INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

All cells have evolved mechanisms to maintain the integrity of their genomes. Homologous and nonhomologous rearrangements or recombinations occur primarily in response to DNA damage during mitotic growth and are mechanisms used to repair DNA lesions. To identify factors that participate in mitotic recombination and to understand the mechanisms of the recombinogenic processes, mutants that display altered rates of mitotic recombination have been isolated (23). In general, hyporecombination mutants are defective in some aspect of the recombination process and are typically associated with mutations in genes encoding components of the recombinational repair machinery. In contrast, mutations that lead to an accumulation of nicked or gapped or broken DNA strands can be identified by a hyperrecombination phenotype. Such mutations may lie within genes encoding proteins that participate in DNA replication, in nonrecombinogenic repair pathways, and in the repression of mitotic recombination. Importantly, hyperrecombination mutants can reveal sources of genome instability.

The HPR1 gene was identified through a mutation that increased the rate of deletion events between directly repeated DNA sequences in Saccharomyces cerevisiae (2). The hyperrecombination phenotype of hpr1 is reminiscent of chromosome instability syndromes, such as ataxia-telangiectasia, Werner syndrome, and Bloom syndrome (16, 17, 27). Additionally, hpr1 mutants display increased rates of chromosome and plasmid loss, indicating that Hpr1p is not exclusively involved in stabilizing directly repeated DNA sequences but has a general influence on genome stability (36).

Hpr1p shows sequence homology to yeast topoisomerase I, and an hpr1 mutation is lethal in combination with mutations that compromise or eliminate the function of any of the three yeast topoisomerases (3, 14). Interestingly, mutations in each of the topoisomerases can also lead to increased rates of intrachromosomal deletion events (10, 48). Other studies have revealed that the removal of histone H3-H4 (copy I) in hpr1 mutants is lethal (14, 53). These observations have led to the suggestion that Hpr1p can influence DNA structure (13).

Unlike other recombination mutants of Escherichia coli, S. cerevisiae, and Homo sapiens, the hpr1 mutant shows no DNA replication or repair defect. In fact, evidence accumulated thus far indicates that hpr1-induced recombination is related to the process of transcription. Mutations in genes encoding transcription factors suppress hpr1-associated phenotypes. These transcription factors include proteins involved in basal transcription such as Rpb2p and Sua7p (yTFIIB) (13); transcription mediators such as Sin4p (H.-Y. Fan and H. L. Klein, unpublished data), Srb2p and Hrs1p (32, 36), and gene-specific activators such as Gcr3p (44). A recent search for high-copy-number suppressors of hpr1 uncovered a novel gene, THO2/RLR1, which is involved in RNA polymerase II transcription (33, 50). The hyperrecombination phenotype associated with hpr1 mutants was also found to be more severe when direct repeats were highly transcribed (13), and recent evidence indicates that Hpr1p influences transcription elongation (7, 34).

To further explore the relationship between Hpr1p and transcription, we have studied a novel class of transcription factors in which mutations are also hyperrecombinogenic and are lethal in combination with a hpr1 mutation. Cdc73p is one example of this class. Cdc73p functions as a transcription factor and interacts with the C-terminal domain of the largest subunit of RNA polymerase II (39). Cdc73p is found in a distinct RNA polymerase II complex which also contains Paf1p, Ccr4p, and Hpr1p (6). cdc73 and paf1 mutants have multiple phenotypes. They show temperature-dependent growth, affect the abundance of some transcripts, and are hypersensitive to growth on 8 mM caffeine (6). The mutations also result in elevated rates of recombination between direct repeats, similar to hpr1 (6). The similarity in phenotype of Cdc73p and Hpr1p and their association in an RNA polymerase II complex are underscored by the finding that the hpr1 cdc73 double mutant is a temperature-sensitive lethal at 3°C. To understand how genome stability is maintained during transcription, we have isolated a high-copy-number suppressor of the hpr1 cdc73 double mutant. Further characterization of this suppressor, the SUB2 gene, has revealed that it is a putative RNA helicase involved in pre-mRNA splicing (22, 24, 52). SUB2 was originally isolated as a high-copy-number suppressor of the yeast snRNP biogenesis mutant brr1-1 (42). Precedence for a presumptive RNA helicase being a high-copy-number suppressor of a transcription component comes from the recovery of DHH1 as a high-copy-number suppressor of the transcription regulator complex CCR4 mutants pop2 and ccr4 (21). Our studies on the SUB2 gene have uncovered a novel role for this factor in the maintenance of genome integrity.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Yeast strains, growth conditions and recombination rate determinations. All strains are in the W303 background. Strains in Table 2 were obtained by transforming plasmids into HFY2170-6A (sub21::TRP1 + pHF68-1 [SUB2 CEN6, URA3]). The vector backbone of pHF68-1 is pRS316. pHF68-1 will be referred to as YCp2-SUB2. Transformants were streaked on fluoro-orotic acid (FOA)-containing leucine dropout medium to select for cells that lost pHF68-1. FOA-resistant cells were crossed to HFY998-1C to acquire the recombination assay system. Recombination rates were calculated as described previously (2).

