA binding activity, we suggest
that the wild-type SMU-1 protein affects unc-52 transcript
accumulation by interacting with and influencing the activity of other
proteins. What are the functions of these other proteins?
SMU-1 probably does not regulate mRNA stability.
We first
conclude that smu-1 is not a member of the smg
family of genes, which are involved in nonsense-mediated mRNA decay in C. elegans (38). smg mutations
confer phenotypes not seen in smu-1 mutants
(25), and a smg-1 mutation has no effect on the
phenotype of unc-52(e669su250ts) (data not shown), an
allele of unc-52 that is completely suppressed by
loss-of-function smu-1 mutations. Mutations in the
smg genes alter the accumulation of alternatively spliced
products with premature stop codons (32, 29). In contrast,
mutations in smu-1 influence the accumulation of an
alternatively spliced product of unc-52 that does not have a
premature stop codon.
It is possible that
smu-1 is a member of an uncharacterized
complex that influences RNA stability in
C. elegans. We have
done
RT-PCR experiments looking at other mRNA isoforms produced by
the
unc-52 gene (data not shown) and have found no evidence
that
the level of any of the other isoforms produced by
unc-52 is altered
in
smu-1 mutants. The
observation that
smu-1 mutations suppress
unc-52 mutations with stop codons only in exon 17 also
suggests
that the function of
smu-1 is specific with respect
to
unc-52.
If the level of the 16-18-19 isoform rises in
smu-1 mutants due
to increased stability, the complex
responsible for destabilizing
that isoform in wild-type animals in vivo
must be able to distinguish
it from the other, very similar,
unc-52 mRNA isoforms. It seems
more likely that such a
specific effect would be due to a small
change in the pattern of
alternative splicing of the
unc-52 pre-mRNA.
SMU-1 affects alternative splicing of unc-52
pre-mRNA.
The physical nature of many intragenic suppressor
mutations of unc-52(viable) mutations supports the idea
that unc-52(viable) mutations can be readily suppressed
by changes in the pattern of alternative splicing. The changes in
nucleotide sequence associated with 13 independent intragenic
suppressors of the unc-52 alleles e1421,
e1012, e669, and e998 have been
determined (40). Most (11 of 13) were mutations in splice
sites within the alternatively spliced region of unc-52 and
were predicted to alter the patterns of alternative splicing of
unc-52 transcripts. One of these intragenic suppressors was
su250, which was located in the middle of an intron and
predicted to suppress e669 by enhancing the skipping of exon 17. Consistent with this prediction, we found that there is an increase
in the 16-18-19 unc-52 mRNA isoform in
e669su250 larvae grown at 25°C compared to e669
larvae. At 25°C, e669 is partially suppressed by
su250. In general, suppression of e669 by
su250 at 25°C is phenotypically similar to the suppression
of e669 by smu-1, although su250 may
be a slightly stronger suppressor of e669 than
smu-1. Considering that virtually all of the intragenic suppressor mutations appear to affect the splicing patterns of unc-52 pre-mRNA, it seems most likely that the
extragenic suppressor mutation smu-1 acts similarly. In the
rest of this discussion, we consider the implications of our hypothesis
that the wild-type smu-1 gene plays a role in regulating
alternative splicing.
SMU-1 is not an essential RNA splicing factor.
The function of
smu-1 is clearly not required for basic splicing activity in
C. elegans. Null mutations in smu-1 are viable, and the expected phenotype for null mutations in genes that are absolutely required for splicing is embryonic lethality. There are no
characterized mutations in core splicing factors in C. elegans, but the activities of some core splicing factors have been disrupted using the technique of RNA interference
(11). These factors include both subunits of U2AF and the
factor cSAP49, a subunit of the U2-associated factor SF3b (14,
48). As expected, RNA interference of any of these three genes
results in embryonic lethality. It is possible that smu-1
does play a role in basic splicing but that its role is masked by the
function of one or more genes that overlap it in function. However, the
idea that smu-1 does not encode a core component of the
spliceosome is supported by the observation that no homolog of
smu-1 exists in S. cerevisiae, an organism that
has been widely used to study basic splicing reactions. A biochemical
purification of human spliceosomes did not identify a human homolog of
SMU-1 as a component (35).
