Previous Article | Next Article 
Molecular and Cellular Biology, August 2001, p. 5031-5040, Vol. 21, No. 15
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.15.5031-5040.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Maf1p, a Negative Effector of RNA Polymerase III in
Saccharomyces cerevisiae
Krzysztof
Pluta,1
Olivier
Lefebvre,2
Nancy C.
Martin,3
Wieslaw J.
Smagowicz,1
David R.
Stanford,4
Steven R.
Ellis,3
Anita K.
Hopper,4
Andre
Sentenac,2 and
Magdalena
Boguta1,*
Department of Genetics, Institute of Biochemistry and
Biophysics, Polish Academy of Sciences, 02 106 Warsaw,
Poland1; Department of Biochemistry,
University of Louisville Medical Center, Louisville, Kentucky
402923; Department of Biochemistry
and Molecular Biology, Milton S. Hershey Medical Center, Pennsylvania
State University, Hershey, Pennsylvania
170334; and Service de Biochimie et de
Génétique Moléculaire, CEA/Saclay, F-91191
Gif-sur-Yvette Cedex, France2
Received 1 February 2001/Returned for modification 2 March
2001/Accepted 24 April 2001
 |
ABSTRACT |
Although yeast RNA polymerase III (Pol III) and the auxiliary
factors TFIIIC and TFIIIB are well characterized, the mechanisms of
class III gene regulation are poorly understood. Previous studies identified MAF1, a gene that affects tRNA suppressor
efficiency and interacts genetically with Pol III. We show here that
tRNA levels are elevated in maf1 mutant cells. In keeping
with the higher levels of tRNA observed in vivo, the in vitro rate of
Pol III RNA synthesis is significantly increased in maf1
cell extracts. Mutations in the RPC160 gene encoding the
largest subunit of Pol III which reduce tRNA levels were identified as
suppressors of the maf1 growth defect. Interestingly, Maf1p
is located in the nucleus and coimmunopurifies with epitope-tagged RNA
Pol III. These results indicate that Maf1p acts as a negative effector of Pol III synthesis. This potential regulator of Pol III transcription is likely conserved since orthologs of Maf1p are present in other eukaryotes, including humans.
 |
INTRODUCTION |
The yeast RNA polymerase III (Pol
III) transcription system is well characterized. Small untranslated
RNAs with essential housekeeping functions, such as tRNAs, 5S rRNA, or
the U6 small nuclear RNA (snRNA) that is required for mRNA splicing,
are synthesized by Pol III with the help of two general auxiliary
factors, TFIIIC and TFIIIB. The large TFIIIC factor (six subunits)
binds to the DNA promoter elements and assembles the initiation factor
TFIIIB (three components) upstream of the start site. Once TFIIIB is in
position, it recruits the Pol III enzyme (17 subunits) and directs
accurate and multiple rounds of transcription. All of the polypeptide
components of the Pol III apparatus (~1,500 kDa) have been
characterized and found to be essential for cell viability (8,
23). The identification of the components of the Pol III system
has facilitated the description of a cascade of protein-protein interactions that leads to the recruitment of the Pol III enzyme (reviewed in reference 55).
Detailed knowledge of the yeast Pol III transcription system contrasts
with the limited information available on the control of class III gene
expression in yeast. Cellular tRNA levels respond to cell growth rate
(48, 49), to a nutritional upshift (27, 48)
or to nitrogen starvation (36) but only modestly to amino acid starvation (41). Finally, Pol III transcription is
repressed in secretion-defective cells (30). Although the
mechanism of repression is not clear, it does involve activation of the
cell integrity pathway (30). The effect of growth
conditions on Pol III transcription is well mimicked in vitro with
whole-cell extracts (11, 39). tRNA synthesis is
downregulated in dense cell cultures approaching stationary phase, a
result due essentially to reduced TFIIIB activity. The TFIIIB component
Brf/TFIIIB70 was found to be the limiting factor in extracts from such
cells (39). However, the occupancy of the TFIIIB binding
site on the SUP53 gene encoding tRNALeu does not
decrease in stationary-phase cells. Rather, in vivo footprinting data
suggest reduced promoter occupancy by Pol III (25).
In higher eukaryotic cells, Pol III transcription responds to growth
rate, developmental phase, cell cycle position, and a number of
pathological conditions (reviewed in reference 55). The
regulation operates principally at the level of TFIIIB and TFIIIC
(17, 20, 42, 46, 52). The tumor suppressors Rb and p53
inhibit TFIIIB (9, 10, 28, 53). Therefore, it is likely
that the control of Pol III transcription rate is important in
restraining tumor cell proliferation (54). No equivalent negative regulator of Pol III transcription has been found in yeast.
Genes controlling tRNA synthesis in yeast can be identified by nonsense
suppression approaches (22). One candidate for such a gene
is Saccharomyces cerevisiae MAF1. It was originally
identified by the isolation of maf1-1 as a
temperature-sensitive mutation that decreases the efficiency of
SUP11 (tRNA Tyr/UAA) suppression (34). A search
for multicopy suppressors of maf1-1 revealed an intriguing
genetic interaction between MAF1 and RPC160, the gene encoding the largest subunit of the RNA Pol III, C160.
RPC160 genes with 3' deletions in their open reading frame
suppress the maf1-1 phenotypes when overexpressed
(6).
In the present work, we show that tRNA levels are elevated in
maf1-1 cells and that spontaneous mutations in
RPC160 which reduce tRNA levels also suppress the growth
phenotype associated with maf1-1. maf1-1 cell extracts
support increased levels of Pol III transcription in vitro compared to
wild-type cells. Further, we show that Maf1p is a nuclear protein that
physically interacts with RNA Pol III. Therefore, Maf1p appears to be a
negative effector of Pol III activity, potentially regulating the level
of cellular tRNA in response to external signals. A database search
revealed that a variety of organisms have sequences similar to Maf1p,
suggesting that this type of Pol III regulation may not be limited to yeast.
 |
MATERIALS AND METHODS |
Media.
The following media were used for growth of yeast:
YPD (2% glucose, 2% peptone, 1% yeast extract), YPGly (2% glycerol,
2% peptone, 1% yeast extract), and W0 (2% glucose, 0.67% yeast
nitrogen base without amino acids). W0
ura, W0
trp, and W0
leu
contained 20 µg of the amino acids per ml required for growth except
for the single amino acid as indicated. 5-Fluoroorotic acid (5-FOA) medium was prepared as described previously (4).
Sporulation medium (SP1) contains 0.25% yeast extract, 0.1% glucose,
and 0.98% potassium acetate. Solid media contained 2% agar. All
reagents used for media were Difco products.
Strains and plasmids.
The strains used in this study are
listed in Table 1. MT6-7, the
maf1-1 mutant, was derived by ethyl methanesulfonate
mutagenesis of T8-1D (34). The MAF1 gene was
disrupted by replacing the internal NheI-HpaI
fragment with the URA3 cassette, as described previously
(6). KC3-4D, designated as
maf1, was derived
by sporulation of 4A × 11D diploid heterozygous
disruption-deletion of the MAF1 gene. R16 and K2 were
selected as spontaneous revertants of maf1-1 in MB123-2C and
maf1 in KC3-4D, respectively. In MW671-HA the chromosomal
copy of RPC160 is deleted, and C160 is provided by pC160-240
(TRP1 CEN4 HA-RPC160) plasmid carrying the RPC160 gene hemagglutinin HA-tagged at the 5' end (14). DNA
coding for 13 repeats of the myc epitope was inserted just before the stop codon in the endogenous MAF1 in MW671-HA by a PCR-based
gene deletion and modification system (31).
Primers F2MAF
(TGTAATAGATGATAAATCAGATCAAGAAGAATCCCTACAGCGGATCCCCGGGTTAATTAA)
and R1MAF
(AAATAGAAACTTACAATAGTAGACATAAAGGGACTGTTTTGAATTCGAGCTCGTTTAAAC)
containing 20 bases complementary to the template (plasmid
pFA6a-13Myc-kanMX6)
and 40 bases complementary to
MAF1 were
used to amplify the DNA
coding for 13 myc epitopes fused to sequences
encoding a kanamycin
resistance marker. The 2,325-bp PCR product,
pooled from 10 reactions,
was transformed into MW671-HA cells, and
transformants were selected
for geneticin resistance. Insertion of the
myc sequences was confirmed
by PCR and Western blot
experiments.
The resulting strain, MW671-HA,myc, encodes two tagged proteins,
Maf1p-myc and C160-HA. MW671-HA,myc harboring pC160-240 (
TRP1 CEN4 HA-RPC160) was also transformed with pC160-6 (
URA3 CEN4
RPC160)
(
14) and grown on nonselective medium
overnight to allow plamid
loss. MW671-myc was selected because it
cannot grow on W0

trp
and 5-FOA medium but can grow on W0

ura media
because it only
contains pC160-6
(URA3 CEN4 RPC160) and
produces a tagged Maf1p-myc
and nontagged
C160.