Generation of sub2 and mud2 deletion strains and SUB2 and MUD2 plasmids. sub2 disruption plasmids pHF15-1 and pHF124-2 were constructed as follows. The HindIII-SacI fragment of YEp-SUB2 (hy41) was cloned into pBS-SK (Stratagene) to form pHF13-2. A SnaBI-PstI fragment containing TRP1 was used to replace the SnaBI-PstI SUB2 fragment from pHF13-2 to form pHF15-1. Plasmid pHF124-2 was generated by inserting HIS3 into the ClaI site of pHF120, which contains the SalI-SacI fragment of SUB2 in pBS-SK. The SacI-XhoI fragment of pHF15-1 and the EcoRI-SacI fragment of pHF124-2 were used to transform the diploid yeast strain HFY2115 to generate sub21::TRP1 and sub22::HIS3 mutants, respectively. The resulting diploids were sporulated and dissected. A 2+:2 segregation for growth was observed for both diploids and no Trp⁺ or His⁺ segregants were recovered, indicating that yeast cells carrying these mutations, sub21::TRP1 and sub22::HIS3, were inviable. pHF22-3 was generated by subcloning a SalI-SacI SUB2 fragment of YEp-SUB2 into pRS316. A fragment containing the 3' untranslated region of the SUB2 gene (which was absent in YEp-SUB2) was obtained through PCR using primer oHF028 (5'AACGTTCATGGTCATATG3') and oHF032 (5'CCGGAATTCTTGAAGAAGGCCTTCACC3') and ligated into the EcoRI site of pHF22-3 to form pHF68-1 (YCp2-SUB2). Yeast strains heterozygous for sub2 alleles were subsequently transformed with YCp2-SUB2, sporulated, and dissected to generate sub21::TRP1 and sub22::HIS strains carrying YCp2-SUB2. The resulting strains were called HFY2170-6A and HFY2210-124B. pHF11-1 was constructed by restriction endonuclease digestion of hy41 with SalI and religation to remove an internal SalI fragment containing the YDL085w sequence. pHF81-4, pHF127-3, and pHF80-4 were generated by subcloning the SalI-SacI fragment of pHF68-1 into pRS315, YCplac111, and YEp351, respectively. To confirm that no changes were introduced into the SUB2 gene through PCR amplification, the SUB2 insert in pHF80-4 was completely sequenced and compared to the reported SUB2 sequence in the database. No changes were found. sub2 conditional alleles and a wild-type control SUB2 allele on the pRS315 vector (CEN6 LEU2) were kindly provided by Christine Guthrie and Amy Kistler.

Site-directed mutagenesis. sub2-112 and sub2-267 were generated using the QuikChange site-directed mutagenesis kit (Stratagene). pHF81-4 and pHF80-4 were used as templates, and oHF043, oHF044, and oHF048 as well as oHF049 were used as primers for PCRs. oHF043 (5' GCAAAGTCTGGTTTAGGTAGGACAGCTCTCTTTGTC 3') introduces an A-to-G mutation at position 335. oHF048 (5' CTTACAGAATCCATTGAAAATTTTCGTCGATGATG 3') introduces a G-to-A change at nucleotide 799. oHF044 and oHF049 are complementary to oHF043 and oHF048, respectively.

Determination of plasmid loss rates. Plasmid loss rates of strains containing pRM102 (CEN6 TRP1) and YEp351 (2µm LEU2) with no insert (YEp-vector), with a SUB2 insert (YEp-SUB2), or with a sub2-112 insert (YEp-sub2-112) were calculated as described previously (9). Briefly, cells were grown in synthetic liquid medium lacking both tryptophan and leucine to mid-log phase. Equal aliquots were taken and plated onto leucine dropout medium and tryptophan-leucine double-dropout medium to determine the percentages of plasmid (pRM102)-containing cells (P1). The culture was then diluted 1:1,000 into leucine dropout liquid medium to release the selection for pRM102 and grown to stationary phase. Again, equal aliquots were plated onto leucine dropout and tryptophan-leucine double-dropout media to determine the percentages of cells that still contained plasmid pRM102 (P2). Plasmid loss rates (m) were calculated using the equation m = 1  e^{ln (P2/P1)/g}, where g is the number of cell doublings during nonselective growth and is described by the equation g = ln (N₂/N₁)/ln 2, where N₁ equals the number of viable cells per milliliter before nonselective growth and N₂ equals the number of viable cells per milliliter after nonselective growth (viable cells are based on the number of colonies growing on leucine dropout medium).

