Lautenberg Center for General and Tumor
Immunology, The Hebrew University Hadassah Medical School, Jerusalem
91120,1 and Department of Biochemistry,
The Rappaport Family Institute for Research in the Medical Sciences
and the Bruce Rappaport Faculty of Medicine, Technion-Israel Institute
of Technology, Haifa 31096,2 Israel
Received 8 March 2001/Returned for modification 11 May
2001/Accepted 4 June 2001
The p53 protein is subject to Mdm2-mediated degradation by the
ubiquitin-proteasome pathway. This degradation requires interaction between p53 and Mdm2 and the subsequent ubiquitination and nuclear export of p53. Exposure of cells to DNA damage results in the stabilization of the p53 protein in the nucleus. However, the underlying mechanism of this effect is poorly defined. Here we demonstrate a key role for c-Abl in the nuclear accumulation of endogenous p53 in cells exposed to DNA damage. This effect of c-Abl is
achieved by preventing the ubiquitination and nuclear export of p53 by
Mdm2, or by human papillomavirus E6. c-Abl null cells fail to
accumulate p53 efficiently following DNA damage. Reconstitution of
these cells with physiological levels of c-Abl is sufficient to promote
the normal response of p53 to DNA damage via nuclear retention. Our
results help to explain how p53 is accumulated in the nucleus in
response to DNA damage.
 |
INTRODUCTION |
During cancer development there is a
strong selection for the loss of p53 function. This occurs primarily
via mutation in the p53 gene, or through inactivation of the p53
protein by viral and cellular oncogenes (45). Stimulation
of p53 by oncogenes or stress conditions induces cell growth arrest,
senescence, or apoptosis (reviewed in references 12, 40, and
45). In normal cells, the p53 protein is tightly regulated at
multiple levels. These include the level of protein stability,
posttranslational modifications, and subcellular localization (1,
20). The key negative regulator of p53 is the proto-oncogene
mdm2. Mdm2 inhibits the transcriptional activity and growth
suppression ability of p53 (32). The most important
mechanism by which Mdm2 negatively regulates p53 is by promoting its
degradation through the ubiquitin-proteasome pathway (16,
24), by acting as an E3 ligase (18). This activity of Mdm2 requires physical interaction between the two proteins. Inhibition of this interaction by antibodies or peptides directed to
the interaction site results in the accumulation of p53
(4). The nuclear export of p53 is important for its
degradation by Mdm2 (35). Blocking this nuclear export of
p53 by the drug leptomycin B results in the accumulation of p53 in the
nucleus (10). In addition to Mdm2, several other proteins
have been shown to promote p53 for degradation, including the human
papillomavirus (HPV) E6 protein (44).
The expression of the high-risk HPV E6 leads to various anogenital and
some oral cancers (44). The E6 protein (HPV type 16 [HPV-16] and HPV-18) promotes p53 for degradation by recruiting a
cellular E3 ligase, E6-associated protein (E6-AP), which interacts with
p53 only in the presence of E6 (reviewed in references 17 and
44). E6 binds p53 in the C terminus and in the core domain; the
latter is essential for p53 degradation (8, 27). E6 can also inhibit p53 activities without promoting its degradation, implicating the involvement of additional inhibitory mechanisms (reviewed in reference 44). This efficient silencing of
p53 by E6 explains why in cervical tumors, in contrast to most other tumors, p53 remains wild type. However, once the cervical tumor cells
metastasize, there is a selection for p53 mutations (9).
The negative regulation of p53 can be neutralized by the action of
partner proteins and by specific modifications. In response to oncogene
expression, the p14ARF protein protects p53 from
Mdm2-mediated degradation (reviewed in reference 40). In
addition, specific modifications of p53, such as phosphorylation on
serines 15 and 20 and on threonine 18, activate p53 by reducing the
affinity of p53 for Mdm2 (reviewed in reference 32). Of
these, phosphorylation of serine 20 by Chk2, a target for ataxia
telangiectasia mutant protein (ATM) activation, has an important
physiological role in the activation and stabilization of p53 in
response to DNA damage (7, 41). Thus, the ATM-Chk2 DNA
damage signaling pathway appears to be important in p53 regulation.
This is further supported by the identification of Chk2 mutations in
Li-Fraumeni syndrome patients (3).
Interestingly, in response to ionizing radiation ATM activates another
important regulator of p53, c-Abl, which is a nonreceptor tyrosine
kinase (2, 38). c-Abl and p53 respond to similar genotoxic
stresses (28). Expression of c-Abl induces G1
cell growth arrest in a p53-dependent manner (47, 50).
Fibroblasts lacking c-Abl are impaired in their G1 arrest
response to ionizing irradiation (50). The induction of
c-Abl-dependent apoptosis in response to DNA damage involves
collaboration with p73 (reviewed in reference 39) and to
lesser extent with p53 (49). However, DNA damage-induced
cell killing may also occur in the absence of c-Abl (28).
c-Abl and p53 interact in vitro, and this interaction is further
enhanced by DNA damage in vivo (48). Thus, a number of
studies support a role for c-Abl in the cellular response to DNA
damage, in which p53 is a key player.
Recently, we found that c-Abl neutralizes the ability of Mdm2 to
promote p53 for degradation and to inhibit the transcriptional and
apoptotic activities of p53 (46). This finding prompted us
to examine the role of c-Abl in the accumulation of p53 by DNA damage,
a major trigger of p53 activation. We report that c-Abl is important
for the signaling pathway inducing p53 in response to DNA damage. The
mechanisms underlying this important role of c-Abl were investigated.
Our results support a key role for c-Abl in the activation of p53 by
stress, by regulating the nuclear export of p53 and the extent of its ubiquitination.
 |
MATERIALS AND METHODS |
Cells and transfection assays.
HeLa cells and the
fibroblastic cell lines c-Abl
/
+LacZ
(Abl
/
fibroblasts reconstituted with LacZ) and
c-Abl
/
+c-Abl (Abl
/
fibroblasts
reconstituted with c-Abl) (46) were grown in Dulbecco modified Eagle medium supplemented with 10% fetal calf serum at 37°C. H1299 cells and Saos-2 cells were grown in RPMI 1640 medium supplemented with 10% fetal calf serum at 37°C. The Saos-2 cell line
was derived from an osteosarcoma, and the H1299 cell line was derived
from lung adenocarcinoma; neither of these lines expresses p53. HeLa
cells were derived from cervical carcinoma infected with HPV-18. The
c-Abl
/
+c-Abl fibroblasts expressed physiological
levels of c-Abl (46). Transfections by the calcium
phosphate precipitation method were carried out as previously described
(15). The amount of expression plasmids used in each
experiment is indicated in the corresponding figure legend. A constant
amount of plasmid DNA in each sample was maintained by adding empty
vector. Sf9 insect cells were grown in Grace's medium supplemented
with yeastolate and lactalbumin hydrolysate solutions and 10%
heat-inactivated fetal calf serum. Cells were grown and infected at
27°C. For the activation of p53, fibroblasts were treated with 3 or
10 µg of mitomycin C (Sigma) per ml or 3 µg of doxorubicin (Sigma)
per ml or exposed to
-irradiation (10 Gy).
