INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

DNA helicases catalyze the unwinding of duplex DNA into individual DNA strands (42). A plethora of DNA helicases within cells is involved in DNA replication, repair, recombination, and transcription. Members of the RecQ family of DNA helicases are involved in the maintenance of genome stability in all organisms characterized, from bacteria to humans (7). Mutations in the SGS1 gene, which encodes the only RecQ homologue in Saccharomyces cerevisiae, result in elevated levels of mitotic homologous and illegitimate recombination, increased rates of chromosomal nondisjunction, and accelerated aging (21, 56, 61, 62, 65). Similarly, mutations in human genes encoding the RecQ homologues RecQL4 (35, 49), WRN (67), and BLM (18) give rise to rare hereditary disorders that are characterized by genome instability and a pronounced predisposition to cancer. Notably, expression of either WRN or BLM in yeast complements the hyperrecombination phenotypes of an sgs1 mutant (65). These findings suggest that the mechanisms by which Sgs1 preserves genetic stability in yeast will serve as a paradigm for the role of RecQ homologues in human disease.

The SGS1 gene was originally isolated in a screen for genetic interaction with DNA topoisomerase III (21). Both topoisomerase III and Sgs1 repress recombination of DNA repeats, and inactivation of either Sgs1 or topoisomerase III results in S-phase-specific defects. Therefore, it was proposed that the combined activity of Sgs1 and topoisomerase III is required to initiate DNA repair events during replication (7). In support of this model, Sgs1 was shown to colocalize with the cell cycle checkpoint kinase, Rad53, in S-phase-specific foci and to participate in activation of the intra-S checkpoint (19). In the absence of Sgs1, DNA lesions that arise during DNA replication may be diverted into a homologous recombination pathway. This view is supported by recent reports that inactivation of Sgs1 and Srs2, another DNA helicase with a partially redundant role in genome maintenance, results in a severe growth defect involving a high incidence of mitotic arrest (22, 40, 46). The growth defect is suppressed by inactivation of homologous recombination proteins, including Rad51, Rad52, Rad55, and Rad57, suggesting that mitotic arrest in sgs1 srs2 mutants results from DNA lesions that arise from abortive recombination events (22, 46). Taken together, these findings suggest that DNA lesions that block the replication fork act as triggers for homologous recombination in sgs1 mutants.

Sgs1 is critical for the stability of repeated DNA sequences such as those in the RDN1 locus. RDN1 contains 100 to 200 tandem repeats of a 9.1-kb region encoding the RNA polymerase I (Pol I)-transcribed 35S rRNA gene and the Pol III-transcribed 5S rRNA gene. Both recombination between ribosomal DNA (rDNA) repeats and Pol II-mediated transcription are inhibited in the RDN1 locus (6, 25, 57, 58). Recombination in the rDNA can give rise to extrachromosomal rDNA circles (ERCs), which accumulate in aging cells and may trigger senescence (55). Many trans-acting factors that repress recombination in rDNA have been identified. Where analyzed, genes that inhibit rDNA recombination, including SIR2, TOP1, UBC2, and ZDS2, have been found to also be required for transcriptional silencing in rDNA (6, 8, 20, 25, 52, 57). Furthermore, both SIR2 and ZDS2 forestall aging (31, 52). These and other findings have led to models in which a specific type of heterochromatin mediates the repression of recombination and transcription in the rDNA, and the integrity of this heterochromatin is a primary determinant of longevity (26, 29). In sgs1 mutants, mitotic recombination in the rDNA is increased sevenfold (21) and longevity is reduced by 60% (55, 56). Paradoxically, ERCs accumulate to the same level in the presence and absence of Sgs1 (28, 46). The role of Sgs1 in rDNA silencing has not been investigated previously, despite its potential to provide insight into the mechanism by which Sgs1 represses rDNA recombination and aging.

In this study, we determined the effect of Sgs1 on the expression and transposition of Ty1 elements in rDNA and euchromatic DNA. Ty1 elements constitute one of five families of retrovirus-like transposons (Ty1 to Ty5) in yeast. Approximately 30 Ty1 elements reside at dispersed sites in the haploid genome, and the majority are transpositionally competent (12, 34). Ty1 elements consist of a central coding domain flanked by long terminal repeats (LTRs). The coding domain contains two overlapping open reading frames: TYA1, which encodes a capsid protein, and TYB1, which encodes protease, integrase (IN), and reverse transcriptase (RT). Ty1 elements are transcribed by Pol II to form a terminally redundant transcript. Ty1 RNA is translated into two proteins, TyA1 and the TyA1-TyB1 fusion protein, which assemble into virus-like particles (VLPs) that encapsulate Ty1 RNA during assembly. Maturation of VLPs occurs by protease-mediated processing of Ty1 precursor proteins, and it is required for synthesis of a full-length linear cDNA by RT, using Ty1 RNA as a template. Subsequently, the Ty1 cDNA and IN protein are transported to the nucleus, presumably as components of a preintegration complex (33, 48). IN mediates transposition of Ty1 cDNA at a nonhomologous target in the genome. Alternatively, Ty1 cDNA can recombine with genomic Ty1 elements, which occurs by IN-independent and Rad52-dependent mechanisms (53). The introduction of Ty1 cDNA into the genome by transposition or recombination is referred to as Ty1 cDNA-mediated mobility.