To construct a gene encoding HA tagged
MAF1, a
ClaI site was created just upstream of the stop codon of the
MAF1 open reading
frame employing an oligonucleotide,
CTGTATCGATTCTTCTTGATCTG, to
allow in-frame ligation of the
sequence coding for the HA epitope
from pYeFH2 (
12). This
construct was cut with
NotI to insert
the 110-bp
NotI-
NotI fragment from pBF30 that encodes a
triple
HA epitope (
47). The
EcoRI fragment,
containing
MAF1 with its
own promoter and four HAs at the 3'
end, was subcloned into YCp111
(
16), giving YCpMAF-4HA
(URA3 CEN4 MAF1-HA).
Identification of maf1-1 mutation.
Two
overlapping fragments of the maf1-1 allele and control
wild-type MAF1 were amplified by PCR using specific primers,
AmpliTaq DNA polymerase (Perkin-Elmer), and genomic DNA prepared from
strains MT6-7 and T8-1D. The primer sequences were
CGAGGATCCGATGAAATTTATTGATGAGCTAGAT, TGCTGTACCAGAACTG,
GAGGATAAGAAGAAGGAG, and
CGCGGATCCTACTGTAGGGATTCTTC. The PCR products were sequenced
with the same primers in an automatic sequencer ABI PRISM
(Perkin-Elmer).
Immunofluorescence.
Immunofluorescence microscopy of
Maf1p-HA protein was performed as described previously
(37). Mouse 16B12 anti-HA (BabCo) was used in a 1:750
dilution as the primary antibody, and goat anti-mouse Cy3 (Jackson
Immunoresearch Laboratories, West Grove, Pa.) at 1:250 dilution was
used as the secondary antibody. Cells were stained with DAPI
(4',6'-diamidino-2-phenylindole) at a final concentration of 4 µg/ml
for 2 min. Samples were viewed at ×600 magnification on a Nikon
Microphot-S.A. microscope equipped with filters for epifluorescence.
Images were captured and saved electronically.
Preparation of total RNA and Northern analysis.
Cells were
grown in liquid YPD or YPGly at 30°C to log phase
(A600 = ca 0.8) and then shifted to a
restrictive temperature for 2.5 h. Total RNA was isolated from
cells disrupted with glass beads by phenol extraction using LETS buffer
(0.1 M LiCl; 0.01 M Na2EDTA; 0.01 M Tris-Cl, pH 7.4; 0.2%
sodium dodecyl sulfate [SDS]) (26). A total of 10 µg
of each RNA sample was resolved by electrophoresis in 7 M urea, 6%
polyacrylamide gel electrophoresis (PAGE), or 1.2% Tris-borate-EDTA
(TBE) agarose gels. The RNAs were transferred from agarose gel to a
Zeta-probe membrane (Bio-Rad) with 10× SSC (1× SSC is 0.15 M NaCl
plus 0.015 M sodium citrate) by capillary action. For quantitative
studies, slot blots were prepared. The membrane was prehybridized in
4× SSC-20 mM EDTA-0.5% SDS-0.1 mg of denatured salmon sperm DNA
per ml, and the RNA was hybridized at 37°C in the same solution with
oligonucleotide probes labeled with [
-32P]ATP and T4
polynucleotide kinase. The probes were as follows: 5'-GCCATCTCCTAGAATCGAACCAGG-3', complementary to
tRNAHis; 5'-GGTAAATTACAGTCTTGCG-3',
complementary to tRNATyr;
5'-CAGTTGATCGGACGGGAACA-3', complementary to 5S rRNA; and
5'-GGATTGCGGACCAAGCTAA-3', complementary to U3 snRNA. After
hybridization, blots were washed 15 min in 6× SSC at room temperature,
exposed to film, or exposed to a phosphorimager plate. RNA was
quantified using the laser densitometer GelScan XL (Pharmacia).
Arithmetic means and standard deviations of tRNA levels, corrected for
snRNA U3 levels, obtained for at least three independent blots are presented.
In vivo labeling of RNA.
Cells were grown in low-phosphate
YPD at 30°C to an optical density at 600 nm of 0.8 and then
pulse-labeled using 150 µCi of carrier-free
[32P]orthophosphate per ml of culture. After 5 min,
unlabeled potassium phosphate was added to a final concentration of 0.8 M. The cell culture was further incubated for 15 min and then
centrifuged and frozen prior to the preparation of total RNA. Labeled
RNA (5 µg) was separated on a 7 M urea-6% PAGE gel. Gels were
stained with ethidium bromide, dried, and exposed to a phosphor storage plate or autoradiographed. Quantitative analysis of RNA bands was done
as described above.
In vitro transcription.
Wild-type (T8-1D) and
maf1-1 mutant (MT6-7) cell extracts were prepared in
parallel essentially as follows. First, 6 to 8 g of cells grown in
YPD at 30°C was collected in early stationary phase
(A600 = ca. 2.0), washed two times with
solubilization buffer (200 mM Tris acetate, pH 8.0; 10 mM magnesium
acetate; 10 mM
-mercaptoethanol; 10% glycerol), resuspended at 1 ml/g (wet weight) of cells in buffer A800 (180 mM Tris acetate, pH 8.0;
9 mM magnesium acetate; 800 mM ammonium sulfate; 10 mM
-mercaptoethanol; 10% glycerol, 2.5 mM phenylmethylsulfonyl
fluoride; Complete protease inhibitor [Roche]), frozen at
70°C in
dry ice and ethanol, and disrupted in an Eaton press. The homogenized
paste was resuspended at 0.5 ml/g (wet weight) of cells in buffer A400
(same as buffer A800 but with 400 mM ammonium sulfate), and clarified
by centrifugation at 20,000 rpm for 10 min ( Beckman roter JA20). The
extract was then diluted with 1 ml of buffer A400/g (wet weight) of
cells and centrifuged at 40,000 rpm for 150 min in a Beckman 45Ti
ultracentrifuge rotor. The whole supernatant was collected, taking care
to avoid the flaky white layer at the top of the tubes, and dialyzed
for 3 h against 1 liter of transcription buffer (20 mM Tris
acetate, pH 8.0; 8 mM magnesium acetate; 25 mM ammonium sulfate; 0.5 mM dithiothreitol [DTT]; 10% glycerol, 1 mM phenylmethylsulfonyl fluoride; 175 mM potassium glutamate). Insoluble material was removed
by low-speed centrifugation.
Transcription was performed as described by Riggs and Nomura
(
38) with minor modifications. Transcription mixtures (40 µl)
contained transcription buffer with 0.2 mM ATP, CTP, and GTP;
0.01 mM UTP; 10 µCi of [

-
32P]UTP (400 Ci/mmol;
Amersham); 8 U of RNasin inhibitor (Promega),
40 ng of DNA per
template; and protein crude extract. Each transcription
experiment was
carried out with two DNA templates: a mini-35S
rRNA gene
(
35) and a Pol III gene. The transcription extract
(65 µg of protein) was preincubated with the DNA templates for
60 min at
25°C in the transcription mixture in the absence of
nucleotides.
Transcription was initiated by the addition of the
nucleotides, allowed
to proceed for 15 min at 25°C, and then stopped
by the addition of 60 µl of 30 mM EDTA containing
E. coli tRNA
(800 µg/ml).
Nucleic acids were extracted once with phenol-chloroform-isoamyl
alcohol (25:24:1) and, after addition of 200 µl of 2.5 M ammonium
acetate, the RNA was precipitated with 2.5 volumes of ethanol
and
analyzed on a 7 M urea-6% PAGE gel. Gels were exposed to a
PhosphorImager plate (Molecular Dynamics). RNA was quantified
using
ImageQuant software v.1.1. The arithmetic means and standard
deviations
of Pol III transcripts levels, corrected for mini-35S
rRNA levels, were
derived from five independent cell cultures
per
strain.
Immunopurification experiments.
Immunoprecipitation
reactions were performed with cellular extracts (30 µg/µl of
protein in a 50-µl reaction volume) in extraction buffer (HEPES [pH
7.5], 50 mM; EDTA, 0.5 mM; CH3COOK, 500 mM; DTT, 1 mM;
glycerol, 10%). The reactions were incubated while being agitated at
1,000 rpm in the presence of Dynal PanMouse immunoglobulin G beads
(Dynal A.S.) preloaded with either
-myc or
-HA antibody.
Incubation was for 3 h at 4°C. Routinely, 2 µg of antibody was
incubated with 20 µl of the beads (4 × 108/ml).
Beads were recovered by use of a magnet and washed with extraction
buffer. The proteins bound to the beads were separated on SDS-8% PAGE
gels and analyzed by immunoblotting. The protein concentration was
estimated by use of a Bio-Rad protein assay using bovine serum albumin
as a standard.