Western blot analysis and luciferase assay were carried out as
previously described (15). For immunofluorescent staining, cells were plated on glass coverslips. Twenty-four hours
posttransfection, cells were treated for 2 h with the proteasome
inhibitor ALLN (150 µM; Calbiochem) in order to prevent the
degradation of p53 and Mdm2 in the cytoplasm. Cells were fixed in cold
methanol and stained with anti-p53 antibodies (PAb1801 and DO1)
followed by Cy3-conjugated goat anti-mouse immunoglobulin
secondary antibody. Cells were stained simultaneously for DNA using
DAPI (4',6'-diamidino-2-phenylindole). Stained cells were observed with
a confocal microscope (Zeiss).
The antibodies used were anti-human p53 monoclonal antibodies PAb1801
and DO1, anti-mouse p53 PAb248 and PAb421, anti-c-Abl ABL-148 (Sigma),
anti-
-tubulin (DM1A; Sigma), anti-histone 2B (LG2-2; kindly provided
by Dan Eilat, Hadassah University Hospital, Jerusalem; Israel),
Cy3-conjugated goat anti-mouse immunoglobulin, and horseradish
peroxidase-labeled goat anti-mouse immunoglobulin G (Jackson
ImmunoResearch Laboratory).
Ubiquitination assay in vivo and in vitro.
The
ubiquitination of p53 in vivo was detected by transfecting HeLa cells
with 0.5 µg of human p53 expression plasmid, with or without 4 µg
of expression plasmid for c-abl. Twenty-two hours posttransfection, cells were treated with 150 µM ALLN for 2 h. Following treatment, cells were subjected to nuclear cytoplasmic fractionation. To prepare the cytoplasmic fraction, the cell pellets were resuspended in cytoplasmic buffer (10 mM Tris HCl [pH 8.0], 10 mM KCl). Cells were allowed to swell for 2 min, and then NP-40 was
added to 0.4%, followed by centrifugation. The supernatant contained
the soluble cytoplasmic fraction. The pellets were washed once more
with the cytoplasmic buffer before proceeding to nuclear fractionation.
For the preparation of the nuclear fraction, the remaining cell pellet
was resuspended in high-salt radioimmunoprecipitation assay buffer (50 mM Tris [pH 8.0], 5 mM EDTA, 400 mM NaCl, 1% NP-40, 1%
deoxycholate, and 0.025% sodium dodecyl sulfate [SDS]). The purity
of the cytoplasmic fraction was verified by probing with
anti-
-tubulin, while that of the nuclear fraction was verified with
anti-histone 2B. Nuclear extracts were subjected to Western blot
analysis using the indicated antibodies.
The in vitro reconstitution assay for the ubiquitination of p53 by
E6-E6-AP was carried out essentially as described by Gonen et al.
(14). Human p53 was translated in vitro by TNT reaction in
wheat germ extract. The conjugation reaction mixture contained 0.2 µg
of human E1 (affinity purified on a ubiquitin column), 1 µg of
His-tagged UbcH5c (purified on a nickel column), glutathione S-transferase (GST)-HPV-16 E6 (purified on a glutathione
Sepharose column), 0.3 µl of Sf9 cell extract expressing E6-AP, 2 µl of in vitro-translated p53, and different amounts of extract from Sf9 cells that were either infected with baculoviral vector encoding c-Abl or noninfected. The reaction was carried out in 12.5 µl containing 40 mM Tris (pH 7.5), 2 mM dithiothreitol, 5 mM
MgCl2, 10 µg of ubiquitin, 5 mM ATP
S, and 0.5 µg of
ubiquitin-aldehyde. The reaction was performed at 30°C for 50 min.
The mixture was then resolved by SDS-10% polyacrylamide gel
electrophoresis (10% PAGE).
The in vitro reconstitution assay for p53 ubiquitination by Mdm2
contained the following components: 0.5 µg of human E1
(affinity purified on a ubiquitin column), 0.5 µg of His-tagged
UbcH5c (purified on a nickel column), 0.3 µg of GST-Mdm2 (purified on
a glutathione Sepharose column), 0.5 µl of in vitro-translated p53 in
wheat germ extract (Promega), and 0.5 µg of Sf9 extracts (from
control and c-Abl-expressing cells). The reaction mixture contained 40 mM Tris (pH 7.6), 2 mM dithiothreitol, 5 mM MgCl2, 10 µg
of ubiquitin, and 1 mM ATP
S. The reaction was performed at 30°C
for 1 h. The mixture was then resolved by SDS-10% PAGE and subjected
to Western blotting using anti-human p53 antibodies (PAb1801 and DO1).
Plasmids.
The expression plasmids used were those encoding
human wild-type p53 (pRC/CMV wtp53), HPV-16 E6 (pCB6 HPV16E6; a
generous gift from K. Vousden), His-tagged E6-AP in a baculoviral
vector (a generous gift from M. Scheffner), human E1 and His-tagged
UbcH5c (14), GST-HPV-16 E6, mouse wild-type
c-abl (pCMV c-abl IV) and kinase-defective
c-abl (pCMV c-abl K290H), mouse mdm2,
and human Hdm2 (15, 46). The green fluorescent
protein (GFP) plasmids used were the enhanced GFP plasmid (pEGFP
Clontech) and pEGFP fused to the farnesylation signal of Ha-ras
(pEGFPF; a generous gift from W. Jiang and T. Hunter). c-Abl was fused
to the N terminus of GFP. Mouse c-abl was amplified by PCR
using the following oligonucleotides: a 5' primer,
GCGAATTCCACCATGGGGCAGCAGCCTGG, containing an
EcoRI restriction site and a 3' primer,
CAGGATCCCTCCGGACAATGTCGCTGA, containing a BamHI
restriction site. The PCR product of c-abl was digested with
these sites and cloned into the same sites in pEGFP. The reporter
plasmid used was the cyclin G luciferase plasmid (15). For expression of c-Abl in baculovirus, c-Abl IV
cDNA was fused to a six-His tag by PCR amplification. The 5'
oligonucleotide was
GCGGATCCCATGCATCATCATCATCATCATGGGCAGCAGCCTGGAAAAGT, and the 3' oligonucleotide was CCGAATTCACCTCCGGACAATGTCGTCGCTGAT.
The PCR product was digested with BamHI and
EcoRI and ligated into a baculovirus expression vector
digested with the same restriction enzymes (pVL1393; Pharmingen). The
baculovirus was generated and amplified in cells according to the
manufacturer's instructions.
 |
RESULTS |
c-Abl is critical for the efficient accumulation of p53 in response
to DNA damage.
Cooperation between c-Abl and p53 in the cellular
response to stress has been implicated by a number of studies (reviewed in reference 22). However, the underlying molecular
mechanism for this cooperation has not been defined. It has previously
been shown that overexpression of c-Abl can neutralize the degradation of p53 by Mdm2 (46). This finding encouraged us to propose
that c-Abl may play a role in the accumulation of p53 in cells exposed to stress. Since both c-Abl and p53 are activated by double-strand DNA
breaks, the role of c-Abl in the accumulation of p53 in response to
such DNA damage was investigated. For this purpose, mouse embryo fibroblasts (MEFs) were generated from normal and c-abl null
mice. Cells were exposed to mitomycin C for 6 h before harvest.
