Previous Article | Next Article 
Molecular and Cellular Biology, August 2001, p. 5142-5155, Vol. 21, No. 15
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.15.5142-5155.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
exo1-Dependent Mutator Mutations: Model
System for Studying Functional Interactions in Mismatch
Repair
Neelam S.
Amin,1
My-Nga
Nguyen,1
Scott
Oh,1 and
Richard D.
Kolodner1,2,3,*
Ludwig Institute for Cancer
Research,1 Department of
Medicine,2 and Cancer
Center,3 University of California, San Diego
School of Medicine, La Jolla, California 92093-0660
Received 7 February 2001/Returned for modification 11 March
2001/Accepted 20 April 2001
 |
ABSTRACT |
EXO1 interacts with MSH2 and MLH1 and has been proposed to be a
redundant exonuclease that functions in mismatch repair (MMR). To
better understand the role of EXO1 in mismatch repair, a genetic screen
was performed to identify mutations that increase the mutation rates
caused by weak mutator mutations such as exo1
and
pms1-A130V mutations. In a screen starting with an
exo1 mutation, exo1-dependent mutator mutations
were obtained in MLH1, PMS1, MSH2, MSH3, POL30 (PCNA),
POL32, and RNR1, whereas starting with the weak
pms1 allele pms1-A130V,
pms1-dependent mutator mutations were identified in MLH1, MSH2, MSH3, MSH6, and EXO1. These
mutations only cause weak MMR defects as single mutants but cause
strong MMR defects when combined with each other. Most of the mutations
obtained caused amino acid substitutions in MLH1 or PMS1, and these
clustered in either the ATP-binding region or the MLH1-PMS1 interaction regions of these proteins. The mutations showed two other types of
interactions: specific pairs of mutations showed unlinked
noncomplementation in diploid strains, and the defect caused by pairs
of mutations could be suppressed by high-copy-number expression of a
third gene, an effect that showed allele and overexpressed gene
specificity. These results support a model in which EXO1 plays a
structural role in MMR and stabilizes multiprotein complexes containing
a number of MMR proteins. A similar role is proposed for PCNA based on
the data presented.
 |
INTRODUCTION |
Postreplicative DNA mismatch repair
(MMR) enhances the fidelity of DNA replication by repairing errors made
by the replicative DNA polymerases. Studies of the Escherichia
coli MutHLS MMR system have been instrumental in providing
insights into the general mechanism of MMR (for reviews, see references
40 and 50). A central player in E. coli MMR is
MutS, which is the mismatch recognition factor. After MutS binds a
mismatch, the MutL protein binds to MutS and activates the MutH
endonuclease, which nicks hemimethylated DNA at unmethylated GATC
sites. Subsequently, the action of one of a number of redundant
single-stranded DNA-specific exonucleases and a DNA helicase, UvrD,
degrades the mismatch-containing DNA from the nick (27, 50,
78). The resulting gap is filled in by the replicative
machinery, including DNA polymerase III. Eukaryotic MMR is related to
bacterial MMR in that it utilizes MutS- and MutL-related proteins, but
it appears to be more complex (for reviews, see references 40,
41, and 50). Instead of a single MutS protein, eukaryotic MMR
utilizes three MutS-related proteins, MSH2, MSH3, and MSH6, that form
two different heterodimeric complexes (1, 15, 21, 48, 53).
The MSH2 and MSH6 proteins form a complex that is important for the
recognition of single-base mispairs and small insertion-deletion loops,
whereas the MSH2 and MSH3 proteins form a complex that recognizes
insertion-deletion loops (21, 48, 62). Similarly,
eukaryotic MMR uses three MutL-related proteins, MLH1, PMS1, and MLH3,
that also form heterodimeric complexes (20, 45, 51, 57,
58). Although the exact function of these MutL homologues is
unclear, it is known that MLH1 and PMS1 form a complex that interacts
with the MSH complexes and is the major MutL-related complex required
for MMR (25, 26, 45, 57, 58). A second MutL-related
complex is composed of MLH1 and MLH3, and this complex seems to only
play a minor role in MMR (20, 51). Several proteins that
function in DNA replication, including DNA polymerase
, PCNA, RFC,
and RPA, have also been suggested to be involved in MMR (10, 13,
19, 33, 39, 46, 47, 76, 79). The importance of MMR in humans is
evident from the fact that defects in MMR genes, predominantly MSH2,
MSH6, and MLH1, underlie inherited cancer predisposition (32,
56) and can also underlie various sporadic cancers (6, 7,
16, 37, 59, 68).
In addition to the eukaryotic MMR proteins discussed above, a 5'-to-3'
double-stranded DNA exonuclease called EXO1 may be involved in the
excision step of MMR. EXO1 belongs to the RAD2/XPG family of endo- and
exonucleases, many of which are known to function in DNA repair
(67, 70). EXO1 is known to function in mitotic and meiotic
recombination (18, 38, 67, 75). In addition, several
observations support the idea that EXO1 may be important in
MSH2-dependent MMR. EXO1 was first suggested to be involved in MMR
because exo1 mutations caused a hyper-rec
phenotype when recombination between intragenic markers was examined
(67). EXO1 has been demonstrated to physically interact
with MSH2 in two-hybrid assays and in coimmunoprecipitation experiments
(70) and EXO1 also interacts with MLH1 (59a,
74a). exo1 null mutants have increased mutation
rates, which is consistent with a role for EXO1 in MMR, and EXO1 has an
epistatic interaction with MSH2 (70, 72). Because the
mutator phenotype of a exo1 null mutant is weak compared to
a msh2 null mutant, the epistatic interaction of the two
genes has been debated because it is not possible to distinguish
whether the phenotype of the exo1 msh2 double mutant is
equal to that of the msh2 single mutant or if it is the sum of the phenotypes of the exo1 and msh2 single
mutants. Because of this, further investigation of the role of EXO1 in
MMR is needed.
The weak mutator phenotype of exo1 single mutants has
suggested that other exonucleases that function in eukaryotic MMR must be present in vivo, just as is the case in E. coli, where at
least three exonucleases, including Exo1, ExoVII, and RecJ, are known to act in MMR (27, 40, 50, 78). Analysis of the
Saccharomyces cerevisiae genome sequence has revealed
putative exonucleases, but none of the obvious candidates from these
searches appear to play a major role in MMR. For example,
RAD27 has been demonstrated to function in DNA replication,
recombination, and many DNA repair processes, but it may only play a
minor role in MMR if at all (34, 71). DIN7 has
recently been shown to be important for mitochondrial DNA repair, and a
role for YEN1 is not yet apparent because a null mutation in this gene
either alone or in combination with other mutations such as
exo1 does not result in an increased mutator phenotype
(17, 34, 70). It has also been suggested that the
exonuclease activities associated with DNA polymerases
and
may
function at the excision step of MMR along with EXO1 and RAD27
(72). However, it has been difficult to test this because
mutations in these genes can cause a number of different phenotypes and
are often lethal when combined with each other. These observations
further underscore the need for additional studies designed to identify
exonucleases that might function in MMR.
To further investigate the role of EXO1 in MMR, we carried out a
genetic screen in the yeast S. cerevisiae to identify
proteins that are functionally interacting and redundant with yeast
EXO1. Mutagenesis of a strain carrying a deletion of the EXO1 gene
revealed 19 mutator mutants that had a strong mutator phenotype that
was dependent on the absence of the EXO1 gene. Identification of the exo1-dependent mutator (edm) genes revealed
functional interactions of EXO1 with a majority of known MMR gene
products, as well as with two proteins that function in DNA
replication. The functional interactions of EXO1 with MMR proteins were
confirmed in a screen for mutator mutants whose phenotype required the
presence of a weak PMS1 allele. These studies illustrate
that the functional importance of EXO1 in MMR is possibly due to its
critical interactions with other MMR proteins.
 |
MATERIALS AND METHODS |
Strains and media.
