Previous Article | Next Article 
Molecular and Cellular Biology, August 2001, p. 5541-5553, Vol. 21, No. 16
Department of Biological Chemistry,
University of California
Received 26 March 2001/Returned for modification 8 May
2001/Accepted 21 May 2001
At the end of the 35S rRNA gene within ribosomal DNA
(rDNA) repeats in Saccharomyces cerevisiae lies an
enhancer that has been shown to greatly stimulate rDNA transcription in
ectopic reporter systems. We found, however, that the enhancer is not necessary for normal levels of rRNA synthesis from chromosomal rDNA or
for cell growth. Yeast strains which have the entire enhancer from rDNA
deleted did not show any defects in growth or rRNA synthesis. We found
that the stimulatory activity of the enhancer for ectopic reporters is
not observed in cells with disrupted nucleolar structures, suggesting
that reporter genes are in general poorly accessible to RNA polymerase
I (Pol I) machinery in the nucleolus and that the enhancer improves
accessibility. We also found that a fob1 mutation
abolishes transcription from the enhancer-dependent rDNA promoter
integrated at the HIS4 locus without any effect on
transcription from chromosomal rDNA. FOB1 is required
for recombination hot spot (HOT1) activity, which also
requires the enhancer region, and for recombination within rDNA
repeats. We suggest that Fob1 protein stimulates interactions between
rDNA repeats through the enhancer region, thus helping ectopic rDNA
promoters to recruit the Pol I machinery normally present in the nucleolus.
The transcription of large rRNAs in
most eukaryotes takes place in a subnuclear structure, the nucleolus,
using a distinct RNA polymerase, RNA polymerase I (Pol I). The
ribosomal DNA (rDNA) encoding the large precursor rRNA is tandemly
repeated in many copies and constitutes the structurally and
functionally essential component of the nucleolus. In addition to the
transcription of rDNA, subsequent steps, such as rRNA processing and
modification and ribosome assembly, all take place within the
nucleolus. Furthermore, several important cellular functions distinct
from ribosome synthesis appear to take place in the nucleolus, as
exemplified by the recent discovery of the presence of proteins in the
nucleolus regulating cell cycle progression in mitosis (reviewed in
references7 and 21). In addition, there are
unique mechanisms regulating the replication and recombination of the
tandemly repeated rDNA genes, and proteins involved in these processes
are also expected to be present in the nucleolus. An example is the
presence of a replication fork barrier (RFB) near the end of every rRNA
transcription unit, which might play a role in preventing collision of
the Pol I transcription machinery with the DNA replication machinery
(2). Thus, studies on rDNA transcription in vivo may have
to deal with nucleolar structures relevant to other nucleolar functions.
In the yeast Saccharomyces cerevisiae, there are ~150
rDNA tandem repeats located on chromosome XII. Each repeat is
~9.1 kb in size and contains the large 35S rRNA gene transcribed by
Pol I and the small 5S rRNA gene transcribed by Pol III (Fig.
1). This study examines the function of
the Pol I enhancer element, which was originally identified by Elion
and Warner (5, 6). These workers reported that a 190-bp
DNA element just distal to the 35S rRNA coding region (shown in Fig.
1A) gave a large stimulation of Pol I transcription in experiments
using an rRNA reporter gene carried on a CEN plasmid. Hence, this
element is called the enhancer of Pol I activity. Subsequently, many
papers on the enhancer were published, generally confirming the Pol I
stimulatory activity using various reporter systems, but as to the
exact DNA sequence element within this enhancer region, different
investigators reported somewhat different conclusions
(39). In addition, while the enhancer activity was even
reported to be observed in vitro (29), the mechanism of
stimulation of Pol I activity by the yeast enhancer and its
physiological significance have remained unclear.
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.16.5541-5553.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Yeast RNA Polymerase I Enhancer Is Dispensable for
Transcription of the Chromosomal rRNA Gene and Cell Growth, and
Its Apparent Transcription Enhancement from Ectopic Promoters
Requires Fob1 Protein
Irvine, Irvine, California
92697-1700,1 and National Institute
for Basic Biology, Okazaki 444-8585, Japan2
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
View larger version (27K):
[in a new window]
FIG. 1.
(A) Structure of rDNA repeats in S.
cerevisiae. One repeat unit of rDNA is 9,137 bp and is numbered
with respect to the Pol I transcription start site (+1). By convention,
one repeat unit is shown as the fragment obtained after digestion of
rDNA with SmaI, between positions 8931 and 8932. The
locations of the 35S and 5S rRNA genes (black bars; the direction of
transcription indicated by arrows), the two nontranscribed spacer
regions (NTS1 and NTS2), and enhancer and RFB regions are shown. The
orientation with respect to the centromere (CEN) and telomere (TEL) is
indicated. Although the enhancer studied by Elion and Warner (5,
6) is the ~190-bp EcoRI
(6743)-HindIII (6931) region, subsequent studies on the
HOT1 system showed that the ~130-bp
HindIII (6931)-HpaI (7060) region (called
the RFB region [see the text]) is also required for efficient Pol I
transcription in this system, and the 320-bp
EcoRI-HpaI region was called the E
element. Following this nomenclature, we define the enhancer and the E
element as shown in the figure, even though the entire E element may
represent an enhancer. The three restriction sites used to define these
regions are indicated. Other EcoRI,
HindIII, and HpaI sites are not shown.
The I element required for the HOT1 activity is also
indicated. In addition, restriction sites for XbaI (X)
and the fragment used as a probe (P) (thin black bar) relevant to
experiments shown in Fig. 2B are indicated. (B) Structures of pNOY373
(pPol I), pNOY454 (an E deletion [ 
E] derivative of pNOY373), and
pNOY130 (pPol II). (C) PCR analysis of genomic DNA showing that the E
element was deleted in rdn strain NOY906. DNA was
isolated from strains NOY505 (wild type [WT]), NOY903 (pPol I),
NOY906 (pPol IE), and NOY892 (pPol II) and subjected to
PCR analysis using two primers outside the E element as indicated by
arrowheads 1 and 2 in panel A. The NOY505 and NOY903 genomic DNA
samples (lanes 1 and 2) yielded the 1.1-kb PCR product. The NOY906
sample (lane 3) yielded the 0.8-kb PCR product, confirming the absence
of the E element. As references, plasmids pNOY373 (pPol I), pNOY454
(pPol IE), and pNOY130 (pPol II) were also subjected to PCR analysis
(lanes 6, 7, and 8, respectively). As expected, pPol II plasmid (lane
8) and rdn strain NOY892 (lane 4) did not yield
any PCR product, because they did not contain DNA sequence
corresponding to primer 2. Lane 5 contains size markers (M).