The steady-state levels of endogenous p53 were determined by subjecting the cell extracts to Western blot analysis using anti-p53 antibodies (PAb421 and PAb248). As shown in Fig. 1A,
the accumulation of p53 in cells exposed to 3 µg of mitomycin C per
ml is greatly impaired in fibroblasts lacking c-Abl compared with
normal fibroblasts (lanes 3 and 4, dark exposure). A similar effect was
observed after exposure to 10 µg of mitomycin C per ml (lanes 5 and
6, light exposure). To ensure that this effect is not specific only to
mitomycin C, cells were also exposed to another DNA-damaging agent,
doxorubicin (3 µg/ml). Again, the accumulation of p53 was more
efficient in the presence of c-Abl (lanes 7 and 8, light exposure). The
expression of p53 was quantified by densitometry, and the results are
summarized in Fig. 1B.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 1.
c-Abl enhances the accumulation of endogenous p53 in
response to DNA damage. (A) MEFs from a c-abl null mouse
(Fib abl / ) or from a normal mouse (Fib
abl+/+) were either untreated (lanes 1 and 2) or
treated as indicated. Cells were incubated with ALLN (150 µM) for
4 h prior to harvest or were treated with mitomycin C (Mito-C) at
the indicated concentrations for 6 h or with doxorubicin at 3 µg/ml for 6 h. At the end of the treatment, cell extracts were
subjected to Western blot analysis using anti-p53 antibodies (PAb248
and PAb421). Two exposures of the enhanced chemiluminescence-treated
blot showing p53 are presented in order to reveal the levels of basal
and activated p53. The same membrane was reprobed with anti-c-Abl, and
the amounts of protein loaded were monitored by reprobing with
anti-histone 2B. (B) The intensity of the bands obtained in the light
exposure was quantified by densitometry and the values are plotted on
the graph. N. T., no treatment; Doxo, doxorubicin. (C) Fibroblasts
null for c-Abl (c-Abl negative) and fibroblasts reconstituted with
c-Abl (c-Abl positive) were either not treated (N.T.), incubated with
ALLN (150 µM) for 4 h before harvest, treated with mitomycin C
(Mito-C) (3 µg/ml) for 6 h, or subjected to both treatments
together. At the end of the treatment, cell extracts were subjected to
Western blot analysis using anti-p53 antibodies (PAb248 and PAb421).
The intensities of the p53 bands were quantified by densitometry and
are presented in arbitrary units. The amounts of protein loaded were
monitored by reprobing with anti- -tubulin. (D) Fibroblasts null for
c-Abl (c-Abl negative) or reconstituted with c-Abl (c-Abl positive)
were either untreated (lanes 1 and 6) or exposed to -irradiation
( -IR) for the periods indicated. The intensity of the bands was
quantified as in panel B. The protein levels were determined as for
panel C.
|
|
It should be noted that the basal level of the p53 protein is higher in
normal cells than in cells lacking c-Abl (Fig. 1A, lanes 1 and 2),
consistent with c-Abl protecting p53 even in the absence of stress.
Similarly, the accumulation of p53 by treatment with the proteasome
inhibitor ALLN was enhanced by the presence of c-Abl (Fig. 1A, lanes 9 and 10; light exposure). The similarity in the level of the p53 protein
between cells treated with ALLN (lane 10) and normal cells, but not
c-abl null cells (lane 7), exposed to doxorubicin (lane 8),
demonstrates the requirement for c-Abl in order to achieve maximal
accumulation of p53 in response to DNA damage.
As an additional approach, the role of c-Abl in the accumulation of p53
in response to DNA damage was tested in a different experimental
system. For this purpose we used two fibroblastic cell lines,
c-Abl
/
+LacZ (c-abl null fibroblasts infected
with LacZ retrovirus) and c-Abl
/
+c-Abl
(c-abl null fibroblasts reconstituted with c-Abl at levels within the physiological range) (46). The accumulation of
p53 in response to mitomycin C (3 µg/ml for 6 h) was greater in
cells reconstituted with c-Abl than in c-abl null cells
(Fig. 1C, lanes 3 and 7). Here too, the basal level of the p53 protein,
and its accumulation in the presence of ALLN was higher in cells
expressing c-Abl (Fig. 1C, lanes 1 and 5 and lanes 2 and 6). Further,
the two cell lines were exposed to
-irradiation (10 Gy), and the steady-state level of p53 was measured by Western blot analysis using
anti-p53 antibodies (PAb421 and PAb248). In the c-Abl-expressing cells,
the p53 protein was elevated by 1 h and remained high for a
subsequent hour (Fig. 1D, lanes 6 to 10). On the other hand, in
c-abl null cells, the elevation by 1 h was less than
20% of that seen in c-Abl-expressing cells. Even at 2 h the
levels of p53 expression in c-abl null cells reached only
60% that of c-Abl-expressing cells (lanes 1 to 5). These results are
in accord with those obtained with the primary cells. Together, these
findings support an important role for c-Abl in the rate and extent of
p53 accumulation in response to different DNA-damaging agents.
c-Abl enhances the nuclear accumulation of p53.
Treatment of
cells with an inhibitor of nuclear export, leptomycin B, results in the
accumulation of p53 (10). It was therefore tempting to
suggest that c-Abl may protect p53 by preventing its nuclear export in
stressed cells. To test this conjecture, the effect of c-Abl on the
accumulation of p53 within the nuclei of cells exposed to DNA damage
was examined. The c-abl null MEFs and their normal
counterparts were exposed to DNA-damaging agents. Nuclear fractions
were prepared, and the extracts were subjected to Western blot analysis
using anti-p53 antibodies (PAb248 and PAb421). Upon exposure to
doxorubicin (3 µg/ml for 6 h), the accumulation of p53 within
the nuclei of c-abl null MEFs was markedly lower than in the
nuclei of normal MEFs (Fig. 2, lanes 4 and 5, light exposure). A consistent difference, albeit at lower
expression levels, was observed after treatment with mitomycin C (3 µg/ml for 6 h) (Fig. 2, lanes 7 and 8). Similar results were
obtained when c-Abl-reconstituted fibroblastic cells were compared to
c-abl null fibroblasts after exposure to doxorubicin and
mitomycin C (data not shown). Overall, these results demonstrate that
the physiological levels of c-Abl are essential for the efficient accumulation of p53 within the nuclei of cells exposed to DNA damage.
It should be noted that the elevation of the p53 protein in the nucleus
by blocking its proteasomal degradation was again largely dependent on
c-Abl (Fig. 2, lanes 8 and 9). This implicates c-Abl as an important
regulator of p53 expression within the nucleus in nonstressed cells as
well.

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 2.
