Previous Article | Next Article 
Molecular and Cellular Biology, August 2001, p. 5426-5436, Vol. 21, No. 16
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.16.5426-5436.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
DNA Methylation Is Linked to Deacetylation of
Histone H3, but Not H4, on the Imprinted Genes Snrpn
and U2af1-rs1
Richard I.
Gregory,1
Tamzin E.
Randall,2
Colin A.
Johnson,2
Sanjeev
Khosla,1,
Izuho
Hatada,3
Laura P.
O'Neill,2
Bryan M.
Turner,2,* and
Robert
Feil1,4,*
Programme in Developmental Genetics, The Babraham
Institute, Cambridge CB2 4AT,1 and
Chromatin and Gene Expression Group, University of
Birmingham Medical School, Birmingham B15 2TT,2
United Kingdom; Gene Research Center, Gunma University,
Maebashi 371-8511, Japan3; and Institute
of Molecular Genetics, CNRS UMR-5535, IRF-24, 34293 Montpellier
Cedex 5, France4
Received 19 March 2001/Returned for modification 30 April
2001/Accepted 15 May 2001
 |
ABSTRACT |
The relationship between DNA methylation and histone acetylation at
the imprinted mouse genes U2af1-rs1 and Snrpn
is explored by chromatin immunoprecipitation (ChIP) and resolution of
parental alleles using single-strand conformational polymorphisms. The U2af1-rs1 gene lies within a differentially methylated
region (DMR), while Snrpn has a 5' DMR (DMR1) with
sequences homologous to the imprinting control center of the
Prader-Willi/Angelman region. For both DMR1 of Snrpn and
the 5' untranslated region (5'-UTR) and 3'-UTR of
U2af1-rs1, the methylated and nonexpressed maternal allele
was underacetylated, relative to the paternal allele, at all H3 lysines
tested (K14, K9, and K18). For H4, underacetylation of the maternal
allele was exclusively (U2af1-rs1) or predominantly (Snrpn) at lysine 5. Essentially the same patterns of
differential acetylation were found in embryonic stem (ES) cells,
embryo fibroblasts, and adult liver from F1 mice and in ES cells from
mice that were dipaternal or dimaternal for U2af1-rs1. In
contrast, in a region within Snrpn that has biallelic
methylation in the cells and tissues analyzed, the paternal (expressed)
allele showed relatively increased acetylation of H4 but not of H3. The
methyl-CpG-binding-domain (MBD) protein MeCP2 was found, by ChIP, to be
associated exclusively with the maternal U2af1-rs1 allele.
To ask whether DNA methylation is associated with histone
deacetylation, we produced mice with transgene-induced methylation at
the paternal allele of U2af1-rs1. In these mice, H3 was
underacetylated across both the parental U2af1-rs1 alleles
whereas H4 acetylation was unaltered. Collectively, these data are
consistent with the hypothesis that CpG methylation leads to
deacetylation of histone H3, but not H4, through a process that
involves selective binding of MBD proteins.
 |
INTRODUCTION |
The differential expression of the
maternal and paternal alleles of imprinted genes depends on an
epigenetic mark, the imprint, placed on the gene in either the female
or male germ line. The nature of such marks remains uncertain, although
DNA methylation, specifically methylation of cytosines in CpG
dinucleotides, clearly plays a crucial role (36). The
maternal and paternal alleles of imprinted loci often have
differentially methylated regions (DMRs), with the nonexpressed allele
generally, although not always, being more highly methylated
(12). As an imprint, CpG methylation has the advantage
that transmission from one cell generation to the next is determined by
the catalytic properties of DNA methyltransferase 1 (DNMT1).
This enzyme preferentially methylates hemimethylated CpGs, thus
perpetuating the methylation imprint on daughter strands postreplication (3, 5). However, DNA methylation does not provide a complete explanation for the somatic maintenance of imprints.
DMRs must somehow survive the widespread demethylation that occurs
following fertilization and during preimplantation stages of
development (33, 39, 50). Furthermore, for DMRs that
undergo demethylation early in development and are remethylated at
later stages (12), methylation cannot be the sole
determinant of the epigenetic memory. Finally, there are results to
suggest that some imprinted mammalian genes, such as Mash2
(7, 62), may have an imprinting mechanism that is
independent of DNA methylation.
The maintenance of transcriptional states from one cell generation to
the next, including imprinted states, may involve the protein
components by which DNA is packaged as chromatin (24, 38,
64). The four core histones, H2A, H2B, H3, and H4, despite their
extreme conservation through evolution, are all subject to a range of
enzyme-catalyzed posttranslational modifications, mostly located in the
N-terminal tail domains exposed on the nucleosome surface (25,
37). These modifications provide a rich potential source of
epigenetic information. The most widely studied modification, acetylation of selected lysines, has been associated with both short-term and long-term regulation of transcription and
transciptional potential. Changes in acetylation can be transient and
local, perhaps confined to just one or two promoter-proximal
nucleosomes (9, 34, 45), or spread over chromatin domains
of 100 kb or more and linked to progression down specific developmental pathways (29, 43, 53). It is also clear that modification of specific lysine residues can be associated with specific
transcriptional states (1, 51, 65) and that associations
can be stable through the cell cycle and over successive cell
generations (8, 15, 63). Recently, other residue-specific
histone modifications, such as phosphorylation of H3 serine 10 (10, 11) and methylation of H3 lysines 4 and 9 (47,
60), have been linked to particular functional chromatin states.
It is becoming increasingly likely that different tail modifications
act in concert to determine the functional properties of chromatin
domains (61, 64).
In trying to unravel the role of chromatin features in the
establishment and maintenance of imprints, it is important to remember that imprinted genes are subject to the same regulatory constraints as
other genes. Imprinted genes often show tissue-specific patterns of
expression (18, 46, 48), and changes in chromatin
structure or histone acetylation may be contingent on changes in
transcriptional status, as well as being components of the epigenetic
mark itself. The regulation of imprinted genes is likely to involve a
spectrum of interrelated modifications in the DNA, protein, and
chromatin structure of imprinted loci. Furthermore, it is quite
possible that individual modifications may play greater or lesser roles in the maintenance of the imprint at different stages of development (14, 18, 46, 48, 58, 68).
A long-standing problem in studying the role of chromatin in imprinting
mechanisms has been the lack of generally applicable means of
distinguishing proteins associated with maternal and paternal alleles.
In the present study, we address this problem through a combination of
chromatin immunoprecipitation (ChIP), PCR amplification of precipitated
material, and electrophoretic detection of single-strand conformational
polymorphisms (SSCP). By using cells from hybrid mice, heterozygous for
polymorphisms, we have been able to discriminate reliably and
quantitatively between the maternal and paternal alleles of the
U2af1-rs1 (chromosome 11) and Snrpn (chromosome
7) genes. Both these imprinted genes encode RNA splice factors and are
expressed most strongly in the brain and exclusively from the paternal
chromosome (20, 21, 27, 28, 35). Previously, we and others
reported that the U2af1-rs1 gene and its direct flanking
sequences are methylated, on the maternal chromosome only, in all
embryonic and adult tissues analyzed (17, 56). In this
domain of differential methylation, chromatin is severalfold more
resistant to DNase I on the methylated maternal chromosome than
on the unmethylated paternal chromosome (17).
Constitutive methylation at the maternal chromosome is also present at
the 5' portion of the Snrpn gene, in a region designated
DMR1 (Fig. 1). For both the
Snrpn and U2af1-rs1 loci, this maternal
methylation originates in the oocyte (55, 57). The
Snrpn DMR1 region is involved in the control of the allelic expression of both Snrpn itself and neighboring genes, in a
large imprinted chromosomal domain corresponding to the Prader
Willi/Angelman region on human chromosome 15q11-q13 (4,
54).

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 1.
(A) The imprinted U2af1-rs1 locus on
chromosome 11. The U2af1-rs1 gene is shown as a box, with
its coding part in black. HindIII (H) and
SacI (S) sites, as well as BglII (B) sites that
are polymorphic between M. musculus (m) and M. spretus (s), are indicated. We determined the DNA sequence of the
11-kb region shown (GenBank accession number AF309654). Sequences
analysed by PCR-SSCP are shown as small bars. The line above the gene
represents the domain of differential methylation (DMR) and
differential nuclease sensitivity (data from references 18, 56,
and 57). (B) The imprinted mouse Snrpn locus on
chromosome 7. Shown are exons 1 to 10 (filled boxes) and the
differentially methylated regions DMR1 and DMR2 (horizontal bars above
the gene), as defined by Shemer et al. (55). Regions
analyzed by PCR-SSCP are indicated, as well as HpaII (Hp)
and HhaI (Ha) sites that were analyzed for their methylation
status.
|
|
We demonstrate here that differential patterns of histone acetylation
distinguish the paternal and maternal alleles at the DMRs of the
imprinted U2af1-rs1 and Snrpn genes. We show that DNA methylation is consistently associated with hypoacetylation of
histone H3 but not H4. For U2af1-rs1, we use
transgene-induced methylation of the paternal allele to explore the
causal relationship between methylation and histone acetylation and
provide in vivo evidence that the allelic CpG methylation at this locus
is linked to hypoacetylation of histone H3 but not H4.
 |
MATERIALS AND METHODS |
Mice, cell lines, and cell culture.
Fetuses that were hybrid
for chromosome 11 were produced by crossing a heterozygous male from a
newly derived congenic mouse line, SP11, with a C57BL/6 female. SP11
has a Mus spretus proximal chromosome 11 on a C57BL/6
background and was obtained by backcrossing to C57BL/6 for eight
generations. Hemizygous males of two transgenic (U2af1-rs1)
lines (TG8 and TG28) (26) were crossed with C57BL/6 females to generate transgenic and nontransgenic offspring. Primary embryonic fibroblasts were derived from (C57BL/6 × SP11)
F1 fetuses cultured in Dulbecco modified Eagle medium
containing 20% fetal calf serum. For the chromatin assays,
early-passage (before passage 5) EF1 cells were used that were of a
uniform morphology. Embryonic stem (ES) cell lines SF1-1, AG-A, and PR8
were cultured in the absence of feeder cells in ES medium containing
103 U of leukemia inhibitory factor (LIF) per ml
(13). In all chromatin studies, semiconfluent
early-passage (before passage 15) ES cells were used that were
morphologically undifferentiated (>90%).