From these observations, we propose that SMU-1 is a member of a complex
that plays a role in splice site selection during
regulated alternative
splicing and that removing
smu-1 function
causes subtle
alterations in the ratios of alternatively spliced
products produced by
several genes. We propose that the sum of
these small changes in
alternative splicing patterns causes the
slightly smaller brood sizes
and the other subtle phenotypes that
have been observed in
smu-1 mutant animals (
25). Since
mec-8 is also predicted to affect the alternative splicing
of multiple
genes (
9,
26), this model accounts for our
observation that
smu-1 suppresses not only certain alleles
of
unc-52 but also the
phenotypes associated with mutations
in
mec-8. smu-1 is a weak
suppressor of
mec-8, suggesting that
smu-1 may have smaller
effects
on alternative splicing than
mec-8. This is the case
for
unc-52,
the only identified target of both
smu-1 and
mec-8.
SMU-1 is highly conserved among multicellular eukaryotes, suggesting
that its function is also conserved. Excellent in vitro
systems for
studying splicing have been developed for
Drosophila and
mammalian tissue culture cells and could be used to define
SMU-1's
role in splice site selection. Members of the SR family
of RNA binding
proteins are involved in splice site selection
in these systems
(
24), and SR proteins are candidates for proteins
that
interact with SMU-1. Functional characterization of SR proteins
using
RNA interference has demonstrated that removing the individual
functions of these proteins often results in a mild or nonobvious
phenotype in
C. elegans, possibly due to overlapping or
redundant
gene function (
23). Like
smu-1, no SR
protein counterparts are
found in
S. cerevisiae
(
44), and their presence is correlated
with complex
alternative splicing. Members of this protein family
also were not
recovered in the biochemical purification of spliceosomes
mentioned
previously (
35), although SR proteins did copurify
with
spliceosomes under less stringent purification conditions.
Although the
rescuing SMU-1::GFP fusion protein did not obviously
localize
to subnuclear structures, as has been observed for mammalian
pre-mRNA splicing factors such as SR proteins (
42), it
is not
clear whether this type of localization is easily visualized in
C. elegans. C. elegans transformation techniques
generally result
in multiple transgene copies (
28) and
protein overexpression,
which might obscure a pattern of subnuclear
localization, particularly
if SMU-1 is only transiently associated with
the splicing
machinery.
SMU-1 function in larvae.
We suggest that the wild-type
function of smu-1 in splicing unc-52 transcripts
in larvae is either to promote the 16-17 splice or to repress the
16-18 splice. The best way to distinguish these two hypotheses will be
to determine what other proteins SMU-1 interacts with and
whether any of these other proteins are able to bind to specific
sequences in the alternatively spliced unc-52 pre-mRNA.
Candidate target binding sequences would be the relevant splice sites
and nearby sequences that regulate splice site usage. It seems likely
that an intron sequence encompassing the su250 mutation
modulates splice site choice, since this mutation affects the level of
the 16-18 splice form. Loss-of function mutations in the gene
smu-2 strongly resemble mutations in smu-1
(25; A. Spartz, unpublished data), suggesting that the
product of the smu-2 gene may interact with SMU-1 or
function in the same process. We have observed that GFP fluorescence
from the rescuing smu-1::gfp transgene is greatly
diminished in homozygous smu-2(mn416) mutants, suggesting that smu-2 may be required for the production or
stability of SMU-1 (data not shown).
SMU-1 function in embryos.