Immunoblotting.
Proteins separated by SDS-8% PAGE were
transferred electrophoretically to nitrocellulose membranes. After
incubation with a specific antibody as indicated, immune complexes were
visualized with anti-mouse or anti-rabbit monoclonal antibody coupled
to horseradish peroxidase (Amersham Life Sciences). The monoclonal antibodies 9E10 against myc and 12CA5 against HA were applied.
Sequence homology searches.
S. cerevisiae Maf1p
(GI:642810) was searched against several databases using the BLAST (1)
server at The National Center for Biotechnology Information (NCBI).
Similar proteins were exhaustively searched against the same databases
until all similar proteins were identified. The identified protein
sequences were aligned using CLUSTAL X (45) based on the
BLOSUM 62 scoring matrix (19). Complete
MAF1-like genes were identified in Caenorhabditis
elegans (GI:3786409), Candida albicans (Con 5 2883),
and Arabidopsis thaliana (GI:7529279). Partial genomic
sequences resembling MAF1 were identified in the following
organisms: Plasmodium falciparum (AL035476), Cryptosporidium parvum (AQ522040, B83774, and G35235), and
Schizosaccharomyces pombe (GI:2388951, GI:2388963, and
GI:1507665). Translations of expressed sequence tags (ESTs) from the
following organisms appear to be Maf1p homologs: human, AL040071,
AA352022, AA179500, AA486502, AA143586, and others; mouse, AA671675, AA066820, AA467315, AA154074, AA042010, and others; rat, AA899627,
H34701, H32342, AI172177, and AA817806; zebrafish, AI794541;
Drosophila melanogaster, AA142300, AA140704, AI403188,
AA539678, and AI109742; Bombyx mori, AU006267; Brugia
malayi, AA841076 and AA471615; Arabidopsis thaliana,
AL096524, R83973, AI992545, and AA042353; rice, C26657, D24548, C26708,
AU030720, and AQ050286; and Saccharum spp., AA525694.
 |
RESULTS |
Maf1p is a nuclear protein conserved from yeast to humans.
Yeast MAF1 gene (6) encodes a hydrophilic
protein of 395 amino acids rich in serine and asparagine residues with
a predicted molecular mass of 44.7 kDa. Comparison of the Maf1p
sequence with multiple databases using the BLAST server at the NCBI
revealed potential orthologs in human, animals, plants, and lower
eukaryotes (Fig. 1). No potential
prokaryotic orthologs were identified. The eukaryotic proteins
identified share three regions of high similarity that are shown in
Fig. 1 (labeled regions A, B, and C). Within these regions signature
sequences for this protein family can be identified (PDYDFS
and WSfnYFFYNkklKR). These motifs have not been
previously reported in the PROSITE database (21). Interestingly, in the majority of Maf1p homologs, the second motif includes a putative nuclear targeting signal. The PSORT program found
two possible nuclear targeting signals in S. cerevisiae Maf1p: KRRK (position 204) and a double signal RKRK-KRKR
(positions 327 and 328).

View larger version (75K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic representation of Maf1p and potential
orthologs. Abbreviations: Homo sapiens, Hs; Drosophila
melanogaster, Dm; Caenorhabditis elegans, Ce;
Arabidopsis thaliana, At; Schizosaccharomyces
pombe, Sp; Saccharomyces cerevisiae, Sc;
Plasmodium falciparum, Pf. Conserved domains are boxed and
labeled by letters A (dashed box), B (black box), and C (gray box) in
the upper panel. Sequence alignments of each conserved domain (A, B,
and C) are shown in the lower panel. Amino acids conserved in at least
two sequences are boxed. A star indicates the maf1-1
mutation substituting a stop codon for W319. The two Maf1p-specific
signature sequences are underlined.
|
|
To investigate whether Maf1p represents a new family of eukaryotic
nuclear proteins, four in-frame sequences encoding the
HA epitope were
introduced at the 3' terminus of
MAF1. The epitope-tagged
version of the gene subcloned into the centromeric plasmid generating
YCpMAF-4HA complemented the growth phenotypes of
maf1-1
(MT6-7)
and
maf1 disruption (KC3-4D). In strains
containing YCpMAF-4HA,
the anti-HA antibody revealed a protein of about
49 kDa that corresponded
to the size expected for HA-tagged Maf1p (not
shown). When
maf1 cells transformed with YCpMAF-4HA were
inspected by indirect immunofluorescence
microscopy, a specific signal
derived from epitope-tagged Maf1p
was detected in the nucleus (Fig.
2), while the cytoplasmic background
was
the same as in the negative control. Therefore, we concluded
that Maf1p
is a nuclear protein.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 2.
Nuclear localization of Maf1p. maf1
(KC3-4D) cells were transformed with the control YCp111 plasmid (A and
B) or YCpMAF-4HA, a single-copy plasmid encoding HA-tagged Maf1p (C and
D). The cells were stained with DAPI (A and C) or tagged with the 16B12
antibody that recognizes the HA epitope in Maf1p-HA (B and D).
|
|
The nature and precise location of the
maf1-1 mutation was
determined by DNA sequencing. The mutant gene has a single nucleotide
change from G to A at position 957, resulting in the change of
codon
319 encoding tryptophan into a UGA stop codon. The
maf1-1 mutation is localized to the 3' end of the gene, maps into the
signature sequence located in conserved region C, and eliminates
the
putative nuclear targeting signal RKRK-KRKR at positions 327
and 328 (Fig.
1). We assume that Maf1p function is inactivated
in
maf1-1 since the temperature-sensitive respiratory growth
and
antisuppressor phenotype are the same as those observed in strains
containing disrupted alleles of
MAF1 (
6).
Mutations in RPC160 suppress the maf1
defects.
To gain a better understanding of Maf1p function, we
searched for second-site suppressors of maf1-1 and
spontaneous bypass suppressors of a
maf1 disruption.
maf1 mutants are temperature sensitive on nonfermentable
carbon sources (6). We selected for suppressor mutations
that allowed colonies to grow at the restrictive temperature of 37°C
on glycerol-containing medium (YPGly). Three spontaneous revertants of
maf1-1, i.e., R2, R9, and R16, were isolated. R2 and R9 were
obtained from MT6-7, while R16 was obtained from MB123-2C (Fig.
3A). All partially complemented the
antisuppressor phenotype of maf1-1 (not shown). In a
parallel screen, one revertant, K2, was isolated in
maf1
KC3-4D, the MAF1 deletion strain (Table 1). All four
suppressors were haploid maf1 mutants with additional
chromosomal suppressor mutations that gave a cold-sensitive phenotype.
The phenotype of R16 was the most severe since cell growth was
reduced at the permissive temperature. Mating of yeast containing
the suppressors to each other yielded cold-sensitive diploids,
indicating that all mutant alleles were members of a single
complementation group.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 3.
Mutations in the RPC160 gene are second site
suppressors of maf1 mutants. (A) The R16 suppressor
(rpc160-16 maf1-1) and its isogenic maf1-1 strain
(MB123-2C), The K2 suppressor (rpc160-2 maf), and the
isogenic maf strain (KC3-4D) were grown on YPD and
replicated on YPD and YPGly prior to incubation at the indicated
temperatures. (B) In vivo content of small RNA species in the
rpc160-2 mutant carrying the wild-type MAF1
(strain MB156-1B; Table 1) transformed with empty vector ([ ]) or
pC160-6 plasmid ([C160]) that complements its cold-sensitive
phenotype. Cells were grown in glucose selective medium and shifted to
a nonpermissive temperature (2.5 h at 16°C). RNA was extracted and
separated by electrophoresis on a 7 M urea-6% PAGE gel using equal
amounts of RNA per lane (10 µg). The gel was stained with ethidium
bromide.
|
|
Analysis of progeny from crosses of R2, R9, R16, and K2 with wild-type
strains showed that the suppressor mutations were recessive
and
unlinked to
maf1. The temperature-sensitive phenotype
segregated
2:2 in all tetrads when backcrosses of each single
suppressor
to the parental
maf1-1 or
maf1
strains were performed. This indicates
that a single nuclear locus was
responsible for the suppression
effect. The cold-sensitive phenotype in
these strains segregated
2:2 in tetrads and was linked to
ade2-1. This linkage was further
analyzed in a cross of
strain K2 with J12-5C (Table
1). Among
20 tetrads analyzed, 18 were PD
(parental ditype), indicating
a 5-centimorgan (cM) genetic linkage of
ade2-1 and the cold-sensitive
mutation (
40).
Given our previous results identifying truncated
forms of
RPC160 as a high-copy-number suppressor of
maf1-1, we
hypothesized that the cold-sensitive suppressor
mutations recovered
here map in
RPC160, which is located
about 20 kbp from
ADE2 on
chromosome XV as indicated from
the yeast genome sequencing data.