Role for c-Abl in the nuclear accumulation of p53 in
response to DNA damage. MEFs from a c-abl null mouse (Fib
abl / ) or from a normal mouse (Fib
abl+/+) were either not treated (lanes 1 and 2)
or treated with doxorubicin at 3 µg/ml for 6 h (lanes 4 and 5),
with mitomycin C at 3 µg/ml for 6 h (lanes 6 and 7), or with with
ALLN at 150 µM for 4 h (lanes 8 and 9). Nuclear fractions were
prepared, and extracts were subjected to Western blot analysis for p53
expression using anti-p53 antibodies (PAb421 and PAb248). Extract from
the cytoplasmic fraction of untreated cells was included as a control
(C). The purity of the nuclear and cytoplasmic fractionation was
monitored by reprobing the membrane with anti-histone 2B and
anti- -tubulin, respectively.
|
|
The nucleocytoplasmic shuttle of p53 by Mdm2 is inhibited by
c-Abl.
Our findings above demonstrating a role for c-Abl in the
accumulation of p53 in the nucleus raised the possibility that c-Abl may interfere with the nuclear export of p53. The nuclear export of p53
by Mdm2 has been previously shown to be essential for the ability of
Mdm2 to promote p53 for degradation (10, 35). This raised
the possibility that c-Abl may protect p53 in the nucleus by preventing
its nuclear export by Mdm2. This notion is particularly attractive in
light of our previous findings showing that c-Abl protects p53 from
Mdm2-mediated degradation and that the protected p53 is functionally
active. This possibility was tested by monitoring the effect of c-Abl
on Mdm2-mediated nuclear export of p53. The p53-deficient Saos-2 cells
were transfected with an expression plasmid for p53 alone, or in
combination with expression plasmids for mdm2 and
c-abl-GFP. Twenty-four hours posttransfection,
cells were treated with the proteasome inhibitor ALLN for 2 h to
prevent p53 degradation. Cells were then fixed in methanol and stained for p53 using anti-p53 monoclonal antibodies (PAb1801 and DO1) followed
by a Cy3-conjugated goat anti-mouse immunoglobulin secondary antibody.
c-Abl-GFP expression was monitored by GFP fluorescence, and the nuclei
were visualized by staining the DNA with DAPI. Stained cells were
examined under the confocal microscope. As shown in Fig.
3, the proportion of cells with nuclear
staining only compared with cells with nuclear and cytoplasmic staining was scored for each combination. Cotransfection of Mdm2 with p53 increased the proportion of cells with cytoplasmic staining almost twofold, consistent with previous findings (10, 35).
Importantly, in the presence of c-Abl and Mdm2, the Mdm2-mediated
nuclear export of p53 was diminished and the proportion of cells with
cytoplasmic staining was reduced to the level observed with p53 alone
(Fig. 3). Thus, c-Abl prevents the nuclear export of p53 induced by Mdm2.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 3.
c-Abl overcomes the nuclear export of p53 by Mdm2. (A)
Saos-2 cells were transfected with the expression plasmids p53 (0.2 µg), mdm2 (0.5 µg), and GFP-c-abl
(4 µg). Twenty-four hours posttransfection, cells were treated with
ALLN (150 µM) for 2 h and then fixed in cold methanol. Fixed
cells were stained for p53 using anti-p53 antibodies (PAb1801 and DO1)
followed by Cy3-conjugated goat anti-mouse immunoglobulin and
simultaneously stained for DNA using DAPI. The GFP and GFP-c-Abl
fluorescence is shown in the rightmost panel. Stained cells were
examined with a confocal microscope. Magnification, ×800. (B) Summary
of p53 localization in stained cells (100 to 850 cells) from three
independent experiments. The staining phenotype was categorized in two
groups, one with nuclear p53 staining only and one with nuclear and
cytoplasmic staining. The graph shows the percentage of cells with
cytoplasmic staining.
|
|
c-Abl inhibits the nuclear export of p53 by E6 in HeLa cells.
As with Mdm2, the degradation of p53 by the HPV E6 protein requires, at
least to a large extent, the nuclear export of p53 (10).
It was of interest to determine whether c-Abl can also protect p53 from
E6-mediated degradation and, if so, whether it blocks the nuclear
export of p53 in HPV-infected cells. To test this hypothesis, Saos-2
cells were transfected with an expression plasmid for wild-type p53
alone, or together with an expression plasmid for E6, with
or without an expression plasmid for c-abl. Twenty-four
hours posttransfection, cells were harvested and subjected to Western
blot analysis using anti-p53 antibodies. The level of p53 expression
was reduced in the presence of E6 (Fig.
4A, lanes 1 and 2), consistent with
previous findings (37). Importantly, coexpression of c-Abl
protected p53 from E6-mediated degradation (Fig. 4A, lane 3). The same
result was obtained in H1299 cells, a lung carcinoma-derived cell line
lacking p53 expression (data not shown). Thus, c-Abl can block the
ability of E6 to destabilize p53, and this effect is not cell type
specific. It should be noted that coexpression of c-Abl with p53 in the
absence of E6 also elevated the level of p53 expression (Fig. 4A, lane
4), probably by overcoming Mdm2-mediated destabilization
(46). The protection of p53 from E6 was effective also in
the absence of c-Abl kinase activity (data not shown), as is the case
with the protection of p53 from Mdm2 (46).

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 4.
c-Abl protects p53 from degradation and inhibits its
nuclear export by E6. (A) c-Abl protects p53 from HPV E6-mediated
degradation. Saos-2 cells were transfected with the indicated
combination of expression plasmids: p53 (50 ng), HPV E6 (0.5 µg), and
c-abl (3 µg). Twenty-four hours posttransfection, cells
were harvested and cell extracts were subjected to Western blot
analysis using a mixture of anti-p53 antibodies (PAb1801 and DO1). The
same blot was reprobed with anti- -tubulin antibody. (B) HeLa cells
were transfected with the indicated expression plasmids for p53 (1 µg) together with either farnesylated pEGFP (pEGFPF; 1 µg) or
pEGFP-c-Abl (4 µg). Twenty-four hours posttransfection, cells were
treated with ALLN, fixed, and stained for p53 as described for Fig. 3A.
Stained cells were examined with a confocal microscope. Magnification,
×800. (C) Summary of the p53 staining in panel A. Over 300 stained
cells from three independent experiments were counted, and the staining
phenotype was categorized as in Fig. 3B. (D) HeLa cells were
transfected and treated as for panel B with the exception that mouse
instead of human p53 was used. Following treatment cytoplasmic (lanes 1 to 3) and nuclear (lanes 4 to 6) fractions were prepared and subjected
to Western blot analysis using anti-p53 antibody (CM5). Equal loading
between the different transfections was monitored by probing with
antiactin.
|
|
On the basis of this result, the effect of c-Abl on the nuclear export
of p53 by E6 was examined. This question was addressed with HeLa cells,
a cell line derived from an HPV-18-infected cervical carcinoma
expressing wild-type p53. HeLa cells were transfected with small
amounts of wild-type p53 expression plasmid together with expression
plasmids for either GFP or c-Abl-GFP fusion protein. Twenty-four hours
posttransfection, cells were treated with ALLN, fixed, and stained for
p53 as described above. In approximately one-half of the transfected
cells, p53 was expressed both in the nucleus and in the cytoplasm, and
in some cells it was expressed in the cytoplasm only (Fig. 4B). In
contrast, a dramatic shift in p53 localization to the nucleus was
observed when p53 and c-Abl-GFP were coexpressed (Fig. 4B).