Stimulation of Pol I transcription by the enhancer was also observed in connection with HOT1 activity in yeast. HOT1 was originally identified as a DNA element that stimulates genetic recombination at nearby regions when inserted at a non-rDNA site (11). HOT1 activity requires the I element, which corresponds to the rDNA promoter, and the E element, which includes the enhancer studied by Elion and Warner (5, 6) and the adjacent 130-bp region (the RFB region [Fig. 1A]). Extensive studies have demonstrated that the E element greatly stimulates transcription originated from the I element and that the resultant high level of transcription is correlated with the stimulation of recombination (9, 32). The 130-bp region of the E element was not studied by Elion and Warner (5, 6) for stimulation of Pol I transcription but was shown to be required for both Pol I stimulation and HOT1 activities (nomenclature for DNA elements with the enhancer activity used in this paper discussed in the legend to Fig. 1). This 130-bp region overlaps the region containing the RFB site(s) mentioned above, which allows progression of DNA replication in the direction of 35S rDNA transcription, but not in the opposite direction (3, 13). Because pausing of a replication fork is known, at least in bacterial systems, to stimulate both DNA double-strand breakage and genetic recombination (reviewed recently in reference 26), replication fork pausing at the RFB site could explain stimulation of recombination in the HOT1 system. In fact, based on their discovery of the FOB1 gene, which is required for both RFB activity and HOT1 activity, this model was proposed by Kobayashi and Horiuchi (14) as an alternative to the original explanation of HOT1 activity being solely a consequence of high-level transcription from the Pol I promoter. However, it was recently demonstrated that HOT1 activity can take place in the absence of replication fork blocking (38). Thus, the reason why both HOT1 and RFB activities require FOB1 has become a challenging question.
In this paper, we first describe our experiments examining the proposed function of the Pol I enhancer directly by measuring synthesis of rRNA and its function to support cell growth, rather than using reporters fused to the Pol I promoter as was done previously. We found that, contrary to the general belief, the enhancer is not directly involved in rDNA transcription by Pol I, and that deletion of the entire enhancer element from the yeast genome does not produce any significant negative effects on rDNA transcription or cell growth relative to those of control strains with the enhancer. We then describe experiments designed to explain why earlier experiments using various reporter systems led to the conclusion that the enhancer element stimulates transcription. Our results demonstrate that the enhancer element is required in ectopic reporter systems to recruit Pol I and Pol I-specific factors, which are localized mostly in the nucleolus, and that FOB1 plays an important role in this process. Some relevant earlier observations such as the requirement of FOB1 for HOT1 activity are discussed in light of these new findings.
| |
MATERIALS AND METHODS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Media, strains, plasmids, and genetic methods. YEPD medium contains 1% yeast extract, 2% peptone, and 2% glucose. YEPGal medium is the same as YEPD medium except 2% galactose was substituted for glucose. Synthetic glucose (SD) medium (2% glucose, 0.67% yeast nitrogen base) was supplemented with tryptophan and required bases as described by Sherman et al. (30) and is called SD complete medium. Synthetic galactose (SGal) medium is the same as SD medium except 2% galactose was substituted for glucose. Cells were grown at 30°C.
The yeast strains and plasmids used in this study are described in Table 1. Plasmid pNOY454 carrying an E-element deletion was constructed from pNOY373. This plasmid carries the XhoI site (CTCGAG; positions 6738 to 6743) and NotI site (CGGCCG; positions 7068 to 7073) flanking the E element (37). The plasmid was digested with XhoI and NotI, blunt ended with T4 DNA polymerase, and ligated with T4 DNA ligase. In the resulting plasmid, pNOY454, the entire E element has been deleted and the XhoI site has been regenerated. Deletion of the E element in pNOY454 and in strain NOY906 was confirmed by PCR analysis with a primer set, primers 1 and 2. Primer 1, GGGTACTGGCAGGAG, hybridizes 76 bp upstream of the E-element EcoRI site at position +6744. Primer 2, TTTGGATCCGAGTAGTGTAGTGGGTGAC, hybridizes 762 bp downstream of the E-element HpaI site at position +7062 (Fig. 1A). Construction of strain TAK201, which has all the rDNA repeats deleted except for two copies of the 35S rRNA gene (Fig. 2), was described previously (15) together with construction of strains TAK312 and TAK314. An outline of the method is included in Fig. 2A. TAK312 carries approximately 70 rDNA repeats, in which the enhancer is deleted from all copies except for one at the centromere-proximal boundary (Fig. 2A). This last copy was replaced with TRP1 by transformation using a DNA fragment which carries the TRP1 gene flanked by two DNA sequences, one ~500 bp downstream and the other ~300 bp upstream of this last enhancer copy (190-bp EcoRI-HindIII). TAK401 is one of Trp+ transformants obtained in this way, whose structure is shown in Fig. 2A. Deletion of the last enhancer was confirmed by PCR using two primers flanking this enhancer. Like TAK312, TAK401 also carries approximately 70 rDNA repeats as judged by contour-clamped homogeneous electric field electrophoresis. Strains TAK320, TAK321, TAK322, and TAK323 were constructed as described previously (14). The HOT1 DNA, which consists of the ~250-bp SmaI-EcoRI fragment (I element) and the ~320-bp EcoRI-HpaI fragment (E element) (32), is inserted within the BIK1 gene, which is adjacent to HIS4, in TAK320 and TAK321. The HOT1 recombination system constructed in this work was similar to that used by Voelkel-Meiman et al. (35). Stimulation of recombination by HOT1 was confirmed by measuring the frequency of Ura
cells using SD
complete medium with and without 5-fluoroorotic acid (5-FOA) as
described previously (14). Strains NOY1003 and NOY1004
were constructed from TAK320 and TAK322, respectively, by replacing the
RAD52 coding region by a DNA containing LEU2.
|
|
E), and
0.6 and 1.2 µg were used to determine the amounts of the 5' end of
35S rRNA as indicated. Radioactive bands visualized by a PhosphorImager
are shown in the gel, and the results of quantification (in arbitrary
units) are shown in the graph.