Localization of the Sub2-HA protein. Indirect immunofluorescence was performed according to the method of Harlow and Lane (20). The Sub2-HA-tagged protein was detected with monoclonal anti-HA antibody (Babco) and visualized with Cy2-conjugated anti-mouse antibody (Jackson Laboratory). Nuclei were stained with 4',6'-diamidino-2-phenylindole (Boehringer Mannheim).

In vitro synthesis and analysis of Sub2p and Mud2p. The Sub2-HA and Mud2-Flag proteins were synthesized using the TNT reticulocyte lysate system (Promega). Immunoprecipitation was performed as described by Goto and Meyerowitz (18). Monoclonal anti-Flag antibody (1:1,000; Kodak) was used for immunoprecipitation. Polyclonal anti-HA antibody (1:1,000; Santa Cruz) was used for the Sub2-HA protein detection.

Immunoprecipitation and Western blotting. Approximately 10⁸ log-phase cells were collected for protein extracts. The cells were resuspended in 0.4 ml of ice-cold lysis buffer (50 mM HEPES-KOH [pH 7.5], 140 mM NaCl, 1.0 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate) with protease inhibitors (1.0 mM phenylmethylsulfonyl fluoride, 1.0 mM benzamidine, 0.05 mg of N-tosyl-L-phenylalanine chloromethyl ketone [TPCK] per ml, 0.25 mM N-p-tosyl-L-lysine chloromethyl ketone [TLCK], 0.01 mg of aprotinin per ml, 0.001 mg of leupeptin per ml, 0.001 mg of pepstatin A per ml, 0.002 mg of antipain per ml) and with 1/2 volume of acid-washed glass beads and kept on ice. Tubes were vortexed for 1 min and then transferred back to ice for an additional minute. This was repeated (usually 10 times) until approximately 90% of the cells were broken. The extract was separated from the beads and cell debris and stored at 4°C.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Genetic interaction between hpr1 and cdc73 mutations. Previous studies have suggested a role for HPR1 in transcription (7, 33, 34). Therefore, we examined genetic interactions between an hpr1 mutation and mutations in genes encoding transcription factors to further understand the relationship between mitotic recombination and transcription. Although both hpr1 and cdc73 single mutants are viable at 30°C, an hpr1 cdc73 double mutation is lethal at 30°C (Fig. 1) (6). Further studies uncovered similarities in the phenotypes of these two mutants. hpr1 and cdc73 strains both showed temperature-dependent growth and increased instability between directly repeated DNA sequences (Fig. 1 and Table 1) (5), with hpr1 and cdc73 mutants having increases of 700- and 70-fold, respectively, in recombination rates (Table 1). These observations suggest that Hpr1p and Cdc73p may perform similar functions in parallel pathways or work together in a complex. This prediction was verified by the finding that Hpr1p and Cdc73p are complexed together in a novel RNA polymerase II complex (6).

View larger version (27K): [in this window] [in a new window]   FIG. 1.   Suppression of growth defect associated with hpr1, cdc73, and hpr1 cdc73 strains by elevated-copy-numbers of the SUB2 gene. Wild type (HKY579-10A), hpr1 (U768-1C), cdc73 (HFY580-104), and hpr1 cdc73 (HFY2051-1D) carrying either YEp-vector (YEp351) or YEp-SUB2 (hy41) were streaked on leucine dropout plates to select for plasmids as indicated and allowed to grow at 30 or 37°C for 2 days. YEp351 is a 2µm-based vector, and hy41 contains the SUB2 gene in the YEp351 plasmid.

hpr1 cdc73

hpr1 cdc73

Increased copies of SUB2 rescue the inviability of an hpr1 cdc73 mutant. Although an hpr1 cdc73 double mutant is inviable at 30°C, it grows extremely slowly at 25°C. We used this phenotype to isolate high-copy-number suppressors by transforming an hpr1 cdc73 strain grown at 25°C with a YEp351-based high-copy-number genomic library and selecting for growth at 30°C. The YEp-SUB2 (hy41) plasmid was isolated based on its ability to restore viability to an hpr1 cdc73 double mutant at 30°C (Fig. 1). Sequence analysis of this plasmid revealed that it contains nearly the full-length coding sequence of YDL084w, lacking only a sequence encoding three amino acids at the C terminus of YDL084w, and a partial coding sequence of YDL085w (amino acid residues 27 to 535). To confirm that YDL084w and not YDL085w was responsible for the suppression, the YDL085w sequence was completely deleted from hy41. The resulting plasmid, pHF11-1, still rescued the lethality of an hpr1 cdc73 strain (data not shown). In addition, pHF80-4, a high-copy-number plasmid containing a YDL084w sequence encoding the full-length protein, behaved similarly to hy41 (data not shown). These results demonstrated that the YDL084w sequence on a high-copy-number plasmid can restore viability to an hpr1 cdc73 double mutant. YDL084w was thereafter termed SOH9 (for suppressor of hpr1), the latest in our series of hpr1 suppressors (14). We subsequently learned that the open reading frame YDL084w had been isolated as a high-copy-number suppressor of the yeast splicing mutant brr1-1 mutant and was termed SUB2 (42).