Quantitative analysis of several hundred p53 and
c-Abl-GFP-coexpressing cells indicated that in over 90% of these
cells, p53 was confined to the nucleus (Fig. 4C). To further quantify
this finding, the effect of c-Abl on the nuclear export of p53 was
examined by Western blot analysis of nuclear and cytoplasmic fractions.
HeLa cells were transfected with expression vector for mouse p53, in
order to distinguish it from the endogenous human p53, with or without
an expression vector for c-Abl. Twenty-four hours posttransfection,
nuclear and cytoplasmic fractions were prepared and the levels of p53
in each fraction were monitored by Western blot analysis using anti-p53
polyclonal antibody (CM5; Novocastra). The presence of c-Abl enhanced
the accumulation of the p53 protein in the nucleus but not in the
cytoplasm. Overall, these results supports the notion that c-Abl
prevents the nuclear export of p53 by E6 and promotes the accumulation
of p53 within the nucleus.
Ubiquitination of p53 by Mdm2 is attenuated by c-Abl in vivo and in
vitro.
The results presented here show that c-Abl promotes p53
accumulation within the nucleus and prevents its nuclear export by Mdm2
and E6. Since Mdm2 is an E3 ligase and since E6 promotes the
ubiquitination of p53 by E6-AP, it was of great interest to determine
whether c-Abl interferes with the ubiquitination of p53 by Mdm2 or E6
to E6-AP. From the current literature, it is unclear whether the
ubiquitination of p53 occurs in the nucleus or the cytoplasm. To
address this question, the effect of c-Abl on the ubiquitination of p53
by Mdm2 was examined. To test the effect in vivo, H1299 cells were
transfected with p53 alone, p53 and mdm2, or both together with
c-abl. Twenty-four hours posttransfection, cells were
treated with ALLN for 2 h, to prevent p53 degradation, prior to
harvesting nuclear and cytoplasmic fractions. Nuclear extracts were
resolved by SDS-PAGE, and p53 ubiquitin conjugates were detected by
Western blot analysis using anti-p53 antibodies (PAb1801 and DO1).
Within the nuclear fraction, the ubiquitination of p53 was enhanced
when Mdm2 was coexpressed with p53, compared with the expression of p53
alone (Fig. 5A, lanes 2 and 3).
Importantly, the addition of c-Abl prevented the in vivo ubiquitination
of p53 by Mdm2 both of the lower conjugates and of the smear at a high
molecular weight (lane 4). This result supports the notion that c-Abl
protects p53 within the nucleus by impairing the efficiency of its
ubiquitination. It should be noted that the pattern of p53 conjugation
(lane 3) disappeared in the absence of ALLN (lane 1), supporting the
identification of the smeared and clear bands above p53 as p53
conjugates. These bands were shown to contain ubiquitin molecules by
coimmunoprecipitation assay using the ubiquitin-Ha tag (data not
shown).

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 5.
The effect of c-Abl on the ubiquitination of p53 by Mdm2
in vivo and in vitro. (A) HI299 cells were transfected with the
indicated expression plasmids for p53 (1 µg), mdm2 (2 µg), and c-abl (4 µg). Twenty-four hours after
transfection, cells were incubated with ALLN (150 µM) for 2 h.
Nuclear and cytoplasmic (cyto) fractions were prepared, and the
extracts were resolved by SDS-PAGE followed by blotting with anti-p53
antibodies (PAb1801 and DO1). The purity of the nuclear and cytoplasmic
fractionation was monitored by reprobing the membrane with anti-histone
2B and anti- -tubulin, respectively. The positions of the
p53-ubiquitin (Ub) conjugates are indicated. The intensity of the
ubiquitinated p53 bands was quantified by densitometry and is presented
as arbitrary units (10 2) below the blots. The
level of ubiquitination of p53 in the absence of ALLN (lane 1) was
taken as background and was given the value 0. The intensity in the
other lanes was calculated relative to lane 1. (B) Ubiquitination of
p53 by Mdm2 in an in vitro reconstitution assay. An in
vitro-synthesized human p53 was incubated with E1, E2 (UbcH5c), and
GST-Mdm2 (lane 2). Incubation without Mdm2 was used as a control (lane
1). Extract from Sf9 cells infected with baculovirus encoding c-Abl
(lane 3) or from noninfected Sf9 cells (lane 4) was added to the
reaction mixture, and the reaction was carried out at 30°C for 1 h.
The mixture was subjected to Western blotting using anti-p53 antibodies
(PAb1801 and DO1). The intensity of the ubiquitinated p53 bands is
presented as in panel A. The intensity of the high-molecular-weight p53
conjugates ("upper") was measured separately.
|
|
To gain further support for this conclusion, the effect of p53
conjugation was examined in an in vitro reconstitution assay. In
vitro-synthesized p53 was incubated with purified E1, His-tagged purified UbcH5c as the E2, and purified GST-Mdm2 as the E3 ligase, as
described in Materials and Methods. p53-ubiquitin conjugates appeared
only in the presence of all three components, not in the absence of
Mdm2 (Fig. 5B, lanes 1 and 2). The effect of c-Abl on the
ubiquitination of p53 was tested by including in the ubiquitination reaction extracts from control Sf9 cells or from c-Abl-expressing cells. The overall efficiency of ubiquitination was impaired in the
presence of extracts containing c-Abl by 40% (Fig. 5B, lane 3), while
the control extract had no inhibitory effect (lane 4). The inhibitory
effect of c-Abl on the generation of the high-molecular-weight p53
conjugates was more significant, reaching 60% inhibition. Overall,
these ubiquitination assays support the notion that c-Abl impairs the
ubiquitination of p53 by Mdm2.
c-Abl impairs the ubiquitination of p53 by E6 in vivo and in
vitro.
The effect of c-Abl on the ubiquitination of p53 by Mdm2
encouraged us to test its effect on the ubiquitination of p53 by E6.
This is of particular importance since some degradation of p53 by
E6-E6-AP appears to occur in the nucleus (10). The effect of c-Abl on the ubiquitination of p53 in vivo was examined in HeLa
cells. Cells were transfected with an expression plasmid for wild-type
p53 with or without an expression plasmid for c-abl. Twenty-four hours after the transfection, cells were treated with ALLN,
nuclear and cytoplasmic fractions were prepared, and extracts were
subjected to Western blot analysis using an anti-p53 antibody. Transfection of HeLa cells with p53 alone resulted in extensive ubiquitination of p53 in the nucleus as measured by the accumulation of
high-molecular-weight bands of p53 (Fig.
6A, lane 2). In the absence of ALLN,
these p53 conjugates were not observed (data not shown). Importantly,
in the presence of c-Abl there was a significant decrease in the amount
and molecular weight of the p53 conjugates in the nucleus (Fig. 6A,
compare lanes 2 and 3). A reduction of 30% was seen in the total
ubiquitination, and more importantly, with the high-molecular-weight
p53 conjugates the reduction reached 75%. c-Abl also reduced the
amount of p53 conjugates in the cytoplasm by approximately 75% (Fig.