Other procedures. Analysis of RNA synthesis by [3H]uridine or [14C]uracil incorporation was performed as described previously (18). Northern analysis of RNA and Southern analysis of DNA were done by standard procedures (27). T7 reporter transcripts from plasmids YCprR8 (rR8) and YCprR10 (rR10) were detected with a 32P-labeled antisense riboprobe prepared with pSP-T7(+) by the method of Johnson and Warner (10). Analysis of the 5' end of 35S rRNA by primer extension was performed by using a 32P-labeled primer which hybridizes to the 35S rRNA external transcribed spacer as described previously (36). Analysis of transcript from the Pol I promoter in the HOT1 system was done with the primer described by Stewart and Roeder (32) which is complementary to chromosomal sequences downstream from the site of HOT1 insertion. Autoradiograms were quantified with a PhosphorImager (Molecular Dynamics, Sunnyvale, Calif.).
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Enhancer deletion in rdn strains.
We have
previously constructed yeast strains in which all the chromosomal rDNA
repeats had been deleted (which we will call rdn
here). Growth is supported by a helper plasmid carrying, in
addition to the 5S rRNA gene, either the 35S rRNA gene transcribed from
the native promoter by Pol I (Pol I plasmid or pPol I) or the
35S rRNA gene fused to the GAL7 promoter for transcription by Pol II (Pol II plasmid or pPol II). This system has made it possible
to assess the expression of rDNA by measuring the actual rRNA
synthesized and its ability to support cell growth, rather than by
using reporter mini-rDNA genes (19, 37). Two Pol I plasmids, one with the 320-bp E element (pNOY373) and one without the
320-bp E element (pNOY454), were constructed (Fig. 1B) and introduced
into rdn strain NOY892, which carries a Pol II plasmid (pNOY130). The growth of NOY892 without the Pol I plasmid (or with only
the control vector plasmid) can take place only on galactose, but not
on glucose, because cell growth depends on the synthesis of 35S rRNA
from the GAL7-35S rDNA fusion gene on the Pol II
plasmid (Fig. 3A). As expected,
introduction of the control Pol I plasmid, pNOY373, allowed the strain
to grow on glucose. To our initial surprise, the Pol I plasmid with the
E-element deletion (E) also allowed growth on glucose (Fig. 3A). No
differences in colony size (Fig. 3A) or growth rate measured in liquid
culture (in YEPD or YEPGal medium) for the two strains were observed
(Table 2). We measured plasmid copy
numbers in these strains and found no significant difference between
the two strains (70 to 100 copies per genome in both strains). We have
also confirmed the complete absence of the E element in DNA from the
strain carrying the E Pol I plasmid by PCR using two primers
flanking the E element (Fig. 1A and C).
|
|
strains was reduced
somewhat relative to that in the wild-type strain which does not have
the rdn deletion (consistent with a small reduction in their
growth rates), no further decrease due to the E-element deletion was observed (Table 2). (In fact, total [3H]uridine
incorporation was slightly higher [~28%] in the E-element deletion
strain. The significance of this slight increase was not studied.)
Analysis of radioactive RNAs by gel electrophoresis demonstrated that
there was no significant difference in the synthesis of rRNAs relative
to that of total RNA in the two rdn strains, one with
and one without the E element (Fig. 3B, lanes 4, 6, and 8). The amounts
of the unstable 5' end of 35S precursor rRNA, which reflect rDNA
transcription rates by Pol I, in the cells were also measured by primer
extension. Again, no significant difference was observed between the
two rdn strains (Fig. 3C). We conclude that the
absence of the E element on helper Pol I plasmid in
rdn strains causes no significant decrease in rDNA transcription rate and does not lead to a decrease in the growth rate
of the cells.
Growth and rDNA transcription in a strain in which the enhancer is removed from all the chromosomal rDNA repeats. In connection with analyses of cis elements required for chromosomal rDNA repeat expansion, we constructed a yeast strain in which most of the rDNA repeats are deleted, leaving two copies of rDNA covering the 5S-NTS2-35S region and a single copy of the intact NTS1 between the two copies. Growth of this strain is supported by the presence of the helper Pol II plasmid pNOY353 (15) (Fig. 2A). This strain is made fob1 by deletion to prevent FOB1-dependent repeat expansion. Thus, it was possible to perform mutagenesis of the intact NTS1 region first and then expand the rDNA containing the desired mutation by introduction of FOB1 on a plasmid by transformation. It was shown that the RFB region is essential for repeat expansion whereas the enhancer is not essential but has a stimulatory role. Substitution of the 190-bp EcoRI-HindIII corresponding to the enhancer with a URA3 fragment allowed repeat expansion, although the rate of expansion was reduced. Strain TAK312 was obtained in this way and was shown to have approximately 70 copies of the expanded rDNA repeats with the coamplified URA3 fragment replacing the enhancer (15) (Fig. 2A). Because there is a single enhancer copy present at the centromere-proximal boundary of the rDNA and this copy was not deleted in strain TAK312, strain TAK401 was constructed from TAK312, replacing this last copy of the enhancer with TRP1 (Fig. 2A). Control strain TAK314 was constructed following the same steps but without the mutational substitution of the enhancer and had approximately the same number (~70) of rDNA repeats. Following the rDNA repeat expansion, loss of the FOB1-containing plasmid was selected in order to stabilize rDNA repeat numbers. The helper Pol II plasmid was spontaneously lost because the chromosomal rDNA repeat expansion allowed these strains to grow in its absence. The substitution of the enhancer by URA3 in all the expanded rDNA repeats in TAK312 was demonstrated previously (15) and was confirmed by a different Southern analysis of genomic DNA prepared from TAK401 in this study (Fig. 2B).
Strain TAK401 essentially had the same growth rate and rRNA accumulation rate as the control strain (TAK314) (Fig. 2C and other data not shown). The rates of rDNA transcription in TAK401 and TAK314 were also compared by measuring the amounts of the unstable 5' end of 35S rRNA by primer extension, as was done in the experiment shown in Fig. 3C. No significant difference was observed between the two strains, TAK401 and TAK314 (Fig. 2D). These results are consistent with the conclusion obtained using the rdn strains
described above, and it appears that the enhancer element is not
required for rDNA transcription even in the context of the normal
tandemly repeated rDNA structure on chromosome XII.
Plasmid Pol I reporter genes with and without the enhancer.
We
obtained two CEN/ARS plasmids carrying the Pol I reporter genes used in
the original Pol I enhancer experiments (5, 6), rR8 and
rR10, from J. R. Warner. These plasmids carry a fragment of
Escherichia coli phage T7 DNA fused to the rDNA promoter together with the upstream NTS1-5S-NTS2 region. Plasmid rR10 retains the intact NTS1, but plasmid rR8 has the enhancer element deleted (Fig.
4A). The two plasmids were individually
introduced into our standard wild-type strain NOY505 by transformation.