Nuclease sensitivity assays, Southern blotting, and Northern
blotting.
Nuclei were isolated from tissue or cultured cells and
nuclease sensitivity assays were performed as described previously (17). Briefly, purified nuclei were suspended in DNase I
or MspI digestion buffer at ~107 nuclei/ml.
For the DNase I assay, 200-µl aliquots of nucleus suspension were
incubated for 10 min at 25°C with increasing amounts of enzyme
(Roche). MspI digestions were performed at 37°C in 50 mM
Tris-HCl (pH 7.9)-10 mM MgCl2-100 mM NaCl-1 mM
dithiothreitol containing 10 U of MspI/µl. Following
nuclease digestion and overnight incubation at 50°C with proteinase
K, genomic DNA was extracted with phenol-chloroform. After restriction
enzyme digestion, electrophoresis through agarose gels and Southern
blotting were performed as described previously (17).
Northern hybridization was performed as described previously
(13), using a 250-bp
HindIII-PstI fragment from the 5' end of
mouse Gapdh, a PCR-amplified 499-bp fragment comprising exon
7 of Snrpn (see below) and U2af1-rs1 probe 1 (17).
ChIP, PCR-SSCP, and duplex-PCR.
For ChIP assays,
purification of nuclei, preparation of chromatin by micrococcal
nuclease digestion (to yield fragments of predominantly one to five
nucleosomes), and immunoprecipitation with affinity-purified antibodies
to acetylated H3 and H4 were all performed as described previously
(44). We used the following antisera for ChIP: R252/16 (to
H4Ac16), R101/12 (to H4Ac12), R232/8 (to H4Ac8), R41/5 (to H4Ac5),
R224/14 (to H3Ac14), and R47/9/18 (to H3Ac9/18) (66, 67).
Precipitations to the methyl-Cpg-binding-domain (MBD) protein MeCP2
were performed with a rat polyclonal antibody (Upstate Biotechnology).
For PCR-SSCP analysis of precipitated chromatin, 50 ng of each DNA
sample was used for PCR (30 to 36 cycles with an annealing temperature
of 60°C for all amplifications) in the presence of
[
-32P]dCTP (1% of total dCTP). Selected
U2af1-rs1 primers (all defined in the 5' to 3' orientation)
amplified from three regions: a 192-bp upstream region (forward,
ggagtcccaggccaatct; reverse, agcactcagaaggcagag), a 293-bp 5' untranslated region (5'-UTR) (forward,
cgcagatcagacatactgcgg; reverse, tgtggtacggccagcctatg),
and a 163-bp 3'-UTR (forward, ctaattcccaaccaagttaca,
reverse, aaaacaacatgggaagccag). Snrpn
primers amplified from two regions: a 228-bp region in DMR1 (forward, aggttgtgactgggatcctg; reverse, gcggcaacagaacttctacc)
and a 499-bp region in DMR2 (forward, ttagactggcattgctcgtg;
reverse, atgtatctgccccagccttc). After denaturation of
PCR products, DNA was resolved by SSCP gel electrophoresis
(23). Briefly, 1 µl of PCR product was added to 10 µl
of loading dye (95% formamide, 10 mM NaOH, 0.25% bromophenol blue,
0.25% xylene cyanol). After the samples were heated to 94°C and
cooled on ice, 1 to 3 µl of each sample was loaded onto a 0.4-mm
thick, 34-cm long nondenaturing polyacrylamide gel (0.5× mutation
detection solution [BioWhittaker Molecular Applications Corp.]) and
migrated in 0.6× Tris-borate-EDTA (TBE) for 21 to 24 h at 10 V/cm. After being dried, the gels were exposed to X-ray films or
analyzed with a phosphorimager (FLA3000; Fuji), after which the
relative band intensities were calculated using Quantity-One imaging
software (Bio-Rad). For duplex-PCR, 50 ng of template DNA was used (30 cycles), with addition of [
-32P]dCTP (1% of total
dCTP) to coamplify from the 293-bp 5'-UTR (see above) and a 161-bp
region at
-Tubulin (forward, cctgctgggagctctact; reverse, gggttccaggtctacgaa), or from Snrpn
DMR1 (see above). PCR products were migrated through nondenaturing
polyacrylamide gels. The gels were dried and band intensities were
determined as for the SSCP-based analyses. Control duplex-PCR
amplifications were conducted with a range of genomic DNA
concentrations (2 to 100 ng/30 µl of reaction volume) and different
cycle numbers (n = 17 to 36); these yielded identical
U2af1-rs1/
-Tubulin and
DMR1/
-Tubulin ratios.
 |
RESULTS |
U2af1-rs1 shows paternal-chromosome-specific
acetylation of H4 lysine 5 and H3 lysines 14 and 9/18.
Experiments
to examine patterns of histone acetylation were carried out on cells
from interspecific hybrid mice constructed so that sequence
polymorphisms could be used to distinguish maternal and paternal
alleles. EF1 fibroblasts were derived from day 14 fetuses that were
(C57BL/6 × M. spretus)F1 for proximal
chromosome 11 on a homozygous C57BL/6 background. We also analyzed a
(C57BL/6 × M. spretus)F1 ES cell line,
SF1-1, that we derived previously (13). In both cell
lines, digestion at a NotI site in the 5'-UTR and at
multiple HpaII sites distributed along the gene showed that
U2af1-rs1 is methylated exclusively on the maternal
chromosome (data not shown).
To search for parental-chromosome-specific histone acetylation at the
U2af1-rs1 locus, we carried out ChIP on unfixed chromatin
fragments prepared from SF1-1 ES cells and EF1 fibroblasts by
micrococcal nuclease digestion. The specificity and efficiency
of ChIP
assays were determined by analyzing proteins extracted
from
antibody-bound and unbound fractions by sodium dodecyl
sulfate-polyacrylamide
gel electrophoresis gel and Western blotting
(
44). In all the
ChIP assays presented in this study,
protein analysis showed an
enrichment of H3 or H4 acetylated at the
appropriate lysine residue
in the antibody-bound fractions and a
parallel depletion in the
unbound fractions (data not shown, but see
reference
44). In
the antibody-bound fractions, the
presence of paternal and maternal
DNA from different regions of the
U2af1-rs1 locus was determined
by PCR amplification followed
by electrophoretic detection of
SSCP. Crucially for the application of
PCR-SSCP to allelic acetylation
studies, for all regions analyzed we
have found that amplifications
from (C57BL/6 ×
M. spretus)F
1 genomic DNA yield equal amounts
of C57BL/6-
and
M. spretus-specific fragments on SSCP gels (Fig.
2).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 2.
Paternal H3 and H4 lysine 5 acetylation at
U2af1-rs1 in embryonic fibroblasts. (A) Analysis of
acetylation at the 5'-UTR by PCR-SSCP. The first three lanes in the
left panel show 5'-UTR PCR products from control liver DNAs, C57BL/6
(m), M. spretus (s), and (C57BL/6 × M. spretus)F1 (F1). PCR products derived from the
paternal and maternal alleles are indicated by P and M, respectively.
Subsequent lanes show PCR products following ChIP with antibodies to
H4Ac16, H4Ac12, H4Ac8, H4Ac5, H3Ac14, and H3Ac9/18, respectively. The
right panel shows results of an independent precipitation against H4Ac5
that included both the bound (B) and unbound (U) fractions.
Paternal/maternal ratios (P:M) are shown beneath each lane. Examples of
the lane profiles used for quantification are shown. (B) Acetylation at
the 3'-UTR. Control (lanes m, s, and F1) and ChIP samples were as in
panel A. Amplification was performed with the 3'-UTR primers. (C) The
same control and immunoprecipitated samples were analyzed by PCR-SSCP
using primers from the upstream region.
|
|
We studied histone acetylation in EF1 primary embryonic fibroblasts at
three selected regions within or adjacent to the
U2af1-rs1 locus. Two lie within the domain of maternal-chromosome-specific
DNA
methylation (5'-UTR and 3'-UTR [Fig.
1A]), and one is upstream
of the
gene where there is equal methylation on the maternal and
paternal
chromosomes (
17,
56). At the 5'-UTR, levels of histone
H4
acetylation at lysines 8, 12, and 16 (H4Ac8, H4Ac12, and H4Ac16)
were
similar on both the parental chromosomes; i.e., the maternal-
and
paternal-chromosome-specific bands are of comparable intensities,
giving paternal/maternal ratios close to 1. In contrast, with
antibodies to H4 acetylated at lysine 5 (H4Ac5), there was a strong
enrichment of the paternal
U2af1-rs1 allele in the
antibody-bound
(acetylated) fraction (Fig.
2A, central panel).
Importantly, precipitation
with anti-H4Ac5 antibodies gave a
parallel depletion of the paternal
allele in the unbound
(nonacetylated) fraction (Fig.
2A, right
panel), For such depletion to
occur, a significant proportion
of chromatin within the 5'-UTR must
carry H4Ac5. Preferential
acetylation of the paternal allele was also
detected with antibodies
to H3 acetylated at lysine 14 (H3Ac14) and
lysines 9 and/or 18
(H3Ac9/18) (the antiserum used does not distinguish
between H3
acetylated at lysines 9 and 18). Exactly the same enrichment
of
the paternal allele in H4Ac5, H3Ac14, and H3Ac9/18 was also found
at
the differentially methylated 3'-UTR (Fig.
2B). In contrast,
2.3 kb
upstream of the transcription initiation site and upstream
of the
region of maternal DNA methylation (Fig.
1A), no significant
differences in H3 and H4 acetylation at any lysines were apparent
between the parental chromosomes (Fig.