The physical distance between
RPC160 and
ADE2 correlated well
with a genetic
linkage of 5 cM (
33). Indeed, introduction of
a
centromeric plasmid carrying
RPC160 complemented the
cold-sensitive
growth of K2 and R16. These mapping and rescue data
indicated
that the suppressor mutations are located in
RPC160.
The K2 suppressor mutant was back-crossed with a parental wild-type
strain to separate
maf1-1 and
rpc160 alleles by
meiosis.
The cold-sensitive phenotype of MB156-1B
rpc160-2
carrying the
wild-type
MAF1 (Table
1) was fully complemented
by pC160-6 centromeric
plasmid encoding C160 (Fig.
3B). Total RNA
was isolated from
rpc160-2 transformed with empty vector or
with plasmid-encoded C160. Examination
of an ethidium-stained RNA gel
reveals that the
rpc160-2 mutation
leads to reduced levels
of tRNA (Fig.
3B).
Increased tRNA levels in maf1 mutants correlate with
increased tRNA synthesis rate in vitro.
The recovery of
RPC160 mutant alleles as suppressors of maf1-1
prompted us to investigate tRNA levels in maf1 mutants.
Total RNA was isolated from maf1-1 (MT6-7),
maf1 (KC3-4D), and the isogenic parental strains (T8-1D
and 11D, respectively) grown with a shift to the restrictive growth
conditions. Separation of total cellular RNAs by electrophoresis and
examination of ethidium-stained gels revealed a substantial increase of
tRNA levels in maf1-1 cells, whereas the levels of 5S and
5.85 rRNA remained stoichiometric and seemed to be unaffected by the
maf1-1 mutation (Fig. 4A).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 4.
tRNA levels are elevated in maf1-1 strains
and subsequently reduced in a maf1 rpc160 cold-sensitive
suppressor strain. Total RNA was isolated from yeast cells after a
shift to a nonpermissive temperature in YPGly (2.5 h at 37°C). (A)
Small RNA species from maf1-1 (MT6-7) and the parental
strain (T8-1D) were separated on a 7 M urea-6% PAGE gel using equal
amounts of RNA per lane (10 µg) and stained with ethidium bromide.
(B) Northern analysis of RNA from the wild-type (11D WT),
maf1-1 (MT6-7), and parental strain isogenic to
maf1-1 (T8-1D) using labeled oligonucleotide probes
complementary to U3 RNA, 5S rRNA, tRNAHis, or
tRNATyr, as indicated. (C) Northern analysis of RNA from
the wild-type (11D WT), maf1-1 (MB123-2C), and
maf1-1 strains with a suppressor mutation in C160 (R16)
using the probes indicated as in panel B.
|
|
Northern blots were performed to confirm this observation. RNA was
transferred to a membrane and hybridized with oligonucleotide
probes
specific to tRNA
His and tRNA
Tyr, 5S rRNA, and
U3 snRNA. U3 snRNA, transcribed by Pol II, was
used as an internal
control to standardize RNA loading. In
maf1-1 (Fig.
4B) and
maf1 strains (data not shown) the levels of
tRNA
His and tRNA
Tyr were markedly elevated
compared to wild-type tRNA levels in the
isogenic parental strains or
in a standard wild-type strain. This
tRNA increase was detected
independently in two
maf1 mutants (
maf1-1 and
maf1) from different genetic backgrounds. Thus, it is
clear
that the increase is due to the inactivation of Maf1p.
Quantification
of the Northern blots revealed that
maf1-1
cells have, respectively,
(4.0 ± 0.2)- and (3.5 ± 0.1)-fold
elevated levels of tRNA
Tyr and tRNA
His over
that of the wild-type when corrected for U3 snRNA content.
Consistent
with the observations made with ethidium-stained RNA,
Northern blots
showed no significant change of 5S rRNA level in
maf1 versus
wild-type strain when U3 snRNA is taken as an internal
control (Fig.
4B)
In accordance with the growth phenotype, the R16 (Fig.
4C) and K2 (data
not shown) cold-sensitive
rpc160 suppressors reduce
tRNA
levels in
maf1 mutants. tRNA
Tyr and
tRNA
His are reduced (5.0 ± 0.5)- and (8.2 ± 2.1)-fold, respectively,
in R16 cells compared to
maf1-1
cells without this suppressor
(Fig.
4C). The reductions of
tRNA
Tyr and tRNA
His by the K2 suppressor
mutation are, respectively, (2.1 ± 0.3)-
and (2.5 ± 0.5)-fold (data not shown). Therefore, suppression
of the Maf1p
deficiency by mutations in the C160 subunit of Pol
III appears to be
correlated with a reduction of tRNA
levels.
Since tRNA content is increased in
maf1 mutant cells, we
determined whether the absence of functional Maf1p could increase
tRNA
synthesis in vitro. We compared the transcription of SUP4
tDNA
Tyr and tDNA
Leu3 in cellular extracts
prepared from
maf1-1 and wild-type cells.
We used crude
extracts so as to avoid removing Maf1p or putative
components important
for Maf1p function in the wild-type samples.
Radiolabeled transcripts
were analyzed by urea-PAGE, and the rate
of tRNAs transcription was
monitored by quantitating the bands
as described in Materials and
Methods. The relative transcription
rates in wild-type and
maf1-1 extracts were estimated by reference
to the
transcription of a mini-35S rRNA gene (a Pol I transcript)
used as an
internal control. As shown in Fig.
5A,
there was a
reproducible increase in the transcription rate of the two
tRNA
genes in
maf1-1 crude extracts (lanes 1 to 4). Means of
different
transcription assays using five independent crude extracts
per
strain and corrected for mini-35S rRNA levels established firmly
the enhanced transcription rate of tRNA genes in crude extracts
from
maf1-1 cells (Fig.
5B). Remarkably, the U6 snRNA and 5S rRNA
were also reproducibly and significantly more actively transcribed
in
maf1-1 extracts (Fig.
5A, lanes 5 to 8, and Fig.
5B),
suggesting
that all class III genes could be affected by
maf1-1 to different
extents.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 5.
Increased transcription of different Pol III genes in
maf1-1 deficient cell extracts. Transcription assays were
performed as described in Materials and Methods using a mixture of two
genes: a gene transcribed by Pol III and a mini-35S rRNA gene
transcribed by Pol I. Transcription was carried out using cell extract
(65 µg) from maf1-1 (MT6-7) or parental (T8-1D) strains.
RNA was analyzed by urea-PAGE and quantified with a PhosphorImager
(Molecular Dynamics). RNA levels transcribed by Pol III were normalized
to the level of mini-35S rRNA transcript. (A) Specific transcription of
various genes transcribed by Pol III in crude extracts from wild-type
(odd lanes) or maf1-1 cells (even lanes). The different DNA
templates are indicated. Lane 9, control experiment with no Pol III
gene; lane 10, negative control experiment with no added template DNA.
(B) Arithmetic means and standard deviations of Pol III transcript
levels, corrected for mini-35S rRNA levels, using five independent
crude extracts per strain. The different DNA templates are indicated.
All of the RNA bands shown in panel A were used for quantification.
Gray bars, wild-type crude extract; black bars, maf1-1 crude
extracts; AU, arbitrary units.
|
|
Transcription of tRNA was also monitored in vivo by pulse-labeling.
Late-log-phase cells from
maf1-1 and wild-type strains
in
low-phosphate medium were incubated for 5 min with
[
32P]orthophosphate at the permissive temperature. After
the addition
of excess unlabeled phosphate and further incubation for
15 min
to allow for the maturation of 5.8S rRNA, the total RNA was
isolated
and analyzed by SDS-PAGE and autoradiography. Labeling of tRNA
band in
maf1-1 cells was found to be increased (3 ± 0.8)-fold.
A small increase in 5S rRNA synthesis rate was also observed
(Fig.
6).

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 6.
In vivo 32P labeling of RNA. The wild-type
(T8-1D) and mutant (MT6-7) cells grown in low-phosphate medium were
pulse-labeled for 5 min and supplemented with an excess of
nonradioactive phosphate for 15 min to allow for the maturation of 5.8S
rRNA. RNAs were extracted and analyzed as described in Materials and
Methods. Loading of equal amounts of RNA in each lane was confirmed by
staining with ethidium bromide prior to drying of the gel and
autoradiography. Synthesis rate of tRNA and 5S rRNA is expressed
relative to the 5.8S rRNA species.
|
|
Maf1p interacts with RNA Pol III.
These genetic studies showed
that the effect of Maf1p deficiency causing elevated tRNA levels is
suppressed by alterations of C160. This genetic interaction suggested
that Maf1p and Pol III might physically interact. Coimmunopurification
experiments were therefore performed to investigate the possibility of
a complex formation between Maf1p and RNA Pol III.