Several independent Ura+ transformants obtained
after introduction of rR8 and those obtained after introduction of rR10
were examined. The expression of the T7 reporter was analyzed by
Northern blotting (see the legend to Fig. 4 for details).
|
strains, one carrying a helper Pol I plasmid
(NOY908) and the other carrying helper Pol II plasmid (NOY891).
Although there was some variability in the expression of the T7
reporter gene among individual transformants derived from the
rdn strain carrying pPol I, there was no
significant difference between the rR8 and rR10 transformant groups,
and the expression in those transformants (both rR8 and rR10) was in
general higher than in rR10 transformants derived from the
wild-type strain (Fig. 4B, lanes 4 and 5). When rR8 or rR10 was
introduced into the rdn strain carrying pPol II , the
reporter T7 expression was strikingly high in both rR8 and rR10
transformants (Fig. 4B, lanes 6 and 7), and there was essentially no
significant variability among independent transformants. Reporter T7
expression was nearly 100-fold higher than that in rR8 or rR10
transformants derived from a rdn strain carrying pPol
I. There was no significant difference in the reporter expression for
rR8 and rR10.
FOB1 is required for Pol I transcription in a HOT1 system at the HIS4 region. Another reporter system where stimulation of Pol I transcription by the enhancer has been well studied is the HOT1 system constructed at the HIS4 region on chromosome III (9, 32). A requirement for the E element in both Pol I transcription and stimulation of recombination has been clearly demonstrated. In addition, it is known that HOT1 activity, i.e., stimulation of recombination, requires FOB1. Thus, we considered the possibility that stimulation of Pol I activities in such a system, which utilizes a reporter promoter present outside the nucleolus, may require FOB1.
We constructed a HOT1 system at the HIS4 locus of chromosome III which is similar to the system used by Roeder and coworkers in their studies on HOT1 stimulation of recombination (32, 35). This system consists of a direct repeat of (truncated) HIS4 DNA which was inserted downstream of the HOT1-initiated transcription site as shown in Fig. 5A. In this system, recombination between the HIS4 repeats is measured by loss of the intervening URA3 marker, resulting in resistance to 5-FOA. As shown in Fig. 5B (and other results not shown), the frequency of recombination between direct repeats was increased by the presence of the HOT1 DNA by 20- to 100-fold. This HOT1-dependent stimulation of recombination was abolished by a deletion of FOB1, confirming the previous observations (14).
|
FOB1-dependent Pol I transcription in the HOT1 system does not require RAD52. FOB1 is known to be required for efficient recombination within rDNA repeats (4, 12). Therefore, there was the possibility that the HOT1 element, the Pol I promoter plus the E element, on chromosome III was integrated into the rDNA repeats on chromosome XII using homologous recombination, which could be the basis for the requirement of FOB1 for efficient Pol I transcription in the HOT1 system. Such a scenario seems unlikely, since a homologous recombination between the two chromosomes would yield a dicentric chromosome and an acentric chromosome due to the orientation of the HOT1 element used in the present experiments (Fig. 1A and 5A). In addition, examination of the HIS4 gene by fluorescence in situ hybridization using a specific HIS4 probe showed no significant difference in the location of the HIS4 gene with respect to the nucleolus in strains with and without the HOT1 element at the HIS4 region; in a majority of cells, the HIS4 gene was localized outside the nucleolus in both types of strains (M. Oakes and M. Nomura, unpublished data). Nevertheless, the possibility of recombinational events between the two chromosomes in a small fraction of cells could not be excluded. Therefore, we examined whether FOB1-dependent Pol I transcription in the HOT1 system required RAD52. The RAD52 gene product is required for most homologous recombinational events (reviewed in reference 31) including recombination within the rDNA repeats that leads to production of extrachromosomal rDNA circles (20) and rDNA repeat expansion (T. Kobayashi, unpublished data). As shown in Fig. 5C (compare lane 9 to lane 5; for quantitative comparison, see the figure legend), deletion of RAD52 did not decrease the transcription from the Pol I promoter in the HOT1 system. Thus, we conclude that the E-element (enhancer)-dependent Pol I transcription in the HOT1 system does not involve RAD52-mediated homologous recombination; that is, the FOB1-dependent Pol I transcription in this system appears to take place almost certainly without integration of the HOT1-HIS4 region into the chromosomal rDNA repeats.
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
The yeast Pol I enhancer is dispensable for Pol I
transcription.
The experiments described in this paper demonstrate
that the yeast Pol I enhancer, which has been assumed to be important for rDNA transcription, is completely dispensable for rDNA
transcription and cell growth. First, rdn strains with
all chromosomal rDNA deleted and carrying a helper Pol I plasmid did
not show any significant differences in rRNA synthesis rate or cell
growth rate, regardless of whether the single rDNA repeat on the
plasmid had a complete deletion of the enhancer (together with the
adjacent RFB region). Second, a yeast strain was constructed in which
approximately 70 copies of an rDNA unit were tandemly repeated at the
natural RDN1 locus of chromosome XII, but all the enhancer
elements were deleted, a terminal copy replaced by a TRP1
fragment and all others replaced by a URA3 DNA
fragment. No significant difference in rRNA synthesis rate or
cell growth rate was observed between this strain and a control strain
without the enhancer deletion.
strains, especially in the rdn strain carrying pPol II. In these strains, no significant difference was observed between reporter plasmids with and without the enhancer. It was previously shown that in rdn strains, the crescent nucleolar
structure does not exist; in the case of the helper Pol I plasmid, many mininucleoli with Pol I and Pol I factors are formed and preferentially localized to the nuclear periphery. In the case of the helper Pol II
plasmid, helper plasmid molecules apparently coalesce, forming one (or
two) round nucleolus at a more internal location(s) (19).
In the latter case, both Pol I and Pol I factors are spread throughout
most of the nuclear region without colocalization with the Pol II-type
nucleolus (19). Thus, in the rdn strains
carrying pPol II, both rR8 and rR10 plasmids may be equally accessible to Pol I and Pol I factors, and without any competition with
other DNA elements for the use of Pol I and Pol I factors, expression of the T7 reporter gene may be maximal. The results suggest a correlation between stimulation of Pol I transcription by the enhancer
for the plasmid reporter system and the presence of an intact nucleolar
structure. It should be noted that plasmids carrying the rDNA reporter
gene are introduced into the wild-type cells by transformation using
the URA3 gene (or other Pol II genes) for selection.