2C). These results are
summarized in Table
1.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Summary of PCR-SSCP data for U2af1-rs1,
presented as the range of paternal/maternal ratios based on multiple
ChIP assaysa
|
|
To determine whether the same paternal-chromosome-specific patterns of
H3 and H4 acetylation are present in an adult differentiated
tissue, we
performed ChIP assays on liver chromatin. Livers were
dissected from
adult mice that were (C57BL/6 ×
M. spretus)F
1 or
(
M. spretus × C57BL/6)F
1 for proximal chromosome 11 (where the
U2af1-rs1 gene is located). Lysine 5 of H4 and lysines 14 and
9/18 of H3 were always acetylated more strongly on the paternal
allele in the livers of the two reciprocal genotypes. Indeed,
the
magnitude of the difference at H4Ac5 between the maternal
and paternal
chromosomes was greater than in the EF1 fibroblasts,
with a more than
10-fold enrichment of the signal on the paternal
chromosome (Table
1).
These experiments formally prove that the
allelic acetylation
differences we observed are parent-of-origin
dependent and not strain
dependent.
Allelic H4 lysine 5 and H3 acetylation patterns at
U2af1-rs1 are established before differentiation.
To
determine whether the paternal-chromosome-specific H3 and H4
acetylation at U2af1-rs1 is established before
differentiation of the embryonic lineages, ChIP assays were performed
on chromatin from undifferentiated ES cells. These are approximately
equivalent to the pluripotent inner-cell-mass cells of blastocysts. At
both the 5'-UTR and the 3'-UTR, H4 lysine 5, but not lysines 8, 12, and
16, was acetylated predominantly on the paternal chromosome, while for
H3, there was preferential paternal acetylation at lysines 14 and 9/18
(Fig. 3A and B, and Table 1). Thus, the
characteristic differences in acetylation of paternal and maternal
U2af1-rs1 chromatin are established prior to
differentiation. In the region 2.3 kb upstream of the gene, equal
levels of H3 and H4 acetylation were detected on maternal and paternal
chromosomes (Table 1).

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 3.
Paternal H3 and H4 lysine 5 acetylation at
U2af1-rs1 in ES cells. (A) Acetylation at the 5'-UTR. ChIP
was performed on chromatin extracted from SF1-1 cells. PCR and SSCP
analysis were performed as for Fig. 2A. (B) Acetylation at the 3'-UTR.
DNA samples derived from the same ChIPs as for the 5'-UTR were used for
PCR amplification with primers from the 3'-UTR (as in Fig. 2B). (C)
Northern analysis of U2af1-rs1 and Snrpn
expression. Total RNAs from SF1-1 and EF1 cells and from adult
(C57BL/6 × M. spretus) F1 liver and brain
were hybridized with U2af1-rs1 probe 1, an exon 7 probe of
Snrpn, and a mouse Gapdh probe. Optical density
measurements established that the intensity of the U2af1-rs1
signal, relative to that of Gapdh, was 0.1 (SF1-1), 0.7 (EF1), 0.4 (liver), and 2.4 (brain).
|
|
Analysis of
U2af1-rs1 mRNA levels on Northern blots showed
that expression was severalfold higher in fibroblasts (sevenfold)
and
liver (fourfold) than in ES cells (Fig.
3C). In all three
cell types,
expression was exclusively from the paternal allele
(reference
17 and data not shown). Despite these differences
in
expression level, the relative levels of H3 and H4 acetylation
on the
paternal and maternal
U2af1-rs1 alleles (the
paternal/maternal
acetylation ratio) were generally similar in the
three different
cell types (Table
1). Acetylation levels did not
reflect the
level of
U2af1-rs1 expression from the paternal
allele.
Paternal-allele-specific H3 and H4 acetylation is also found at the
maternally methylated imprinting control center of the
Snrpn gene.
The 5' portion of the Snrpn
gene on mouse chromosome 7 has a well-characterized DMR (DMR1; Fig. 1B)
with maternal DNA methylation that is established in the female germ
line and maintained throughout development (55). DMR1
corresponds to the "imprinting-control center" that is involved in
the regulation of allele-specific gene expression at the
Prader-Willi/Angelman domain on human chromosome 15q11-q13 (4,
54). We have used the ChIP-SSCP approach with chromatin from
hybrid ES cells and adult tissue and PCR-SSCP to determine whether
maternal methylation correlates with H3 and H4 hypoacetylation at this
imprinting-control center.
In early-passage SF1-1 ES cells, with unaltered maternal methylation at
the
Snrpn DMR1 (Fig.
4 and
data not shown), H3 acetylation
at lysines 14 and 9/18 was detected on
the paternal (unmethylated,
expressed) chromosome only. For H4, there
was a generally higher
level of acetylation on the paternal chromosome
than on the maternal
(methylated, repressed) chromosome, with
paternal/maternal ratios
ranging from 1.8 to 4.7 (Fig.
4). As with
U2af1-rs1, the strongest
allelic difference in H4
acetylation was at lysine 5. These allelic
differences were not
confined to ES cells. Essentially the same
pattern of allele-specific
H3 and H4 acetylation was found when
chromatin from adult mouse liver
was subjected to the same type
of analysis (data not shown). By
Northern analysis, we established
that
Snrpn expression was
relatively high in the SF1-1 ES cells
whereas little expression was
detected in adult liver (Fig.
3C).
Thus, the paternal/maternal
acetylation differences at the DMR1
do not reflect the level of
(paternal)
Snrpn expression.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 4.
Differential H3 and H4 acetylation at DMR1 of
Snrpn. (A) Analysis of DMR1 acetylation in SF1-1 ES cells.
Lanes m, s, and F1 in the left panel show DMR1 PCR products from
control liver DNAs [C57BL/6, M. spretus, and (C57BL/6 × M. spretus) F1, respectively]. Subsequent
lanes show PCR products following ChIP on chromatin from SF1-1 ES cells
with antibodies to H4Ac16, H4Ac12, H4Ac8, H4Ac5, H3Ac14, and H3Ac9/18.
Measured paternal/maternal ratios (P:M) are shown underneath each lane.
(B) PCR-SSCP-based analysis of DNA methylation at DMR1. SF1-1 ES cell
DNA was PCR amplified with the DMR1 primers and migrated on an SSCP gel
(left lane). The right lane corresponds to the same DNA sample,
digested with the methylation-sensitive endonuclease HpaII
prior to PCR amplification. Maternal methylation was confirmed by
Southern hybridization (data not shown).
|
|
Paternal-allele-specific acetylation of H4, but not H3, in the 3'
region of Snrpn.
Snrpn has a second region
(DMR2; Fig. 1B) that has been reported to be methylated more highly on
the expressed paternal than on the repressed maternal allele in some
adult tissues (55). We did not find evidence for
paternal-allele-specific DNA methylation at DMR2 in undifferentiated
SF1-1 ES cells. We analyzed the methylation status of a single,
methylation-sensitive HhaI restriction site in exon 7 of
Snrpn (Fig. 1A). In the brain, this site is prefentially methylated on the paternal allele (55). In contrast, we
found that in the SF1-1 cells and the liver, this site was methylated on both parental alleles (Fig. 5B).
Methylation at this HhaI site and two directly flanking
HhaI sites was also analyzed in the androgenetic and
parthenogenetic ES cell lines, using a Southern hybridization approach.
This confirmed that in ES cells, this region is highly methylated on
both parental chromosomes (data not shown). In SF1-1 ES cells, the
relative levels of H3Ac14 and H3Ac9/18 on DMR2 were equal on the
maternal and paternal chromosomes (Fig. 5). In contrast, for H4 there
was differential acetylation of this region, with much higher
acetylation levels on the expressed paternal than on the repressed
maternal chromosome. We also found comparable levels of maternal and
paternal DMR2 methylation in the liver (Fig. 5A) and did not detect
allelic differences in H3 acetylation. However, as in ES cells, we
found paternal H4 acetylation at all lysines analyzed (data not shown).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 5.
Differential H4, but not H3, acetylation at the DMR2 of
Snrpn. (A) Analysis of acetylation at the DMR2 in SF1-1 ES
cells. Lanes m, s, and F1 in the left panel show DMR2 PCR products from
control liver DNAs [C57BL/6, M. spretus, and (C57BL/6 × M. spretus)F1, respectively]. Subsequent lanes
show PCR products (DMR2 primers) following ChIP with antibodies to
H4Ac16, H4Ac12, H4Ac8, H4Ac5, H3Ac14, and H3Ac9/18 (the same ChIP
series as in Fig. 4A). Paternal/maternal ratios (P:M) are shown
underneath each lane. (B) PCR-SSCP-based analysis of DNA methylation in
the DMR2 region. In the left lane, genomic DNA from SF1-1 ES cells was
PCR amplified using the DMR2 primers and then separated by SSCP. The
middle lane shows the same DNA digested with the methylation-sensitive
endonuclease HhaI prior to amplification. The right lane
shows the PCR product amplified from HhaI-digested
(C67BL/6 × M. spretus)F1 liver DNA.
|
|
Acetylation patterns in androgenetic and parthenogenetic ES
cells.
The high levels of acetylation on the paternal relative to
the maternal U2af1-rs1 and Snrpn alleles, as
measured by ChIP-SSCP, could be due to hyperacetylation (compared to
nonimprinted genes) of the paternal allele, to hypoacetylation of the
maternal allele, or to a combination of the two. To address this, we
immunoprecipitated chromatin from early-passage androgenetic
(dipaternal) and parthenogenetic (dimaternal) ES cell lines. In the
lines selected, U2af1-rs1 was almost completely methylated
(parthenogenetic line PR8 [13]) or unmethylated
(androgenetic line AG-A [17]) at the passages used. DNA
samples were extracted from antibody-bound fractions and used as
templates to coamplify PCR fragments from U2af1-rs1 and
-Tubulin, a ubiquitously expressed gene previously shown to have moderate levels of acetylation typical of euchromatic genes
(31; L. P. O'Neill, unpublished results). PCR
products were size fractionated through polyacrylamide gels, and their relative abundance was determined (Fig.