Several host mechanisms limit the potentially mutagenic effects of Ty1 transposition. First, Ty1 elements are preferentially targeted to genomic regions that do not encode proteins, including the upstream regions of Pol III-transcribed genes (16, 30). Second, Ty1 elements that are located in the rDNA array are subject to transcriptional silencing (6). Third, transposition is inhibited by host factors that block posttranscriptional steps in Ty1 replication. For example, Fus3, a mitogen-activated protein kinase, destabilizes VLP-associated proteins via its negative regulation of the invasive growth pathway (10). In addition, Ssl2 and Rad3, two helicase components of transcription factor TFIIH, promote degradation of Ty1 cDNA, thereby repressing transposition 100-fold or more (39). Finally, members of the Rad52 epistasis group, including Rad50, Rad51, Rad52, Rad54, and Rad57, reduce Ty1 cDNA levels and transposition by inhibiting cDNA synthesis or stability (50).

In this work, we demonstrate that Sgs1 inhibits the mobility of Ty1 elements by a novel mechanism. Initially, we proposed that Sgs1 might specifically repress transcription (and therefore transposition) of rDNA-Ty1 elements, since Sgs1 is required for the repression of rDNA recombination. To our surprise, we found that Sgs1 is not involved in the transcriptional silencing of Ty1 elements in the rDNA, although it is required for their mitotic stability. Furthermore, Sgs1 is a global inhibitor of Ty1 mobility that acts primarily at a step following cDNA synthesis. In the absence of Sgs1, extrachromosomal Ty1 cDNA molecules recombine at a high frequency, forming multimeric cDNA arrays that are subsequently integrated into the genome. We demonstrate that transposition of multimeric cDNA is the major cause of increased Ty1 mobility in sgs1 mutants.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Yeast strains, media, and genetic procedures. Standard yeast culture medium was prepared as described previously (51). The yeast strains used in this study are listed in Table 1. The mapping of Ty1his3AI-236r and Ty1his3AI-816r to the rDNA and Ty1his3AI-242 to a locus outside of rDNA on chromosome XII was described previously (6). Strain JC1109 is a haploid spore derived from a cross between strain JC1078 [MATa ura3(-52 or -167) trp1(-289 or :hisG) his3200 ade2:hisG Ty1ade2AI-515] and strain JC816 (6). The leu2:hisG allele was introduced into strains JC236, JC242, and JC1109 by two-step transplacement using plasmid pNK58, as described by Alani et al. (1). Subsequently, sgs1LEU2 derivatives were constructed by one-step transplacement using a DNA fragment of plasmid pPWSGS1 (62). The sgs1LEU2 strain JC3161 was constructed by the same method of transformation in strain YH8 (64). The sgs1LEU2 disruption alleles were verified by Southern analysis. Strains containing the rad52:hisG allele were constructed by two-step transplacement using plasmid pBDG542 (12). To construct strains containing a HIS3-marked Ty1 element, the his3AI marker was replaced in strains JC236, JC242, and JC1109 and isogenic leu2:hisG sgs1LEU2 derivatives by integrative transformation of a 0.8-kb ClaI fragment of plasmid pGEM-HIS3 containing the HIS3 allele (6).

Plasmid construction. Plasmid pJC573, a URA3-based integrating vector containing 1.2 kb of yeast genomic DNA sequences from the BIK1-HIS4 intergenic region (chromosome III, nucleotides 68462 to 69636) adjacent to a Ty1his3AI[1] element, was constructed in two steps. First, an 8.9-kb XhoI-EagI fragment of plasmid pOY1 (38) including the BIK1-HIS4 intergenic region adjacent to a Ty1-H3/912 element marked with his3AI was subcloned into pRS406 (54). Second, a 0.9-kb ClaI fragment containing his3AI was deleted from this plasmid and replaced with a 0.9-kb ClaI fragment containing the modified retrotranscript indicator gene (RIG), his3AI[1]. The his3AI[1] RIG contains the same 104-bp artificial intron (AI) that is present in his3AI, but the intron has been relocated to position +440 in the HIS3 open reading frame. Consequently, the AI in his3AI[1] is included within sequences that are deleted in the his31 allele in yeast strain BY4742 and derivatives. Use of the his3AI[1] RIG in strains carrying the his31 allele prevents formation of His⁺ prototrophs by ectopic DNA-mediated recombination. The his3AI[1] RIG was generously provided by D. Garfinkel (Frederick Cancer Research and Development Center, National Cancer Institute), and its construction will be described elsewhere.

Northern blot analysis. Total RNA was isolated from yeast strains JC236, JC280, JC2359, JC242, JC544, and JC2360 as described previously (6). Northern blot analysis was performed as described previously (59). ³²P-labeled RNA probes were used to detect Ty1his3AI, total Ty1, and PYK1 transcripts (13). Quantification was performed on a Storm 8600 phosphorimager using ImageQuant software.

Mitotic stability of Ty1HIS3 elements. The mitotic stability of Ty1HIS3 elements was assayed as described previously (6). Briefly, single His⁺ colonies were inoculated into 10 ml of yeast extract-peptone-dextrose (YPD) medium and grown overnight at 30°C. Cultures were diluted 1:10,000 in fresh YPD and grown to saturation. A dilution of the ninth serial culture was plated on YPD medium and replicated to synthetic complete (SC) medium lacking histidine to determine the fraction of His auxotrophs.

Phenotypic assay for expression of mURA3-LEU2. SGS1 and congenic sgs1 strains containing the mURA3-LEU2 marker in rDNA or at the leu21 locus were constructed using standard genetic techniques (51). Strain BY4742-10775 (sgs1kanMX4) was crossed to strain JS210-1 (mURA3-LEU2 at leu21) and strain JS215-10 (mURA3-LEU2 in rDNA) (57) to obtain SGS1 and sgs1kanMX4 spores from the same tetrad. Individual spores were used to seed 10-ml cultures of YPD medium, which were grown to saturation at 30°C. Tenfold serial dilutions of each culture were made in sterile distilled water, and 5 µl of each dilution was spotted onto SC, SC-Ura, and 5-fluoro-orotic acid (5-FOA) agar.