The observation that a
loss-of-function mutation in smu-1 enhances the embryonic
arrest phenotype but not the larval onset-of-paralysis phenotype
conferred by unc-52(e1421) suggests that
smu-1 regulates the splicing of unc-52
transcripts in embryos and larvae differently. This difference could be
related to differences between embryos and larvae in the alternative
splicing of unc-52 transcripts controlled by other factors,
such as MEC-8. Recent experiments suggest that there is both temporal
and spatial regulation of the production of UNC-52 protein isoforms
generated by alternative splicing (33). If MEC-8's
promotion of the 15-19 and 16-19 unc-52 isoforms occurs predominantly in embryos (as suggested by our unpublished experiments), for example, then an increase in the 16-19 isoform in smu-1
embryos at the expense of the 15-19 isoform could account for the
enhancement of the embryonic arrest phenotype of
unc-52(e1421) by smu-1 mutation; an increase
in the exon 16-containing isoform would lead to increased dependence on
the e1421 mutant splice site. A change in the relative amounts of the mec-8-dependent 15-19 and 16-19 isoforms by
smu-1 mutation would not be expected to affect the embryonic
phenotypes of other viable unc-52 mutations, which affect
exons 17 and 18.
 |
ACKNOWLEDGMENTS |
We thank Todd Starich for much good advice, Claire Kari for able
technical help, Heather Gardner and Angela Spartz for useful discussions about RT-PCR, and Y. Kohara for cDNA clones. Some nematode strains were supplied by the Caenorhabditis Genetics Center.
This work was supported by U.S. National Institutes of Health (NIH)
research grants GM56367 (J.E.S.) and GM22387 (R.K.H.). C.A.S. was a
recipient of a doctoral dissertation fellowship from the University of
Minnesota and a fellowship from NIH training grant HD07480.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Genetics, Cell Biology, and Development, University of Minnesota, 250 BioScience Center, 1445 Gortner Ave., St. Paul, MN 55108. Phone: (612)
624-6203. Fax: (612) 625-5754. E-mail: bob-h{at}umn.edu.
 |
REFERENCES |
| 1.
|
Baker, B. S.
1989.
Sex in flies: the splice of life.
Nature
340:521-524[CrossRef][Medline].
|
| 2.
|
Bateman, A.,
E. Birney,
R. Durbin,
S. R. Eddy,
K. L. Howe, and E. L. Sonnhammer.
2000.
The Pfam protein families database.
Nucleic Acids Res.
28:263-266[Abstract/Free Full Text].
|
| 3.
|
Bird, D. M., and D. L. Riddle.
1989.
Molecular cloning and sequencing of ama-1, the gene encoding the largest subunit of Caenorhabditis elegans RNA polymerase II.
Mol. Cell. Biol.
9:4119-4130[Abstract/Free Full Text].
|
| 4.
|
Bowerman, B.,
B. W. Draper,
C. C. Mello, and J. R. Priess.
1993.
The maternal gene skn-1 encodes a protein that is distributed unequally in early C. elegans embryos.
Cell
74:443-452[CrossRef][Medline].
|
| 5.
|
Brenner, S.
1974.
The genetics of Caenorhabditis elegans.
Genetics
77:71-94[Abstract/Free Full Text].
|
| 6.
|
Chalfie, M., and M. Au.
1989.
Genetic control of differentiation of the Caenorhabditis elegans touch receptor neurons.
Science
243:1027-1033[Abstract/Free Full Text].
|
| 7.
|
Chalfie, M.,
Y. Tu,
G. Euskirchen,
W. W. Ward, and D. C. Prasher.
1994.
Green fluorescent protein as a marker for gene expression.
Science
263:802-805[Abstract/Free Full Text].
|
| 8.
|
Conrad, R.,
K. Lea, and T. Blumenthal.
1995.
SL1 trans-splicing specified by AU-rich synthetic RNA inserted at the 5' end of Caenorhabditis elegans pre-mRNA.
RNA
1:164-170[Abstract].
|
| 9.
|
Davies, A. G.,
C. A. Spike,
J. E. Shaw, and R. K. Herman.
1999.
Functional overlap between the mec-8 gene and five sym genes in Caenorhabditis elegans.
Genetics
153:117-134[Abstract/Free Full Text].
|
| 10.
|
Finney, M., and G. Ruvkun.
1990.
The unc-86 gene product couples cell lineage and cell identity in C. elegans.