Yeast cells were grown in YEPD (1% yeast
extract, 2% Bacto Peptone, and 2% dextrose, with or without 2% Bacto
Agar) or SD (0.67% yeast nitrogen base and 2% dextrose, with or
without 2% Bacto Agar) medium (11, 61). SD medium was
supplemented with the appropriate dropout mix of amino acids (Bio 101, Inc., Vista, Calif.); these plates are referred to as selective plates.
Plates containing all amino acids are called synthetic complete (SC) plates. Canavanine plates contained SD medium with all amino acids except arginine, with 60 µg of canavanine (Sigma, St. Louis, Mo.) added per ml prior to pouring the plates. Sporulation medium consisted of 0.1% yeast extract, 1% potassium acetate, and 0.05% dextrose, with or without 2% Bacto Agar. Bacterial cells harboring plasmids were
grown using Luria-Bertani medium (1% Bacto Tryptone, 0.5% yeast
extract, and 0.5% NaCl, with or without 2% Bacto Agar) containing 100 µg of ampicillin per ml.
All strains used in this study were derived from an S288c strain
background and are listed in Table 1. The strains were
created by standard procedures involving crosses, tetrad dissection,
gene disruption, and transformations. The
lys2::InsE-A10 frameshift reversion
substrate was introduced into strain RKY2700 (LYS2) using plasmid p93-10A (pRDK706; obtained from D. A. Gordenin, National Institute of Environmental Health Sciences) (73).
The resulting strain RKY3590 (lys2::InsE-A10) was
then used to create strain RKY4168 (exo1::URA3
lys2::InsE-A10) in which the chromosomal copy of the
wild-type EXO1 gene had been replaced by the URA3 gene through transformation with a PCR product generated using pM53
(from R. Shiestl, Harvard School of Public Health) as template DNA and
the primers
5'-ATGCTCTCATAGAATTATATTTGATATTGCTTTTTGGACCACATTAAAATAgcggataacaatttcacacagga-3' and
5'-TTA ATTCTTGTCTTGAGGCATTTCGACGAGATTTTCATTTGAAAAATAT ACgccagggttttcccagtcacga-3' (uppercase indicates homology to the disrupted region; lowercase indicates homology to the vector). Strain RKY4168
(exo1::URA3 lys2::InsE-A10) was used
for the ethyl methanesulfonate (EMS) mutagenesis experiment described
below and the strains obtained from this mutant screen that are
exo1-dependent are RKY4170 to RKY4188. Strain RKY3590
(MATa lys2::InsE-A10) was crossed with RKY2704 (MAT
), and upon sporulation of the resulting
diploid followed by tetrad dissection, the strain RKY3686
(MAT
lys2::InsE-A10) was obtained.
Strain RKY3686 (MAT
lys2::InsE-A10)
was crossed with strain RKY4168 (MATa
exo1::URA3 lys2::InsE-A10), and upon sporulation of the diploid followed by tetrad dissection, the
strain RKY4169 (MAT
exo1::URA3
lys2::InsE-A10) was obtained. A PCR product generated
using pPS729 (from P. Silver, Harvard Medical School) as template DNA
and the primers
5'-ATGGATCAAAAGGCGTCATATTTTATCAATGAGAAGCTCTTCACTGAGGTGgcctcctctagtacactc-3' and
5'-TTATTTTGCCTTTCTTTT GAAAAAGCTTTCCAATGTTCCTTGCTTTTTTAGcgcgcctcgttcagaatg-3' was
used for disrupting POL32 with HIS3 in strains
RKY3686 (lys2::InsE-A10) and RKY4169
(exo1::URA3 lys2::InsE-A10) to create
strains RKY4206 (pol32::HIS3 lys2::InsE-A10)
and RKY4207 (exo1::URA3 pol32::HIS3 lys2::InsE-A10), respectively.
Mutant screens.
The mutants isolated in this study were
obtained by random mutagenesis with the DNA alkylating agent EMS
(49). Strain RKY4168 (exo1::URA3
lys2::InsE-A10) was grown in YEPD at 30°C to late log
phase and then treated with 3% EMS (Sigma) in water for 30 min at
23°C. Appropriate dilutions of the cell suspension were then plated
onto YEPD and were incubated at 30°C for 4 days. The resulting
colonies were replica plated onto lysine-deficient, threonine-deficient, canavanine-containing plates and were incubated at
30°C for 3 days before screening for mutants that showed increased papilation on at least one of the indicator plates and therefore exhibited a mutator phenotype. The mutator strains obtained were retested by streaking for single colonies and carrying out patch tests
as described below. To determine if any of the mutants had an
edm phenotype, all of the mutant yeast strains (RKY4170 to RKY4188) and the control strains RKY3590 (EXO1) and RKY4168
(exo1::URA3) were transformed with either the CEN6/ARSH4
plasmid pRDK834 (EXO1, TRP1) or the 2µm plasmid
pRDK480 (EXO1, LEU2) and the control plasmids
pRDK838 (pRS314, TRP1) and YEP213 (LEU2) (12,
63). Plasmid pRDK834 contains full-length EXO1 and
was obtained from a library of pRS200-derived yeast genomic DNA
containing plasmids obtained from Phil Hieter (University of British
Columbia) (pRS200 is a slight modification of pRS314). Plasmid pRDK480
(EXO1, LEU2) was also derived from a genomic DNA library
made in the 2µm vector YEP213 and has been previously described
(70). Mutants whose mutator phenotype as measured by patch
tests (see below) was suppressed by the introduction of an
EXO1 plasmid but not by the appropriate control plasmid were
considered to be edm mutants. The resulting edm
mutants were then backcrossed to RKY4169 (exo1
) both to
determine if the mutator phenotype was a single gene trait and to
obtain derivatives having the opposite mating type. A virtually
identical screen was subsequently performed using strain RKY4190
(pms1-A130V lys2::InsE-A10) to identify
pms1-A130V-dependent mutator (pdm) mutants.
pRDK436 (PMS1) and pRS425 (control) plasmids were used to assess the
pms1-A130V-dependent phenotype of the mutants essentially as
described above.
Mutator patch tests.
Qualitative patch tests were used to
assess the mutator phenotype of the different mutants in
lys2::InsE-A10. Specifically, three or more
colonies of a given strain were first patched onto YEPD plates or
selective plates in the case of plasmid containing transformants. After
1 to 3 days of incubation at 30°C, the patches were replica plated
onto lysine-deficient plates (selection was maintained if the strains
contained plasmids). The mutator phenotype of the different strains was
assessed after 2 to 3 days of incubation at 30°C. All experiments
were carried out at least twice.
Fluctuation analysis.
Mutation rates were determined by
fluctuation analysis (44, 48). Briefly, each strain was
streaked out on a YEPD plate to obtain single colonies, and independent
colonies were used to grow five overnight cultures in YEPD (5 ml)
at 30°C. Appropriate dilutions of cells from each culture were then
plated onto SC plates and onto SC plates lacking lysine. The number of
colonies grown on each plate was scored after 3 days of incubation at
30°C. For each strain, the average mutation rate was calculated from four independent fluctuation experiments as described by Lea and Coulson (44).
Complementation analysis.
To identify the EDM
genes, patch tests were used to determine if wild-type copies of
candidate MMR genes or if plasmids from a yeast genomic DNA library
could complement the mutator phenotype of individual mutants.
Low-copy-number CEN/ARS plasmids (12, 63) were used for
this purpose, and they include pRDK363 (MSH2, LEU2), pRDK444 (MSH3, LEU2), pRDK439
(MSH6, LEU2), pRDK835 (MLH1, TRP1), pRDK433 (PMS1, LEU2), pRDK837
(POL30, TRP1), pRDK842 (RAD27, TRP1), or the pRS200-derived TRP1
CEN6/ARSH4 yeast genomic DNA library obtained
from Phil Hieter (made by digesting pRS200 with BamHI and
BglII and inserting a Sau3A partial digest of
yeast genomic DNA).