Therefore, it appears likely that these plasmids take a subnuclear
localization outside the nucleolus (as was found by fluorescence in
situ hybridization; Oakes and Nomura, unpublished), that the
efficiency of recruitment of Pol I and Pol I factors is low, and that
the enhancer somehow increases this efficiency. The variability of the
reporter gene expression among transformants in the wild-type
background, but not in rdn strains carrying pPol II,
might also be explained on the basis of heterogeneity in subnuclear
localization of the reporter plasmids.
Another system we used to study the Pol I enhancer is a HOT1
system similar to the HOT1 system in which the requirement
of the E element for Pol I transcription was established
(32). We have discovered that a fob1 mutation
abolishes Pol I transcription in this ectopic system without any effect
on the transcription of chromosomal rDNA. The HOT1 system
analyzed was integrated at the HIS4 region of (heterologous)
chromosome III, which is localized outside the nucleolus. Thus, we
would expect that the Pol I promoter in this HOT1 system to
be poorly accessible to the Pol I transcription machinery. In fact, we
have found that without some special mechanism, which apparently
requires both the enhancer and the Fob1 protein, transcription from
this ectopic Pol I promoter is extremely inefficient. It was previously
observed that the effect of the enhancer was higher when the T7 Pol I
reporter was integrated at the URA3 locus compared to the
effect observed in the rR8-rR10 plasmid system; as much as a
nearly 100-fold stimulation of Pol I transcription by the
enhancer was reported for the integrated reporter system (10). The Pol I promoter on rR8 without the enhancer
appears to have a limited but higher accessibility to the Pol I
machinery in the nucleolus than the same reporter integrated at
URA3. However, even plasmid DNAs in this Pol I reporter
system appear to be primarily extranucleolar. Our preliminary
examination of localization of the rR8 and rR10 plasmids by
fluorescence in situ hybridization analysis indicated that even the
rR10 plasmid, which has the enhancer and the RFB regions, is localized
outside the nucleolus in a majority of cells in which the plasmid
signal was clearly distinguishable (Oakes and Nomura, unpublished). (In
preliminary experiments, we have examined the expression of the
reporter T7 RNA carried by rR8 and rR10 plasmids in a fob1
mutant. While the results varied among individual transformants, on
average, there was no significant difference between the two reporter
plasmids. However, the data in this case were not as clear as those
seen for the HOT1 system. This might be due to the presence
of the RFB region in plasmid rR8 [Fig. 4], the region which was
clearly shown to be required for efficient Pol I transcription in the
HOT1 system [32]. In addition, the plasmid
reporter system shows high variability in the reporter expression in
different transformants, making a reliable analysis rather difficult.
The role of FOB1 in Pol I transcription in plasmid reporter
systems will require further study.)
Some earlier studies on yeast Pol I enhancers were done using reporters
integrated within chromosomal rDNA repeats. Here, the reported effects
of deletion of the E element (the enhancer and the RFB regions) were
smaller than those observed using reporter systems integrated at
heterologous chromosomal loci or plasmid reporter systems; the
difference between a reporter missing the E element on one side and a
control reporter was approximately twofold, and the difference between
a reporter missing the E element on both sides and the control reporter
was approximately fourfold (1, 16). Nevertheless, it was
argued from the data that the observed effects may have been small
because of the presence of the E element in many other rDNA repeats at
the RDN1 locus. These rDNA repeats would presumably have
exerted a stimulatory effect at a distance on the reporter, and the
importance of the E element in overall rRNA synthesis in vivo was
emphasized (16). Although these data are more difficult to
explain, it should be noted that the E element comprises the RFB
region, which is essential for rDNA repeat expansion (and presumably
also contraction) (15). In fact, copy numbers of the
control reporter were described to vary more widely than those of the
reporter missing one or both of the adjacent E elements
(16). Thus, without any means to reduce reporter copy
number fluctuation, e.g., by the use of a fob1 mutation, it
might be difficult to completely eliminate experimental errors due to
copy number fluctuation. In any event, the present experiments
demonstrate that deletion of the enhancer from all the rDNA repeats did
not cause any significant reduction in rRNA synthesis rate or cell
growth rate, an observation which is not consistent with the direct
function of the enhancer in transcription stimulation proposed in these
previous studies.
Possible function(s) of Pol I enhancer and FOB1. Two alternative models explain our observations that the enhancer (the E element) is required only for stimulation of Pol I transcription in ectopic systems, such as the HOT1 system at the HIS4 region, but not for Pol I transcription of the rRNA genes in the chromosomal rDNA repeat context. The first model assumes that Pol I, Pol I factors, and Fob1p are present mostly in the nucleolus but are also present in lower amounts outside the nucleolus and that the E element and Fob1p play direct roles in transcription by somehow facilitating recruitment of Pol I and Pol I factors to ectopic Pol I promoters. The second model assumes that both the enhancer (the E element) and Fob1p do not play a direct role in transcription and that both are required for an efficient interaction between ectopic Pol I promoters with the nucleolus, perhaps specifically with the chromosomal rDNA, and thus indirectly stimulate transcription of ectopic Pol I promoters. The first model implies a physiological significance of the proposed (hypothetical) role of the enhancer and Fob1p in transcription of chromosomal rDNA repeats, perhaps under conditions of extremely reduced concentrations of the Pol I machinery in the nucleolus. While we cannot exclude this model completely, we have failed to find growth conditions where one finds a significant difference in growth rate or rRNA synthesis rate for a strain with the intact enhancer present versus a strain with deletion of the entire enhancer from rDNA copies. In addition, the first model proposes an additional (new) function for Fob1p, whereas the second model gives a unified explanation for this and other known functions of Fob1p, as discussed below. Therefore, we favor the second model and suggest that the physiological function(s) of the enhancer and Fob1p are not directly related to Pol I transcription but are concerned mainly with facilitating interactions between rDNA repeats that are important for rDNA repeat expansion and contraction.