Cell
63:895-905[CrossRef][Medline].
|
| 11.
|
Fire, A.,
S. Xu,
M. K. Montgomery,
S. A. Kostas,
S. E. Driver, and C. C. Mello.
1998.
Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.
Nature
391:806-811[CrossRef][Medline].
|
| 12.
|
Francis, R., and R. H. Waterston.
1991.
Muscle cell attachment in Caenorhabditis elegans.
J. Cell Biol.
114:465-479[Abstract/Free Full Text].
|
| 13.
|
Frohman, M.
1990.
RACE: rapid amplification of cDNA ends, p. 28-38.
In
M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White (ed.), PCR protocols: a guide to methods and applications. Academic Press, San Diego, Calif.
|
| 14.
|
Fujita, M.,
T. Kawano,
K. Terashima,
T. Tanaka, and H. Sakamoto.
1998.
Expression of spliceosome-associated protein 49 is required for early embryogenesis in Caenorhabditis elegans.
Biochem. Biophys. Res. Commun.
253:80-84[CrossRef][Medline].
|
| 15.
|
Gilchrist, E. J., and D. G. Moerman.
1992.
Mutations in the sup-38 gene of Caenorhabditis elegans suppress muscle-attachment defects in unc-52 mutants.
Genetics
132:431-442[Abstract].
|
| 16.
|
Grabowski, P. J.
1998.
Splicing regulation in neurons: tinkering with cell-specific control.
Cell
92:709-712[CrossRef][Medline].
|
| 17.
|
Hanke, J.,
D. Brett,
I. Zastrow,
A. Aydin,
S. Delbruck,
G. Lehmann,
F. Luft,
J. Reich, and P. Bork.
1999.
Alternative splicing of human genes: more the rule than the exception?
Trends Genet.
15:389-390[CrossRef][Medline].
|
| 18.
|
Hodgkin, J.
1997.
Genetics, p. 881-1047.
In
D. L. Riddle, T. Blumenthal, B. J. Meyer, and J. R. Priess (ed.), C. elegans II. Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 19.
|
Hresko, M. C.,
B. D. Williams, and R. H. Waterston.
1994.
Assembly of body wall muscle and muscle cell attachment structures in Caenorhabditis elegans.
J. Cell Biol.
124:491-506[Abstract/Free Full Text].
|
| 20.
|
Jeon, M.,
H. F. Gardner,
E. A. Miller,
J. Deshler, and A. E. Rougvie.
1999.
Similarity of the C. elegans developmental timing protein LIN-42 to circadian rhythm proteins.
Science
286:1141-1146[Abstract/Free Full Text].
|
| 21.
|
Johnstone, I. L., and J. D. Barry.
1996.
Temporal reiteration of a precise gene expression pattern during nematode development.
EMBO J.
15:3633-3639[Medline].
|
| 22.
|
Kelly, W. G.,
S. Xu,
M. K. Montgomery, and A. Fire.
1997.
Distinct requirements for somatic and germline expression of a generally expressed Caenorhabditis elegans gene.
Genetics
146:227-238[Abstract].
|
| 23.
|
Langman, D.,
I. L. Johnstone, and J. F. Caceres.
2000.
Functional characterization of SR and SR-related genes in Caenorhabditis elegans.
EMBO J.
19:1625-1637[CrossRef][Medline].
|
| 24.
|
Lopez, A. J.
1998.
Alternative splicing of pre-mRNA: developmental consequences and mechanisms of regulation.
Annu. Rev. Genet.
32:279-305[CrossRef][Medline].
|
| 25.
|
Lundquist, E. A., and R. K. Herman.
1994.
The mec-8 gene of Caenorhabditis elegans affects muscle and sensory neuron function and interacts with three other genes: unc-52, smu-1 and smu-2.
Genetics
138:83-101[Abstract].
|
| 26.
|
Lundquist, E. A.,
R. K. Herman,
T. M. Rogalski,
G. P. Mullen,
D. G. Moerman, and J. E. Shaw.
1996.