6A, compare lanes 5 and 6). This observation demonstrates that c-Abl
impairs the efficiency and extent of E6-E6-AP-dependent ubiquitination
of p53 within the nucleus. It cannot be excluded that Mdm2 also
contributed to the ubiquitination of p53 in HeLa cells; the extent of
this contribution is difficult to assess.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 6.
c-Abl impairs the ubiquitination of p53 by E6-E6-AP in
vivo and in vitro. (A) HeLa cells were transfected with an expression
plasmid for p53 (1 µg), either alone or together with an expression
plasmid for c-Abl (4 µg). Twenty-four hours posttransfection, cells
were treated with ALLN for 2 h. Nuclear and cytoplasmic fractions
were prepared and subjected to Western blot analysis using anti-p53
antibodies (PAb1801 and DO1). The intensity of the ubiquitinated
conjugates of p53 (Ub-p53) was quantified and is presented as arbitrary
units (10 2) below the blot. The intensity of the
high-molecular-weight p53 conjugates ("upper") was also measured
separately. The levels of ubiquitination in the presence of vector
alone (lanes 1 and 4) were taken as background and given the value 0. The intensity in the other lanes was calculated relative to the
corresponding background. (B) Ubiquitination of p53 by E6-E6-AP in
vitro. Radioactively labeled p53 was synthesized in vitro and incubated
with purified E1, UbcH5C as an E2, HPV E6, and E6-AP (lanes 4 to 9). As
controls, p53 was incubated in the absence of one or more components
(lanes 1 to 3). Extracts from cells infected with baculovirus encoding
c-Abl and from noninfected cells were added to the reaction mixture.
The reaction was carried out at 30°C for 50 min, and the mixture was
subjected to SDS-PAGE followed by exposure to an X-ray film. The
intensity of the high-molecular-weight band of ubiquitinated p53 was
quantified by densitometry. Lane 4 was taken as 100%, from which the
relative intensity of ubiquitinated p53 bands was calculated.
|
|
To address the same question more directly we examined the effect of
c-Abl on the ubiquitination of p53 in an in vitro reconstitution assay.
The ubiquitination of p53 in vitro was performed essentially as
previously described (14). The p53 protein was synthesized in vitro in the presence of [35S]methionine and incubated
with purified E1, UbcH5C as an E2, HPV E6, and E6-AP. The appearance of
p53 ubiquitin conjugates was obtained only when all the components were
present (Fig. 6B, lane 4) but not in the absence of E6 or E6-AP (lanes
1 to 3). The effect of c-Abl on the ubiquitination of p53 was tested by adding to the ubiquitination reaction extracts of Sf9 cells that were
infected with baculovirus expressing c-Abl or of noninfected cells used
as a control. The efficiency of the ubiquitination of p53 was
significantly impaired in the presence of extract from c-Abl-infected
Sf9 cells in a dose-dependent manner, reaching 86% inhibition (Fig.
6B, lanes 6, 8, and 10), while the extracts from control cells had only
a minor effect, with inhibition reaching only 24% (lanes 5, 7 and 9).
The extent of inhibition by Sf9 expressing c-Abl correlated with the
integrity of the c-Abl protein in the Sf9 extracts. Overall, these in
vivo and in vitro assays suggest that c-Abl impairs the ubiquitination
of p53 by E6-E6-AP, thereby providing an explanation for the
accumulation of p53 in the nucleus.
c-Abl neutralizes the inhibitory effects of HPV E6 on p53
transcriptional activity.
The findings that c-Abl protects p53
from degradation and nuclear export by E6 (Fig. 4) and impairs its
ubiquitination by E6-E6-AP (Fig. 6) prompted us to ask whether p53
that is protected by c-Abl from E6 remains functionally active. This
was of particular interest, since the HPV E6 protein can also inhibit
p53 activity without promoting it for degradation (23, 25, 26,
43). To test this notion, the effect of c-Abl on the inhibitory
effect of E6 on p53 transcriptional activity was measured. Saos-2 cells were transiently transfected with a reporter plasmid containing the
luciferase gene under the control of the cyclin G promoter. The induction of the luciferase activity by p53 was reduced by 60% in
the presence of E6 (Fig. 7A).
Significantly, coexpression of c-Abl completely neutralized the
inhibition by E6, and p53 activity was increased to a higher level than
that obtained with p53 alone (Fig. 7A). Expression of c-Abl alone had a
minor effect on the cyclin G promoter (Fig. 7A); hence, this
effect of c-Abl was specific for p53. This result suggests that c-Abl
stabilizes p53 in an active form despite the presence of E6.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 7.
c-Abl neutralizes the inhibitory effect of E6 on p53
transcriptional activity. Saos-2 cells (A) or HeLa cells (B) were
transfected with the cyclin G luciferase reporter plasmid
alone or with expression plasmids for the various combinations as
indicated. The amounts of plasmid DNA per transfection were 50 ng (A)
or 20 ng (B) for p53, 0.5 µg for E6, 3 µg for c-Abl, and 0.5 µg
for the reporter plasmid. Twenty-four hours posttransfection, cells
were harvested and the luciferase activity in the cell extracts was
measured. Data include standard deviations of triplicates from one of
four independent experiments with consistent results.
|
|
These results raised the question of whether c-Abl protects p53 from E6
only when E6 is expressed alone or also when it is expressed in
the context of HPV-infected cell. To explore this, HeLa cells were
transfected with the cyclin G luciferase reporter plasmid
alone, and low transcriptional activity was observed, presumably
reflecting the activation of endogenous p53 by the transfection
conditions (34). Expression of c-Abl together with the
reporter gene induced a significant level of luciferase activity (Fig.
7B), supporting the notion that c-Abl enhances the transcriptional activity of endogenous wild-type p53 in the presence of E6. This activation reached already 60% of the activity that was obtained by
the expression of exogenous p53 in these cells (Fig. 7B). Co-expression of p53 together with c-Abl increased p53 activity even further, presumably reflecting the ability of c-Abl to overcome not only the
inhibition by E6 but also by other negative regulators, such as Mdm2
(46). Overall, these results support a role for c-Abl in
the activation of p53 in HPV-infected cells.
 |
DISCUSSION |
c-Abl is important for efficient accumulation of p53 in response to
DNA damage.
Under normal growth conditions, the p53 protein is
kept as a labile and inactive protein. But upon exposure to DNA damage and other stress signals, it accumulates in the nucleus and becomes transcriptionally active. Here we demonstrated that physiological levels of c-Abl are crucial for the efficient accumulation of endogenous p53 in response to various DNA-damaging agents (Fig. 1).
c-Abl enhances both the rate and the extent of p53 accumulation in
response to stress (Fig. 1). In contrast, the DNA damage-induced accumulation of p53 in c-abl-deficient fibroblasts is weak
and slow. This implicates c-Abl as an important regulator in the
stabilization of p53 in response to DNA damage. Moreover, our results
support a role for c-Abl in the regulation of p53 levels in nonstressed cells. First, the basal level of the p53 protein is significantly higher in cells expressing c-Abl than in cells lacking it. Second, the
extent of p53 stabilization by blocking its proteasomal degradation is
c-Abl dependent (Fig. 1). Hence, c-Abl is an important factor regulating the maintenance of p53 protein levels under normal conditions. This action may assure a rapid and efficient
stabilization of p53 upon exposure to stress.