6A). For histone H3, relatively high
levels of acetylation at all lysines tested were detected in the AG-A
cells (2- to 3-fold higher levels than
-Tubulin) and
relatively low levels were detected in the PR8 cells (0.3- to 0.5-fold
lower levels than
-Tubulin). In contrast, with only one
exception, H4 acetylation at all lysines was similar on the U2af1-rs1 and
-Tubulin genes in both the AG-A
and PR8 cells. The one exception was that in PR8 (dimaternal) cells,
H4Ac5 at U2af1-rs1 was relatively low, at about 0.3 times
the value for
-Tubulin (Fig. 6A). These findings are
consistent with the relative levels of acetylation of the maternal and
paternal U2af1-rs1 alleles measured by PCR-SSCP in SF1-1 and
EF1 cells. They also suggest that whereas H3 acetylation is both
increased on the paternal U2af1-rs1 allele and decreased on
the maternal allele, the maternal-paternal difference in H4Ac5 is due
primarily, and perhaps exclusively, to a reduction in the level of
H4Ac5 on the maternal allele.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 6.
Analysis of H3 and H4 acetylation in monoparental ES
cells. (A) Levels of U2af1-rs1 acetylation. ChIP assays were
performed on AG-A (androgenetic) and PR8 (parthenogenetic) ES cells.
DNA, extracted from the immunoprecipitated fractions was used to
coamplify with primers from U2af1-rs1 (5' UTR) and
a-Tubulin. Ratios between the U2af1-rs1- and
a-Tubulin-amplified fragments (U2:Tub) are plotted
underneath the gels. The first lanes indicate amplification from input
chromatin to which no antibody (NA) was added. (B) Levels of
Snrpn DMR1 acetylation. ChIP was performed on chromatin from
AG-A and PR8 ES cells. DNA extracted from the immunoprecipitated
fractions coamplified with primers from the DMR1 and
a-Tubulin. Ratios between DMR1 and a-Tubulin
products (DMR1:Tub) are plotted underneath the gels. NA indicates
amplification from no-antibody control samples.
|
|
We also tested the levels of H3 and H4 acetylation at
Snrpn
in the androgenetic and parthenogenetic ES cell lines. As expected,
the
DMR1 was methylated in the parthenogenetic PR8 cells and unmethylated
in the androgenetic AG-A cells (data not shown). In the AG-A cells,
DMR1 showed relatively high levels of acetylation, compared to
the

-
Tubulin gene, at all H3 and H4 lysine residues tested,
with
H3 giving the highest values (Fig.
6B). In PR8 cells, the levels
of acetylation at lysine 5 of H4 and at lysines 14 and 9/18 of
H3 were
substantially lower at DMR1 than at

-
Tubulin. In
contrast,
acetylation of lysines 16, 12, and 8 of H4 was only slightly
lower
at DMR1 than at

-
Tubulin (Fig.
6B). These findings
are consistent
with the relative levels of acetylation of the maternal
and paternal
DMR1 alleles that we measured by PCR-SSCP in the SF1-1 ES
cells
and similar to the levels of H3 and H4 acetylation at
U2af1-rs1 in AG-A and PR8 cells (see above). In fact, the
only significant
difference between the two genes, in terms of the
levels of H3
and H4 acetylation on the maternal and paternal alleles,
is that
whereas the
Snrpn DMR1 region shows differential
acetylation of
all H4 lysines (with lysine 5 showing the greatest
difference),
for
U2af1-rs1 the difference is confined to H4
lysine
5.
Transgene-induced CpG methylation on the paternal
U2af1-rs1 allele correlates with deacetylation of histone
H3.
To investigate whether CpG methylation affects the acetylation
status of H3 and H4, we analyzed mice that had acquired a
U2af1-rs1 methylation imprint in both the female and the
male germ lines. We have previously reported that U2af1-rs1
methylation can be affected by the presence, in the testis, of multiple
copies of a transgene construct comprising the entire
U2af1-rs1 gene plus 2.9 kb of upstream sequences and 2 kb of
downstream sequences (26). We showed that offspring (even
nontransgenic ones) of hemizygous transgenic males acquired full
methylation on the normally unmethylated paternal allele at a low
frequency. As on the maternal chromosome (57), this
paternal methylation was found to spread throughout the locus during
early development. This was observed in two independent transgenic
lines, TG8 and TG28, both of which had 20 to 30 copies of the transgene
(26). In the present study, we crossed hemizygous males of
these two transgenic lines with C57BL/6 females. From each cross we
selected one nontransgenic offspring that had methylation on the
paternal U2af1-rs1 allele in addition to the maternal gene.
In these two offspring (designated TG8-BF3-11 and TG28-BF2-46), the
NotI restriction site at the 5'-UTR was fully methylated in
liver (Fig. 7A), as were all 24 HpaII sites across the gene (data not shown). These animals
also showed no expression of U2af1-rs1 (data not shown, but
see reference 26). To analyze the levels of histone
acetylation in these two animals, we purified liver nuclei and
performed ChIP assays on chromatin. To determine the levels of
U2af1-rs1 acetylation relative to those at the
-Tubulin gene, we performed duplex-PCR amplification on
DNA from immunoprecipitated fractions. The results for TG28-BF2-46 are
shown in Fig. 7B. In comparison to a control (C57BL/6 × M. spretus)F1 liver, TG28-BF2-46 revealed strongly
reduced levels of H3 acetylation (lysines 14 and 9/18) on
U2af1-rs1. In contrast, the levels of H4 acetylation
(lysines 5 and 16) were the same in TG28-BF2-46 and the F1
control. These results demonstrate that histone H3, but not histone H4,
is hypoacetylated on both the methylated parental chromosomes.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 7.
CpG methylation is linked to H3 underacetylation at
U2af1-rs1. (A) Genomic DNAs were digested with
BglII (B) or BglII-NotI (B+N) and
analyzed by Southern hybridization with probe 1. Lanes 1 correspond to
(C57BL/6 × SP11)F1 liver DNA, lane 2 corresponds to
liver DNA from mouse TG28-BF2-46. (B) ChIP assays were performed on
TG28-BF2-46 liver and a (C57BL/6 × SP11)F1 control
liver. Duplex PCR was carried out as in Fig. 6A.
|
|
MBD proteins associate with the maternal allele of
U2af1-rs1.
One mechanism by which the maternal DNA
methylation at U2af1-rs1 could confer the observed maternal
hypoacetylation at H3 is the association of specific
methyl-CpG-binding-domain (MBD) proteins and subsequent recruitment of
histone deacetylases (32, 40). In support of this
possibility, we found that across the U2af1-rs1 gene the
maternal chromosome was highly resistant to the methylation-insensitive
restriction endonuclease MspI in purified nuclei. This was
observed in the SF1-1 ES cells (Fig. 8A)
and also in adult liver cells in a previous study (17).
Four MspI sites within a polymorphic
BglII-SacI fragment (Fig. 1A) were highly
sensitivity to MspI on most of the paternal chromosomes, whereas these sites were MspI resistant on most of the
maternal chromosomes (Fig. 8A). Similar results were obtained when 24 MspI sites distributed along the entire U2af1-rs1
locus were studied (data not shown).

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 8.
In vivo association of MeCP2 with the methylated allele
of U2af1-rs1. (A) MspI sensitivity in nuclei
purified from SF1-1 ES cells. Lanes 1 to 7 correspond to 0, 1, 2, 4, 7, 15, and 30 min of incubation with MspI, respectively.
Extracted DNA samples were digested with BglII plus
SacI and hybridized with probe 1. Maternal (M) and paternal
(P) chromosome-specific bands are indicated, as well as MspI
digestion products (in kilobases). (B) Association of MeCP2 with the
methylated maternal U2af1-rs1 allele. SSCP results for the
5'UTR region are shown. PCR amplifications were performed using DNA
samples extracted from input native chromatin and from chromatin
precipitated with the antisera to H3Ac14 and MeCP2, as indicated. To
study allelic methylation (last lane), DNA from input chromatin was
digested with HpaII (which has a unique site in the
amplified sequences) and amplified with the 5'UTR primers.
|
|
To test directly for the allelic association of MBD proteins, we
precipitated chromatin from (C57BL/6 × SP11)F
1 liver
with
an antiserum against the MBD protein MeCP2. Allele-specific
analysis
of immunoprecipitated chromatin at the 5' UTR of
U2af1-rs1 showed
that MeCP2 was associated almost
exclusively with the maternal
(methylated) allele (Fig.
8B).
 |
DISCUSSION |
Patterns of H3 and H4 acetylation on imprinted genes.
In the
present report, we describe how a combination of ChIP, PCR
amplification, and detection of SSCP can be used to define patterns of
histone acetylation along the maternal and paternal alleles of the
imprinted genes Snrpn and U2af1-rs1. At the
U2af1-rs1 gene, in ES cells, fibroblasts, and liver cells,
we found that (i) H3 is more highly acetylated at lysines 14 and 9/18
on the paternal allele than on the maternal allele; (ii) H4 is more
highly acetylated at lysine 5 on the paternal allele than on the
maternal allele; and (iii) H4 acetylation at lysines 8, 12, and 16 is
essentially the same on the maternal and paternal alleles. We emphasize
that these allelic differences have been consistent through multiple experiments with different cells and tissues and when using different antisera. They also occur at opposite ends of the differentially methylated region of U2af1-rs1, namely, the 5'-UTR and the
3'-UTR. Acetylation differences are not present in a region 2.3 kb
upstream of the gene that has equal DNA methylation on both the
parental chromosomes.
The differentially methylated CpG island DMR1 in the 5' region of the
mouse
Snrpn gene (
54) is homologous to the
imprinting
control center of the Prader-Willi/Angelman domain on human
chromosome
15q11-q13 (
4,
54). For DMR1, allele-specific
acetylation
studies revealed high levels of H3 and H4 acetylation on
the paternal
(unmethylated, expressed) allele relative to the maternal
(methylated,
repressed) allele, both in ES cells and in adult liver
cells.
As with
U2af1-rs1, differential H3 acetylation was
apparent at
all lysines tested (lysines 14, 9, and 18) whereas for H4,
the
differential acetylation was most pronounced for lysine 5. However,
unlike
U2af1-rs1, there was also a small but consistent
elevation
of H4 acetylation at lysines 8, 12, and 16 on the paternal
allele.