The mec-8 gene of C. elegans encodes a protein with two RNA recognition motifs and regulates alternative splicing of unc-52 transcripts.
Development
122:1601-1610[Abstract].
|
| 27.
|
Mackenzie, J. M., Jr.,
R. L. Garcea,
J. M. Zengel, and H. F. Epstein.
1978.
Muscle development in C. elegans mutants exhibiting retarded sarcomere construction.
Cell
15:751-762[CrossRef][Medline].
|
| 28.
|
Mello, C. C., and A. Fire.
1995.
DNA transformation, p. 451-482.
In
H. F. Epstein, and D. C. Shakes (ed.), Caenorhabditis elegans: modern biological analysis of an organism. Academic Press, San Diego, Calif.
|
| 29.
|
Mitrovitch, Q. M., and P. Anderson.
2000.
Unproductively spliced ribosomal protein mRNAs are natural targets of mRNA surveillance in C. elegans.
Genes Dev.
14:2173-2184[Abstract/Free Full Text].
|
| 30.
|
Moerman, D. G.,
H. Hutter,
G. P. Mullen, and R. Schnabel.
1996.
Cell autonomous expression of perlecan and plasticity of cell shape in embryonic muscle of Caenorhabditis elegans.
Dev. Biol.
173:228-242[CrossRef][Medline].
|
| 31.
|
Mori, I.,
D. G. Moerman, and R. H. Waterston.
1988.
Analysis of a mutator activity necessary for germline transposition and excision of Tc1 transposable elements in Caenorhabditis elegans.
Genetics
120:397-407[Abstract/Free Full Text].
|
| 32.
|
Morrison, M.,
K. S. Harris, and M. B. Roth.
1997.
smg mutants affect the expression of alternatively spliced SR protein mRNAs in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. USA
94:9782-9785[Abstract/Free Full Text].
|
| 33.
|
Mullen, G. P.,
T. M. Rogalski,
J. A. Bush,
P. R. Gorji, and D. G. Moerman.
1999.
Complex patterns of alternative splicing mediate the spatial and temporal distribution of perlecan/UNC-52 in Caenorhabditis elegans.
Mol. Biol. Cell
10:3205-3221[Abstract/Free Full Text].
|
| 34.
|
Neer, E. J.,
C. J. Schmidt,
R. Nambudripad, and T. F. Smith.
1994.
The ancient regulatory-protein family of WD-repeat proteins.
Nature
371:297-300[CrossRef][Medline].
|
| 35.
|
Neubauer, G.,
A. King,
J. Rappsilber,
C. Calvio,
M. Watson,
P. Ajuh,
J. Sleeman,
A. Lamond, and M. Mann.
1998.
Mass spectrometry and EST-database searching allows characterization of the multi-protein spliceosome complex.
Nat. Genet.
20:46-50[CrossRef][Medline].
|
| 36.
|
Perkins, L. A.,
E. M. Hedgecock,
J. N. Thomson, and J. G. Culotti.
1986.
Mutant sensory cilia in the nematode Caenorhabditis elegans.
Dev. Biol.
117:456-487[CrossRef][Medline].
|
| 37.
|
Priess, J. R., and D. I. Hirsh.
1986.
Caenorhabditis elegans morphogenesis: the role of the cytoskeleton in elongation of the embryo.
Dev. Biol.
117:156-173[CrossRef][Medline].
|
| 38.
|
Pulak, R., and P. Anderson.
1993.
mRNA surveillance by the Caenorhabditis elegans smg genes.
Genes Dev.
7:1885-1897[Abstract/Free Full Text].
|
| 39.
|
Rogalski, T. M.,
B. D. Williams,
G. P. Mullen, and D. G. Moerman.
1993.
Products of the unc-52 gene in Caenorhabditis elegans are homologous to the core protein of the mammalian basement membrane heparan sulfate proteoglycan.
Genes Dev.
7:1471-1484[Abstract/Free Full Text].
|
| 40.
|
Rogalski, T. M.,
E. J. Gilchrist,
G. P. Mullen, and D. G. Moerman.
1995.