Ty1 cDNA-mediated mobility assay. The rate of His⁺ prototroph formation in strains containing a Ty1his3AI element was determined by the maximum-likelihood method (37). Strains JC236, JC2359, JC1109, JC2378, JC242, JC2360, JC2712, and JC2698 were grown to saturation in YPD medium at 30°C. For each strain, 9 or 11 tubes containing 2 ml of YPD medium were inoculated with 500 cells and grown to saturation at 20 or 23°C. The cell count in three cultures was determined by determining the titers on YPD plates. All cultures were subsequently plated to SC-His medium and grown at 30°C to quantify His⁺ prototrophs. SGS1 and sgs1LEU2 congenic pairs were tested in the same experiment.

Protein analysis. Western blot analyses were performed on whole-cell yeast extracts prepared from exponential-phase cultures as described previously (2), except that 50 µg of protein was analyzed per lane on a sodium dodecyl sulfate-10% polyacrylamide gel. Proteins were transferred to a polyvinylidene difluoride membrane and then incubated overnight with TyA1 antiserum (9) diluted 1:5,000. Horseradish peroxidase (HRP)-conjugated anti-rabbit antibody (Amersham) diluted 1:2,500 was used as a secondary antibody. Subsequently, the membrane was incubated with goat antisera raised against N- and C-terminal peptides of Fus3 (Santa Cruz Biotechnology, Inc.), which were combined and used at a 1:2,000 dilution for 1 to 2 h. HRP-conjugated anti-goat antibody (Santa Cruz Biotechnology, Inc.) diluted 1:5,000 was used as a secondary antibody.

Quantitation of Ty1 cDNA. Two independent colonies of each yeast strain were grown on YPD medium at 20°C and then inoculated into a 10-ml culture of YPD medium and grown to saturation at 20°C. Genomic DNA was prepared from each culture as described previously (9). DNA samples were digested with PvuII and subjected to electrophoresis on a 1% Seakem-GTG agarose (FMC) gel, followed by transfer of the DNA to a Hybond N+ membrane (Amersham). A ³²P-labeled riboprobe containing sense-strand TYB1 sequences was synthesized using plasmid pGEM-TYB1. Bands were quantified by phosphorimage analysis using a Molecular Dynamics Phosphorimager and ImageQuant software.

Ty1 integration into the CAN1 locus. Strains JC242 and JC2360 were grown overnight in YPD medium at 30°C. Twenty 2-ml cultures of YPD were inoculated with 500 cells and grown at 20°C to saturation. The titers of four cultures were determined by plating dilutions on YPD medium, and the number of canavanine-resistant (Can^r) cells in each culture was determined by plating on SC-Arg+Can medium. The rate of resistance to canavanine was calculated by the maximum-likelihood method (37). To determine the fraction of can1 mutations caused by insertion of a Ty1 element, one Can^r colony was obtained from 40 independent cultures. Genomic DNA was prepared from each strain, and 250 ng of DNA was used as a template in PCR analysis with AX016 (GAAAATTTCGAGGAAGACGATAAGG) and AX019 (CAAATGCTTCTACTCCGTCTGC) to amplify a 2,265-bp fragment of the CAN1 gene (9). DNA samples that yielded no CAN1-specific PCR product were subjected to two additional PCR amplifications with the CAN1-specific primer AX016 or AX019 and a Ty1 LTR-specific oligomer, AX015 (GCCTTTATCAACAATGGAATCCC), to amplify a Ty1:can1 junction fragment, if present. The rate of Ty1 transposition into CAN1 in strain JC2360 was calculated by multiplying the rate of resistance to canavanine by the fraction of Can^r strains that contained a Ty1 element within CAN1.

Ty1HIS3 cDNA-genomic Ty1his3AI element recombination assay. Plasmid pJC573 was linearized at the PacI site in BIK1-HIS4 intergenic DNA and used to transform strains BY4742, BY4742-10775, YH8, and JC3161. Ura⁺ transformants were grown as large patches on SC-Ura medium at 30°C and then replicated to two YPD plates, one of which was grown at 20°C and the other of which was grown at 30°C. Following growth for 3 days, patches of cells were replicated to SC-Ura-His medium to select for His⁺ Ura⁺ colonies that sustained a Ty1HIS3 insertion and retained the Ty1his3AI[1]-URA3 cassette. No His⁺ Ura⁺ prototrophs were detected following growth on YPD at 30°C, indicating that His⁺ Ura⁺ colonies that arose at 20°C were independent. His⁺ Ura⁺ colonies were transferred as small patches to YPD medium. Following growth at 30°C for 2 to 3 days, patches of cells were replicated to 5-FOA-His medium and grown for 3 days at 30°C. The fraction of His⁺ colonies that failed to generate His⁺ Ura derivatives was determined.

PCR-based detection of multimeric Ty1HIS3 transposition events. Independent His⁺ colonies that sustained an insertion of Ty1HIS3 by retrotransposition were obtained as follows. Yeast strain JC236 and isogenic sgs1, rad52, and sgs1 rad52 derivatives were single-colony purified and then spread onto YPD plates and grown at 30°C. After 2 days, the cells were replicated to SC-His to check that no preexisting His⁺ colonies were present. Cells were also replicated to a fresh YPD plate and grown at 20°C for three days to induce transposition. The cells were subsequently replicated to SC-His medium and grown at 30°C. His⁺ papillae were single-colony purified, and cells in a medium-sized colony were lysed using Lyse-N-Go PCR Reagent (Pierce Chemical Co.), according to the manufacturer's specifications. Lysates were used in PCR amplification reactions with oligomers HISOUT-2 (GTACTAGAGGAGGCCAAGAG) and TYA1OUT-2 (TCTCTGGAACAGCTGATGAAG). Oligomers TEL1-F (CGGATTTCTGACGATATGGAC) and TEL1-R (ACCAACGTACTGAAGGTATCC), which amplify a 475-bp fragment of the TEL1 locus, were included in each PCR amplification to ensure that the genomic DNA was PCR competent. PCR mixtures were incubated at 94°C for 30 s, 63°C for 30 s, and 72°C for 30 s, followed by 29 cycles in which the annealing temperature (63°C) was successively lowered by 0.3°C. A portion of each reaction mixture was analyzed on a 2% agarose gel.