Mutation detection by DNA sequencing.
To identify mutations
in the EDM genes, genomic DNA was prepared from the
edmx exo1
double mutant strains (RKY4170 to RKY4188) using the glass bead method (35) and was used as template
DNA in PCR reactions to amplify the chromosomal copy of
MLH1, PMS1, MSH2, MSH3,
POL30, POL32, and RNR1. The PCR
products were then treated with shrimp alkaline phosphatase (USB Corp.,
Cleveland, Ohio) and exonuclease 1 (USB Corp.) and sequenced using an
PE ABI 3700 DNA sequencer. The respective wild-type genes were also amplified from the unmutagenized parent strain RKY4168
(exo1::URA3) and sequenced as controls.
Unlinked noncomplementation analysis.
To detect an unlinked
noncomplementation phenotype in diploids containing mutations in two
different EDM genes, the MAT
strains RKY4169
(exo1
), RKY4193 (mlh1-G19D exo1
), RKY4194
(mlh1-A41T exo1
), RKY4195 (mlh1-R265F
exo1
), RKY4196 (mlh1-R547 exo1
), RKY4197
(pms1-A130V exo1
), and RKY4252 (msh2-S762F
exo1
) were crossed with the MATa strains
RKY3590 (wild type) and RKY4168 (exo1
) and the
edmx exo1
strains RKY4170 to RKY4181 and RKY4183 to
RKY4188 (see Table 1). The generation of diploid strains in each case
was confirmed by using mating-type tests with the mating-type tester strains RKY1109 (MATa thr4) and
RKY1110 (MATa thr4). Patch tests of the diploids
were used to assess the presence of a mutator phenotype using the
lys2::InsE-A10 assay. To determine if the unlinked
noncomplementation observed in many of the diploids was exo1
dependent, the diploid strains RKY4240 (exo1
/exo1
MLH1/mlh1-A41T),
RKY4241 (exo1
/exo1
PMS1/pms1-A130V), RKY4242 (exo1
/exo1
MLH/mlh1-R265K), RKY4243
(exo1
/exo1
MLH1/mlh1-G19D), RKY4244 (exo1
/exo1
MLH1/mlh1-A41T PMS1/pms1-A130V), RKY4245 (exo1
/exo1
pms1-A130V/pms1-A130V), RKY4246
(exo1
/exo1
PMS1/pms1-A130V MLH1/mlh1-R265K), and RKY4247
(exo1
/exo1
PMS1/pms1-A130V
MLH1/mlh1-G19D) were transformed with pRDK838 (pRS314) or plasmid
pRDK834 containing wild-type EXO1, and patch tests were used
to detect mutator phenotypes using the
lys2::InsE-A10 assay.
High- and low-copy-number suppression studies.
For the high-
and low-copy-number suppression studies, the pairs of 2µm plasmids
pRDK436 (PMS1) and pRS425 (control) or pRDK833 (POL30) and pRS424 (control) or the CEN6/ARSH4 plasmids
pRDK835 (MLH1; a low-copy-number plasmid was used because
overexpression of MLH1 from a 2µm plasmid causes a dominant mutator
phenotype in wild-type cells [60]) and pRS314 (control)
were transformed into RKY3590 (wild type), RKY4168
(exo1
), and the edmx exo1
strains RKY4170
to RKY4188 (12, 63). The transformants were then analyzed
for a mutator phenotype in the lys2::InsE-A10
assay using patch tests.
 |
RESULTS |
Screening for exo1-dependent mutator mutations.
Biochemical and genetic studies have suggested that MMR involves the
action of many proteins, possibly in the context of a multiprotein
complex (40, 41, 50). The majority of studies have
centered on understanding the MSH2-dependent mismatch recognition step,
whereas the events occurring downstream of this step have yet to be
elucidated in detail. In particular, EXO1 has been shown to physically
interact with MSH2 (70) and, more recently, with MLH1
(59a, 74a), but it is not clear if EXO1 functionally
interacts with MSH2 or another MMR protein(s). In addition, because the mutator phenotype of exo1
cells is weak compared to
msh2
mutants, it is possible that other redundant or
compensatory exonucleases function in MMR (34, 70, 72). To
identify proteins that are functionally interacting and/or redundant
with yeast EXO1, we screened for mutations (called edm
mutations) that cause a strong mutator phenotype only in the absence of
EXO1. The lys2::InsE-A10 frameshift assay,
which primarily measures
1 frameshifts in a tract of 10 A's, was
used in this screen because it is highly sensitive for detecting MMR
defects with the additional advantage of having a low background
mutation rate in wild-type cells (73). A total of 8,000 EMS-mutagenized survivors were screened, and 19 mutants were
obtained that had an edm phenotype in the
lys2::InsE-A10 assay. Examples of the phenotype of
the edm mutants derived from the screen are shown in Fig.
1. In contrast to the weak mutator phenotype observed
with the exo1
single mutant, the edm mutants show a significantly increased mutator phenotype when transformed with
the control plasmid pRDK838 (pRS314). However, upon transformation of
the edm strains with the wild-type
EXO1-containing plasmid pRDK834, a dramatic suppression of
the strong mutator phenotype was observed. In addition, 37 strong
mutator mutations were identified that, as well as the null mutations
in MSH2, MSH6, MLH1, and PMS1, were not enhanced
by an exo1
mutation; none of these mutations or null
mutations in MSH2, MSH6, MLH1, and PMS1 were
suppressed by overexpression of EXO1 (70, 74a; data not
shown).

View larger version (107K):
[in this window]
[in a new window]
|
FIG. 1.
Characterization of the mutator phenotype of the
exo1-dependent mutator mutants using patch tests. The
indicated strains were transformed with either the control vector or
the vector containing the EXO1 gene. Then, three colonies
each were patched onto a master plate and replica plated onto an SD-Lys
plate to evaluate the lys2::InsE-A10 reversion properties of
each strain as described in Materials and Methods.
|
|
Quantitation of the exo1-dependent mutator phenotype of
selected mutants once again revealed a striking increase in the
mutation rate of the edm mutants in the absence of
EXO1 but a significantly reduced mutation rate in the
presence of wild-type EXO1. The mutation rates of three
different edm mutants were determined in the presence or
absence of a wild-type copy of EXO1 using the
lys2::InsE-A10 and hom3-10
frameshift reversion assays, as well as the canavanine resistance
forward mutation assay. In comparison to the exo1 single mutant strain RKY4168, which has a mutation rate that is only 11-fold
higher than that of the wild-type strain RKY3590 in the lys2::InsE-A10 assay, the absence of
EXO1 in the D11 (RKY4192), J2 (RKY4176), and J10
(RKY4186) mutant strains caused a 350- to 7,500-fold increase in
the mutation rate compared to the wild type (Table 2).
In contrast, when wild-type EXO1 was introduced into the D11
(RKY4190), J2 (RKY4189), and J10 (RKY4191) mutant strains, a dramatic
suppression of the mutator phenotype was observed (Table 2). Similar
results were observed using the hom3-10 assay (data not
shown). Increased mutation rates in the canavanine resistance forward
mutation rate assay were also observed when EXO1 was absent compared to when a copy of EXO1 was present in the mutant
strains; however, the rate differences were not as large as in the
frameshift reversion assays (data not shown). This possibly reflects
the fact that the canavanine resistance assay detects a wide variety of
mutations, while the lys2::InsE-A10 and
hom3-10 assays primarily detect frameshift mutations, which
are characteristic of defects in MMR (48, 62, 73).