Fob1p is localized to the nucleolus (4). It was previously demonstrated that FOB1 is required for rDNA repeat expansion and contraction (12) and formation of extrachromosomal rDNA circles (4). These recombinational events require pairing of different rDNA repeat units. The E element consists of the enhancer and the RFB region, and both elements are required for stimulation of Pol I transcription in the HOT1 system (32). It was recently shown that the RFB region is essential for repeat expansion and the enhancer region is not essential but has a stimulatory role in this process (15). As shown in this paper, stimulation of Pol I transcription by FOB1 and the E element in the HOT1 system almost certainly takes place in the absence of recombinational events. Therefore, we speculate that the role of Fob1p in recombination within rDNA repeats is to facilitate initial pairing (or interaction) of different repeats by the use of the RFB and the enhancer regions (i.e., the E element) and that stimulation by Fob1p of a similar pairing (or interaction) between the E element in the HOT1 system and the corresponding regions in the chromosomal rDNA repeats may be the basis of the stimulation of recruitment of the Pol I machinery to the Pol I promoter in the HOT1 system. After this initial common pairing step involving the Fob1p protein and the E element, subsequent steps leading to repeat expansion on one hand and those leading to recruitment of the Pol I machinery on the other are obviously expected to be different. Thus, the requirement of some DNA cis elements in addition to the E element for repeat expansion (15) but not for transcription stimulation in the HOT1 system (35) is not inconsistent with the model suggested here. There are some unique features of the enhancer activity found in the earlier studies using the plasmid reporter system (5, 6). These features are orientation independence, action from either upstream or downstream of the reporter gene, and action over long distances (more than 2 kb from the promoter), which are quite different from known yeast enhancers for Pol II. In addition, using the Pol I reporter integrated at the URA3 locus, it was observed that transcription of the reporter gene increases roughly in proportion to the number of enhancer elements (10). These observations are highly consistent with the model proposed here that the enhancer element increases the probability of localization of the reporter gene to be near the nucleolus, perhaps through its interaction with rDNA, rather than by stimulating Pol I transcription directly. In addition to its requirement for the HOT1 activity, the FOB1 gene is known to be required for RFB activities (14). As for cis elements required for RFB activities, the work by Ward and coworkers (38) showed that some DNA elements are shared with those required for HOT1 activity, but others are required for one activity but not for the other. Although RFB activities were demonstrated using plasmids carrying cloned DNA containing the E element or the RFB region (3, 13, 38), the observed activities were reported to be very weak compared to the activities in the chromosomal context (3). This situation resembles that observed for transcription of a reporter gene; transcription of a Pol I reporter on a plasmid was reported to be much weaker relative to transcription of the same reporter integrated into the chromosomal rDNA repeats (16). It may be interesting to examine whether interactions of rDNA repeats through the E element might play a role in forming, at or near this element, a presumptive macromolecular structure that would achieve the RFB function.Role of FOB1 in HOT1 activity. Extensive studies done on the HOT1 system have demonstrated that strong transcription by Pol I stimulates intra- and interchromosomal recombination (9, 32, 35). Stimulation of mitotic recombination by high levels of transcription was also demonstrated for RNA Pol II (28, 33) and may be a general phenomenon related to changes in DNA supercoiling and torsional stress. We have now demonstrated that the requirement for FOB1 in HOT1 activity can be entirely accounted for by its requirement for stimulation of Pol I transcription by the E element (including the enhancer) in ectopic Pol I promoter systems outside the nucleolus. Thus, our finding supports the original conclusion of transcription-associated stimulation of recombination and explains why FOB1 is required for HOT1 activity.
Pol I terminator is dispensable.
Although there were
disagreements on the exact sites of yeast Pol I transcription
termination in earlier studies (see, e.g., reference 34),
extensive in vivo and in vitro studies performed by Reeder and
coworkers led to the conclusion that there are two terminators, one at
a site 93 nucleotides downstream of the 3' end of 25S rRNA, which
requires binding of the Reb1 protein at a nearby site, and the second
at a site 250 bp downstream of the 3' end of 25S rRNA
(23). Although the present work was not designed to study
transcription termination, the 190-bp enhancer element we studied
contains the Reb1 binding site essential for termination and the second
fail-safe terminator. As described in this paper, deletion of the
enhancer region, i.e., deletion of the two Pol I terminators, does not
cause a significant decrease in the synthesis of rRNA or in growth
rate, either in rdn strains or in the context of
chromosomal rDNA repeats. It appears that transcription termination at
these two proposed sites is not required for processing of rRNA to form
functional ribosomes. How and where Pol I transcription terminates in
these enhancer deletion strains have not been studied.
Pol I enhancers in higher eukaryotes. The S. cerevisiae Pol I enhancer studied in this work is structurally different from Pol I enhancers in higher eukaryotes, which consist of several repeats of a sequence that is similar to a portion of the gene promoter (22). Thus, results and conclusions obtained for the yeast enhancer in the present study may not apply to those in higher eukaryotes. Nevertheless, we would like to note that most of the published experiments were done using cloned enhancer DNA fragments in ectopic expression systems. In addition, the assays used for enhancer function were mostly by competition assays rather than actual stimulation of transcription in cis. Thus, the possibility that these intergenic elements might have a function(s) only indirectly related to Pol I transcription (rather than direct enhancement of Pol I transcription) cannot be excluded. It is interesting that rDNA enhancer elements in Drosophila melanogaster are known to play an essential role in X-Y meiotic chromosome pairing (17, 24). It may be prudent to await more rigorous future experimentation before accepting the conclusion that these enhancer elements really function directly in stimulating Pol I transcription within the native chromosomal rDNA genes in vivo.
| |
ACKNOWLEDGMENTS |
|---|
The first two authors, Hobert Wai and Katsuki Johzuka, contributed equally to this work.
We thank Jonathan R. Warner for providing plasmids and for helpful discussions; C. Greer, S. M. Arfin, and S. Jinks-Robertson for critical reading of the manuscript; and M. Oakes and S. VanAmburg for help in preparation of the manuscript.
This work was supported in part by Public Health Service grant GM35949 from the National Institute of Health (to M.N.) and by grants from the Ministry of Education, Culture, Sports, Science and Technology of Japan (to T.H. and T.K.) and the Ministry of Health, Labour and Welfare, Japan (to T.K.).
| |
FOOTNOTES |
|---|
*
Corresponding author. Mailing address: Department of
Biological Chemistry, 240D Medical Sciences I, University of
CaliforniaIrvine, Irvine, CA 92697-1700. Phone: (949) 824-4564. Fax:
(949) 824-3201. E-mail: mnomura{at}uci.edu.
Present address: Beckman Coulter, Inc., Bioresearch Division,
Fullerton, CA 92834-3100.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. |
Banditt, M.,
T. Koller, and J. M. Sogo.
1999.
Transcriptional activity and chromatin structure of enhancer-deleted rRNA genes in Saccharomyces cerevisiae.
Mol. Cell. Biol.