Sequence analysis of 3' Ty1HIS3:genomic DNA junctions. Plasmid pGTy1-H3his3AI (14) was introduced into sgs1 strain JC3161. Ura⁺ transformants were grown on SC-Ura-2% galactose medium at 20°C for 4 days to induce expression of the pGTy1-H3his3AI element and subsequently plated on SC-His-2% glucose to isolate colonies containing Ty1HIS3 transpositions. Ura segregants were identified following single-colony purification of His⁺ isolates on YPD plates. Independent His⁺ Ura colonies containing a single >3.0-kb PvuII fragment that hybridized to a ³²P-labeled HIS3 riboprobe in Southern blot analysis were identified. The 3' Ty1HIS3:genomic DNA junction was cloned by integration and eviction of plasmid pGEM-URA3-HIS3 DNA linearized with NheI. The Ty1HIS3:genomic DNA junction fragments were evicted from pGEM-URA3-HIS3 transformants by digestion of genomic DNA that was prepared with AatII and ligation at <0.1 µg of DNA/µl. Ligation reactions were used to transform Escherichia coli to ampicillin resistance. DNA sequencing was performed with the HIS3-specific primer AX009 (CTTTATCAACAATGGAATCCC), and sequencing data were analyzed by BLASTN homology search with the Saccharomyces Genome Database (http://genome-www2.stanford.edu/cgi-bin/SGD/).

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Mitotic stability and transcriptional silencing of Ty1 elements in rDNA. We demonstrated previously that Ty1 elements located in the rDNA are subject to transcriptional silencing (6). To monitor the effect of deleting SGS1 on transcriptional silencing of Ty1 elements in the rDNA, we quantified RNA from individual Ty1 elements marked with the his3AI gene and from genomic Ty1 elements collectively in wild-type, sgs1, and ubc2 cells (Fig. 1). RNA of the rDNA element Ty1his3AI-236r was found at very low abundance in the SGS1 strain JC236 because of rDNA silencing, and it was increased only twofold in an isogenic sgs1 strain (Fig. 1, lanes 1 and 3). In contrast, deletion of UBC2, which is required for rDNA-specific transcriptional silencing (6), increased Ty1his3AI-236r RNA 13.3-fold (lanes 1 and 2). RNA of the euchromatic element Ty1his3AI-242 was not significantly altered by deletion of SGS1 (lanes 4 and 6) or UBC2 in strain JC242 (lanes 4 and 5). Deletion of SGS1 caused a minor increase in total Ty1 RNA levels in both strains (lanes 1, 3, 4, and 6), as did deletion of UBC2 (lanes 1, 2, 4, and 5). In summary, the data show that SGS1 is not involved in transcriptional silencing of rDNA Ty1 elements or in the regulation of total Ty1 RNA levels.

View larger version (55K): [in this window] [in a new window]   FIG. 1.   SGS1 is not required for transcriptional silencing of Ty1his3AI-236r in rDNA. Total RNA samples from strains JC236 and JC242 and sgs1 and ubc2 derivatives were analyzed by Northern blotting. The blot was hybridized to a 32P-labeled sense-strand HIS3 riboprobe to detect Ty1his3AI RNA (top), an antisense Ty1 riboprobe to detect total Ty1 RNA (middle), and an antisense PYK1 riboprobe as a loading control (bottom). The ratios of Ty1his3AI-236 to PYK1 RNA, normalized to the SGS1 strain (lane 1), were 13.3 (ubc2; lane 2) and 2.0 (sgs1; lane 3); the Ty1his3AI-242/PYK1 RNA ratios, normalized to SGS1 (lane 4), were 1.1 (ubc2; lane 5) and 1.5 (sgs1; lane 6); the Ty1/PYK1 RNA ratios, normalized to SGS1 (lane 1), were 1.5 (ubc2; lane 2) and 1.7 (sgs1; lane 3); and the Ty1/PYK1 RNA ratios, normalized to SGS1 (lane 4), were 1.5 (ubc2; lane 5) and 1.7 (sgs1; lane 6).

sgs1

sgs1

sgs1

Silencing of the mURA3 marker in rDNA. To corroborate the finding that SGS1 does not regulate transcriptional silencing of Ty1 elements in rDNA, we analyzed the effect of the sgs1 mutation on silencing of the mURA3 gene in rDNA using quantitative growth assays (Fig. 2). An mURA3-LEU2 cassette was integrated in rDNA or at the leu21 locus, and serial dilutions of cells from SGS1 and sgs1 spores containing the mURA3-LEU2 cassettes were plated on different media. In SGS1 strains, expression of mURA3 in rDNA was reduced relative to the same marker at leu21, resulting in relatively weaker growth on SC-Ura and stronger growth on 5-FOA medium. This result reflects the fact that mURA3 is subject to transcriptional silencing in the rDNA (57). Deletion of SGS1 did not relieve silencing of mURA3 in the rDNA (compare growth on SC, SC-Ura, and 5-FOA plates in columns 3 and 4 or 5 and 6 of Fig. 2). As expected, deletion of SGS1 also did not affect expression of mURA3 at leu21 (compare growth on SC, SC-Ura, and 5-FOA plates in columns 1 and 2). In summary, our data demonstrate that Sgs1 is not required for transcriptional silencing of the mURA3-LEU2 cassette or Ty1his3AI elements in rDNA.