The
Snrpn gene contains a DNA element within its
coding region
that is methylated more highly on the paternal chromosome
than
on the maternal chromosome in the brain (
55). We
found no evidence
for differential methylation of this region in ES
cells or liver
and no evidence for allele-specific differences in H3
acetylation,
such as are found at DMR1. However, it is interesting that
the
paternal DMR2 allele shows relatively increased levels of
acetylated
H4, comparable to the elevated paternal H4 acetylation seen
at
DMR1. Allele-specific differences in H4 acetylation at DMR2 clearly
do not require differential DNA
methylation.
The difference between parental
U2af1-rs1 alleles in levels
of H4Ac5, but not of H4Ac8, H4Ac12, or H4Ac16, provides an example
in
mammalian cells of a lysine-specific acetylation difference
associated
with a specific function. Previous examples of such
associations have
been found in
Drosophila (
65) and yeast
(
6,
51). In
Drosophila, the preferential
acetylation of H4 lysine
16 on the X chromosome in male flies is driven
by a histone acetyltransferase
with the necessary catalytic specificity
(
1,
59). The enzymatic
basis of the consistent depletion
of H4Ac5 on the maternal alleles
of the imprinted genes studied here
remains to be established,
but an H4Ac5-specific deacetylase, targeted
to the maternal allele
(see below), is a
possibility.
Relationship between CpG methylation and histone acetylation.
We used a transgenic approach to investigate the relationship between
DNA methylation and histone acetylation on the U2af1-rs1 gene. Full methylation of the paternal U2af1-rs1 allele can
be induced in the male germ line by the presence of multiple copies of
a U2af1-rs1 transgene. Methylation persists in some
offspring, even those that lack the transgene itself. For two such
nontransgenic offspring with elevated paternal U2af1-rs1
methylation, we found that the levels of H3 acetylation were extremely
low along the paternal U2af1-rs1 allele (i.e., at the 5'-UTR
and 3'-UTR). This result provides in vivo evidence from a mammalian
system that CpG methylation can confer hypoacetylation of associated
core histones. In contrast to the clear link between DNA methylation and H3 deacetylation, we found no evidence for substantial
deacetylation of H4 (at any lysine) in the offspring that had biallelic
methylation at U2af1-rs1. From this, it seems that whereas
CpG methylation, even in an inappropriate chromosomal context, may lead
to H3 deacetylation in vivo, it is insufficient, in itself, to bring
about deacetylation of H4. The relatively low levels of H4Ac5 on the
maternal U2af1-rs1 allele in all cell types analyzed may be
induced by a maternal-chromosome-specific signal other than, or in
addition to, CpG methylation. These findings are consistent with the
properties of the DMR2 of Snrpn, where differential H4
acetylation occurs in the absence of differences in DNA methylation.
MBD proteins and histone deacetylases.
Work from several
laboratories has provided evidence for the physical association between
HDAC1 or HDAC2 and MBD proteins MeCP2 and MBD2 (32, 40, 42,
69). In addition, there are recent data which demonstrate that
the methyl-CpG binding protein MBD1 can also repress methylated genes
via histone deacetylation, but here the mechanism seems to involve a
deacetylase other than HDAC1 (41). The association of
specific MBD proteins with methylated chromosomal DNA would provide an
attractive targeting mechanism to account for the observed low
acetylation at histones associated with the (methylated) maternal
U2af1-rs1 and Snrpn alleles and could also
account for the observed H3 hypoacetylation in the nontransgenic
offspring with biallelic U2af1-rs1 methylation. The strong
differential sensitivity of the maternal and paternal alleles to
digestion with MspI in vivo is revealing. This restriction enzyme recognizes sites that can be methylated, but it is not methylation sensitive. Despite this, the maternal U2af1-rs1
allele is highly resistant to MspI digestion in embryonic
cells and adult liver tissue. One interpretation of these findings is
that MspI sensitivity is reduced by proteins that bind
specifically to these (CpG-containing) sites on the methylated maternal
allele (2). To test this hypothesis, we performed ChIP
with antibodies against one of the MBD proteins, MeCP2, on liver
chromatin. In vivo association of MeCP2 with U2af1-rs1 was
detected exclusively on the methylated maternal allele.
Collectively, our results support a model in which allele-specific
patterns of histone acetylation are regulated, in part,
by the
targeting of histone deacetylases to the methylated allele.
However,
whereas the presence of DNA methylation correlates with
deacetylation
of histone H3 at all lysines tested, it is not sufficient,
in itself,
to cause deacetylation of H4. Whether this is because
of the
specificity of the histone deacetylase complexes recruited
or because
of compensation by selective recruitment of H4-specific
HATs remains to
be determined. The assays we used detect only
steady-state levels of H3
and H4 acetylation at specific regions.
They cannot detect differences
in turnover, although such differences
can be revealed by the use of
histone deacetylase inhibitors such
as trichostatin A (TSA). It is,
however, clear from studies on
androgenetic and parthenogenetic ES
cells that allele-specific
differences in H3 and H4 acetylation
generally involve both increased
acetylation on the paternal allele
(relative to a control, nonimprinted
gene) and decreased acetylation on
the maternal allele. While
targeting of specific MBD proteins seems to
play a crucial role
in selective histone hypoacetylation, it is
unlikely to be the
only route by which this is achieved. Further work
is needed to
determine what other mechanisms could also be involved.
For example,
recent studies show that specific histone deacetylases can
be
locally recruited by the maintenance methyltransferase DNMT1
(
19,
49).
Differential H3 and H4 acetylation has been found at the 5' CpG island
(DMR1) of the human
SNRPN gene (
52). In this
study,
reactivation of the repressed maternal allele was associated
with
an increase in acetylation of H4 but not H3. It seems that on
the
human
SNRPN gene, as in the mouse, H3 and H4 acetylation
levels
are independently regulated. Several recent studies with mice
have described allele-specific H4 acetylation at differentially
methylated control regions of the imprinted
Igf2r and
H19 loci
(
22,
30). As at
Snrpn and
U2af1-rs1, acetylation at these
germ line DMRs is
consistently low on the methylated allele. In
attempts to determine the
role of allele-specific histone acetylation
in the regulation of
imprinted-gene expression, several recent
studies have examined the
effects of growing cultured cells in
the presence of the histone
deacetylase inhibitor TSA. In some
cases, this leads to transient
induction of gene expression from
the normally silent allele. Such
effects have been demonstrated
for
Igf2, Igf2r, and
p57Kip2 (
3,
16,
22,
30). However,
expression of
other imprinted genes, including
Snrpn and
U2af1-rs1,
appears to remain unaltered on exposure to TSA
(
16,
52). We
also did not observe changes in the allelic
expression of
U2af1-rs1 or
Snrpn on culture of ES
and differentiated cells in the presence
of TSA, although TSA treatment
did induce changes in chromatin
conformation at
U2af1-rs1
(R. I. Gregory, S. Khosla, and R. Feil,
unpublished results).
Maintenance of the allele-specific differences
in the expression of
imprinted genes requires several interacting
components, including DNA
methylation, MBD proteins, histone deacetylases,
and histone
acetylation. Methylation-dependent targeting of histone
deacetylases
via MBD proteins such as MeCP2 is likely to be an
important mechanism
for setting levels of H3 acetylation, but
other,
methylation-independent mechanisms are likely to also be
involved, at
least for histone
H4.
 |
ACKNOWLEDGMENTS |
We thank Wolf Reik, Peter Fraser, and Gavin Kelsey for critical
reading of the manuscript.
This work was supported by the Biotechnology and Biological Sciences
Research Council (Studentship to R.I.G.), the Wellcome Trust (grant
045030/Z/95 to B.M.T.), the Human Frontier Science Program (grant
RG0083/1999 to R.F., I.H., and Neil Brockdorff), the Centre National de
la Recherche Scientifique (ATIPE grant to R.F.), the Fondation pour la
Recherche Médicale (to R.F.), and the Royal Society (Fellowship
516002 to L.P.O.).
 |
FOOTNOTES |
*
Corresponding authors. Mailing address for R. Feil:
Institute of Molecular Genetics, CNRS UMR-5535, IRF-24, 1919 Route de Mende, 34293 Montpellier Cedex 5, France. Phone: 33 4 67 61 36 63. Fax:
33 4 67 04 02 03 31. E-mail: feil{at}igm.cnrs-mop.fr. Mailing address for B. M. Turner: Chromatin and Gene Expression Group, University of Birmingham Medical School, Birmingham B15 2TT, United Kingdom. Phone: 44 121 414 6824. Fax: 44 121 414 6815. E-mail: b.m.turner{at}bham.ac.uk.
Present address: Wellcome/CRC Institute of Developmental Biology
and Cancer Research, University of Cambridge, Cambridge, United Kingdom.
 |
REFERENCES |
| 1.
|
Akhtar, A., and P. B. Becker.
2000.
Activation of transcription through H4 acetylation by MOF, an acetyltransferase essential for dosage compensation in Drosophila.
Mol. Cell
5:367-375[CrossRef][Medline].
|
| 2.
|
Antequera, F.,
J. Boyes, and A. Bird.
1990.
High levels of de novo methylation and altered chromatin structure at CpG islands in cell lines.
Cell
62:503-514[CrossRef][Medline].
|
| 3.
|
Bestor, T. H.
2000.
The DNA methyltransferases in mammals.
Hum. Mol. Genet.
12:2395-2402.
|
| 4.
|
Bielinska, B,
S. M. Blaydes,
K. Buiting,
T. Yang,
M. Krajewska-Walasek,
B. Horsthemke, and C. I. Brannan.
2000.
De novo deletions of SNRPN exon 1 in early human and mouse embryos result in a paternal to maternal imprint switch.
Nat. Genet.
25:74-78[CrossRef][Medline].
|
| 5.
|
Bird, A. P., and A. P. Wolffe.
1999.
Methylation-induced repression belts, braces, and chromatin.