We constructed a strain expressing both C160 and Maf1p tagged with
different epitopes. We used the strain MW671-HA (see Table
1) harboring
a lethal
rpc160 deletion complemented by the HA-tagged
RPC160 gene harbored on a centromeric plasmid
(
14), and the
chromosomal
MAF1 gene in MW671-HA
was tagged with the sequence
of 13 myc epitopes at its carboxyl
terminus (see Materials and
Methods). The resulting strain, MW671-HA,
myc, which encodes two
tagged proteins, Maf1p-myc and C160-HA, has a
wild-type phenotype
with respect to
MAF1 and
RPC160. The control strain, MW671-myc,
codes for a tagged
Maf1p-myc and the untagged version of
C160.
Extracts prepared from MW671-HA,myc, MW671-HA, and MW671-myc were
incubated with magnetic beads coated with anti-myc monoclonal
antibody.
The beads were washed, and the bound proteins were eluted
and analyzed
by SDS-PAGE, followed by immunoblotting. The anti-myc
antibody revealed
a single band of about 70 kDa in extracts from
MW671-HA,myc
(
RPC160-HA MAF1-myc) and from MW671-myc
(
MAF1-myc).
This protein band was not observed in the
control extract from
MW671-HA (
RPC160-HA) (Fig.
7A, left panel) and therefore corresponds
to Maf1p-myc, although the predicted molecular mass of the tagged
protein was somewhat lower (65 kDa). Interestingly, a significant
fraction (5 to 10%) of HA-tagged C160 was found to copurify with
Maf1p-myc when the MW671-HA,myc (
RPC160-HA MAF1-myc) extract
was
incubated with anti-myc beads. The control immunopurified material
from MW671-HA (
RPC160-HA) cell extracts did not contain
Maf1p-myc
nor C160-HA (Fig.
7A, left panel). These results suggested
the
interaction of Maf1p and C160 subunit or at least the interaction
of Maf1p and Pol III.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 7.
Maf1p interacts with RNA Pol III. Crude extracts from
cells expressing HA-tagged C160 (RPC160-HA), myc-tagged
Maf1p (MAF1-myc) or both (RPC160-HA MAF1-myc)
were incubated with magnetic beads coated with anti-myc (left panels)
or anti-HA (right panels) antibodies. The beads were washed, and the
bound polypeptides were eluted and analyzed by SDS-PAGE, followed by
immunoblotting using specific antibodies, as indicated on the left. For
clarity, the polypeptides revealed by the specific antibodies are
identified on the right. (A) The beads coated with anti-myc antibodies
retained specifically Maf1p-myc; background retention of C160-HA was
undetectable. However, C160-HA copurified with Maf1p-myc (left panel).
Reciprocally, Maf1p-myc was specifically retained on the anti-HA beads
only in the presence of C160-HA (right panel). (B) Pol III subunits
C82, AC40, and C34 specifically copurified with Maf1p-myc (left panel),
as well as with C160-HA (right panel).
|
|
To reinforce this conclusion, a reciprocal experiment was performed
using anti-HA specific antibody for immunopurification
of Pol III,
followed by analysis for the presence of Maf1p-myc.
Probing with
anti-HA antibody indicated that C160-HA was retained
on the magnetic
beads from MW671-HA,myc (
RPC160-HA MAF1-myc) and
MW671-HA
(
RPC160-HA) but not from MW671-myc (
MAF1-myc)
extracts.
Using the anti-myc antibody, the presence of Maf1p-myc was
detected
in the immunocomplex purified from MW671-HA,myc
(
RPC160-HA MAF1-myc)
extract (Fig.
7A, right panel),
providing evidence that Maf1p
binds to Pol III in vivo. According to
our estimation, about 15%
of the Maf1p present in the extract
copurifies with the RNA polymerase.
As a control for the specificity of
this interaction, a protein
extract from MW671-myc
(
MAF1-myc) was used in the same protocol
with the anti-HA
antibody under the same conditions as described
above. As expected,
neither C160-HA nor Maf1p-myc was
detected.
The anti-myc immune complex from the MW671-myc (
MAF1-myc)
extract was examined further to determine if the whole Pol III complex,
and not simply C160, was bound to Maf1p. Indeed, three other subunits
of RNA Pol III

C82, C34, and AC40

were found to copurify with
Maf1p
(Fig.
7B, left panel). These polypeptides were not detected
in the
control extract from MW671-HA (
RPC160-HA) cells subjected
to
the anti-myc
immunoprecipitation.
Note that the relative intensity of the immune complex in the Western
blots was similar when Pol III was directly immunopurified
by anti-HA
antibody (Fig.
7B, right panel) or copurified with
the myc-tagged Maf1p
(Fig.
7B, left). These results confirmed
the associations of Maf1p and
Pol III. As determined by Western
blot analysis, neither TBP nor

55,

95, and

131 subunits of
TFIIIC copurified detectably with Maf1p.
A slight increase of
Brf1/TFIIIB70 signal above background suggested
the possibility
of a Maf1p-TFIIIB70 interaction (results not
shown).
 |
DISCUSSION |
Regulation of Pol III-directed tRNA biosynthesis is a potentially
important mechanism that may contribute to the cell metabolic economy
and coordination of translation with growth. The genetic and
biochemical data presented here support the model that in S. cerevisiae Maf1p is a negative effector of Pol III: (i) mutations in the MAF1 gene increased the level of tRNAs in vivo and
the rate of Pol III RNA synthesis in vitro; (ii) Maf1p, a nuclear protein, coimmunopurified with the components of the Pol III complex; and (iii) mutations in the largest Pol III subunit, C160, suppressed mutations in MAF1 and restored normal levels of tRNA. The
presence of proteins similar to yeast Maf1p in a wide variety of
organisms suggests that Maf1p homologs may provide a mechanism for the
coordination of Pol III transcription with cell growth rate in eukaryotes.
Pleiotropic phenotype of maf1 mutants.
maf1-1 was originally isolated as a mutation that decreases
the efficiency of the tRNA suppressor SUP11. Although one
might have anticipated that increased cellular tRNA levels would
improve the efficiency of tRNA-mediated nonsense suppression, our data show the opposite. There are a number of mechanisms that could account
for this counterintuitive result. First, since SUP11 tRNA is
a minor tRNA Tyr/UAA, even if SUP11 tRNA is proportionally elevated in the maf1 tRNA population, it may compete less
efficiently for tyrosyl-tRNA synthetase, EF1
, or ribosome binding,
resulting in the observed antisuppressor phenotype. This explanation is supported by the observation that increasing the copy number of a
SUP11 tRNA encoding gene overcomes the antisuppression of
maf1-1 cells (K. Pluta and M. Boguta, unpublished results).
Alternatively, reduced suppression could result from altered
SUP11 tRNA modification. We recently reported that cells
have limiting quantities of dimethylallyl pyrophosphate
(3), the precursor for the i6A modification
found at position 37 of tRNATyr. Since suppression is
dependent upon this modification and tRNAs are overproduced, it is
possible that not all i6A-containing tRNAs are completely
modified in maf1 cells. Our preliminary results indicate
that tRNAs in maf1-1 strains contain i6A (M. Boguta and N. C. Martin, unpublished results); nevertheless, partial modification would result in reduced nonsense suppression.
In addition to having high tRNA levels,
maf1 mutants are
also temperature sensitive when grown on nonfermentable carbon sources,
suggesting a connection between Maf1p and mitochondrial biogenesis
or
function. Since Maf1p is a nuclear protein, its location is
inconsistent with a mitochondrial function. Nonetheless, this
is not
the first example of a mutation that alters tRNA biogenesis
and the
ability of yeast cells to grow on respiratory substrates.
A partial
deletion of the N-terminal domain of

55, a TFIIIC subunit
required
for tRNA transcription, impairs its function and cell
growth at
elevated temperatures on nonfermentable carbon sources
(
32). Maf1p may be involved in coupling carbon metabolism
to
tRNA transcription because the levels of tRNA in
maf1-1
cells
are fourfold increased on nonfermentable carbon source and only
twofold increased on fermentable carbon source (data not
shown).
Effect of Maf1p on Pol III transcription.
Steady-state tRNA
levels in maf1 mutants are significantly increased relative
to 5S rRNA levels that reflect the cellular content in the 60S
ribosomal subunit. Northern analysis confirmed that the level of two
different tRNAs, tRNAHis and tRNATyr, increased
about fourfold but the 5S rRNA level remained the same relative to U3
RNA that is a Pol II transcript. That result is supported by
pulse-labeling experiments showing a threefold increase of tRNA
synthesis in maf1-1 relative to 5.8S rRNA (Fig. 6). It is
likely that the population of tRNAs was increased as a whole, as also
suggested by the trailing of the tRNA species in ethidium
bromide-stained stained gels (Fig. 4A).