These findings provide a mechanistic explanation for the cooperation
between p53 and c-Abl in response to genotoxic stresses. c-Abl enhances
the transcriptional activity of p53 (13, 47, 48) and is
required for the down-regulation of Cdk2 activity in cells exposed to
DNA damage. p53 is important for the ability of c-Abl to promote
G1 growth arrest and apoptosis (13, 47, 49,
50), suggesting a synergistic action of both proteins in the
growth-inhibitory response to genotoxic stress. c-Abl is activated by
ATM in response to DNA damage (2, 38). This provides one
of the multiple pathways by which ATM protects p53 from the inhibitory
effect of Mdm2. ATM activates p53 by direct phosphorylation on serine
15 of p53, and it activates Chk2 to phosphorylate p53 on serine 20. The
latter modification has the most dramatic effect on the accumulation of
p53 in response to DNA damage (7, 41). More recently, a
direct phosphorylation of Mdm2 by ATM has been shown to contribute to
this effect (30). Presumably, the combined activation of
multiple parallel pathways is essential for securing an efficient and
rapid activation of p53 in response to DNA damage.
c-Abl regulates p53 nuclear export and ubiquitination.
The
mechanisms involved in the enhanced accumulation of p53 in the presence
of c-Abl following DNA damage have not been defined. Since the nuclear
export of p53 is essential for its degradation by both Mdm2 and E6
(10, 35), it was tempting to propose that c-Abl protects
p53 by regulating its subcellular localization. Indeed, c-Abl is
required for the efficient accumulation of p53 in the nuclei of cells
exposed to DNA damage (Fig. 2A). Specifically, c-Abl prevents the
nuclear export of p53 by Mdm2 and by HPV E6 (Fig. 2 and 3). It is not
yet clear whether the nucleocytoplasmic shuttle of p53 requires the
nuclear export signal (NES) of Mdm2 (35), that of p53
(42), or the combined signals of both. c-Abl may affect
the accessibility of the NES of p53. c-Abl binds the C terminus of p53
and stabilizes its interaction with DNA (33). This
interaction is likely to stabilize the tetrameric form of p53 and
consequently mask the NES of p53 and prevent its nuclear export. This
notion is supported by the fact that the interaction between p53 and
c-Abl is enhanced by DNA damage (48). However, other
mechanisms operating in parallel cannot be excluded at this stage.
It has recently been suggested that the ubiquitination of p53 by Mdm2
in the nucleus facilitates its nuclear export (5, 11). It
is conceivable that the nuclear export of p53 by E6 operates through a
similar mechanism, in particular since both Mdm2 and E6 promote the
ubiquitination and nuclear export of p53 (10). c-Abl
impairs both Mdm-2- and E6-E6-AP-mediated p53 ubiquitination within
the nucleus (Fig. 5A and 6A) and in an in vitro reconstituted degradation assay (Fig. 5B and 6B). This explains the effect of c-Abl
on the accumulation of p53 in the nuclei of stressed cells. The ability
of c-Abl to interfere with both processes is consistent with this conjecture.
How does c-Abl impair the ubiquitination of p53 by E6-E6-AP and by
Mdm2? To date, little is known about the regulation of p53-ubiquitin
conjugation. While c-Abl does not inhibit the p53-Mdm2 interaction (46), it may affect the E3 ligase
activity of Mdm2 (Fig. 5). Similarly, the binding between p53 and
E6 is not inhibited by c-Abl (data not shown), but p53-E6-AP binding,
which is essential for the ubiquitination of p53 (19),
could be affected. In fact, the binding site of c-Abl in p53 (residues
363 to 393 [33]) overlaps with one of the two binding
sites for E6 (residues 376 to 384 [27]). Moreover, the
stabilization of the p53-DNA complex by c-Abl (33) may
render p53 more resistant to degradation by E6 (31). By
stabilizing the tetrameric form of p53 (33), c-Abl may
also impair efficient ubiquitination of p53 by Mdm2 or E6-AP. The
action of c-Abl on p53 stabilization may also involve indirect mechanisms, such as through p300 (51). Unraveling the
mechanism by which c-Abl impairs the ubiquitination of p53 is a subject for further investigation.
Role for c-Abl in the protection of p53 from HPV E6.
c-Abl
protects p53 from degradation by HPV E6 (Fig. 4A). This degradation is
essential for E6 to inhibit p53-mediated apoptosis (43)
but refractory for the inhibition of other activities of p53, such as
DNA binding (25), transcriptional activity, and the
induction of growth arrest (23, 26, 43). Indeed,
inhibition of E6-mediated p53 degradation by a proteasome inhibitor is
insufficient for the full activation of p53. An additional stimulation
of p53, such as exposure to DNA damage, appears to be required
(29). Importantly, the p53 protein that is protected by
c-Abl remains functionally active (Fig. 7). Therefore, c-Abl not only
protects p53 from degradation by E6 but also overcomes the
degradation-independent inhibitory effects of E6. Mechanisms underlying
the latter inhibitory effects are partially understood. E6 blocks the
interaction between p53 and the transcriptional coactivators CBP
and p300, thereby impairing the transcriptional activity of p53
(52). Further, the nuclear localization of p53 is
perturbed in the presence of E6, resulting in the accumulation of
inactive p53 in the cytoplasm (29).
In the majority of cervical tumors, p53 remains wild type (8,
36), and its signaling pathways are intact in HPV-infected cells
(6). While there is no direct evidence for the regulation of E6 in HPV-infected cells, p53 can be stabilized and activated in
response to mitomycin C in some HPV-infected cells (29). Interestingly, the same drug activates c-Abl (21) and
enhances its interaction with p53 (48). Our findings
suggest that c-Abl plays a cardinal role in the activation of p53 in
HPV-infected cells in response to stress; in this case the transfected
DNA triggers p53 activation (34). Presumably, under normal
conditions, the presence of c-Abl is insufficient to protect p53 from
HPV E6. In principle, the c-Abl protein may provide an effective means of activating p53 in HPV-infected cells.
R.V.S., S.C., and Z.G. contributed equally to
this work.
We thank M. Oren, K. Vousden, W. Jiang, and T. Hunter for the generous
gift of plasmids, D. Lane and D. Eilat for the generous gift of
antibodies, and Y. Reiss for purified E1. We are grateful to S. Moody-Haupt for critical comments.
This work was supported by a Center for Excellence grant of the Israel
Science Foundation awarded to Y.B.-N., A.C., and Y.H., by a Research
Career Development Award from the Israel Cancer Research Fund awarded
to Y.H., and by the Lejwa Fund for Biochemistry and was supported in
part by research grant 1-FY01-177 from the March of Dimes Birth Defects Foundation.
| 1.
|
Ashcroft, M., and K. H. Vousden.
1999.
Regulation of p53 stability.
Oncogene
18:7637-7643[CrossRef][Medline].
|
| 2.
|
Baskaran, R.,
L. D. Wood,
L. L. Whitaker,
C. E. Canman,
S. E. Morgan,
Y. Xu,
C. Barlow,
D. Baltimore,
A. Wynshawboris,
M. B. Kastan, and J. Y. J. Wang.
1997.