Cell
99:451-454[CrossRef][Medline].
|
| 6.
|
Braunstein, M.,
R. E. Sobel,
C. D. Allis,
B. M. Turner, and J. R. Broach.
1996.
Efficient transcriptional silencing in Saccharomyces cerevisiae requires a heterochromatin histone acetylation pattern.
Mol. Cell. Biol.
16:4349-4356[Abstract].
|
| 7.
|
Caspary, T,
M. A. Cleary,
C. C. Baker,
X. J. Guan, and S. M. Tilghman.
1998.
Multiple mechanisms regulate imprinting of the mouse distal chromosome 7 cluster.
Mol. Cell. Biol.
18:3466-3474[Abstract/Free Full Text].
|
| 8.
|
Cavalli, G., and R. Paro.
1999.
Epigenetic inheritance of active chromatin after removal of the main transactivator.
Science
286:955-958[Abstract/Free Full Text].
|
| 9.
|
Chen, H.,
R. J. Lin,
W. Xie,
D. Wilpitz, and R. M. Evans.
1999.
Regulation of hormone-induced histone hyperacetylation and gene activation via acetylation of an acetylase.
Cell
98:675-686[CrossRef][Medline].
|
| 10.
|
Cheung, P.,
K. G. Tanner,
W. L. Cheung,
P. Sassone-Corsi,
J. M. Denu, and C. D. Allis.
2000.
Synergistic coupling of histone H3 phosphorylation and acetylation in response to epidermal growth factor stimulation.
Mol. Cell
5:905-915[CrossRef][Medline].
|
| 11.
|
Clayton, A. L.,
S. Rose,
M. J. Barratt, and L. C. Mahadevan.
2000.
Phosphoacetylation of histone H3 on c-fos- and c-jun-associated nucleosomes upon gene activation.
EMBO J.
19:3714-3726[CrossRef][Medline].
|
| 12.
|
Constância, M.,
B. Pickard,
G. Kelsey, and W. Reik.
1998.
Imprinting mechanisms.
Genome Res.
8:881-900[Abstract/Free Full Text].
|
| 13.
|
Dean, W. L.,
L. Bowden,
A. Aitchison,
J. Klose,
T. Moore,
J. J. Meneses,
W. Reik, and R. Feil.
1998.
Altered imprinted gene methylation and expression in completely ES cell-derived mouse fetuses: association with aberrant phenotypes.
Development
125:2273-2282[Abstract].
|
| 14.
|
Drewell, R. A.,
J. D. Brenton,
J. F. Ainscough,
S. C. Barton,
K. Hilton,
K. L. Arney,
L. Dandolo, and M. A. Surani.
2000.
Deletion of a silencer element disrupts H19 imprinting independently of a methylation epigenetic switch.
Development
127:3419-3428[Abstract].
|
| 15.
|
Ekwall, K.,
T. Olsson,
B. M. Turner,
G. Cranston, and R. C. Allshire.
1997.
Transient inhibition of histone deacetylation alters the structural and functional imprint at fission yeast centromeres.
Cell
91:1021-1032[CrossRef][Medline].
|
| 16.
|
El Kharroubi, A.,
G. Piras, and C. L. Stewart.
2001.
DNA demethylation reactivates a subset of imprinted genes in uniparental mouse embryonic fibroblasts.
J. Biol. Chem.
276:8674-8680[Abstract/Free Full Text].
|
| 17.
|
Feil, R.,
M. D. Boyano,
N. D. Allen, and G. Kelsey.
1997.
Parental chromosome-specific chromatin conformation in the imprinted U2af1-rs1 gene in the mouse.
J. Biol. Chem.
272:20893-20900[Abstract/Free Full Text].
|
| 18.
|
Feil, R., and S. Khosla.
1999.
Genomic imprinting in mammals: an interplay between chromatin and DNA methylation?
Trends Genet.
15:431-435[CrossRef][Medline].
|
| 19.
|
Fuks, F.,
W. A. Burgers,
A. Brehm,
L. Hughes-Davies, and T. Kouzarides.
2000.
DNA methyltransferase Dnmt1 associates with histone deacetylase activity.
Nat. Genet.
24:88-91[CrossRef][Medline].
|
| 20.
|
Gerelli, D.,
N. G. Sharpe, and D. S. Latchman.
1991.
Cloning and sequencing of a mouse embryonal carcinoma cell mRNA encoding the tissue specific RNA splicing factor SmN.
Nucleic Acids Res.
19:6642[Free Full Text].
|
| 21.
|
Glenn, C. C.,
S. Saitoh,
M. T. Jong,
M. M. Filbrandt,
U. Surti,
D. J. Driscoll, and R. D. Nicholls.
1996.
Gene structure, DNA methylation, and imprinted expression of the human SNRPN gene.
Am. J. Hum. Genet.
58:335-346[Medline].
|
| 22.
|
Grandjean, V.,
L. O'Neill,
T. Sado,
B. Turner, and A. Ferguson-Smith.
2001.
Relationship between DNA methylation, histone H4 acetylation and gene expression in the mouse imprinted Igf2-H19 domain.
FEBS Lett.
488:165-169[CrossRef][Medline].
|
| 23.
|
Gregory, R. I., and R. Feil.
1999.
Analysis of chromatin in limited numbers of cells: a PCR-SSCP based assay of allele-specific nuclease sensitivity.
Nucleic Acids Res.
27:R1-R4.
|
| 24.
|
Grunstein, M.
1998.
Inheritance by histones.
Cell
93:325-328[CrossRef][Medline].
|
| 25.
|
Hansen, J. C.,
C. Tse, and A. P. Wolffe.
1998.
Structure and function of the core histone N-termini: more than meets the eye.
Biochemistry
37:17637-17641[CrossRef][Medline].
|
| 26.
|
Hatada, I.,
A. Nabetani,
Y. Arai,
S. Ohishi,
M. Suzuki,
S. Miyabara,
Y. Nishimune, and T. Mukai.
1997.
Aberrant methylation of an imprinted gene U2af1-rs1 (SP2) caused by its own transgene.
J. Biol. Chem.
272:9120-9122[Abstract/Free Full Text].
|
| 27.
|
Hatada, I.,
T. Sugama, and T. Mukai.
1993.
A new imprinted gene cloned by a methylation-sensitive genome scanning method.
Nucleic Acids Res.
21:5577-5582[Abstract/Free Full Text].
|
| 28.
|
Hayashizaki, Y.,
H. Shibata,
S. Hirotsune,
H. Sugino,
Y Okazaki,
N. Sasaki,
K. Hirose,
H. Imoto,
H. Okuizumi,
M. Muramatsu,
H. Komatsubara,
T. Shiroishi,
K. Moriwaki,
M. Katsuki,
N. Hatano,
H. Sasaki,
T. Ueda,
N. Mise,
N. Takagi,
C. Plass, and V. M. Chapman.
1994.
Identification of an imprinted U2af binding protein related sequence on mouse chromosome 11 using the RLGS method.
Nat. Genet.
6:33-39[CrossRef][Medline].
|
| 29.
|
Hebbes, T. R.,
A. L. Clayton,
A. W. Thorne, and C. Crane-Robinson.
1994.
Core histone hyperacetylation co-maps with generalised DNaseI sensitivity in the chicken -globin chromosomal domain.
EMBO J.
13:1823-1830[Medline].
|
| 30.
|
Hu, J.-F.,
J. Pham,
I. Dey,
T. Li,
T. H. Vu, and A. R. Hoffman.
2000.
Allele-specific histone acetylation accompanies genomic imprinting of the insulin-like growth factor II receptor gene.
Endocrinology
141:4428-4435[Abstract/Free Full Text].
|
| 31.
|
Johnson, C. A.,
L.P. O'Neill,
A. Mitchell, and B. M. Turner.
1998.
Distinctive patterns of histone H4 acetylation are associated with defined sequence elements within both heterochromatic and euchromatic regions of the human genome.
Nucleic Acids Res.
26:994-1001[Abstract/Free Full Text].
|
| 32.
|
Jones, P. L.,
G. J. Veenstra,
P. A. Wade,
D. Vermaak,
S. U. Kass,
N. Landsberger,
J. Strouboulis, and A. P. Wolffe.
1998.
Methylated DNA and MeCP2 recruit histone deacetylase to repress transcription.
Nat. Genet.
19:187-191[CrossRef][Medline].
|
| 33.
|
Kafri, T.,
M. Ariel,
M. Brandeis,
R. Shemer,
L. Urven,
J. McCarrey,
H. Cedar, and A. Razin.
1992.
Developmental pattern of gene-specific DNA methylation in the mouse embryo and germ line.
Genes Dev.
6:705-714[Abstract/Free Full Text].
|
| 34.
|
Kuo, M. H.,
J. Zhou,
P. Jambeck,
M. E. A. Churchill, and C. D. Allis.
1998.
Histone acetyltransferase activity of yeast Gcn5p is required for the activation of target genes in vivo.
Genes Dev.
12:627-639[Abstract/Free Full Text].
|
| 35.
|
Leff, S. E.,
C. I. Brannan,
M. L. Reed,
T. Ozcelik,
U. Francke,
N. G. Copeland, and N. A. Jenkins.
1992.
Maternal imprinting of the mouse Snrpn gene and conserved linkage homology with the human Prader-Willi syndrome region.
Nat. Genet.
2:259-264[CrossRef][Medline].
|
| 36.
|
Li, E.,
C. Beard, and R. Jaenisch.
1993.
Role of DNA methylation in genomic imprinting.
Nature
366:362-365[CrossRef][Medline].
|
| 37.
|
Luger, K., and T. J. Richmond.
1998.
Histone tails of the nucleosome.
Curr. Opin. Genet. Dev.
8:140-146[CrossRef][Medline].
|
| 38.
|
Lyko, F., and R. Paro.
1999.
Chromosomal elements conferring epigenetic inheritance.
Bioessays
21:824-832[CrossRef][Medline].
|
| 39.
|
Mayer, W.,
A. Niveleau,
J. Walter,
R. Fundele, and T. Haaf.
2000.
Demethylation of the zygotic paternal genome.