Remarkably, in vitro mutant extracts showed a small but reproducible
increase in tRNA synthesis and a larger effect on 5S
rRNA, also a Pol
III transcript. The fact that the in vitro synthesis
rate but not the
steady-state level of 5S rRNA in vivo is affected
in the absence of
functional Maf1p is intriguing. This result
is reminiscent of the in
vivo observation that mutations in essential
components of the Pol III
transcription system, including several
Pol III subunits (C34, C31,
C82, C55, and C160), caused a strong,
preferential decline in tRNA
synthesis, while 5S rRNA synthesis
and the 5S rRNA/5.8S rRNA ratio
remained relatively unaffected
(
18,
43). This observation
is only partly understood (
13).
Since cell extracts from
maf1-1 cells were found to be more active
in transcribing
several class III genes, including the 5S rRNA
gene, in vitro, we
suggest that the 5S rRNA made in excess of
ribosome biogenesis needs is
rapidly turned
over.
Interaction of Maf1p with RNA Pol III.
The increased in vitro
Pol III transcription of maf1-1 extracts suggests a direct
interaction of Maf1p with the Pol III complex. The observation that
mutations in the largest subunit of Pol III, C160, counteract
MAF1 inactivation led us to investigate a possible physical
interaction between Maf1p and Pol III. Immunopurification experiments
demonstrated that Maf1p is directly or indirectly tightly associated
with C160 in cell extracts. The precise binding target of Maf1p on Pol
III, however, is undefined since C160 is part of a 17-subunit enzyme.
That Maf1p is bound to Pol III and not to a hypothetical free pool of
C160 polypeptides was confirmed by showing that three additional
subunits of Pol III (C34, AC40, and C82) copurify, together with C160,
with Maf1p. This finding strongly suggests that Maf1p represses tRNA
synthesis by a direct action on the Pol III enzyme.
Maf1p might interfere with Pol III recruitment by the preinitiation
TFIIIB-TFIIIC-DNA complex, or it might block a later stage
of the
transcription cycle or counteract a putative activator
that might
either be a component of the Pol III transcription
machinery or an
yet-as-unknown protein interacting with the Pol
III enzyme. One could
propose a model in which an undefined activator
would bind to the
N-terminal part of C160 to account for the fact
that overexpression of
that small part of C160 suppresses the
maf1-1 defect,
possibly by titrating the activator (
6). Limitation
of the
activator would in consequence decrease the tRNA levels.
The
rpc160 cold-sensitive mutations could similarly interfere
with the interaction or the function of the putative activator.
Alternatively, these mutations could decrease the basal enzyme
activity, thereby restoring a lower level of tRNA. This explanation
is
in keeping with the cryosensitive phenotype of the R16 and
K2
suppressors but does not account well for the fact that all
suppressor
mutations isolated affected C160 and not other subunits
of Pol III. It
is interesting that stationary-phase cells, with
repressed tRNA
synthesis, have a normal in vivo footprinting pattern
on the TFIIIB
binding region and a decreased occupancy of the
transcription start
site (

10 to +15 region) indicative of a Pol
III recruitment defect
(
25). Our attempts to supplement Maf1p-deficient
transcription extracts with recombinant Maf1p to restore control
(decreased) levels of
SUP4 DNA transcription were
unsuccessful.
Maf1p, the founding member of a new class of Pol III negative
effectors.
There is a remarkable conservation of the yeast and
human Pol III machineries. The most conserved components are those
involved in transcription complex assembly: subunit of TFIIIC,
131,
all components of TFIIIB (TBP, Brf/TFIIIB70, and B"/TFIIIB90), and the
tetrad of Pol III-specific subunits (C82, C34, C31, and C17) all have
structural and functional homologs in human cells (2, 15, 24, 44,
50, 51). Since Maf1p is conserved across a wide range of
organisms, it is probable that the orthologs of Maf1p are involved in
Pol III regulation in higher cells. This would be very interesting in
light of the connection between Pol III regulation and the malignancy
process (29). The abundance of Pol III transcripts is
abnormally elevated in many types of transformed and tumor cells
(55). In mammals, two tumor suppressors, Rb
(53) and p53 (7, 9), act as global repressors
of Pol III transcription. Rb and p53 interact with and inactivate
TFIIIB (9, 10, 28). Remarkably, Rb mutations occurring in
tumors also release TFIIIB from repression (10).
Deregulation of the control of Pol III and Pol I transcription is
clearly an important step in tumor development. Therefore, it will be
important to determine whether Maf1p orthologs really represent a new
class of Pol III regulators in mammals.
 |
ACKNOWLEDGMENTS |
We thank B. Szczesniak and M. Steffen for excellent technical
assistance. We are also grateful to Joël Acker, Christine Conesa, Gérald Peyroche, and Emmanuel Favry (CEA/Saclay) for helpful discussions and their help with the in vitro experiments.
This work was supported by State Committee for Scientific Research
(KBN) grant 6PO4B02915 to K.P. and M.B., State Committee for Scientific
Research grant 6P04A03315 to K.P. National Science Foundation grant MCB
9506810 to A.K.H., National Science Foundation grant MCB9528216 to
N.C.M., and French-Polish Centre of Biotechnology of Plants grants to
K.P. and W.J.S.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Genetics, Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawinskiego 5a, 02 106 Warsaw, Poland. Phone: (48 22)659-70-72, ext. 1312. Fax: (48)39121623. E-mail:
magda{at}ibbrain.ibb.waw.pl.
 |
REFERENCES |
| 1.
|
Altschul, S. F.,
T. L. Madden,
A. A. Schaffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402[Abstract/Free Full Text].
|
| 2.
|
Arrebola, R.,
N. Manaud,
S. Rozenfeld,
M. C. Marsolier,
O. Lefebvre,
C. Carles,
P. Thuriaux,
C. Conesa, and A. Sentenac.
1998.
Tau91, an essential subunit of yeast transcription factor IIIC, cooperates with tau138 in DNA binding.
Mol. Cell. Biol.
18:1-9[Abstract/Free Full Text].
|
| 3.
|
Benko, A. L.,
G. Vaduva,
N. C. Martin, and A. K. Hopper.
2000.
Competition between a sterol biosynthetic enzyme and tRNA modification in addition to changes in the protein synthesis machinery causes altered nonsense suppression.
Proc. Natl. Acad. Sci. USA
97:61-66[Abstract/Free Full Text].
|
| 4.
|
Boeke, J. D.,
F. Lacroute, and G. R. Fink.
1984.
A positive selection for mutants lacking orotidine 5' phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance.
Mol. Gen. Genet.
197:345-346[CrossRef][Medline].
|
| 5.
|
Boguta, M.,
L. A. Hunter,
E. C. Gillman,
N. C. Martin, and A. K. Hopper.
1994.
Subcellular locations of MOD5 proteins: mapping of the sequences sufficient for targeting to mitochondria and demonstration that mitochondrial and nuclear isoforms commingle in the cytosol.
Mol. Cell. Biol.
14:2298-2306[Abstract/Free Full Text].
|
| 6.
|
Boguta, M.,
K. Czerska, and T. Zoladek.
1997.
Mutation in a new gene MAF1 affects tRNA suppressor efficiency in Saccharomyces cerevisiae.
Gene
185:291-296[CrossRef][Medline].
|
| 7.
|
Cairns, C. A., and R. J. White.
1998.
p53 is a general repressor of RNA polymerase III transcription.
EMBO J.
17:3112-3123[CrossRef][Medline].
|
| 8.
|
Chedin, S.,
M. L. Ferri,
G. Peyroche,
J. C. Andrau,
S. Jourdain,
O. Lefebvre,
M. Werner,
C. Carl, and A. Sentenac.
1998.
The yeast RNA polymerase III transcription machinery: a paradigm for eukaryotic gene activation.
Cold Spring Harbor Symp. Quant. Biol.
63:381-389[CrossRef][Medline].
|
| 9.
|
Chesnokov, I.,
W. M. Chu,
M. R. Botchan, and C. W. Schmid.
1996.
p53 inhibits RNA polymerase III-directed transcription in a promoter-dependent manner.
Mol. Cell. Biol.
16:7084-7088[Abstract].
|
| 10.
|
Chu, W. M.,
Z. Wang,
R. G. Roeder, and C. W. Schmid.
1997.
RNA polymerase III transcription repressed by Rb through its interactions with TFIII and TFIIIC2.
J. Biol. Chem.
272:14755-14761[Abstract/Free Full Text].
|
| 11.
|
Clarke, E. M.,
C. L. Peterson,
A. V. Brainard, and D. L. Riggs.
1996.
Regulation of the RNA polymerase I and III transcription systems in response to growth conditions.
J. Biol. Chem.
271:22189-22195[Abstract/Free Full Text].
|
| 12.
|
Cullin, C., and L. Minvielle-Sebastia.