View larger version (45K): [in this window] [in a new window]   FIG. 2.   Quantitative growth assay measuring the effect of sgs1 on silencing of the mURA3 gene in rDNA. Tenfold serial dilutions of saturated cultures of strains containing the mURA3-LEU2 cassette at leu21 (columns 1 and 2) or in rDNA (columns 3 to 6) were spotted onto SC, SC-Ura, and 5-FOA plates. The plates were incubated for 3 days at 30°C before being photographed. The strain pairs in columns 1 (SGS1) and 2 (sgs1), columns 3 (sgs1) and 4 (SGS1), and columns 5 (SGS1) and 6 (sgs1) are progeny from the same tetrad.

Global increase in the cDNA-mediated mobility of Ty1his3AI elements in sgs1 mutants. To determine if Sgs1 is involved in maintaining transpositional dormancy, we measured the effect of deleting SGS1 on the mobility of individual Ty1 elements marked with his3AI. The his3AI RIG allows the cDNA-mediated mobility of Ty1 elements to be detected in a quantitative phenotypic assay for His⁺ prototroph formation (Fig. 3). Because the formation of His⁺ prototrophs is absolutely dependent on splicing of the intron from the Ty1his3AI transcript (14), this assay detects only cDNA-mediated transposition or recombination events. The rate of His⁺ prototroph formation in a strain containing the rDNA element Ty1his3AI-236r was increased 79-fold as a result of deleting SGS1 (Table 3). Similarly, deletion of SGS1 resulted in a 43-fold increase in the cDNA-mediated mobility of a second element in the rDNA, Ty1his3AI-816r, and a 32-fold increase in the mobility of the euchromatic element, Ty1his3AI-242. These data demonstrate that Sgs1 is a global repressor of Ty1 mobility. Furthermore, the data are consistent with the finding that Sgs1 does not specifically affect expression of Ty1 elements in the rDNA. The increased Ty1 mobility in the absence of significantly elevated Ty1 RNA levels in sgs1 mutants (Fig. 1) suggests that Sgs1 inhibits a posttranscriptional step in Ty1 retrotransposition.

View larger version (19K): [in this window] [in a new window]   FIG. 3.   A phenotypic assay for Ty1 cDNA-mediated mobility events, which utilizes a genomic Ty1 element (tripartite rectangles flanking a black rectangle) marked with the his3AI RIG. his3AI consists of an AI interrupting the HIS3 coding sequence (broken rectangle). The AI is in the antisense orientation relative to HIS3 transcription; consequently, his3AI is nonfunctional and cells containing it, which also harbor a deletion of the chromosomal HIS3 locus, are phenotypically His. The his3AI gene is placed within the Ty1 element in the opposing transcriptional orientation. Therefore, the AI is in the sense orientation in the Ty1his3AI RNA (wavy line) and can be removed by splicing. When the spliced transcript is used as a template for reverse transcription, a linear double-stranded Ty1 cDNA containing a functional copy of the HIS3 gene is formed. Insertion of Ty1HIS3 cDNA into the genome by IN-mediated transposition (left) or Rad52-mediated recombination with preexisting genomic Ty1 elements (right) results in formation of a His+ prototroph.

Sgs1 affects a posttranslational step in retrotransposition. To determine if the sgs1 mutation affects the level of Ty1 proteins, total cell proteins isolated from two different SGS1 strains and isogenic sgs1 mutants were analyzed on a Western blot. The blot was probed with antiserum against TyA1 protein and subsequently with antiserum against Fus3, which served as a loading control (Fig. 4A). The levels of TyA1 protein relative to Fus3 in the sgs1 mutants were 1.0- and 2.0-fold that of TyA1 in the isogenic SGS1 strains. As a control, we showed that an spt3 mutant had undetectable levels of TyA1 protein. TyB1 proteins are present in very low levels in whole-cell extracts and are therefore difficult to detect. For that reason, we obtained subcellular fractions enriched for Ty1 VLPs from the same SGS1 and sgs1 strain pairs. Equal amounts of protein from each VLP-enriched fraction were analyzed with antisera directed against TyA1, IN, and RT (Fig. 4B). Only very minor increases in the levels of TyA1 (1.6- and 1.3-fold), p60-RT (1.5- and 1.6-fold), and p90-IN (2.3- and 2.0-fold) were observed in the sgs1 mutants. These data suggest that Sgs1 does not directly regulate the synthesis or stability of Ty1 proteins.

View larger version (28K): [in this window] [in a new window]   FIG. 4.   Ty1 protein levels in sgs1 mutants. Western blot analyses of Ty1 proteins in total cell lysates (A) and VLP-enriched subcellular fractions (B) from SGS1 strain JC1430, the isogenic sgs1 derivative JC2360, strain JC2102, and the isogenic sgs1 derivative JC2378 are shown. The spt3 strain DG789 was used as a negative control. (A) The Western blot of total cell lysates was probed sequentially with antisera specific for TyA1 and Fus3. (B) The Western blot of VLP fractions was probed sequentially with antisera against TyA1, RT, and IN.