Overall, these results indicate that the mutations identified cause a
mutator phenotype that is dependent on the absence of the
EXO1 gene product.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Mutation rate analysis of representative edm
mutants using the lys2::InsE-A10 frameshift
reversion assay
|
|
Identification of EDM genes.
The synergistic
effect caused by combination of edm and exo1
mutations could occur because the wild-type counterparts of the two
proteins identified by these mutations normally have overlapping functions or because they interact with one another. It is also possible that EXO1 and the EDM gene products act
sequentially in the repair of DNA damage. To determine the nature of
the exo1-dependent mutations, the EDM genes were
identified. For this purpose, it was first necessary to determine if
the edm mutations were dominant or recessive and if a single
gene was affected in each edm mutant strain. The
exo1
edmx double mutant strains were crossed
with an exo1
single mutant strain (RKY4169), and the
resulting diploids were analyzed for a dominant or recessive mutator
phenotype (data not shown). None of the diploids revealed a mutator
phenotype, suggesting that all of the edm mutant alleles
were recessive. Sporulation and tetrad analysis of the diploids further
revealed that a single EDM gene was affected in each of the
edm mutant strains (data not shown).
The recessive nature of the edm mutations allowed
identification of the edm genes by complementation analysis
using plasmids containing a wild-type copy of known MMR and DNA
replication genes and using a yeast genomic DNA library. In this manner
the mutant genes in all 19 of the edm strains were
identified and, in 17 of the 19 cases, the EDM genes were
found to be known MMR genes. In particular, 13 of the edm
mutations mapped to MLH1 or PMS1, two mapped to
MSH2, one affected MSH3, and one affected the
PCNA-encoding gene POL30. It is striking that almost all of the known
MMR genes, with the exception of MSH6 and MLH3,
were identified. This is not surprising in the case of MSH6 because it
is predominantly important in the repair of base-base mispairs
(48), whereas the lys2::InsE-A10
assay used in the screen is specific for detecting frameshift mutations
(73); an msh6
mutation caused a small increase in the lys2::InsE-A10 assay that was
0.3% of that caused by an msh2
mutation (Table 2).
Probably, mutations in the MLH3 gene were not identified
because MLH3 has been shown to play a very minor role in MMR (20,
51). EXO1 has previously been shown to physically interact with
MSH2 and, more recently, with MLH1, and the fact that mutations in
MSH2 and MLH1 were obtained that showed an
enhanced exo1-dependent mutator phenotype is consistent with
a physical and functional interaction between EXO1 and these two
proteins (59a, 70, 74a). A physical or functional
interaction of yeast EXO1 with PMS1, MSH3, and POL30 has not been shown
prior to this study.
In addition to the 17 edm MMR mutations, two edm
mutations were obtained that affected other DNA synthesis genes (see
below), namely, RNR1, which encodes the large subunit of
ribonucleotide reductase, and POL32, which encodes one of
the small subunits of the DNA polymerase
holoenzyme (9, 22,
30). Because RNR1 is important in maintaining cellular
deoxynucleoside triphosphate (dNTP) pools, it is conceivable that
alterations in the activity of RNR1 in combination with a small defect
in MMR, such as in an exo1
mutant, may result in an
enhanced mutator phenotype. Thus, our remaining studies did not
generally include the rnr1 exo1
double mutant. In
contrast, that pol32 was identified in our screen as a
mutator mutation in an exo1
background suggests that it
may be directly important in MMR in vivo since it is known to be a
component of the DNA polymerase
holoenzyme; it also interacts with
PCNA, DNA polymerase
, and WRN, and it has been shown to play a role
in mutagenic bypass repair (9, 22, 28-30, 36).
Identification of mutations in the edm mutant
genes.
To determine the nature of the defects in MLH1, PMS1,
MSH2, MSH3, POL30, POL32, or RNR1 that cause the
exo1-dependent mutator phenotype, the genomic copy of these
genes from the respective edm mutant strains was sequenced.
The sequencing results are summarized in Table 3. Single
nucleotide mutations were observed in the respective edm
genes in all 19 mutant strains. Each mutation caused a single amino
acid change, except for the pol32 mutation, which was a
nonsense mutation that changed glutamine 46 of the POL32 open reading frame to a stop codon. Because the nonsense mutation was
present at the beginning of the 351-amino-acid open reading frame of
POL32, this mutation was likely to cause a null phenotype. Consistent with this, complete deletion of the POL32 gene in
an exo1
strain resulted in the same enhanced mutator
phenotype seen with the exo1
pol32-Q46STP
double mutant (data not shown). It is not clear whether the
msh3-G824R mutation is a weak allele or a
loss-of-function allele of MSH3 because even msh3
null mutations cause only weak mutator phenotypes in the assays used
here. In contrast, the mlh1, pms1, msh2, pol30, and
rnr1 mutant alleles appear to be hypomorphic because they
confer weak mutator phenotypes in EXO1+ cells
compared to the deletion alleles of these genes, which cause a strong
mutator phenotype (MLH1, PMS1, or MSH2) or result in cell inviability (POL30 or RNR1). While most
of the mutations observed were missense mutations, it is conceivable
that, had more mutants been screened, it would have been possible to
identify rare nonsense and frameshift mutations that were weak alleles like the other mutations identified here.
To identify the regions in MLH1, PMS1, MSH2, MSH3, and POL30 that are
important for functional interaction with EXO1, the amino acid changes
observed in these proteins were mapped onto the linear and in some
cases the three-dimensional structures of these proteins. Mapping the
amino acid changes observed in MLH1 onto the linear protein sequence
revealed that six of the seven affected amino acids were in the
N-terminal half of the protein (Fig. 2A). This region of
the MutL family of proteins contains four ATP-binding motifs and other
residues that are likely to be important for preserving an intact
ATP-binding site (3-5), and mapping the amino acids
described here onto the MutL structure shows that they all may be close
to the ATP-binding site (Fig. 3A). In particular, the
A28T and A41T amino acid changes occur within motif I of the
ATP-binding site and the G19D change is adjacent to this motif
(references 4 and 74 and references cited within). The
P157L change affects a residue adjacent to motif IV (references
4 and 74 and references cited within) that is conserved
among many MutL homologues (although not among human or rat MLH1),
while the R265K change also affects a highly conserved sequence, common
among the MutL proteins, which maps close to the ATP-binding site in
the MutL proteins in a region thought to be important for ATP binding
(3) (Fig. 3). Interestingly, missense mutations have been
identified in human MLH1 in cases of hereditary nonpolyposis colorectal
carcinoma (HNPCC) that alter the equivalent of the alanine 41 and
arginine 265 residues (cited in reference 4). Besides the
six-amino-acid changes observed in the N-terminal half of MLH1, a
single-amino-acid change, R547K, was found in the C-terminal portion of
the protein. This part of MLH1 contains the PMS1 interaction domain
(residues 501 to 756 [24, 54]). Overall, the amino acid
changes observed in or surrounding the ATPase motifs of MLH1 are likely
to affect ATP binding or hydrolysis, and the single amino acid change
observed in the C-terminal part of MLH1 could affect the interaction of MLH1 with PMS1.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 2.
Schematic representation of the position of the
exo1-dependent and pms1-A130V-dependent mutator
mutations. The relative positions of the exo1-dependent (A)
and pms1-A130V-dependent (B) mutator mutations on the
indicated genes are indicated by the arrows. The black vertical bars in
PMS1 and MLH1 indicate the position of motifs
important for ATP binding. The stippled boxes in PMS1 and
MLH1 indicate the position of motifs important for PMS1-MLH1
interactions. The two open vertical boxes in MSH2, MSH3, and
MSH6 indicate motifs important for ATP hydrolysis. The
single vertical black bars in MSH3, MSH6, and
POL32 indicate the motif that is important for interaction
with PCNA. The two stippled boxes in EXO1 indicate motifs
thought to be important for exonuclease activity.
|
|

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 3.