hpr1

hpr1

Suppression of hyperrecombination by an increase in SUB2 copy number. YEp-SUB2 suppresses the lethality of an hpr1 cdc73 double mutant. To determine whether SUB2 suppresses the phenotypes associated with hpr1 or cdc73 single mutants, we evaluated the effects of SUB2 on growth of hpr1 and cdc73 strains at 37°C and on recombination rates of deletion events between directly repeated DNA sequences. As shown in Fig. 1, YEp-SUB2 restored the growth of an hpr1 strain at 37°C but not the growth of the cdc73 single or hpr1 cdc73 double mutant at 37°C. Additionally, YEp-SUB2 suppressed 90% of the increased recombination observed in the hpr1 and cdc73 single mutants at 30°C (Table 1). We next determined whether Sub2p has a general influence on spontaneous or transcription-induced recombination (43) between direct repeats in wild-type strains. In contrast to what occurs with the hpr1 and cdc73 mutant strains, an increase in SUB2 copy number does not suppress the rate of spontaneous recombination in wild-type strains (Table 1) or transcription-induced recombination (Fan and Klein, unpublished). This indicates that Sub2p acts on recombination events occurring in the absence of Hpr1p or Cdc73p but not when both gene products are functional.

Additional hpr1 phenotypes suppressed by high-copy-number SUB2 We have found that hpr1 strains are compromised in the ability to retain certain YCp plasmids that carry strong yeast promoters. Figure 2 shows pRM102, which carries a 1.7-kb BamHI fragment with the HIS3 gene and fragments of the DED1 and SUP56 genes that include the promoters to these genes. The HIS3 fragment is inserted in the polylinker of the YCp plasmid pRS314. The strains also carry the empty vector YEp351 (YEp-vector) or YEp351 with a SUB2 insert (YEp-SUB2). The pRM102 plasmid is stable in wild-type strains, but stability is decreased 2.6-fold in hpr1 strains (Fig. 2, compare wt + YEp-vector to hpr1 + YEp-vector [P < 0.001]). The pRM102 plasmid has the strong DED1 promoter transcribing leftwards. Evidence that the plasmid instability is due to transcription comes from the finding that removal of the DED1 sequence or placement of a CYC1 transcription terminator sequence immediately downstream of the DED1 sequence restores plasmid stability to the level observed in wild-type strains. Insertion of the CYC1 terminator sequence decreased plasmid loss rate 7.2-fold in the hpr1 strain to an extent such that the plasmid was more stable than the pRM102 plasmid in an HPR1 strain (Fig. 2).

View larger version (27K): [in this window] [in a new window]   FIG. 2.   Plasmid instability in hpr1 strains is suppressed by high-copy-number SUB2. Wild-type (wt) and hpr1 strains were transformed with plasmid pRM102 and YEp351 with no insert or with a SUB2 insert. pRM102CYC1ter contains a CYC1 transcriptional terminator inserted into the ApaI restriction site located directly downstream of the ded1 sequence on pRM102. Plasmid loss rates were determined after transfer from selective to nonselective growth conditions for the pRM102 plasmid. Loss rates were determined as described previously (9). Plasmid loss rates were averaged from three independent experiments.

hpr1

hpr1

hpr1

hpr1

hpr1

hpr1

hpr1

hpr1

SUB2 is an essential gene and encodes a putative RNA helicase. sub2 deletion mutants were generated to determine the requirement of SUB2 for cell growth. Two sub2 disruption constructs were made and used to transform a wild-type diploid strain. Tetrad analyses of the two sub2 disruption constructs, sub21::TRP1 and sub22::HIS3, were not viable in haploid spore segregants, indicating that the SUB2 gene is indispensable for cell viability (data not shown), as previously reported by Shiratori et al. (40). To maintain the inviable sub2 mutant strains, the wild-type SUB2 gene was segregated into sub2 spore segregants as described in Materials and Methods (Fig. 3). This is consistent with the phenotype reported by Lopez et al. (25), Kistler and Guthrie (22), and Zhang and Green (52).