sgs1

sgs1

View larger version (56K): [in this window] [in a new window]   FIG. 5.   Levels of unintegrated Ty1 cDNA in sgs1, rad52, and sgs1 rad52 mutants. (A) The structures of unintegrated Ty1 cDNA and a genomic Ty1 element are shown. The hatched area within the Ty1 elements (tripartite rectangles bordering an open box) indicates the location of the TYB1 probe. The locations of relevant PvuII sites are indicated. The TYB1 riboprobe detects a 2.0-kb fragment from the PvuII site in Ty1 to the 3' end of the unintegrated Ty1 cDNA and >2.0-kb PvuII fragments from genomic Ty1 elements. (B) Southern blot analysis of PvuII-digested genomic DNAs from two independent colonies of each strain grown at 20°C. The strains analyzed are wild-type strain JC1430 (lanes 1 and 2), an isogenic sgs1 derivative (JC2360; lanes 3 and 4), an sgs1 rad52 derivative (JC2698; lanes 5 and 6), a rad52 derivative (JC2712; lanes 7 and 8), and a tec1 derivative (JC2148; lanes 9 and 10). Two Ty1:genomic DNA junction fragments (G1 and G2) detected by the TYB1 riboprobe were used as controls in the quantification of the Ty1 cDNA band (C) by phosphorimage analysis.

sgs1

sgs1 rad52

Integration of Ty1 in sgs1 mutants. The hypothesis that Sgs1 represses integration of Ty1 cDNA was explored using two different assays. First, a PCR-based assay was employed to detect de novo Ty1 integration events upstream of Pol III transcription units (38; M. Bryk and M. J. Curcio, unpublished results). Unselected integration events upstream of two types of targets, the 16 glycyl-tRNA genes or the 100 to 200 5S rRNA genes, were detected in DNA samples prepared from cells grown at 20°C, the permissive temperature for transposition. No significant change in the pattern or intensity of integration events was observed at either target set in an sgs1 mutant compared to an isogenic SGS1 strain (data not shown). The same conclusion was drawn from quantitation of spontaneous Ty1 insertions into the selectable target gene, CAN1, in SGS1 and isogenic sgs1 strains. Loss-of-function mutations in CAN1 cause resistance to canavanine. Deletion of SGS1 resulted in a 2.4-fold increase in the rate of resistance to canavanine; however, the fraction of canavanine-resistant mutants with a Ty1 insertion in CAN1 was not significantly increased in the sgs1 strain (1/40) relative to the isogenic SGS1 strain (0/40). The rate of Ty1 transposition into CAN1 in the sgs1 strain JC2360 (1.15 × 10⁸) was equivalent to that previously measured in a wild-type strain and was significantly lower than that in a fus3 mutant, despite the fact that the mobility of Ty1his3AI elements is elevated to similar levels in sgs1 and fus3 mutants (9). In summary, these data indicate that deletion of SGS1 does not significantly increase the frequency of Ty1 integration at preferred or selected target sites.

Recombination between Ty1 cDNA and genomic Ty1 elements. In the absence of an increase in Ty1 integration, enhanced recombination of Ty1 cDNA might explain how Ty1 cDNA-mediated mobility events are increased in sgs1 mutants. Rad52 is required for homologous recombination of cDNA (15, 53). Therefore, we determined whether Rad52 is required for the increase in Ty1HIS3 cDNA-mediated mobility events in an sgs1 mutant. Deletion of SGS1 in the rad52 strain JC2712, which contains Ty1his3AI-242, increased the rate of His⁺ formation 1.7-fold (Table 3). This is a minor increase compared to the 32-fold increase resulting from deletion of SGS1 in the isogenic RAD52 strain JC242. Hence, the data suggest that Rad52 is required for most of the stimulation of Ty1HIS3 cDNA-mediated mobility in sgs1 mutants. Therefore, Sgs1 may repress recombination of Ty1 cDNA with genomic Ty1 elements or recombination between Ty1 cDNA molecules prior to integration.

sgs1

View larger version (29K): [in this window] [in a new window]   FIG. 6.   Assay for recombination between Ty1HIS3 cDNA and a genomic Ty1his3AI element. Yeast strains containing direct repeats of a 1.2-kb region of yeast DNA (horizontal black arrows) flanking a Ty1his3AI element and the URA3 gene were constructed as described in Materials and Methods. Splicing of AI from Ty1his3AI RNA and subsequent reverse transcription result in formation of Ty1HIS3 cDNA. The Ty1HIS3 cDNA can transpose into nonhomologous target sites (not illustrated) or recombine with genomic Ty1 elements, including the Ty1his3AI element that is linked to URA3. One possible mechanism of recombination in which Ty1HIS3 cDNA initiates gene conversion of the Ty1his3AI element is illustrated in brackets. Gene conversion would result in replacement of Ty1his3AI with a Ty1HIS3 element adjacent to URA3. Subsequent selection for the loss of URA3 by recombination between the flanking direct repeats would result in concomitant loss of the Ty1HIS3 element. Therefore, cosegregation of Ura and His phenotypes would be observed. Wavy line, plasmid vector sequences; double line with open circle, chromosome III.

sgs1

sgs1

Formation of multimeric Ty1 arrays during transposition in sgs1 mutants Our results suggested that Sgs1 inhibits a Ty1 cDNA-mediated mobility process that is Rad52 dependent but does not involve recombination of Ty1 cDNA with genomic Ty1 elements. Therefore, we hypothesized that Ty1 cDNA molecules undergo intermolecular recombination in sgs1 mutants, forming tandem Ty1 arrays that transpose into the genome. This process would increase the number of Ty1 cDNA molecules per transposition event in sgs1 mutants.