Maps of the positions of the amino acid residues
affected by the exo1-dependent and
pms1-A130V-dependent mutator mutations onto the crystal
structure of the ADP-bound form of the N-terminal fragment of MutL. The
indicated structures were generated using the RasMol program from Roger
Sayle (University of California at San Diego) with coordinates of the
40-kDa ATPase fragment of E. coli MutL complexed with ADP
from the Protein Data Bank (ID1B62). The ribbon diagram of MutL is in
blue. The ADP is indicated in yellow. The residues affected by the
exo1-dependent mlh1 mutations (A), the
exo1-dependent pms1 mutations (B), and the
pms1-A130V-dependent mlh1 mutations are indicated
in red. The relevant E. coli MutL amino acid residue numbers
are indicated followed by the relevant yeast amino acid residue numbers
in parentheses.
|
|
Mapping of the amino acid changes obtained in the second MutL homologue
protein, PMS1, revealed a similar clustering of amino acids in either
the N-terminal region that contains the ATP-binding site or the
C-terminal region that contains the MLH1 interaction domain.
Specifically, the A130V, G160D, and G305S amino acid changes observed
in PMS1 lie within or around key residues in the ATP-binding region
based on the three-dimensional structure of the N-terminal fragment of
E. coli MutL (Fig. 2A and 3B). Of these, alanine 130 in
yeast, which is alanine 98 in E. coli, is located in the
ATP-binding motif III, which is highly conserved among the MutL family
of proteins (74). Three amino acid changes that caused an
exo1-dependent mutator phenotype were observed in the
C-terminal region of PMS1, which is the MLH1 interaction domain
(24, 54) (Fig. 2). Similar to the mutations identified in
MLH1, there appear to be two classes of PMS1 mutations that cause an
exo1-dependent mutator phenotype: the first class of PMS1
mutations is likely to perturb ATP binding or hydrolysis, while the
second class is likely to affect the interaction with MLH1 and may
indirectly affect the ATP binding or hydrolysis by the MLH1-PMS1 heterodimer.
Similar to that observed with PMS1 and MLH1, the amino acid changes in
MSH2 and MSH3 that confer an exo1-dependent mutator phenotype are also located in or surrounding the region in these proteins that is important for ATP binding and hydrolysis (31, 43, 52, 66). The M541I amino acid change in MSH2 is
significantly upstream of the phosphate-binding loop (p-loop) consensus
sequence; however, the S762F amino acid change affects a highly
conserved serine of the Walker B domain that is important for binding
Mg2+ (Fig. 2A). The single-amino-acid change (G824R)
observed in MSH3 was also found to reside in the highly conserved
p-loop domain of MSH3 (Fig. 2A). It is possible that these
msh2 and msh3 mutations affect ATP binding or
hydrolysis or affect the structural transitions that occur in these
proteins on ATP binding. Finally, the single-amino-acid change
observed in PCNA mapped near the monomer-monomer boundary of the
homotrimeric crystal structure of this protein (42). It is
possible that this pol30 mutation could affect the stability of the PCNA trimer, as has been observed for other mutations that alter
amino acids in this region of PCNA (2).
edm mutations show unlinked noncomplementation.
If
the basis for the exo1-dependent mutator phenotype caused by
the different edm alleles is that in the absence of EXO1
they destabilize a protein complex that is critical for MMR, then this could be tested using other genetic assays, such as unlinked
noncomplementation. Unlinked noncomplementation refers to the
observation of a mutant phenotype in a diploid cell that is
heterozygous for recessive mutations in genes encoding different
interacting proteins (65, 77). Noncomplementation of the
mutant alleles occurs despite the wild-type copies of the proteins
present in the diploid because only a small fraction of the heteromeric
complexes are fully functional. To determine if unlinked
noncomplementation could be observed between any of the
exo1-dependent mutator mutations, seven different MAT
strains, i.e., exo1
, mlh1-A41T
exo1
, pms1-A130V exo1
, mlh1-R265K
exo1
, mlh1-G19D exo1
, mlh1-R547K
exo1
, and msh2-S762F exo1
strains, were crossed
with the different MATa strains listed in Table
4 (pms1-D901N exo1
was not analyzed as
this strain does not mate). The resulting diploid strains were
subsequently analyzed for the presence of a mutator phenotype using the
lys2::InsE-A10 patch assay (Table 4). As expected,
a mutator phenotype was not observed when a wild-type strain was
crossed with either exo1 or any of the edmx exo1
double mutant strains because of the recessive nature of the mutations.
When the exo1 single mutant was crossed with each of the
edmx exo1 double mutant strains, only a weak mutator
phenotype was observed in the diploids because they were homozygous for
the exo1 deletion mutation and contained one wild-type copy
of each EDM gene. As expected, no allele was observed to complement
itself. For example, in contrast to the weak mutator phenotype of the
diploid that is homozygous for the exo1 mutation and
heterozygous for the pms1-A130V allele, a strong mutator
phenotype was observed in diploids that were homozygous for both
exo1
and pms1-A130V mutations. Interestingly,
in addition to these expected results, several cases of unlinked
noncomplementation were observed in diploids that were heterozygous for
mlh1 and pms1 mutations in an
exo1-deficient background. For example, when the
pms1-A130V exo1
double mutant was
crossed with any of the mlh1 exo1 double mutants, a strong
mutator phenotype resulted (Table 4).
MLH1 and PMS1 are well known to interact with each other (24, 45,
54, 58). Because the mlh1 and pms1 alleles
identified here cause strong mutator phenotypes in the absence of
EXO1, it was of interest to determine if the unlinked
noncomplementation observed between the mlh1 and
pms1 alleles was exo1 dependent. In other words,
if the mlh1 and pms1 mutations obtained cause destabilization of an MMR complex only in the absence of EXO1 in vivo,
then the reintroduction of EXO1 into the diploids showing unlinked noncomplementation should overcome this defect. For this purpose, three different diploid strains that showed unlinked noncomplementation, RKY4244 (pms1-A130V × mlh1-A41T), RKY4246 (pms1-A130V × mlh1-R265K), and RKY4247
(pms1-A130V × mlh1-G19D)
as well as
the control strains RKY4240 (exo1
× mlh1-A41T), RKY4241 (exo1
× pms1-A130V), RKY4242 (exo1
× mlh1-R265K), and RKY4243 (exo1
× mlh1-G19D)
were transformed with either an empty vector plasmid, pRDK838(pRS314) or a plasmid containing wild-type
EXO1, pRDK834. The transformants were then analyzed for
their mutator phenotype by patch tests using the
lys2::InsE-A10 mutator assay. In contrast to the
strains transformed with the empty vector pRDK838, which showed a
mutator phenotype due to unlinked noncomplementation of the
pms1 and mlh1 alleles in an exo1
background, suppression of this phenotype was observed when the same
strains were transformed with pRDK834 which contains wild-type
EXO1 (data not shown). These results support the idea that
EXO1 plays an important role in the functional interaction between
other proteins that function in MMR, especially MLH1 and PMS1.
Overexpression of specific MMR proteins alleviates the defect of
edm mutations.
If the mutations identified here cause
destabilization of a higher-order MMR complex in the absence of EXO1,
then it is conceivable that increasing the level of other wild-type MMR
proteins could restabilize the MMR complex. To investigate this
possibility, we determined if increased expression of MLH1, PMS1, or
PCNA could overcome the defect of one or more of the edm
mutants. RKY3590 (wild type), RKY4168 (exo1
), and the
edmx exo1
double mutant strains listed in Table
5 were transformed with the 2µm plasmid pRDK436
(PMS1) or pRDK833 (POL30) or the low-copy-number
plasmid pRDK835 (MLH1; note that overexpression of MLH1 by a
2µm plasmid causes a dominant mutator phenotype in wild-type cells
[this study and reference 60]). The transformants were
then analyzed for their mutator phenotype in the
lys2::InsE-A10 assay in comparison to the transformants
containing the empty vector plasmid pRS425, pRS424, or pRS314.