Mutations in the unc-52 gene responsible for body wall muscle defects in adult Caenorhabditis elegans are located in alternatively spliced exons.
Genetics
139:159-169[Abstract].
|
| 41.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 42.
|
Sleeman, J. E., and A. I. Lamond.
1999.
Nuclear organization of pre-mRNA splicing factors.
Curr. Opin. Cell Biol.
11:372-377[CrossRef][Medline].
|
| 43.
|
Sulston, J., and J. Hodgkin.
1988.
Methods, p. 587-606.
In
W. B. Wood (ed.), The nematode Caenorhabditis elegans. Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 44.
|
Tacke, R., and J. L. Manley.
1999.
Determinants of SR protein specificity.
Curr. Opin. Cell Biol.
11:358-362[CrossRef][Medline].
|
| 45.
|
Tyers, M.,
G. Tokiwa,
R. Nash, and B. Futcher.
1992.
The Cln3-Cdc28 kinase complex of S. cerevisiae is regulated by proteolysis and phosphorylation.
EMBO J.
11:1773-1784[Medline].
|
| 46.
|
Williams, B. D., and R. H. Waterston.
1994.
Genes critical for muscle development and function in Caenorhabditis elegans identified through lethal mutations.
J. Cell Biol.
124:475-490[Abstract/Free Full Text].
|
| 47.
|
Williams, B. D.,
B. Schrank,
C. Huynh,
R. Shownkeen, and R. H. Waterston.
1992.
A genetic mapping system in Caenorhabditis elegans based on polymorphic sequence-tagged sites.
Genetics
131:609-624[Abstract].
|
| 48.
|
Zorio, D. A., and T. Blumenthal.
1999.
U2AF35 is encoded by an essential gene clustered in an operon with RRM/cyclophilin in Caenorhabditis elegans.
RNA
5:487-494[Abstract].
|
Molecular and Cellular Biology, August 2001, p. 4985-4995, Vol. 21, No. 15
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.15.4985-4995.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Wang, X., Zhang, W., Cheever, T., Schwarz, V., Opperman, K., Hutter, H., Koepp, D., Chen, L.
(2008). The C. elegans L1CAM homologue LAD-2 functions as a coreceptor in MAB-20/Sema2 mediated axon guidance. JCB
180: 233-246
[Abstract]
[Full Text]
-
Sugaya, K., Hongo, E., Ishihara, Y., Tsuji, H.
(2006). The conserved role of Smu1 in splicing is characterized in its mammalian temperature-sensitive mutant. J. Cell Sci.
119: 4944-4951
[Abstract]
[Full Text]
-
Spartz, A. K., Herman, R. K., Shaw, J. E.
(2004). SMU-2 and SMU-1, Caenorhabditis elegans Homologs of Mammalian Spliceosome-Associated Proteins RED and fSAP57, Work Together To Affect Splice Site Choice. Mol. Cell. Biol.
24: 6811-6823
[Abstract]
[Full Text]
-
Jiang, X., Couchman, J. R.
(2003). Perlecan and Tumor Angiogenesis. J. Histochem. Cytochem.
51: 1393-1410
[Abstract]
[Full Text]
-
Lodato, P., Alcaino, J., Barahona, S., Retamales, P., Cifuentes, V.
(2003). Alternative Splicing of Transcripts from crtI and crtYB Genes of Xanthophyllomyces dendrorhous. Appl. Environ. Microbiol.
69: 4676-4682
[Abstract]
[Full Text]
-
Spike, C. A., Davies, A. G., Shaw, J. E., Herman, R. K.
(2002). MEC-8 regulates alternative splicing of unc-52 transcripts in C. elegans hypodermal cells. Development
129: 4999-5008
[Abstract]
[Full Text]
-
Emes, R. D., Ponting, C. P.
(2001). A new sequence motif linking lissencephaly, Treacher Collins and oral-facial-digital type 1 syndromes, microtubule dynamics and cell migration. Hum Mol Genet
10: 2813-2820
[Abstract]
[Full Text]