sgs1

sgs1

View larger version (22K): [in this window] [in a new window]   FIG. 7.   Deletion of SGS1 increases genomic Ty1HIS3:Ty1 multimers. (A) Tandem arrays of Ty1 elements, consisting of LTRs (tripartite rectangles) bordering a central domain that carries TYA1 and TYB1 (open box), within chromosomal DNA (curved line). The left schematic represents a dimeric Ty1 array with a single shared LTR between each coding domain and the HIS3 marker adjacent to the upstream TYB1 domain (one-LTR Ty1HIS3:Ty1 multimer). The right schematic represents a Ty1 dimer with two joined LTRs between coding domains (two-LTR Ty1HIS3:Ty1 multimer). PCR primers that hybridize to the HIS3 marker gene and to the TYA1 domain amplify a 570-bp DNA fragment of a one-LTR Ty1HIS3:Ty1 element and a 905-bp DNA fragment of a two-LTR Ty1HIS3:Ty1 element. (B) Independent His+ revertants of the SGS1 RAD52 strain JC236 and isogenic mutant derivatives were analyzed by PCR to determine the fraction of His+ revertants that contained a one-LTR Ty1HIS3:Ty1 multimer, a two-LTR Ty1HIS3:Ty1 multimer, or either.

sgs1

sgs1

sgs1

sgs1

sgs1

View larger version (29K): [in this window] [in a new window]   FIG. 8.   Southern blot analysis of sgs1 strains that sustained a Ty1HIS3 transposition event. (A) Three schematics showing the size of the HIS3-containing HpaI fragment from a monomeric Ty1HIS3 element within chromosomal DNA or a one-LTR or two-LTR Ty1HIS3:Ty1 multimer. (B) Results of hybridization of a 32P-labeled HIS3 riboprobe to HpaI-digested genomic DNA from 13 sgs1 Ty1his3AI-236 strains harboring a Ty1HIS3 element. DNA samples containing a one-LTR or two-LTR Ty1HIS3:Ty1 multimer, as demonstrated by PCR (Fig. 7), are labeled accordingly. The sizes of the HpaI bands derived from Ty1his3AI-236 (6.1 kb) and from one-LTR (6.4 kb) and two-LTR (6.7 kb) Ty1HIS3:Ty1 multimers are indicated. The sizes of the bands derived from monomeric Ty1HIS3 elements, which are expected to be >5.9 kb, are not indicated.

Preferred target sites for Ty1 transposition in sgs1 mutants. We have observed a stimulation of Ty1 mobility in sgs1 mutants that is not associated with elevated Ty1 integration into preferred or selected target sites. However, it is possible that transposition into a novel target, which would not be detected by assays for Ty1 integration at glycyl-tRNA, 5S rRNA, or CAN1 genes, occurs at a high frequency in sgs1 mutants. To test this hypothesis, unselected genomic DNA targets of Ty1 transposition were identified in sgs1 mutants. Independent His⁺ colonies that harbored Ty1HIS3 transpositions were obtained following galactose induction of a plasmid-borne P_GAL1Ty1-H3his3AI fusion element in the sgs1 strain JC3161. Plasmid segregants were analyzed by Southern blotting with a HIS3 probe to identify strains containing one Ty1HIS3 element in genomic DNA. Of 56 PvuII fragments derived from Ty1HIS3 elements that were detected, 21 (37.5%) were 3.0 kb, which is the length expected for Ty1HIS3 elements within multimeric Ty1 arrays. Five strains were identified that contained one >3.0-kb PvuII fragment, indicating the presence of a single 3' Ty1HIS3:genomic DNA junction fragment. The junction fragment was cloned from each of the five strains by plasmid integration and eviction, and the site of Ty1HIS3 integration into genomic DNA was determined by sequencing and comparison to the Saccharomyces Genome Database. Four of the five Ty1HIS3 elements analyzed were located upstream of Pol III-transcribed genes (Table 4), which are preferred target sites for Ty1 transposition in SGS1 strains. The fifth Ty1HIS3 element analyzed was adjacent to the beginning of the TYA2 open reading frame of a Ty2 element. Ty2 elements are highly related to Ty1 elements and have nearly identical LTRs (34). Thus, this Ty1HIS3 element is a component of a heterogeneous Ty multimer containing an upstream Ty1HIS3 element and a downstream Ty2 element separated by a single LTR. In summary, this analysis failed to reveal a novel target site preference for Ty1 transposition in sgs1 mutants. As predicted by the effect of Sgs1 on spontaneous transposition, expression of the inducible P_GAL1Ty1-H3his3AI element in an sgs1 mutant resulted in a high frequency of Ty1 multimer transposition. We conclude that transposition of Ty1 cDNA multimers into typically preferred transposition targets is primarily responsible for the increase in Ty1 cDNA-mediated mobility in sgs1 mutants.

View this table: [in this window] [in a new window]   TABLE 4.   Locations of Ty1HIS3 elements in an sgs1 strain

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Although host-mediated regulation of Ty1 transposition has been evoked for some time, the identity and role of the host regulators have only recently begun to be elucidated. The findings presented here demonstrate that Sgs1 is involved in maintaining transpositional dormancy by a novel mechanism. Sgs1 does not regulate transcriptional silencing of Ty1 elements located in the rDNA, even though it represses rDNA recombination. This finding indicates that Sgs1 inhibits rDNA recombination by a mechanism that is independent of maintaining the rDNA heterochromatin. Moreover, Sgs1 does not have a major effect of the levels of Ty1 RNA, proteins, cDNA, or integration. However, Sgs1 was shown to inhibit recombination of extrachromosomal Ty1 cDNA molecules during transposition. Our data suggest that repression of cDNA recombination by Sgs1 limits the number of individual Ty1 cDNA molecules that are involved in each transposition event.