View larger version (50K): [in this window] [in a new window]   FIG. 3.   SUB2 is an essential gene, as illustrated by complementation of the sub2 mutants by different plasmids. Shown is the growth of SUB2 (HKY579-10A), sub21::TRP1 + YCp2-SUB2 (pHF68-1) (HFY2170-6A) and sub22:: HIS3 + YCp2-SUB2 (pHF68-1) (HFY2210-114B) on yeast extract-peptone-dextrose and FOA-containing media. To examine the effects of SUB2 or sub2 mutant alleles (on CEN vectors) in complementing the lethality of the sub21 strain, HFY2170-6A and HFY2210-114B were transformed with various plasmids. The transformants were checked for viability on FOA-containing medium. The genotype of each strain is as indicated. Strains streaked on the FOA-containing medium all carried YCp2-SUB2. Since only uracil-auxotrophic cells can grow on media containing FOA, all cells grown on the FOA-containing medium have lost YCp2-SUB2. SUB2 is an essential gene, as sub2 deletion strains failed to grow on FOA-containing medium which selects against YCp2-SUB2. YCp1-SUB2 (pHF127-3) and YCp2-sub9-267 can substitute for YCp2-SUB2 and rescue the sub2 strains, indicating that these plasmids contain a functional SUB2 fragment. YCp2-sub2-112, which contains a mutation in the ATP binding domain of the SUB2 gene, was unable to replace YCp2-SUB2, suggesting that the putative ATPase activity is necessary for the Sub2p function.

View larger version (72K): [in this window] [in a new window]   FIG. 4.   Sequence alignment of Sub2p and related proteins. Shown are sequence alignments of the S. cerevisiae Sub2p (GenBank accession number Z74132) with related proteins from S. pombe (Z99162), Drosophila (WM6/HEL, X79802), human 1 (UAP56/BAT1, Z37166), and human 2 (U90426). Sequences were aligned according to the Hotun Hein algorithm method with a PAM250 weight table using Lasergene sequence analysis software. Shaded regions contain amino acid identity. Boxed sequences represent the conserved helicase motifs.

sub2

Characterization of the Sub2 protein and mRNA. To determine the subcellular localization of Sub2p, an HA epitope was introduced at the carboxyl terminus of Sub2p, and DNA sequence encoding the Sub2-HA protein was placed downstream of the inducible GAL10 promoter. This fusion protein complemented the sub2 mutation, indicating that the HA-tagged Sub2 protein behaves like the endogenous Sub2 protein. Indirect-immunofluorescence analysis demonstrated that the Sub2-HA protein was localized to the nucleus (data not shown). The Drosophila homologue of Sub2p, WM6/HEL, was identified as a suppressor of a wee1 mik1 double mutant of S. pombe, which results in mitotic catastrophe (49), suggesting that Sub2p may play a critical role in cell cycle control. Therefore, we determined whether SUB2 expression fluctuated during the cell cycle. Northern blot analysis indicated that SUB2 produced a single transcript that was expressed constitutively throughout the cell cycle (data not shown.). This is consistent with recent reports on genome-wide analyses of yeast mRNA levels during the cell cycle (8, 41).

Sub2p interacts with Mud2p in vitro. Sub2p shows high sequence homology to the human protein UAP56/BAT1 (Fig. 4) (see also references 22, 24, and 52). UAP56 has been found to interact with U2AF⁶⁵, which is a branch point recognition protein and is involved in pre-mRNA splicing (15). The yeast Mud2 protein, which resembles the human U2AF⁶⁵ protein, also binds to pre-mRNA and is a component of the pre-mRNA-U1-snRNP complex (1). We examined Mud2p and Sub2p interaction through Flag-tagged Mud2p and HA-tagged Sub2p. In vitro-translated proteins were mixed and examined for interaction through immunoprecipitation. Figure 5A shows that Sub2-HA coimmunoprecipitated with the Mud2-Flag protein, indicating that Sub2p binds to Mud2p in vitro. Interaction of Sub2p with Mud2p has also been noted by another group (22). The interaction strengthens the thesis that Sub2 is the yeast counterpart of UAP56/BAT1. Moreover, Sub2p has recently been demonstrated to be required for pre-mRNA splicing in vitro and in vivo (22, 24, 52).