19:4953-4960 |
| 2. | Brewer, B. J., and W. L. Fangman. 1988. A replication fork barrier at the 3' end of yeast ribosomal RNA genes. Cell 55:637-643[CrossRef][Medline]. |
| 3. | Brewer, B. J., D. Lockshon, and W. L. Fangman. 1992. The arrest of replication forks in the rDNA of yeast occurs independently of transcription. Cell 71:267-276[CrossRef][Medline]. |
| 4. | Defossez, P. A., R. Prusty, M. Kaeberlein, S. J. Lin, P. Ferrigno, P. A. Silver, R. L. Keil, and L. Guarente. 1999. Elimination of replication block protein Fob1 extends the life span of yeast mother cells. Mol. Cell 3:447-455[CrossRef][Medline]. |
| 5. | Elion, E. A., and J. R. Warner. 1984. The major promoter element of rRNA transcription in yeast lies 2 kb upstream. Cell 39:663-673[CrossRef][Medline]. |
| 6. |
Elion, E. A., and J. R. Warner.
1986.
An RNA polymerase I enhancer in Saccharomyces cerevisiae.
Mol. Cell. Biol.
6:2089-2097 |
| 7. | Garcia, S. N., and L. Pillus. 1999. Net results of nucleolar dynamics. Cell 97:825-828[CrossRef][Medline]. |
| 8. | Hill, J. E., A. M. Meyers, T. J. Koerner, and A. Tzagoloff. 1986. Yeast/E. coli shuttle vectors with multiple unique restriction sites. Yeast 2:163-167[CrossRef][Medline]. |
| 9. | Huang, G. S., and R. L. Keil. 1995. Requirements for activity of the yeast mitotic recombination hotspot HOT1: RNA polymerase I and multiple cis-acting sequences. Genetics 141:845-855[Abstract]. |
| 10. |
Johnson, S. P., and J. R. Warner.
1989.
Unusual enhancer function in yeast rRNA transcription.
Mol. Cell. Biol.
9:4986-4993 |
| 11. | Keil, R. L., and G. S. Roeder. 1984. cis-acting, recombination-stimulating activity in a fragment of the ribosomal DNA of S. cerevisiae. Cell 39:377-386[CrossRef][Medline]. |
| 12. |
Kobayashi, T.,
D. J. Heck,
M. Nomura, and T. Horiuchi.
1998.
Expansion and contraction of ribosomal DNA repeats in Saccharomyces cerevisiae: requirement of replication fork blocking (Fob1) protein and the role of RNA polymerase I.
Genes Dev.
12:3821-3830 |
| 13. | Kobayashi, T., M. Hidaka, M. Nishizawa, and T. Horiuchi. 1992. Identification of a site required for DNA replication fork blocking activity in the rRNA gene cluster in Saccharomyces cerevisiae. Mol. Gen. Genet. 233:355-362[Medline]. |
| 14. | Kobayashi, T., and T. Horiuchi. 1996. A yeast gene product, Fob1 protein, required for both replication fork blocking and recombinational hotspot activities. Genes Cells 1:465-474[Abstract]. |
| 15. |
Kobayashi, T.,
M. Nomura, and T. Horiuchi.
2001.
Identification of DNA cis elements essential for expansion of ribosomal DNA repeats in Saccharomyces cerevisiae.
Mol. Cell. Biol.
21:136-147 |
| 16. | Kulkens, T., C. A. F. M. van der Sande, A. F. Dekker, H. van Heerikhuizen, and R. J. Planta. 1992. A system to study transcription by yeast RNA polymerase I within the chromosomal context: functional analysis of the ribosomal DNA enhancer and the RBP1/REB1 binding sites. EMBO J. 11:4665-4674[Medline]. |
| 17. | McKee, B. D., and G. H. Karpen. 1990. Drosophila ribosomal RNA genes function as an X-Y pairing site during male meiosis. Cell 61:61-72[CrossRef][Medline]. |
| 18. |
Nogi, Y.,
R. Yano, and M. Nomura.
1991.
Synthesis of large rRNAs by RNA polymerase II in mutants of Saccharomyces cerevisiae defective in RNA polymerase I.
Proc. Natl. Acad. Sci. USA
88:3962-3966 |
| 19. |
Oakes, M.,
J. P. Aris,
J. S. Brockenbrough,
H. Wai,
L. Vu, and M. Nomura.
1998.
Mutational analysis of the structure and localization of the nucleolus in the yeast Saccharomyces cerevisiae.
J. Cell Biol.
143:23-34 |
| 20. |
Park, P. U.,
P.-A. Defossez, and L. Guarente.
1999.
Effects of mutations in DNA repair genes on formation of ribosomal DNA circles and life span in Saccharomyces cerevisiae.
Mol. Cell. Biol.
19:3848-3856 |
| 21. |
Pederson, T.
1998.
Survey and summary: the plurifunctional nucleolus.
Nucleic Acids Res.
26:3871-3876 |
| 22. | Reeder, R. H. 1999. Regulation of RNA polymerase I transcription in yeast and vertebrates. Prog. Nucleic Acid Res. Mol. Biol. 62:293[Medline]. |
| 23. |
Reeder, R. H.,
P. Guevara, and J. G. Roan.
1999.
Saccharomyces cerevisiae RNA polymerase I terminates transcription at the Reb1 terminator in vivo.
Mol. Cell. Biol.
19:7369-7376 |
| 24. | Ren, X., L. Eisenhour, C. Hong, Y. Lee, and B. D. McKee. 1997. Roles of rDNA spacer and transcription unit sequences in X-Y meiotic chromosome pairing in Drosophila melanogaster males. Chromosoma 106:29-36[CrossRef][Medline]. |
| 25. | Rose, M. D., and J. R. Broach. 1991. Cloning genes by complementation in yeast. Methods Enzymol. 194:195-230[Medline]. |
| 26. |
Rothstein, R.,
B. Michel, and S. Gangloff.
2000.
Replication fork pausing and recombination or "gimme a break."
Genes Dev.
14:1-10 |
| 27. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 28. |
Saxe, D.,
A. Datta, and S. Jinks-Robertson.
2000.
Stimulation of mitotic recombination events by high levels of RNA polymerase II transcription in yeast.
Mol. Cell. Biol.
20:5404-5414 |
| 29. |
Schultz, M. C.,
S. Y. Choe, and R. H. Reeder.
1993.
In vitro definition of the yeast RNA polymerase I enhancer.
Mol. Cell. Biol.
13:2644-2654 |
| 30. | Sherman, F., G. R. Fink, and J. B. Hicks. 1986. Laboratory course manual for methods in yeast genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 31. | Shinohara, A., and T. Ogawa. 1995. Homologous recombination and the roles of double-strand breaks. Trends Biochem. Sci. 20:387-391[CrossRef][Medline]. |
| 32. |
Stewart, S. E., and G. S. Roeder.
1989.
Transcription by RNA polymerase I stimulates mitotic recombination in Saccharomyces cerevisiae.