Nature
403:501-502[Medline].
|
| 40.
|
Nan, X.,
H.-H. Ng,
C. A. Johnson,
C. D. Laherty,
B. M. Turner,
R. N. Eisenman, and A. Bird.
1998.
Transcriptional repression by the methyl CpG binding protein MeCP2 involves a histone acetylase complex.
Nature
393:386-389[CrossRef][Medline].
|
| 41.
|
Ng, H.-H.,
P. Jeppesen, and A. Bird.
2000.
Active repression of methylated genes by the chromosomal protein MBD1.
Mol. Cell. Biol.
20:1394-1406[Abstract/Free Full Text].
|
| 42.
|
Ng, H.-H.,
Y. Zhang,
B. Hendrich,
C. A. Johnson,
B. M. Turner,
H. Erdjument-Bromage,
P. Tempst,
D. Reinberg, and A. Bird.
1999.
MBD2 is a transcriptional repressor belonging to the MeCP1 histone deacetylase complex.
Nat. Genet.
23:58-61[Medline].
|
| 43.
|
O'Neill, L. P.,
A. M. Keohane,
J. S. Lavender,
V. McCabe,
E. Heard,
P. Avner,
N. Brockdorff, and B. M. Turner.
1999.
A developmental switch in H4 acetylation upstream of Xist plays a role in X chromosome inactivation.
EMBO J.
18:2897-2907[CrossRef][Medline].
|
| 44.
|
O'Neill, L. P., and B. M. Turner.
1995.
Histone H4 acetylation distinguishes coding regions of the human genome from heterochromatin in a differentiation-independent manner.
EMBO J.
14:3946-3957[Medline].
|
| 45.
|
Parekh, B. S., and T. Maniatis.
1999.
Virus infection leads to localized hyperacetylation of histones H3 and H4 at the IFN- promoter.
Mol. Cell
3:125-129[CrossRef][Medline].
|
| 46.
|
Pfeifer, K.
2000.
Mechanisms of genomic imprinting.
Am J. Hum. Genet.
67:777-787[CrossRef][Medline].
|
| 47.
|
Rea, S.,
F. Eisenhaber,
D. O'Carroll,
B. D. Strahl,
Z. W. Sun,
M. Schmid,
S. Opravil,
K. Mechter,
C. P. Ponting,
C. D. Allis, and T. Jenuwein.
2000.
Regulation of chromatin structure by site-specific histone H3 methyltransferases.
Nature
406:593-599[CrossRef][Medline].
|
| 48.
|
Reik, W., and J. Walter.
1998.
Imprinting mechanisms in mammals.
Curr. Opin. Genet. Dev.
8:154-164[CrossRef][Medline].
|
| 49.
|
Robertson, K. D.,
S. Ait-Si-Ali,
T. Yokochi,
P. A. Wade,
P. L. Jones, and A. P. Wolffe.
2000.
DNMT1 forms a complex with Rb, E2F1 and HDAC1 and represses transcription from E2F-responsive promoters.
Nat. Genet.
25:338-342[CrossRef][Medline].
|
| 50.
|
Rougier, N.,
D. Bourc'his,
D. M. Gomes,
A. Niveleau,
M. Planchot,
A. Paldi, and E. Viegas-Pequignot.
1998.
Chromosome methylation patterns during mammalian preimplantation development.
Genes Dev.
12:2108-2113[Abstract/Free Full Text].
|
| 51.
|
Rundlett, S. E.,
A. A. Carmen,
N. Suka,
B. M. Turner, and M. Grunstein.
1998.
Transcriptional repression by UME6 involves deacetylation of lysine 5 of histone H4 by RPD3.
Nature
392:831-835[CrossRef][Medline].
|
| 52.
|
Saitoh, S., and T. Wada.
2000.
Parent-of-origin specific histone acetylation and reactivation of a key imprinted gene locus in Prader-Willi syndrome.
Am. J. Hum. Genet.
66:1958-1962[CrossRef][Medline].
|
| 53.
|
Schübeler, D.,
C. Francastel,
D. M. Cimbora,
A. Reik,
D. I. Martin, and M. Groudine.
2000.
Nuclear localization and histone acetylation: a pathway for chromatin opening and transcriptional activation of the human beta-globin locus.
Genes Dev.
14:940-950[Abstract/Free Full Text].
|
| 54.
|
Shemer, R.,
A. Y. Hersko,
J. Perk,
R. Mostoslavsky,
B. Z. Tsuberi,
H. Cedar,
K. Buiting, and A. Razin.
2000.
The imprinting box of the Prader-Willi/Angelman syndrome domain.
Nat. Genet.
26:440-443[CrossRef][Medline].
|
| 55.
|
Shemer, R.,
Y. Birger,
A. D. Riggs, and A. Razin.
1997.
Structure of the imprinted mouse Snrpn gene and establishment of its parental-specific methylation pattern.
Proc. Natl. Acad. Sci. USA
94:10267-10272[Abstract/Free Full Text].
|
| 56.
|
Shibata, H.,
K. Yoshino,
S. Sunahara,
Y. Gondo,
M. Katsuki,
T. Ueda,
M. Kamiya,
M. Muramatsu,
Y. Murakami,
L. Kalcheva,
C. Plass,
V. N. Chapman, and Y. Hayashizaki.
1996.
Inactive allele-specific methylation and chromatin structure of the imprinted gene U2af1-rs1 on mouse chromosome 11.
Genomics
35:248-252[CrossRef][Medline].
|
| 57.
|
Shibata, H.,
T. Ueda,
M. Kamiya,
A. Yoshida,
M. Kusakabe,
C. Plass,
W. A. Held,
S. Sunahara,
M. Katsuki,
M. Muramatsu, and Y. Hayashizaki.
1997.
An oocyte-specific methylation imprint center in the mouse U2afbp-rs/U2af1-rs1 gene marks the establishment of allele-specific methylation during preimplantation development.
Genomics
44:171-178[CrossRef][Medline].
|
| 58.
|
Sleutels, F.,
D. P. Barlow, and R. Lyle.
2000.
The uniqueness of the imprinting mechanism.
Curr. Opin. Genet. Dev.
10:229-233[CrossRef][Medline].
|
| 59.
|
Smith, E. R.,
A. Pannutti,
W. Gu,
A. Steurnagel,
R. G. Cook,
C. D. Allis, and J. C. Lucchesi.
2000.
The Drosophila MSL complex acetylates histone H4 at lysine 16, a chromatin modification linked to dosage compensation.
Mol. Cell. Biol.
20:312-318[Abstract/Free Full Text].
|
| 60.
|
Strahl, B. D.,
R. Ohba,
R. G. Cook, and C. D. Allis.
1999.
Methylation of histone H3 at lysine 4 is highly conserved and correlates with transcriptionally active nuclei in Tetrahymena.
Proc. Natl. Acad. Sci. USA
96:14967-14972[Abstract/Free Full Text].
|
| 61.
|
Strahl, B. D., and C. D. Allis.
2000.
The language of covalent histone modifications.
Nature
403:41-45[CrossRef][Medline].
|
| 62.
|
Tanaka, M.,
M. Puchyr,
M. Gerstenstein,
K. Harpal,
R. Jaenisch,
J. Rossant, and A. Nagy.
1999.
Parental origin-specific expression of Mash2 is established at the time of implantation with its imprinting mechanism highly resistant to genome-wide demethylation.
Mech. Dev.
87:129-142[CrossRef][Medline].
|
| 63.
|
Turner, B. M.
1998.
Histone acetylation as an epigenetic determinant of long-term transcriptional competence.
Cell. Mol. Life Sci.
54:21-31[CrossRef][Medline].
|
| 64.
|
Turner, B. M.
2000.
Histone acetylation and an epigenetic code.
Bioessays
22:836-845[CrossRef][Medline].
|
| 65.
|
Turner, B. M.,
A. J. Birley, and J. Lavender.
1992.
Histone H4 isoforms acetylated at specific lysine residues define individual chromosomes and chromatin domains in Drosophila polytene nuclei.
Cell
69:375-384[CrossRef][Medline].
|
| 66.
|
Turner, B. M., and G. Fellows.
1989.
Specific antibodies reveal ordered and cell-cycle-related use of histone-H4 acetylation sites in mammalian cells.
Eur. J. Biochem.
179:131-139[Medline].
|
| 67.
|
White, D. A.,
N. D. Belyaev, and B. M. Turner.
1999.
Preparation of site-specific antibodies to acetylated histones.
Methods
19:417-424[CrossRef][Medline].
|
| 68.
|
Wolffe, A. P.
2000.
Transcriptional control: imprinting insulation.
Curr. Biol.
10:R463-R465[CrossRef][Medline].
|
| 69.
|
Zhang, Y.,
H.-H. Ng,
H. Erdjument-Bromage,
P. Tempst,
A. Bird, and D. Reinberg.
1999.
Analysis of the NuRD subunits reveals a histone deacetylase core complex and a connection with DNA methylation.
Genes Dev.
13:1924-1935[Abstract/Free Full Text].
|
Molecular and Cellular Biology, August 2001, p. 5426-5436, Vol. 21, No. 16
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.16.5426-5436.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Sanders, Y. Y., Pardo, A., Selman, M., Nuovo, G. J., Tollefsbol, T. O., Siegal, G. P., Hagood, J. S.
(2008). Thy-1 Promoter Hypermethylation: A Novel Epigenetic Pathogenic Mechanism in Pulmonary Fibrosis. Am. J. Respir. Cell Mol. Bio.
39: 610-618
[Abstract]
[Full Text]
-
Hwang, C. K., Song, K. Y., Kim, C. S., Choi, H. S., Guo, X.-H., Law, P.-Y., Wei, L.-N., Loh, H. H.
(2007). Evidence of Endogenous Mu Opioid Receptor Regulation by Epigenetic Control of the Promoters. Mol. Cell. Biol.
27: 4720-4736
[Abstract]
[Full Text]
-
Wagschal, A., Delaval, K., Pannetier, M., Arnaud, P., Feil, R.