1994.
Multipurpose vectors designed for the fast generation of N- or C-terminal epitope-tagged proteins.
Yeast
10:105-112[CrossRef][Medline].
|
| 13.
|
Dechampesme, A. M.,
O. Koroleva,
I. Leger-Silvestre,
N. Gas, and S. Camier.
1999.
Assembly of 5S ribosomal RNA is required at a specific step of the pre-rRNA processing pathway.
J. Cell Biol.
145:1369-1380[Abstract/Free Full Text].
|
| 14.
|
Dieci, G.,
S. Herman-Le-Denmat,
E. L. Lukhtanov,
P. Thuriaux,
M. Werner, and A. Sentenac.
1995.
A universally conserved region of the largest subunit participates in the active site of RNA polymerase III.
EMBO J.
14:3766-3776[Medline].
|
| 15.
|
Ferri, M. L.,
G. Peyroche,
M. Siaut,
O. Lefebvre,
C. Carles,
C. Conesa, and A. Sentenac.
2000.
A novel subunit of yeast RNA polymerase III interacts with the TFIIB-related domain of TFIIIB70.
Mol. Cell. Biol.
20:488-495[Abstract/Free Full Text].
|
| 16.
|
Gietz, R. D., and A. Sugino.
1988.
New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites.
Gene
74:527-534[CrossRef][Medline].
|
| 17.
|
Gottesfeld, J. M.,
V. J. Wolf,
T. Dang,
D. J. Forbes, and P. Hartl.
1994.
Mitotic repression of RNA polymerase III transcription in vitro mediated by phosphorylation of a TFIIIB component.
Science
263:81-84[Abstract/Free Full Text].
|
| 18.
|
Gudenus, R.,
S. Mariotte,
A. Moenne,
A. Ruet,
S. Memet,
J. M. Buhler,
A. Sentenac, and P. Thuriaux.
1988.
Conditional mutants of RPC160, the gene encoding the largest subunit of RNA polymerase C in Saccharomyces cerevisiae.
Genetics
119:517-526[Abstract/Free Full Text].
|
| 19.
|
Henikoff, S., and J. G. Henikoff.
1992.
Amino acid substitution matrices from protein blocks.
Proc. Natl. Acad. Sci. USA
89:10915-10919[Abstract/Free Full Text].
|
| 20.
|
Hoeffler, W. K.,
R. Kovelman, and R. G. Roeder.
1988.
Activation of transcription factor IIIC by the adenovirus E1A protein.
Cell
53:907-920[CrossRef][Medline].
|
| 21.
|
Hofmann, K.,
P. Bucher,
L. Falquet, and A. Bairoch.
1999.
The PROSITE database, its status in 1999.
Nucleic Acids Res.
27:215-219[Abstract/Free Full Text].
|
| 22.
|
Hopper, A. K.
1990.
Genetic methods for study of trans-acting genes involved in processing of precursors to yeast cytoplasmic transfer RNAs.
Methods Enzymol.
181:400-420[Medline].
|
| 23.
|
Huet, J.,
N. Manaud,
G. Dieci,
G. Peyroche,
C. Conesa,
O. Lefebvre,
A. Ruet,
M. Riva, and A. Sentenac.
1996.
RNA polymerase III and class III transcription factors from Saccharomyces cerevisiae.
Methods Enzymol.
273:249-267[Medline].
|
| 24.
|
Hsieh, Y. J.,
Z. Wang,
R. Kovelman, and R. G. Roeder.
1999.
Cloning and characterization of two evolutionarily conserved subunits (TFIIIC102 and TFIIIC63) of human TFIIIC and their involvement in functional interactions with TFIIIB and RNA polymerase III.
Mol. Cell. Biol.
19:4944-4952[Abstract/Free Full Text].
|
| 25.
|
Huibregtse, J. M., and D. R. Engelke.
1989.
Genomic footprinting of a yeast tRNA gene reveals stable complexes over the 5'-flanking region.
Mol. Cell. Biol.
9:3244-3252[Abstract/Free Full Text].
|
| 26.
|
Kaiser, C.,
S. Michaelis, and A. Mitchel.
1994.
Yeast RNA isolation: methods in yeast genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 27.
|
Kief, D. R., and J. R. Warner.
1981.
Coordinate control of syntheses of ribosomal ribonucleic acid and ribosomal proteins during nutritional shift-up in Saccharomyces cerevisiae.
Mol. Cell. Biol.
1:1007-1015[Abstract/Free Full Text].
|
| 28.
|
Larminie, C. G.,
C. A. Cairns,
R. Mital,
K. T. Martin,
K. Kouzarides,
S. P. Jackson, and R. J. White.
1997.
Mechanistic analysis of RNA polymerase III regulation by the retinoblastoma protein.
EMBO J.
16:2061-2071[CrossRef][Medline].
|
| 29.
|
Larminie, C. G.,
H. M. Alzuherri,
C. A. Cairns,
A. McLees, and R. J. White.
1998.
Transcription by RNA polymerases I and III: a potential link between cell growth, protein synthesis and the retinoblastoma protein.
J. Mol. Med.
76:94-103[CrossRef][Medline].
|
| 30.
|
Li, Y.,
R. D. Moir,
I. K. Sethy-Coraci,
J. R. Warner, and I. M. Willis.
2000.
Repression of ribosome and tRNA synthesis in secretion-defective cells is signaled by a novel branch of the cell integrity pathway.
Mol. Cell. Biol.
11:3843-3851.
|
| 31.
|
Longtine, M. S.,
A. McKenzie III,
D. J. Demarini,
N. G. Shah,
A. Wach,
A. Brachat,
P. Philippsen, and J. R. Pringle.
1998.
Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae.
Yeast
14:953-961[CrossRef][Medline].
|
| 32.
|
Manaud, N.,
R. Arrebola,
B. Buffin-Meyer,
O. Lefebvre,
H. Voss,
M. Riva,
C. Conesa, and A. Sentenac.
1998.
A chimeric subunit of yeast transcription factor IIIC forms a subcomplex with tau95.
Mol. Cell. Biol.
18:3191-3200[Abstract/Free Full Text].
|
| 33.
|
Mortimer, R. K.,
D. Schild,
C. R. Contopoulou, and J. A. Kans.
1989.
Genetic map of Saccharomyces cerevisiae, 10th
Yeast
5:321-403[CrossRef][Medline].
|
| 34.
|
Murawski, M.,
B. Szczesniak,
T. Zoladek,
A. K. Hopper,
N. C. Martin, and M. Boguta.
1994.
maf1 mutation alters the subcellular localization of the Mod5 protein in yeast.
Acta Biochim. Pol.
41:441-448[Medline].
|
| 35.
|
Musters, W.,
J. Knol,
P. Maas,
A. F. Dekker, and H. Van Heerikhuizen.
1989.
Linker scanning of the yeast RNA polymerase I promoter.
Nucleic Acids Res.
17:9661-9678[Abstract/Free Full Text].
|
| 36.
|
Oliver, S. G., and C. S. McLaughlin.
1977.
The regulation of RNA synthesis in yeast. I: Starvation experiments.
Mol. Gen. Genet.
154:145-153[CrossRef][Medline].
|
| 37.
|
Pringle, J. R.,
A. E. Adams,
D. R. Drubin, and B. K. Haarer.
1991.
Immunofluorescence methods for yeast.
Methods Enzymol.
194:565-602[Medline].
|
| 38.
|
Riggs, D. L., and M. Nomura.
1990.
Specific transcription of Saccharomyces cerevisiae 35 S rDNA by RNA polymerase I in vitro.
J. Biol. Chem.
265:7596-7603[Abstract/Free Full Text].
|
| 39.
|
Sethy, I.,
R. D. Moir,
M. Librizzi, and I. M. Willis.
1995.
In vitro evidence for growth regulation of tRNA gene transcription in yeast. A role for transcription factor (TF) IIIB70 and TFIIIC.
J. Biol. Chem.
270:28463-28470[Abstract/Free Full Text].
|
| 40.
|
Sherman, F., and P. Wakem.
1991.
Mapping of the yeast genes.
Methods Enzymol.
194:38-56[Medline].
|
| 41.
|
Shulman, R. W.,
C. E. Sripati, and J. R. Warner.
1977.
Noncoordinated transcription in the absence of protein synthesis in yeast.
J. Biol. Chem.
252:1344-1349[Abstract/Free Full Text].
|
| 42.
|
Sinn, E.,
Z. Wang,
R. Kovelman, and R. G. Roeder.
1995.
Cloning and characterization of a TFIIIC2 subunit (TFIIIC beta) whose presence correlates with activation of RNA polymerase III-mediated transcription by adenovirus E1A expression and serum factors.
Genes Dev.