View larger version (32K): [in this window] [in a new window]   FIG. 5.   Interaction of Sub2p with Mud2p in vitro and Rpb3p in vivo. (A) Sub2-HA and Mud2-Flag proteins were synthesized in vitro using a coupled transcription and translation system. Sub2-HA and Mud2-Flag proteins were mixed and immunoprecipitated with monoclonal antibodies as indicated. Immune complexes were resolved on an SDS-polyacrylamide gel electrophoresis gel which was transferred and probed with polyclonal anti-HA antibody. Lane 4 indicated that the Sub2-HA and Mud2-Flag proteins coimmunoprecipitated. Lane 1, positive control; lanes 2 and 3, negative controls. The positions of protein size markers are indicated. (B) Coimmunoprecipitation of Sub2p and the RNA polymerase II component Rpb3. Lanes 1 and 2, Western blots of extracts from HPR1 (wt) + YEp351-SUB2-FLAG and hpr1 + YEp351-SUB2-FLAG cells. Extracts were electrophoresed on a 9% SDS-polyacrylamide gel and subjected to Western blot analysis with anti-FLAG antibodies. Lanes 4 and 6 show extracts from the strains used in lanes 1 and 2 after immunoprecipitation using mouse anti-Rpb3 antibody, goat anti-mouse with a biotin conjugate, and then streptavidin-coated beads. Lanes 3 and 5 are controls in which only the goat anti-mouse biotin conjugate and streptavidin beads were added to the same extracts. The immunoprecipitated proteins were electrophoresed on a 9% SDS-polyacrylamide gel and subjected to Western blot analysis with anti-FLAG antibodies.

Suppression of hpr1 temperature-dependent growth by loss of MUD2 MUD2 is not an essential gene, whereas SUB2 is essential. This suggests that there may be multiple roles for SUB2. In pre-mRNA splicing, Sub2p has been proposed to aid in the removal of Mud2 from the pre-mRNA-U1-snRNP complex (22). It was of interest to examine the effect of a mud2 mutation on hpr1 growth, as loss of Mud2p might free up Sub2p to participate in other activities. Figure 6 shows growth of wild-type, mud2, hpr1, and hpr1 mud2 strains at 30 and 37°C carrying the empty vector YEp-vector or the high-copy-number YEp-SUB2 plasmid. The hpr1 strain carrying only the empty vector does not grow at 37°C, but the hpr1 mud2 double mutant does show some growth at 37°C. High-copy-number SUB2 allows slightly better growth of the hpr1 mud2 strain at 37°C, showing that this suppression is independent of MUD2. This is consistent with the finding that a MUD2 deletion can bypass the cellular requirement for SUB2 function (22).

View larger version (24K): [in this window] [in a new window]   FIG. 6.   Suppression of hpr1 growth defect is MUD2 independent. Wild type (HKY579-10A), hpr1 (HFY824-1A), mud2 (RMY161-2C), and hpr1 mud2 (RMY159-11A) carrying either YEp-vector (YEp351) or YEp-SUB2 (pHF80-4) were streaked on leucine dropout plates to select for plasmids as indicated and allowed to grow at 30 or 37°C for 2 days. YEp351 is a 2µm-based vector, and hy41 contains the SUB2 gene in the YEp351 plasmid.

Effect of SUB2 on recombination. SUB2 suppresses the hyperrecombination phenotype of hpr1 and cdc73 mutants, suggesting that Sub2p may be involved in regulating recombination between direct repeats. To investigate a potential role of Sub2p in recombination, we determined the effects of varying the copy number of SUB2 on the maintenance of stability between directly repeated DNA sequences. The recombination rate of a sub2 strain containing the pHF127-3/YCp1-SUB2 plasmid (SUB2 [full-length] CEN4) was found to be increased relative to a wild-type strain containing a YCp empty vector (Table 2). This indicates that, although YCp1-SUB2 rescues the lethality of a sub2 strain (Fig. 3), it is unable to fully complement all aspects of Sub2p function, including rescue of hpr1 growth at 37°C. Indeed, a similar result was obtained when SUB2 was carried on another CEN-based plasmid (CEN6), plasmid YCp2-SUB2 (Fan and Klein, unpublished). We do not know the basis of the lower-copy-number SUB2 recombination phenotype. It may be related to titration of Sub2p by Mud2p. We do not believe that our plasmid versions of SUB2 are missing important transcriptional or translational regulatory elements, although this is always a formal possibility. We have reproduced the hyperrecombination phenotype with a wild-type SUB2 CEN-based plasmid (p297) obtained from C. Guthrie (Table 3). The SUB2 insert in p297 contains more upstream and downstream sequences than does the pHF127-3 SUB2 insert. Increasing the copy number of SUB2 in a wild-type strain had no effect on recombination rates.

sub2

sub2

sub2

4

4

hpr1

hpr1

sub21

sub21

mud2

sub2 mud2

mud2

hpr1

hpr1

hpr1

sub21 hpr1

Interaction of Sub2p with the RNA polymerase II transcription complex. Since sub2 mutants have recombination phenotypes similar to that of the hpr1 mutant, high-copy-number SUB2 suppresses hpr1 mutant phenotypes and Hpr1p is found in an RNA polymerase II complex, it was of interest to determine whether we could find Sub2p associated with an RNA polymerase II complex. We used FLAG-tagged Sub2p in coimmunoprecipitation reactions with anti-RPB3. Rpb3p is a subunit of RNA polymerase II. We were able to detect Sub2-FLAG in a coimmunoprecipitate in an hpr1 strain but not in the isogenic HPR1 strain (Fig. 5B). This suggests that Sub2p may substitute for Hpr1p in the RNA polymerase II complex.