Increased expression of MLH1 was found to suppress the phenotypes of a
limited number of mutants (Table 5). First, the addition of a second
copy of wild-type MLH1 in the pms1-G305S exo1 or
pms1-T749I exo1 double mutant caused a mild suppression of
the mutator phenotype. Suppression by low levels of wild-type MLH1 was
allele specific since it was not observed in the other pms1
exo1 double mutants. Suppression of the phenotype of some
pms1 exo1 double mutants by elevated levels of MLH1 was not
surprising since MLH1 and PMS1 form a heterodimer. Second, and more
surprisingly, the mutator phenotypes of the rnr1-G271S exo1
and the pol32-Q46STP exo1 mutants were significantly
suppressed by adding a second copy of wild-type MLH1. This
suggests a functional interaction between MLH1 and either RNR1 or POL32.
Allele-specific suppression of the mutator phenotype of some of the
mlh1 exo1 double mutants by overexpression of PMS1 was also
observed (Table 5). Not surprisingly, expression of PMS1 from a 2µm
plasmid partially suppressed the mutator phenotype of the
mlh1-R547K exo1 mutant since mlh1-R547K changes
an amino acid in the PMS1 interaction region of MLH1. In addition,
partial suppression of the mutator phenotype was observed for two other mlh1 mutations that cause amino acid changes in the
N-terminal half of MLH1, where the ATP-binding pocket is located. This
suggests that the N-terminal region of MLH1 is also important in the
functional interaction with PMS1 and/or other proteins during MMR.
Besides the suppression of the mutator phenotype of some of the
mlh1 exo1 mutants by pRDK436 (PMS1), the
msh2-M541I exo1 and msh3-G824R exo1 mutants were
partially suppressed by the 2µm PMS1 plasmid. This
observation is consistent with the idea that the defect in msh2-S762F exo1 and msh3-G824R exo1 mutants is
also associated with instability of a multiprotein MMR complex.
One of the interesting features of the proteins identified here is that
most of them (i.e., MLH1-PMS1, MSH2-MSH3, MSH2-MSH6, and POL32) have
been previously shown to physically interact with the DNA replication
and repair factor, PCNA (9, 13, 19, 22, 23, 30, 33, 76).
Thus, PCNA may play a crucial role in the functional interaction of MMR
proteins in vivo. To test this idea, a control high-copy-number
plasmid, pRDK839 (pRS424), or a high-copy-number plasmid containing the
PCNA-encoding gene POL30, pRDK833, was introduced into
RKY3590 (wild type), RKY4168 (exo1
), and all the
edm strains. Compared to the transformants containing the
control plasmid pRDK839, the POL30-containing plasmid pRDK833
suppressed the mutator phenotype of all the edm strains as
well as the exo1
single mutant strain (Table 5 and Fig.
4). To confirm that the PCNA-dependent suppression was
specific, the plasmids pRDK839 (control) and pRDK833 (POL30)
were introduced into strains RKY3591 (msh2
), RKY2751
(mlh1
), and RKY2750 (pms1
), which contain
complete deletion mutations in essential MMR genes. In contrast to the
suppression of the mutator phenotypes of the exo1 and
exo1 edm strains by the high-copy-number POL30
plasmid, pRDK833, there was no suppression of the mutator phenotypes of the msh2
, mlh1
, or pms1
strain by the POL30 plasmid (Fig. 4 and data not shown).
These results suggest that PCNA alleviates the MMR defects observed in
the exo1 and exo1 edm strains by stabilizing the
functional interactions within the MMR complex in the absence of EXO1.

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 4.
Suppression of representation exo1-dependent
mutator mutations by increased expression of PCNA. The indicated
strains were transformed with either the control vector or the vector
containing the POL30 gene encoding PCNA. Then, three
colonies each were patched onto a master plate and replica plated onto
an SD-Lys plate to evaluate the lys2::InsE-A10 reversion
properties of each strain as described in Materials and Methods.
|
|
Isolation of pms1-dependent mutator mutations.
If
the genetic interactions discussed above reflect protein-protein
interactions that are required for MMR, then it should be possible to
obtain similar mutations in EXO1 and other known and unknown MMR repair
genes in a similar screen starting with one of the edm
single mutants. To test this possibility, the pms1-A130V single mutant strain RKY4190 was mutagenized with EMS as described for
the exo1
strain RKY4168, and the survivors were screened for an increased mutator phenotype. Of 10,000 colonies that were screened for an enhanced mutator phenotype in the
lys2::InsE-A10 assay, 43 mutants were obtained
that had a pdm phenotype. Because the starting strain
contained a missense mutation in the PMS1 gene
(pms1-A130V), it was necessary to determine if the
pdm mutants contained a second mutation in PMS1.
Sequencing the PMS1 gene in all 43 pdm mutants
revealed that 12 mutants contained a second mutation in the
PMS1 gene. To identify the remaining 31 pdm
mutations, the obvious candidate genes, such as MLH1, EXO1, MSH2,
MSH3, MSH6, and POL30, were sequenced in the
pdm strains. Eight of the mutants had a mutation in the
MLH1 gene, five had a mutation in the EXO1 gene,
two had a mutation in MSH2, two had a mutation in
MSH6, and one had a mutation in MSH3 (Table
6). No mutations were identified in the POL30
gene. The remaining 13 pdm mutants had relatively weak
mutator phenotypes and, because of this, they were not analyzed further.
Further analysis of the pdm mutations revealed that four of
the eight mlh1 mutations caused amino acid changes located
in the N terminus of MLH1 in the vicinity of the ATP-binding site (4, 5, 74), two of the MLH1 mutations caused
amino acid substitutions located in the central region of the linear
MLH1 amino acid sequence, and the remaining two mlh1
mutations caused amino acid substitutions in the PMS1 interaction
domain of MLH1 (24, 54) (Fig. 2B and 3C). One of the
MLH1 mutations, P251, has been described as causing a
~50% MMR defect in lys2A14 and his7-2
frameshift reversion assays and a complete MMR defect in a
CAN assay and was interpreted as causing a partial MMR
defect (60). The observation here that this mutation was
only partially suppressed by a PMS1 plasmid, which indicates
that this allele causes a strong, but not complete, mutator phenotype
on its own and is only partially dependent on pms1-A130V, is
consistent with previously published results (60). The two
MSH2 mutations caused amino acid substitutions in the
C-terminal half of the protein, with the G688R amino acid change being
located within the Walker A ATPase domain (14, 31, 43, 52,
66) (Fig. 2B). In contrast, the mutations identified in
MSH3 and MSH6 caused amino acid substitutions in
the N-terminal half of these proteins in regions of these proteins that
are thought to interact with DNA (8, 14, 43, 52) (Fig. 2).
Given that MSH3 and MSH6 are redundant with regard to the repair of
frameshift mispairs, it was surprising to find pdm mutations
in MSH3 or MSH6. It is possible that these
mutations, in combination with pms1-A130V, are dominant
(14). Three of the exo1 mutations identified
were nonsense mutations in the N-terminal half of the EXO1
gene and are presumably null mutations. The two exo1
missense mutations identified caused amino acid changes within one of
the conserved exonuclease domains of EXO1 and could be loss-of-function
mutations, as well as significantly altering the structure or
expression of EXO1 (64, 70). Overall, these results
suggest that PMS1 has critical functional interactions with MLH1, as
expected from previous studies (25, 26, 45, 57, 58).