(2007). Chromatin Immunoprecipitation (ChIP) on Unfixed Chromatin from Cells and Tissues to Analyze Histone Modifications. CSH Protocols
2007: pdb.prot4767-pdb.prot4767
[Abstract]
[Full Text]
-
Wagschal, A., Delaval, K., Pannetier, M., Arnaud, P., Feil, R.
(2007). PCR-Based Analysis of Immunoprecipitated Chromatin. CSH Protocols
2007: pdb.prot4768-pdb.prot4768
[Abstract]
[Full Text]
-
Yamasaki-Ishizaki, Y., Kayashima, T., Mapendano, C. K., Soejima, H., Ohta, T., Masuzaki, H., Kinoshita, A., Urano, T., Yoshiura, K.-i., Matsumoto, N., Ishimaru, T., Mukai, T., Niikawa, N., Kishino, T.
(2007). Role of DNA Methylation and Histone H3 Lysine 27 Methylation in Tissue-Specific Imprinting of Mouse Grb10. Mol. Cell. Biol.
27: 732-742
[Abstract]
[Full Text]
-
Monk, D., Arnaud, P., Apostolidou, S., Hills, F. A., Kelsey, G., Stanier, P., Feil, R., Moore, G. E.
(2006). From the Cover: Limited evolutionary conservation of imprinting in the human placenta. Proc. Natl. Acad. Sci. USA
103: 6623-6628
[Abstract]
[Full Text]
-
Hiura, H., Obata, Y., Komiyama, J., Shirai, M., Kono, T.
(2006). Oocyte growth-dependent progression of maternal imprinting in mice. GENES CELLS
11: 353-361
[Abstract]
[Full Text]
-
Galvao, T. C., Thomas, J. O.
(2005). Structure-specific binding of MeCP2 to four-way junction DNA through its methyl CpG-binding domain. Nucleic Acids Res
33: 6603-6609
[Abstract]
[Full Text]
-
Li, T., Vu, T. H., Ulaner, G. A., Littman, E., Ling, J.-Q., Chen, H.-L., Hu, J.-F., Behr, B., Giudice, L., Hoffman, A. R.
(2005). IVF results in de novo DNA methylation and histone methylation at an Igf2-H19 imprinting epigenetic switch. Mol Hum Reprod
11: 631-640
[Abstract]
[Full Text]
-
Sha, K., Fire, A.
(2005). Imprinting Capacity of Gamete Lineages in Caenorhabditis elegans. Genetics
170: 1633-1652
[Abstract]
[Full Text]
-
Makedonski, K., Abuhatzira, L., Kaufman, Y., Razin, A., Shemer, R.
(2005). MeCP2 deficiency in Rett syndrome causes epigenetic aberrations at the PWS/AS imprinting center that affects UBE3A expression. Hum Mol Genet
14: 1049-1058
[Abstract]
[Full Text]
-
Caballero, I. M., Hendrich, B.
(2005). MeCP2 in neurons: closing in on the causes of Rett syndrome. Hum Mol Genet
14: R19-R26
[Abstract]
[Full Text]
-
Samaco, R. C., Hogart, A., LaSalle, J. M.
(2005). Epigenetic overlap in autism-spectrum neurodevelopmental disorders: MECP2 deficiency causes reduced expression of UBE3A and GABRB3. Hum Mol Genet
14: 483-492
[Abstract]
[Full Text]
-
Ruzov, A., Dunican, D. S., Prokhortchouk, A., Pennings, S., Stancheva, I., Prokhortchouk, E., Meehan, R. R.
(2004). Kaiso is a genome-wide repressor of transcription that is essential for amphibian development. Development
131: 6185-6194
[Abstract]
[Full Text]
-
Sakamoto, A., Liu, J., Greene, A., Chen, M., Weinstein, L. S.
(2004). Tissue-specific imprinting of the G protein Gs{alpha} is associated with tissue-specific differences in histone methylation. Hum Mol Genet
13: 819-828
[Abstract]
[Full Text]
-
Lucifero, D., Mann, M. R.W., Bartolomei, M. S., Trasler, J. M.
(2004). Gene-specific timing and epigenetic memory in oocyte imprinting. Hum Mol Genet
13: 839-849
[Abstract]
[Full Text]
-
Li, T., Vu, T. H., Ulaner, G. A., Yang, Y., Hu, J.-F., Hoffman, A. R.
(2004). Activating and silencing histone modifications form independent allelic switch regions in the imprinted Gnas gene. Hum Mol Genet
13: 741-750
[Abstract]
[Full Text]
-
Schumacher, A., Doerfler, W.
(2004). Influence of in vitro manipulation on the stability of methylation patterns in the Snurf/Snrpn-imprinting region in mouse embryonic stem cells. Nucleic Acids Res
32: 1566-1576
[Abstract]
[Full Text]
-
Lucifero, D., Chaillet, J.R., Trasler, J. M.
(2004). Potential significance of genomic imprinting defects for reproduction and assisted reproductive technology. Hum Reprod Update
10: 3-18
[Abstract]
[Full Text]
-
Cerrato, F., Dean, W., Davies, K., Kagotani, K., Mitsuya, K., Okumura, K., Riccio, A., Reik, W.
(2003). Paternal imprints can be established on the maternal Igf2-H19 locus without altering replication timing of DNA. Hum Mol Genet
12: 3123-3132
[Abstract]
[Full Text]
-
Yang, Y., Li, T., Vu, T. H., Ulaner, G. A., Hu, J.-F., Hoffman, A. R.
(2003). The Histone Code Regulating Expression of the Imprinted Mouse Igf2r Gene. Endocrinology
144: 5658-5670
[Abstract]
[Full Text]
-
van Driel, R., Fransz, P. F., Verschure, P. J.
(2003). The eukaryotic genome: a system regulated at different hierarchical levels. J. Cell Sci.
116: 4067-4075
[Abstract]
[Full Text]
-
O'Neill, L. P., Randall, T. E., Lavender, J., Spotswood, H. T., Lee, J. T., Turner, B. M.
(2003). X-linked genes in female embryonic stem cells carry an epigenetic mark prior to the onset of X inactivation. Hum Mol Genet
12: 1783-1790
[Abstract]
[Full Text]
-
Matarazzo, M. R., De Bonis, M. L., Gregory, R. I., Vacca, M., Hansen, R. S., Mercadante, G., D'Urso, M., Feil, R., D'Esposito, M.
(2002). Allelic inactivation of the pseudoautosomal gene SYBL1 is controlled by epigenetic mechanisms common to the X and Y chromosomes. Hum Mol Genet
11: 3191-3198
[Abstract]
[Full Text]
-
Singal, R., vanWert, J. M., Ferdinand, L. Jr
(2002). Methylation of alpha -type embryonic globin gene alpha pi represses transcription in primary erythroid cells. Blood
100: 4217-4222
[Abstract]
[Full Text]
-
Lunyak, V. V., Burgess, R., Prefontaine, G. G., Nelson, C., Sze, S.-H., Chenoweth, J., Schwartz, P., Pevzner, P. A., Glass, C., Mandel, G., Rosenfeld, M. G.
(2002). Corepressor-Dependent Silencing of Chromosomal Regions Encoding Neuronal Genes. Science
298: 1747-1752
[Abstract]
[Full Text]
-
Koizume, S., Tachibana, K., Sekiya, T., Hirohashi, S., Shiraishi, M.
(2002). Heterogeneity in the modification and involvement of chromatin components of the CpG island of the silenced human CDH1 gene in cancer cells. Nucleic Acids Res
30: 4770-4780
[Abstract]
[Full Text]
-
Deplus, R., Brenner, C., Burgers, W. A., Putmans, P., Kouzarides, T., Launoit, Y. d., Fuks, F.
(2002). Dnmt3L is a transcriptional repressor that recruits histone deacetylase. Nucleic Acids Res
30: 3831-3838
[Abstract]
[Full Text]
-
Roder, K., Latasa, M.-J., Sul, H. S.
(2002). Silencing of the Mouse H-rev107 Gene Encoding a Class II Tumor Suppressor by CpG Methylation. J. Biol. Chem.
277: 30543-30550
[Abstract]
[Full Text]
-
Suh, Y.-A., Lee, H.-Y., Virmani, A., Wong, J., Mann, K. K., Miller, W. H. Jr., Gazdar, A., Kurie, J. M.
(2002). Loss of Retinoic Acid Receptor {beta} Gene Expression Is Linked to Aberrant Histone H3 Acetylation in Lung Cancer Cell Lines. Cancer Res.
62: 3945-3949
[Abstract]
[Full Text]
-
Gregory, R. I., O'Neill, L. P., Randall, T. E., Fournier, C., Khosla, S., Turner, B. M., Feil, R.
(2002). Inhibition of Histone Deacetylases Alters Allelic Chromatin Conformation at the Imprinted U2af1-rs1 Locus in Mouse Embryonic Stem Cells. J. Biol. Chem.
277: 11728-11734
[Abstract]
[Full Text]
-
El-Osta, A., Kantharidis, P., Zalcberg, J. R., Wolffe, A. P.
(2002). Precipitous Release of Methyl-CpG Binding Protein 2 and Histone Deacetylase 1 from the Methylated Human Multidrug Resistance Gene (MDR1) on Activation. Mol. Cell. Biol.
22: 1844-1857
[Abstract]
[Full Text]
-
Johnson, C. A., White, D. A., Lavender, J. S., O'Neill, L. P., Turner, B. M.
(2002). Human Class I Histone Deacetylase Complexes Show Enhanced Catalytic Activity in the Presence of ATP and Co-immunoprecipitate with the ATP-dependent Chaperone Protein Hsp70. J. Biol. Chem.
277: 9590-9597
[Abstract]
[Full Text]
-
Lorincz, M. C., Schubeler, D., Groudine, M.
(2001). Methylation-Mediated Proviral Silencing Is Associated with MeCP2 Recruitment and Localized Histone H3 Deacetylation. Mol. Cell. Biol.
21: 7913-7922
[Abstract]
[Full Text]
-
Jenuwein, T., Allis, C. D.
(2001). Translating the Histone Code. Science
293: 1074-1080
[Abstract]
[Full Text]