9:675-685[Abstract/Free Full Text].
|
| 43.
|
Stettler, S.,
S. Mariotte,
M. Riva,
A. Sentenac, and P. Thuriaux.
1992.
An essential and specific subunit of RNA polymerase III (C) is encoded by gene RPC34 in Saccharomyces cerevisiae.
J. Biol. Chem.
267:21390-21395[Abstract/Free Full Text].
|
| 44.
|
Teichmann, M.,
G. Dieci,
J. Huet,
J. Ruth,
A. Sentenac, and K. H. Seifart.
1997.
Functional interchangeability of TFIIIB components from yeast and human cells in vitro.
EMBO J.
16:4708-4716[CrossRef][Medline].
|
| 45.
|
Thompson, J. D.,
T. J. Plewniak,
F. Jeanmougin, and D. G. Higgins.
1997.
The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Res.
25:4876-4882[Abstract/Free Full Text].
|
| 46.
|
Tower, J., and B. Sollner-Webb.
1988.
Polymerase III transcription factor B activity is reduced in extracts of growth-restricted cells.
Mol. Cell. Biol.
8:1001-1005[Abstract/Free Full Text].
|
| 47.
|
Tyers, M.,
G. Tokiwa, and B. Futcher.
1993.
Comparison of the Saccharomyces cerevisiae G1 cyclins: Cln3 may be an upstream activator of Cln1, Cln2 and other cyclins.
EMBO J.
12:1955-1968[Medline].
|
| 48.
|
Waldron, C.
1977.
Synthesis of ribosomal and transfer ribonucleic acids in yeast during a nutritional shift-up.
J. Gen. Microbiol.
98:215-221[Abstract/Free Full Text].
|
| 49.
|
Waldron, C., and F. Lacroute.
1975.
Effect of growth rate on the amounts of ribosomal and transfer ribonucleic acids in yeast.
J. Bacteriol.
122:855-865[Abstract/Free Full Text].
|
| 50.
|
Wang, Z.,
T. Luo, and R. G. Roeder.
1997.
Identification of an autonomously initiating RNA polymerase III holoenzyme containing a novel factor that is selectively inactivated during protein synthesis inhibition.
Genes Dev.
11:2371-2382[Abstract/Free Full Text].
|
| 51.
|
Wang, Z., and R. G. Roeder.
1997.
Three human RNA polymerase III-specific subunits form a subcomplex with a selective function in specific transcription initiation.
Genes Dev.
11:1315-1326[Abstract/Free Full Text].
|
| 52.
|
White, R. J.,
D. Stott, and P. W. Rigby.
1989.
Regulation of RNA polymerase III transcription in response to F9 embryonal carcinoma stem cell differentiation.
Cell
59:1081-1092[CrossRef][Medline].
|
| 53.
|
White, R. J.,
D. Trouche,
K. Martin,
S. P. Jackson, and T. Kouzarides.
1996.
Repression of RNA polymerase III transcription by the retinoblastoma protein.
Nature
382:88-90[CrossRef][Medline].
|
| 54.
|
White, R. J.
1997.
Regulation of RNA polymerases I and III by the retinoblastoma protein: a mechanism for growth control?
Trends Biochem. Sci.
22:77-80[CrossRef][Medline].
|
| 55.
|
White, R. J.
1998.
RNA polymerase III transcription.
Springer-Verlag/ R. G. Landes Co., New York, N.Y.
|
| 56.
|
Zoladek, T.,
G. Vaduva,
L. A. Hunter,
M. Boguta,
B. D. Go,
N. C. Martin, and A. K. Hopper.
1995.
Mutants altering the mitochondrial-cytoplasmic distribution of Mod5p implicate the actin cytoskeleton and mRNA 3' ends and/or protein synthesis in mitochondrial delivery.
Mol. Cell. Biol.
15:6884-6894[Abstract].
|
Molecular and Cellular Biology, August 2001, p. 5031-5040, Vol. 21, No. 15
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.15.5031-5040.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Boisnard, S., Lagniel, G., Garmendia-Torres, C., Molin, M., Boy-Marcotte, E., Jacquet, M., Toledano, M. B., Labarre, J., Chedin, S.
(2009). H2O2 Activates the Nuclear Localization of Msn2 and Maf1 through Thioredoxins in Saccharomyces cerevisiae. Eukaryot Cell
8: 1429-1438
[Abstract]
[Full Text]
-
Cabart, P., Lee, J., Willis, I. M.
(2008). Facilitated Recycling Protects Human RNA Polymerase III from Repression by Maf1 in Vitro. J. Biol. Chem.
283: 36108-36117
[Abstract]
[Full Text]
-
Soragni, E., Kassavetis, G. A.
(2008). Absolute Gene Occupancies by RNA Polymerase III, TFIIIB, and TFIIIC in Saccharomyces cerevisiae. J. Biol. Chem.
283: 26568-26576
[Abstract]
[Full Text]
-
French, S. L., Osheim, Y. N., Schneider, D. A., Sikes, M. L., Fernandez, C. F., Copela, L. A., Misra, V. A., Nomura, M., Wolin, S. L., Beyer, A. L.
(2008). Visual Analysis of the Yeast 5S rRNA Gene Transcriptome: Regulation and Role of La Protein. Mol. Cell. Biol.
28: 4576-4587
[Abstract]
[Full Text]
-
Towpik, J., Graczyk, D., Gajda, A., Lefebvre, O., Boguta, M.
(2008). Derepression of RNA Polymerase III Transcription by Phosphorylation and Nuclear Export of Its Negative Regulator, Maf1. J. Biol. Chem.
283: 17168-17174
[Abstract]
[Full Text]
-
Arimbasseri, A. G., Bhargava, P.
(2008). Chromatin Structure and Expression of a Gene Transcribed by RNA Polymerase III Are Independent of H2A.Z Deposition. Mol. Cell. Biol.
28: 2598-2607
[Abstract]
[Full Text]
-
Berger, A. B., Decourty, L., Badis, G., Nehrbass, U., Jacquier, A., Gadal, O.
(2007). Hmo1 Is Required for TOR-Dependent Regulation of Ribosomal Protein Gene Transcription. Mol. Cell. Biol.
27: 8015-8026
[Abstract]
[Full Text]
-
Ciesla, M., Towpik, J., Graczyk, D., Oficjalska-Pham, D., Harismendy, O., Suleau, A., Balicki, K., Conesa, C., Lefebvre, O., Boguta, M.
(2007). Maf1 Is Involved in Coupling Carbon Metabolism to RNA Polymerase III Transcription. Mol. Cell. Biol.
27: 7693-7702
[Abstract]
[Full Text]
-
Moir, R. D., Lee, J., Haeusler, R. A., Desai, N., Engelke, D. R., Willis, I. M.
(2006). Protein kinase A regulates RNA polymerase III transcription through the nuclear localization of Maf1. Proc. Natl. Acad. Sci. USA
103: 15044-15049
[Abstract]
[Full Text]
-
Michels, A. A., Hernandez, N.
(2006). Does Pol I talk to Pol II? Coordination of RNA polymerases in ribosome biogenesis. Genes Dev.
20: 1982-1985
[Full Text]
-
Laferte, A., Favry, E., Sentenac, A., Riva, M., Carles, C., Chedin, S.
(2006). The transcriptional activity of RNA polymerase I is a key determinant for the level of all ribosome components. Genes Dev.
20: 2030-2040
[Abstract]
[Full Text]
-
Kassavetis, G. A., Soragni, E., Driscoll, R., Geiduschek, E. P.
(2005). Reconfiguring the connectivity of a multiprotein complex: Fusions of yeast TATA-binding protein with Brf1, and the function of transcription factor IIIB. Proc. Natl. Acad. Sci. USA
102: 15406-15411
[Abstract]
[Full Text]
-
Desai, N., Lee, J., Upadhya, R., Chu, Y., Moir, R. D., Willis, I. M.
(2005). Two Steps in Maf1-dependent Repression of Transcription by RNA Polymerase III. J. Biol. Chem.
280: 6455-6462
[Abstract]
[Full Text]
-
Roberts, D. N., Stewart, A. J., Huff, J. T., Cairns, B. R.
(2003). The RNA polymerase III transcriptome revealed by genome-wide localization and activity-occupancy relationships. Proc. Natl. Acad. Sci. USA
100: 14695-14700
[Abstract]
[Full Text]
-
Schramm, L., Hernandez, N.
(2002). Recruitment of RNA polymerase III to its target promoters. Genes Dev.
16: 2593-2620
[Full Text]
-
Johnston, I. M., Allison, S. J., Morton, J. P., Schramm, L., Scott, P. H., White, R. J.
(2002). CK2 Forms a Stable Complex with TFIIIB and Activates RNA Polymerase III Transcription in Human Cells. Mol. Cell. Biol.
22: 3757-3768
[Abstract]
[Full Text]