Additionally, PMS1 also appears to have important functional
interactions with EXO1, MSH2, MSH6, and MSH3.
 |
DISCUSSION |
In the present study, we have described a genetic approach for the
identification and characterization of mutations in MMR genes that
cause little or no defect as single mutations but which cause strong
defects when combined with other mutations that also cause little or no
defect as single mutations. This approach is a generalized extension of
previous studies that have examined interactions between individual MMR
genes, including genes encoding DNA polymerases (20, 34, 38, 48,
73, 74). One experiment involved the isolation of mutations that
increased the frameshift mutator phenotype of an exo1
mutation and resulted in the identification of mutations in the
majority of known MMR genes, including MLH1, PMS1, MSH2,
MSH3, and POL30, as well as POL32 and
RNR1, which have not been previously implicated in MMR. A
second experiment involved the isolation of mutations that increased
the frameshift mutator phenotype of a pms1 mutation and
resulted in the identification of mutations in many of the known MMR
genes, including EXO1, MLH1, MSH2, MSH3, and
MSH6. These mutations also showed two other types of genetic
interactions: specific pairs of mutations were observed to show
unlinked noncomplementation in doubly heterozygous diploid strains, and
the defect caused by pairs of mutations could be suppressed by
high-copy-number expression of a third gene, an effect that showed
considerable mutant allele specificity and overexpressed gene
specificity. Previous studies have shown that MSH2 exists as a stable
complex with MSH3 or MSH6 (1, 15, 21, 48, 53), that MLH1
exists as a stable complex with PMS1 (24, 45, 54, 58), and
that interactions have been detected between POL30 (PCNA) and MLH1,
MSH3, and MSH6 (13, 19, 23, 33, 76) and between EXO1 and
both MSH2 and MLH1 (59a, 70, 74a). Combined with these
previous results, as expanded upon below, our results support the
hypothesis that higher-order protein complexes are formed during MMR
that may simultaneously contain MSH2-MSH6 (or alternately MSH2-MSH3),
MLH1-PMS1, EXO1, POL30 (PCNA), and DNA polymerase
(POL32 and other
subunits). Furthermore, such higher-order complexes likely involve
multiple protein-protein interactions and protein-protein interactions
that may be dependent on interactions with a third protein.
Particularly key interactions appear to be interactions with EXO1 and
POL30 (PCNA). We are presently attempting to isolate some of the
higher-order protein complexes predicted by the genetic results
presented here and study the biochemical properties of these complexes.
An alternate hypothesis that might explain the edm mutations
is if exo1
mutations cause a weak defect in the editing
of mutations caused by an error-prone pathway. Given the polarity of
EXO1, such a pathway is unlikely to edit DNA polymerase
misincorporation errors but could be a pathway that edits the 5' end of
Okazaki fragments (71) or a function that acts during
recombination (18, 38, 67, 75). If MMR normally repairs
such errors, then combining an exo1
mutation with a weak
MMR-defective mutation might result in the saturation of MMR with
errors and hence an increase in mutation rates. In this circumstance,
the observed mutator phenotypes, unlinked noncomplementation, and
suppression of mutations by overexpression of other MMR proteins would
still reflect the destabilization of MMR complexes by the
edm and pdm mutations. However, the mutator
phenotypes measured would reflect the combination of increased errors
due to exo1 mutations and destabilization of MMR complexes
due to the edm and pdm mutations. One point in
contradiction to this hypothesis is the observation that
exo1
mutations do not increase the mutation rate caused by null mutations in MSH2, MSH6, MLH1, or PMS1,
whereas mutations in the editing exonuclease functions of DNA
polymerases that increase misincorporation rates do increase the
mutation rate caused by null mutations in MMR genes (69, 72
,74a; also data not shown).
The genetic screen to identify proteins that are functionally
interacting or redundant with EXO1 was performed to better
understand the in vivo role of EXO1. The observation that a
majority of exo1-interacting mutations was obtained in
five known MMR genes (MSH2, MSH3, MLH1, PMS1, and
POL30) is consistent with, but does not prove, that EXO1
plays a direct role in MMR. Because EXO1 has been proposed to be a
redundant exonuclease that functions in MMR (34, 71, 73),
it was surprising that no genes encoding potential exonucleases were
identified. Some mutations like the pol2-04 editing
exonuclease mutation should have been found (72), but if,
like pol2-04, they were specific missense mutations in
essential genes, they might not be identified unless much higher
numbers of mutants were examined. It is possible that exo1
mutations may be lethal in combination with mutations in other genes
encoding exonucleases that function in MMR and other aspects of DNA
metabolism (71, 72). Alternatively, it is possible that
there are many redundant exonucleases, as in E. coli, that
function in MMR so that mutations in even two such genes will not yield
a strong mutator phenotype (27, 40, 50, 78). It is also
possible that EXO1 plays an important role in the formation of protein
complexes that function in MMR and that the mutator phenotype caused by
an exo1 mutation reflects this structural role of EXO1,
possibly in addition to an enzymatic role in the degradation of DNA
during MMR. A number of results support the view that EXO1 could
stabilize a multiprotein complex. Many of the exo1-dependent
mutator mutations affect MLH1 and MSH2, which are known to interact
with EXO1. These could represent cases where EXO1 stabilizes MLH1 and
MSH2 so that the mlh1 and msh2 mutations by
themselves do not destabilize these proteins but do so in the absence
of the EXO1 interaction. This interpretation is supported by the
observation that overexpression of a third protein that interacts with
the protein containing the amino acid substitution (e.g., POL30 or PMS1
with exo1 mlh1, POL30 with exo1 msh3, and PMS1
with exo1 mlh1) (Table 5) suppresses the MMR defect. This is
because if the edm mutations were to weaken the interaction between the mutant protein and a normal partner protein and if this
interaction was further weakened by the lack of the EXO1 interaction,
overexpression of a different interacting protein would stabilize the
weakened protein-protein interaction. Many of the
exo1-dependent mutator mutations affect PMS1, MSH3, and POL30, which are not known to interact with EXO1. This is also true for
the pms1-dependent exo1 mutations identified
(Table 6). Thus, EXO1 interactions with MLH1 and MSH2 could be critical
in maintaining a conformation important for the interactions between these latter proteins and PMS1, MSH3, and POL30 so that the mutation by
itself does not destabilize these proteins but does so in the absence
of the EXO1 interaction with MSH2 and MLH1. This interpretation is
supported by the observation that the overexpression of a third protein
that does not interact with either mutant protein but does interact
with MSH2 or MLH1 (e.g., POL30 with exo1 pms1 and exo1
msh2) (Table 5) suppresses the MMR defect.
In light of the fact that EXO1 interacts directly with MLH1 but not
with PMS1 (74a), a striking feature of the data presented here is the high proportion of exo1-dependent mutations that
were in either MLH1 or PMS1 and the high
proportion of pms1-dependent mutations that were in either
MLH1 or EXO1. The mlh1 and
pms1 mutations clustered in two homologous regions of each
protein, the C-terminal MLH1-PMS1 interaction region (24,
54) and the region around the N-terminal ATP-binding site
(4, 5), which have been suggested to participate in
ATP-binding-regulated interactions between the N-terminal regions of
MLH1 and PMS1 (74). This appears to reflect the importance
of both the MLH1-PMS1 interaction and the interaction between EXO1 and
MLH1-PMS1. Two aspects of the data further support the view that the
N-terminal regions of MLH1 and PMS1 interact during MMR. First,
overexpression of PMS1 partially suppresses the defect caused by two
N-terminal mlh1 edm mutations (Table 5) and, second,
unlinked noncomplementation was observed between N-terminal pms1
edm mutations and a C-terminal mlh1 edm mutation and
between N-terminal mlh1 edm mutations and C-terminal pms1 edm mutations (Table 4). These effects seem unlikely if MLH1 and PMS1 interact only at their C termini. Finally, the fact that
the expression of EXO1 suppresses a broad spectrum of mutations present
in interaction regions of MLH1 and PMS1 supports the view that the
EXO1-MLH1 interaction is important for the stability of the entire
MLH1-PMS1 complex.