Involvement of the Sub2 protein in transcriptional repression at telomeres. The HEL/WM6 protein, the Drosophila homologue of Sub2p, was also identified through a mutation that enhanced position effect variegation (PEV) (12). PEV is the change in gene expression levels when a euchromatic gene is translocated adjacent to heterochromatic regions, from variations in the extent of propagation of heterochromatin-associated proteins into euchromatic structures (for a recent review, see reference 47). The chromatin structure at telomeres and the silent MAT loci can be considered heterochromatin in S. cerevisiae. The silencing of sequences adjacent to telomeres is called telomere position effect in yeast cells. We examined gene expression at the telomeric regions and at the HMR locus in sub21 strains carrying the YCp1-SUB2 plasmid, using the reporters adh4::URA3-TEL and hmr::TRP1. In wild-type cells, chromatin structure at these two regions results in transcriptional silencing (4, 19); therefore, cells are Ura (growth on FOA-containing media) and Trp. Strains were allowed to grow on leucine dropout medium to maintain the SUB2-containing plasmids. The amount of growth on an FOA-containing leucine dropout plate indicates the expression level of the reporter gene URA3, while growth on the leucine dropout plate indicates the relative growth rates and the total number of cells plated for each dilution. All strains grew equally well on a leucine dropout plate (Fig. 7A). Wild-type cells carrying YCp1-SUB2 grew as well on FOA plates as did wild-type strains carrying the YCplac111 vector (Fig. 7B), indicating that an increase in SUB2 copy number did not influence transcriptional silencing at telomeres to a noticeable level. Interestingly, the number of colonies of the YCp1-SUB2-containing sub2 strain that grew on a FOA plate was reduced compared to that of the wild-type strain carrying YCp1-SUB2, indicating an involvement of SUB2 in the maintenance of a transcriptionally repressed chromatin state at telomere regions. Control experiments using a sub2 URA3 + YCp-SUB2 strain showed that this genotype had no effect on growth on 5-FOA-containing medium, the URA3 allele being located at the normal URA3 locus on chromosome V. The influence of SUB2 on telomere position effect could be indirect through altered splicing of genes that more directly affect this process.

View larger version (25K): [in this window] [in a new window]   FIG. 7.   Involvement of Sub2p in transcriptional silencing at telomeres. Serial dilutions of yeast strains were plated on a leucine dropout plate (A) or an FOA-containing leucine-dropout medium (B). Leucine dropout medium selects for cells containing plasmids, and FOA selects against Ura+ cells. Lanes 1 and 2, wild-type cells containing YCp1-vector (YCplac111) and YCp1-SUB2 (pHF127-3), respectively. Lane 3, sub2 cells carrying YCp1-SUB2. All the above strains contain the telomere-silencing assay system adh4::URA3-TEL. The ratio of the number of cells grown on panel B to the number of cells grown on panel A is slightly decreased in lane 3 compared to lanes 1 and 2.

sub2

sub21

sub21

Mutual suppression of HPR1 and SUB2 Overexpressing HPR1 did not rescue sub2 lethality, indicating that Hpr1p, even in excess, cannot substitute for the essential function of Sub2p (Fan and Klein, unpublished). We then evaluated the influence of overexpressing HPR1 on the increased recombination rate observed in a sub21 strain with YCp1-SUB2. Interestingly, YEp-HPR1 (pHF136-3/[HPR1, 2µM]) was able to suppress the hyperrecombination phenotype of the sub21 + YCp1-SUB2 (SUB2 CEN) strain (Table 4). Therefore, an increase in the amount of Hpr1p can compensate for the function of Sub2p in stabilizing directly repeated DNA sequences, although it cannot fulfill the essential function of Sub2p.

hpr1

hpr1

hpr1

6

6

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

In this study we have shown that hyperrecombination phenotypes associated with mutations in the transcription components HPR1 and CDC73 can be suppressed by increased expression of a gene linked to pre-mRNA splicing. This surprising action of a putative RNA helicase factor in genome stability gains further support from our observation that conditional alleles and the null allele of SUB2 result in greatly increased repeat instability or hyperrecombination. The convergence of transcription components and the putative splicing factor to ensure genomic stability suggests that different protein machines may act together or redundantly to avoid damage to the DNA template and that the splicing machinery is closely associated with the RNA polymerase II transcription machinery.