Sgs1 represses mitotic recombination without affecting gene silencing in the rDNA. Our findings demonstrate that the mechanism by which Sgs1 represses recombination in the rDNA is independent from the mechanism of maintaining rDNA silencing. The three- to sevenfold increase in the loss of rDNA-Ty1HIS3 elements in sgs1 mutants (Table 2) is comparable to the sevenfold increase in loss of marker genes in the rDNA that was observed previously (21). Variation in the rate of loss may be due to the different locations of individual Ty1HIS3 elements within the rDNA gene array. In contrast to the requirement for Sgs1 in the mitotic stability of rDNA-Ty1 elements, Sgs1 was not required for and may inhibit the stability of euchromatic Ty1 elements.

sgs1

sgs1

Rad52 is required for increased Ty1 cDNA mobility in sgs1 mutants. In strains containing Ty1his3AI elements at different locations, deletion of SGS1 caused a marked increase in the cDNA-mediated mobility of Ty1 elements (Table 3) accompanied by a twofold or lower increase in Ty1 RNA (Fig. 1). Hence, Sgs1 may be a weak inhibitor of the transcription or stability of Ty1 RNA. Ty1 protein levels (Fig. 4) and cDNA levels (Fig. 5) are also slightly elevated in sgs1 mutants, probably as a direct result of the small increase in Ty1 RNA, although this cannot be determined with certainty. Several findings indicate that modestly elevated Ty1 cDNA levels are not the major reason for the increase in Ty1 mobility in sgs1 mutants. First, no significant stimulation of Ty1 integration upstream of glycyl-tRNA genes or 5S rRNA genes or into the CAN1 locus was observed in sgs1 mutants. These findings do not support a simple model in which elevated levels of Ty1 cDNA result in an increase in the number of integration events in sgs1 mutants. Second, the level of Ty1 cDNA in an sgs1 mutant was about one-quarter of that in a rad52 mutant (Fig. 5), even though both mutations stimulated the mobility of Ty1his3AI-242 to an equivalent level (Table 3). This finding suggests that there is a second mechanism of increasing the cDNA-mediated mobility of Ty1 elements in sgs1 mutants aside from the small increase in Ty1 cDNA. Third, deletion of SGS1 in a rad52 strain did not cause a significant increase in the mobility of Ty1his3AI-242 or the level of Ty1 cDNA, indicating that Sgs1 inhibits a Rad52-dependent mechanism of Ty1 mobility.

Sgs1 inhibits transposition of multimeric Ty1 cDNA. We envisaged two Rad52-dependent pathways for entry of Ty1 cDNA into the genome that might be stimulated in the absence of Sgs1. First, recombination of Ty1 cDNA with genomic Ty1 elements might be enhanced, resulting in introduction of Ty1HIS3 cDNA into the genome at an elevated rate. Notably, genomic multimers of Ty5 elements are commonly formed by "ends-out" recombination between Ty5 cDNA and the upstream LTR of a genomic Ty5 element (32). However, this possibility was excluded for Ty1 multimers, since recombination between Ty1HIS3 cDNA and a genomic Ty1his3AI element was not affected by deletion of SGS1. Second, intermolecular recombination between extrachromosomal Ty1 cDNA molecules including Ty1HIS3 cDNA might be stimulated in sgs1 mutants, leading to transposition of tandem Ty cDNA arrays. In fact, the fraction of His⁺ strains that contain Ty1HIS3 as a component of a multimeric array was fourfold higher in sgs1 mutants (Fig. 7). The PCR assay we used detected multimers minimally containing a Ty1HIS3:Ty1 array. However, the total number of Ty1 elements within each multimer could be higher, especially in sgs1 strains. Hence, elevated Ty1 mobility in sgs1 mutants could result from increases both in the fraction of multimeric transposition events and in the average number of Ty1 cDNA molecules per multimer. Formation of Ty1 multimers required Rad52 in both SGS1 and sgs1 strains. Since the increase in Ty1 mobility in sgs1 mutants is also dependent on Rad52, our data suggest that transposition of Ty1 multimers is the primary cause of the elevated Ty1 mobility in sgs1 mutants.

sgs1

sgs1

sgs1

sgs1

sgs1

his34

sgs1

sgs1

sgs1

sgs1

sgs1

Direct or indirect interaction of Sgs1 with Ty1 cDNA? Our finding that extrachromosomal Ty1 cDNA recombines at a high frequency in sgs1 mutants raises the possibility that Sgs1 interacts directly with Ty1 cDNA. Assuming the interaction is direct, we propose the following model to explain how Sgs1 represses recombination between Ty1 cDNA molecules. Although a fraction of Ty1 cDNA in normal cells enters the genome by integration or recombination, most of it is degraded (39). Hence, some of the nuclear cDNA may not be protected by Ty1 IN and instead may be recognized as a recombination substrate. By analogy to a chromosomal double-strand break, free cDNA ends are likely to be potent initiators of recombination. Since 5'-end resection is the initial step in all pathways of double-strand break repair (27), the cDNA ends would be resected by a 5'-to-3' exonuclease activity, leaving 3' single-stranded DNA tails. The single-stranded 3' ends would be able to invade homologous Ty1 cDNA molecules and initiate recombination, thereby forming structures in which the DNA strands from different molecules are annealed. Sgs1 may bind these branched structures and unwind the annealed strands to prevent homologous recombination. In fact, purified Sgs1 has been shown to bind preferentially to forked DNA substrates (3). Following unwinding by Sgs1, partially degraded Ty1 cDNA molecules may lack the terminal nucleotides required for recognition by Ty1 IN and be completely degraded. In the absence of Sgs1, homologous recombination between the LTR sequences of extrachromosomal Ty1 cDNAs results in the formation of multimeric Ty1 arrays with double-stranded DNA ends restored by gap filling. Hence, these multimers would be suitable substrates for Ty IN to carry out integration.