It was surprising to obtain mutations in the genes encoding POL30
(PCNA), POL32, and RNR1 because these proteins had not previously been
shown to interact with either EXO1 or PMS1. RNR1 and POL32 had not
previously been implicated in MMR, although DNA polymerase
, of
which POL32 is a subunit, is required for MMR (47).
Combined with previous observations that PCNA (POL30) interacts with
MLH1, MSH3, and MSH6 (19, 23, 30, 33, 76), the
exo1-dependent pol30 mutation and the observation
that overexpression of POL30 suppresses essentially all
exo1- and pms1-dependent mutations support the
view that interactions with PCNA are important in maintaining complexes
of MMR proteins. It is possible that POL30 and EXO1 each interact with
many MMR proteins and complexes, and hence a combination of mutations
in both genes has a general effect on the stability of complexes that
function in MMR. The observation of an exo1-dependent
pol32 mutation may also reflect a critical role of PCNA
because POL32 is a subunit of DNA polymerase
that is not required
for DNA polymerase activity but is involved in DNA polymerase
PCNA
interactions (9, 22, 30). Thus, this involvement of POL32
in MMR could reflect the coupling of polymerase
to MMR proteins via
PCNA interactions. It is not clear from our data if RNR1 plays a direct
role in MMR. This is because the rnr1 mutation identified
increases the mutation rate of msh2 and mlh1 null
mutants (data not shown), a result that is more consistent with the
rnr1 mutation altering dNTP pools in a way that leads to
increased mutation rates.
Previous studies have shown that inherited mutations in two MMR genes,
hMSH2 and hMLH1, underlie the majority of HNPCC
cases, a common cancer susceptibility syndrome associated with high
penetrance, early onset, and a diversity of tumor types
(56). Inherited mutations in hMSH6 also appear
to cause inherited cancer susceptibility, although associated with a
lower penetrance and later onset than classical HNPCC
(32). Finally, somatic inactivation of MMR genes, notably
the silencing of hMLH1, is associated with a variety of sporadic cancers (6, 7, 16, 37, 59, 68). The results described here demonstrating that interactions between weak alleles of
MMR genes can produce strong mutator phenotypes have interesting implications for the genetics of human cancer susceptibility. These
results suggest that weak alleles could exist in humans without causing
cancer susceptibility by themselves but could result in increased
cancer susceptibility in individuals who had inherited two or more such
alleles. Because the inheritance of two or more independent alleles
would not show vertical, dominant transmission as seen in HNPCC, this
view suggests that some sporadic cancer cases might have a polygenic
basis. The observation of unlinked noncomplementation between multiple
weak alleles is particularly interesting in this regard. Individuals
carrying alleles showing unlinked noncomplementation would be expected
to show some mutator phenotype in normal tissues, as has been observed
in individuals carrying potentially dominant mutations in
hMLH1 and hPMS2 (55). The types of
experiments described here in which interacting weak alleles can be
identified and tested provide a model on which to base tests for
polygenic inheritance of MMR defects in humans.
 |
ACKNOWLEDGMENTS |
We thank the Kolodner lab for helpful discussions and comments on
the manuscript, Mike Liskay and Rick Fishel for communicating unpublished results, and John Weger and Jill Green for DNA sequencing.
This work was supported by National Institutes of Health grant GM50006
to R.D.K.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Ludwig Institute
for Cancer Research, UCSD School of Medicine-CMME3080, 9500 Gilman Dr., La Jolla, CA 92093-0660. Phone: (858) 534-7804. Fax: (858) 534-7750. E-mail: rkolodner{at}ucsd.edu.
 |
REFERENCES |
| 1.
|
Acharya, S.,
T. Wilson,
S. Gradia,
M. F. Kane,
S. Guerrette,
G. T. Marsischky,
R. Kolodner, and R. Fishel.
1996.
hMSH2 forms specific mispair-binding complexes with hMSH3 and hMSH6.
Proc. Natl. Acad. Sci. USA
93:13629-13634[Abstract/Free Full Text].
|
| 2.
|
Ayyagari, R.,
K. J. Impellizzeri,
B. L. Yoder,
S. L. Gary, and P. M. Burgers.
1995.
A mutational analysis of the yeast proliferating cell nuclear antigen indicates distinct roles in DNA replication and DNA repair.
Mol. Cell. Biol.
15:4420-4429[Abstract].
|
| 3.
|
Ban, C.,
M. Junop, and W. Yang.
1999.
Transformation of MutL by ATP binding and hydrolysis: a switch in DNA mismatch repair.
Cell
97:85-97[CrossRef][Medline].
|
| 4.
|
Ban, C., and W. Yang.
1998.
Crystal structure and ATPase activity of MutL: implications for DNA repair and mutagenesis.
Cell
95:541-552[CrossRef][Medline].
|
| 5.
|
Bergerat, A.,
B. de Massy,
D. Gadelle,
P. C. Varoutas,
A. Nicolas, and P. Forterre.
1997.
An atypical topoisomerase II from Archaea with implications for meiotic recombination.
Nature
386:414-417[CrossRef][Medline].
|
| 6.
|
Bevilacqua, R. A., and A. J. Simpson.
2000.
Methylation of the hMLH1 promoter but no hMLH1 mutations in sporadic gastric carcinomas with high-level microsatellite instability.
Int. J. Cancer
87:200-203[CrossRef][Medline].
|
| 7.
|
Borresen, A.-L.,
R. A. Lothe,
G. I. Meling,
S. Lystad,
P. Morrison,
J. Lipford,
M. F. Kane,
T. O. Rognum, and R. D. Kolodner.
1995.
Somatic mutations in the hMSH2 gene in microsatellite unstable colorectal carcinomas.
Hum. Mol. Genet.
11:2065-2072.
|
| 8.
|
Bowers, J.,
T. Sokolsky,
T. Quach, and E. Alani.
1999.
A mutation in the MSH6 subunit of the Saccharomyces cerevisiae MSH2-MSH6 complex disrupts mismatch recognition.
J. Biol. Chem.
274:16115-16125[Abstract/Free Full Text].
|
| 9.
|
Burgers, P. M., and K. J. Gerik.
1998.
Structure and processivity of two forms of Saccharomyces cerevisiae DNA polymerase delta.
J. Biol. Chem.
273:19756-19762[Abstract/Free Full Text].
|
| 10.
|
Chen, C.,
B. J. Merrill,
P. J. Lau,
C. Holm, and R. D. Kolodner.
1999.
Saccharomyces cerevisiae pol30 (proliferating cell nuclear antigen) mutations impair replication fidelity and mismatch repair.
Mol. Cell. Biol.
19:7801-7815[Abstract/Free Full Text].
|
| 11.
|
Chen, C.,
K. Umezu, and R. D. Kolodner.
1998.
Chromosomal rearrangements occur in S. cerevisiae rfa1 mutator mutants due to mutagenic lesions processed by double-strand-break repair.
Mol. Cell
2:9-22[CrossRef][Medline].
|
| 12.
|
Christianson, T. W.,
R. S. Sikorski,
M. Dante,
J. H. Shero, and P. Hieter.
1992.
Multifunctional yeast high-copy-number shuttle vectors.
Gene
110:119-122[CrossRef][Medline].
|
| 13.
|
Clark, A. B.,
F. Valle,
K. Drotschmann,
R. K. Gary, and T. A. Kunkel.
2000.
Functional interaction of proliferating cell nuclear antigen with MSH2-MSH6 and MSH2-MSH3 complexes.
J. Biol. Chem.
275:36498-36501[Abstract/Free Full Text].
|
| 14.
|
Das Gupta, R., and R. D. Kolodner.
2000.
Novel dominant mutations in Saccharomyces cerevisiae MSH6.
Nat. Genet.
24:53-56[CrossRef] |