The transcription machinery acts to repress genome instability. Our results offer direct evidence that defects in the transcriptional machinery can be a source of genome instability. First, we have found that the cdc73 mutant, similar to the hpr1 mutant, displays a hyperrecombination phenotype. Second, we have observed a novel interaction between the hpr1 mutant and the transcription factor cdc73 mutant in that the hpr1 cdc73 double-mutant is a temperature-sensitive lethal. This genetic interaction is distinct from previous results in which transcription mutants were shown to suppress hpr1-associated phenotypes (13, 33, 36, 44). The lethality indicates that these two proteins together carry out an essential biological process or that they are redundant with an essential function that fails to function at high temperature. Cdc73p and Hpr1p have been found together in a complex (5, 6), and Cdc73p has been demonstrated to interact with the C-terminal domain of the largest subunit of RNA polymerase II (39). We do not yet know if Sub2p is found associated with the Hpr1p/Cdc73p complex, particularly when SUB2 is overexpressed. Although absence of either Hpr1p or Cdc73p from a transcription-related complex leads to an increase in genome instability, when both proteins are missing this complex may be crippled and cell death is the result. Alternatively, the hpr1 and cdc73 mutations may act synergistically to increase genome instability to such an extent that cell growth cannot be supported. Third, we show that plasmid instability in an hpr1 strain is directly linked to transcription of a plasmid segment since inhibition of transcription with a transcription terminator restores plasmid stability.

Biological function of the Sub2 protein. Sub2p is the closest yeast homologue to the human UAP56/BAT1 protein (11) and is suggested to function as an ATP-dependent RNA helicase in pre-mRNA splicing. In vivo and in vitro splicing are dependent on Sub2p (22, 24, 52). The amino acid sequence of Sub2p suggests that it is an ATP-dependent RNA helicase, and we have demonstrated the importance of the putative ATPase activity for its essential function by site-directed mutagenesis. The involvement of Sub2p in splicing is also supported by the interaction that we and others (22) have observed between Sub2p and Mud2p, a protein required for RNA splicing in yeast cells. Furthermore, overexpression of SUB2 has been found to suppress the brr1-1 mutant, which is defective in splicing (42).

hpr1

hpr1

sub21

sub21

hpr1

sub2

sub2

sub2

sub21

sub21 mud2

Genetic interactions between SUB2, HPR1, and CDC73 The hyperrecombination phenotypes and the genetic interactions between hpr1, cdc73, and SUB2 show that the Hpr1p-Cdc73p complex and Sub2p have some degree of functional overlap, representing two activities that can influence genome stability. The recombination rates of the hpr1 sub2 + YCp-sub2 strains with the conditional sub2 mutant alleles are not additive or synergistic but rather show rates close to the sub2 mutant rate (except for p322 sub2-1) (Table 3). This suggests that both hpr1 and the sub2 mutants contribute to repeat instability in a single process. The finding that the SUB2 hyperrecombination can be suppressed by high-copy-number expression of HPR1, similar to SUB2 high-copy-number suppression of hpr1 hyperrecombination, strengthens this view. We have also shown that lack of Cdc73p leads to hyperrecombination, and this phenotype too can be suppressed by increasing the copy number of SUB2.

Mechanism of Hpr1p-Cdc73p and Sub2p function. Absence of Hpr1p or Cdc73p or partial function (in the conditional alleles) or complete loss of function (the sub2 mud2 genotype) of Sub2p leads to hyperrecombination between direct repeats. Evidence accumulated thus far indicates that Hpr1p and Cdc73p function during transcription. The mutual suppression of hyperrecombination suggests that Hpr1p and Sub2p functions are intimately related in their ability to maintain genome stability. The hyperrecombination phenotype associated with hpr1 mutants has been suggested to originate in blocked transcription elongation (13, 34). Since the effect of SUB2 on repeat instability is MUD2 independent, we suggest that free Sub2p can have functions outside of pre-mRNA splicing. One of these functions may be to aid in transcription elongation as an RNA helicase. We suggest that during elongation Hpr1p aids in avoiding transcription pauses, possibly by removing accumulated secondary structures in the nascent RNA. In the absence of Hpr1p, available free Sub2p may be able to remove transcription blocks through the RNA helicase activity, removing the secondary structure. This could explain the mutual high-copy-number suppression by HPR1 and SUB2 and the absence of synergism or additivity in recombination rates. The transcription blocks, if not removed by Hpr1p or Sub2p, are eventually processed into recombination substrates. Indeed, it has been proposed that deletions between direct repeats may result from the convergence of a stalled transcription complex with a DNA replication complex (32, 45). We suggest that the action of Hpr1p is during elongation and not splicing, as no defect in splicing is observed in the hpr1 mutant (37).

sub2

sub21