Mol. Cell. Biol.
9:3464-3472 |
| 33. | Thomas, B. J., and R. Rothstein. 1989. Elevated recombination rates in transcriptionally active DNA. Cell 56:619-630[CrossRef][Medline]. |
| 34. |
van der Sande, C. A. F. M.,
T. Kulkens,
A. B. Kramer,
I. J. de Wijs,
H. van Heerikhuizen,
J. Klootwijk, and R. J. Planta.
1989.
Termination of transcription by yeast RNA polymerase I.
Nucleic Acids Res.
17:9127-9146 |
| 35. | Voelkel-Meiman, K., R. L. Keil, and G. S. Roeder. 1987. Recombination-stimulating sequences in yeast ribosomal DNA correspond to sequences regulating transcription by RNA polymerase I. Cell 48:1071-1079[CrossRef][Medline]. |
| 36. |
Vu, L.,
I. Siddiqi,
B.-S. Lee,
C. A. Josaitis, and M. Nomura.
1999.
RNA polymerase switch in transcription of yeast rDNA: role of transcription factor UAF (upstream activation factor) in silencing rDNA transcription by RNA polymerase II.
Proc. Natl. Acad. Sci. USA
96:4390-4395 |
| 37. |
Wai, H. H.,
L. Vu,
M. Oakes, and M. Nomura.
2000.
Complete deletion of yeast chromosomal rDNA repeats and integration of a new rDNA repeat: use of rDNA deletion strains for functional analysis of rDNA promoter elements in vivo.
Nucleic Acids Res.
28:3524-3534 |
| 38. |
Ward, T. R.,
M. L. Hoang,
R. Prusty,
C. K. Lau,
R. L. Keil,
W. L. Fangman, and B. J. Brewer.
2000.
Ribosomal DNA replication fork barrier and HOT1 recombination hot spot: shared sequences but independent activities.
Mol. Cell. Biol.
20:4948-4957 |
| 39. | Warner, J. R., R. Ikonomova, S. P. Johnson, C. R. Nierras, and K. Wang. 1998. The role of the enhancer element in rRNA transcription in Saccharomyces cerevisiae, p. 243-254. In M. R. Paule (ed.), Transcription of ribosomal RNA genes by eukaryotic RNA polymerase I. Springer-Verlag and R. G. Landes Co., Georgetown, Tex. |
Molecular and Cellular Biology, August 2001, p. 5541-5553, Vol. 21, No. 16
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.16.5541-5553.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Merz, K., Hondele, M., Goetze, H., Gmelch, K., Stoeckl, U., Griesenbeck, J.
(2008). Actively transcribed rRNA genes in S. cerevisiae are organized in a specialized chromatin associated with the high-mobility group protein Hmo1 and are largely devoid of histone molecules. Genes Dev.
22: 1190-1204
[Abstract] [Full Text] -
Kawauchi, J., Mischo, H., Braglia, P., Rondon, A., Proudfoot, N. J.
(2008). Budding yeast RNA polymerases I and II employ parallel mechanisms of transcriptional termination. Genes Dev.
22: 1082-1092
[Abstract] [Full Text] -
Oakes, M. L., Johzuka, K., Vu, L., Eliason, K., Nomura, M.
(2006). Expression of rRNA Genes and Nucleolus Formation at Ectopic Chromosomal Sites in the Yeast Saccharomyces cerevisiae.. Mol. Cell. Biol.
26: 6223-6238
[Abstract] [Full Text] -
Campbell, J. L., Lorenz, A., Witkin, K. L., Hays, T., Loidl, J., Cohen-Fix, O.
(2006). Yeast Nuclear Envelope Subdomains with Distinct Abilities to Resist Membrane Expansion. Mol. Biol. Cell
17: 1768-1778
[Abstract] [Full Text] -
Ganley, A. R. D., Hayashi, K., Horiuchi, T., Kobayashi, T.
(2005). Identifying gene-independent noncoding functional elements in the yeast ribosomal DNA by phylogenetic footprinting. Proc. Natl. Acad. Sci. USA
102: 11787-11792
[Abstract] [Full Text] -
Michel, A. H., Kornmann, B., Dubrana, K., Shore, D.
(2005). Spontaneous rDNA copy number variation modulates Sir2 levels and epigenetic gene silencing. Genes Dev.
19: 1199-1210
[Abstract] [Full Text] -
Serizawa, N., Horiuchi, T., Kobayashi, T.
(2004). Transcription-mediated hyper-recombination in HOT1. GENES CELLS
9: 305-315
[Abstract] [Full Text] -
Sanchez-Gorostiaga, A., Lopez-Estrano, C., Krimer, D. B., Schvartzman, J. B., Hernandez, P.
(2004). Transcription Termination Factor reb1p Causes Two Replication Fork Barriers at Its Cognate Sites in Fission Yeast Ribosomal DNA In Vivo. Mol. Cell. Biol.
24: 398-406
[Abstract] [Full Text] -
Kobayashi, T.
(2003). The Replication Fork Barrier Site Forms a Unique Structure with Fob1p and Inhibits the Replication Fork. Mol. Cell. Biol.
23: 9178-9188
[Abstract] [Full Text] -
Huang, J., Moazed, D.
(2003). Association of the RENT complex with nontranscribed and coding regions of rDNA and a regional requirement for the replication fork block protein Fob1 in rDNA silencing. Genes Dev.
17: 2162-2176
[Abstract] [Full Text] -
Takeuchi, Y., Horiuchi, T., Kobayashi, T.
(2003). Transcription-dependent recombination and the role of fork collision in yeast rDNA. Genes Dev.
17: 1497-1506
[Abstract] [Full Text] -
Weitao, T., Budd, M., Hoopes, L. L. M., Campbell, J. L.
(2003). Dna2 Helicase/Nuclease Causes Replicative Fork Stalling and Double-strand Breaks in the Ribosomal DNA of Saccharomyces cerevisiae. J. Biol. Chem.
278: 22513-22522
[Abstract] [Full Text] -
Hoopes, L. L. M., Budd, M., Choe, W., Weitao, T., Campbell, J. L.
(2002). Mutations in DNA Replication Genes Reduce Yeast Life Span. Mol. Cell. Biol.
22: 4136-4146
[Abstract] [Full Text] -
NOMURA, M.
(2001). Ribosomal RNA Genes, RNA Polymerases, Nucleolar Structures, and Synthesis of rRNA in the Yeast Saccharomyces cerevisiae. Cold Spring Harb Symp Quant Biol
66: 555-566
[Abstract]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»