Ataxia telangiectasia mutant protein activates c-Abl tyrosine kinase in response to ionizing radiation.
Nature
387:516-519[CrossRef][Medline].
|
| 3.
|
Bell, D. W.,
J. M. Varley,
T. E. Szydlo,
D. H. Kang,
D. C. Wahrer,
K. E. Shannon,
M. Lubratovich,
S. J. Verselis,
K. J. Isselbacher,
J. F. Fraumeni,
J. M. Birch,
F. P. Li,
J. E. Garber, and D. A. Haber.
1999.
Heterozygous germ line hCHK2 mutations in Li-Fraumeni syndrome.
Science
286:2528-2531[Abstract/Free Full Text].
|
| 4.
|
Böttger, A.,
V. Böttger,
A. Sparks,
W. L. Liu,
S. F. Howard, and D. P. Lane.
1997.
Design of a synthetic Mdm2-binding mini protein that activates the p53 response in vivo.
Curr. Biol.
7:860-869[CrossRef][Medline].
|
| 5.
|
Boyd, S. C.,
K. Y. Tsai, and T. Jacks.
2000.
An intact Hdm2 RING-finger domain is required for nuclear exclusion of p53.
Nat. Cell Biol.
2:563-568[CrossRef][Medline].
|
| 6.
|
Butz, K.,
L. Shahabeddin,
C. Geisen,
D. Spitkovsky,
A. Ullmann, and F. Hoppe Seyler.
1995.
Functional p53 protein in human papillomavirus-positive cancer cells.
Oncogene
10:927-936[Medline].
|
| 7.
|
Chehab, N. H.,
A. Malikzay,
E. S. Stavridi, and T. D. Halazonetis.
1999.
Phosphorylation of Ser-20 mediates stabilization of human p53 in response to DNA damage.
Proc. Natl. Acad. Sci. USA
96:13777-13782[Abstract/Free Full Text].
|
| 8.
|
Crook, T.,
J. A. Tidy, and K. H. Vousden.
1991.
Degradation of p53 can be targeted by HPV E6 sequences distinct from those required for p53 binding and trans-activation.
Cell
67:547-556[CrossRef][Medline].
|
| 9.
|
Crook, T., and K. H. Vousden.
1992.
Properties of p53 mutations detected in primary and secondary cervical cancers suggest mechanisms of metastasis and involvement of environmental carcinogens.
EMBO J.
11:3935-3940[Medline].
|
| 10.
|
Freedman, D. A., and A. J. Levine.
1998.
Nuclear export is required for degradation of endogenous p53 by MDM2 and human papillomavirus E6.
Mol. Cell. Biol.
18:7288-7293[Abstract/Free Full Text].
|
| 11.
|
Geyer, R. K.,
Z. K. Yu, and C. G. Maki.
2000.
The Mdm2 RING-finger domain is required to promote p53 nuclear export.
Nat. Cell Biol.
2:569-573[CrossRef][Medline].
|
| 12.
|
Giaccia, A. J., and M. B. Kastan.
1998.
The complexity of p53 modulation: emerging patterns from divergent signals.
Genes Dev.
12:2973-2983[Free Full Text].
|
| 13.
|
Goga, A.,
X. Liu,
T. M. Hambuch,
K. Senechal,
E. Major,
A. J. Berk,
O. N. Witte, and C. L. Sawyers.
1995.
p53 dependent growth suppression by the c-Abl nuclear tyrosine kinase.
Oncogene
11:791-799[Medline].
|
| 14.
|
Gonen, H.,
B. Bercovich,
A. Orian,
A. Carrano,
C. Takizawa,
K. Yamanaka,
M. Pagano,
K. Iwai, and A. Ciechanover.
1999.
Identification of the ubiquitin carrier proteins, E2s, involved in signal-induced conjugation and subsequent degradation of IkBa.
J. Biol. Chem.
274:14823-14830[Abstract/Free Full Text].
|
| 15.
|
Haupt, Y.,
Y. Barak, and M. Oren.
1996.
Cell type-specific inhibition of p53-mediated apoptosis by mdm2.
EMBO J.
15:1596-1606[Medline].
|
| 16.
|
Haupt, Y.,
R. Maya,
A. Kazaz, and M. Oren.
1997.
Mdm2 promotes the rapid degradation of p53.
Nature
387:296-299[CrossRef][Medline].
|
| 17.
|
Hershko, A., and A. Ciechanover.
1998.
The ubiquitin system.
Annu. Rev. Biochem.
67:425-479[CrossRef][Medline].
|
| 18.
|
Honda, R., and H. Yasuda.
1999.
Association of p19ARF with Mdm2 inhibits ubiquitin ligase activity of Mdm2 for tumor suppressor p53.
EMBO J.
18:22-27[CrossRef][Medline].
|
| 19.
|
Huibregtse, J. M.,
M. Scheffner, and P. M. Howley.
1993.
Cloning and expression of the cDNA for E6-AP, a protein that mediates the interaction of the human papillomavirus E6 oncoprotein with p53.
Mol. Cell. Biol.
13:775-784[Abstract/Free Full Text].
|
| 20.
|
Jimenez, G. S.,
S. H. Khan,
J. M. Stommel, and G. M. Wahl.
1999.
p53 regulation by post-translational modification and nuclear retention in response to diverse stresses.
Oncogene
18:7656-7665[CrossRef][Medline].
|
| 21.
|
Kharbanda, S.,
R. Ren,
P. Pandey,
T. D. Shafman,
S. M. Feller,
R. R. Weichselbaum, and D. W. Kufe.
1995.
Activation of the c-Abl tyrosine kinase in the stress response to DNA-damaging agents.
Nature
376:785-788[CrossRef][Medline].
|
| 22.
|
Kharbanda, S.,
Z. M. Yuan,
R. Weichselbaum, and D. Kufe.
1998.
Determination of cell fate by c-Abl activation in the response to DNA damage.
Oncogene
17:3309-3318[Medline].
|
| 23.
|
Kiyono, T.,
A. Hiraiwa,
S. Ishii,
T. Takahashi, and M. Ishibashi.
1994.
Inhibition of p53-mediated transactivation by E6 of type 1, but not type 5, 8, or 47, human papillomavirus of cutaneous origin.
J. Virol.
68:4656-4661[Abstract/Free Full Text].
|
| 24.
|
Kubbutat, M. H. G.,
S. N. Jones, and K. H. Vousden.
1997.
Regulation of p53 stability by Mdm2.
Nature
387:299-303[CrossRef][Medline].
|
| 25.
|
Lechner, M. S., and L. A. Laimins.
1994.
Inhibition of p53 DNA binding by human papillomavirus E6 proteins.
J. Virol.
68:4262-4273[Abstract/Free Full Text].
|
| 26.
|
Lechner, M. S.,
D. H. Mack,
A. B. Finicle,
T. Crook,
K. H. Vousden, and L. A. Laimins.
1992.
Human papillomavirus E6 proteins bind p53 in vivo and abrogate p53-mediated repression of transcription.
EMBO J.
11:3045-3052[Medline].
|
| 27.
|
Li, X., and P. Coffino.
1996.
High-risk human papillomavirus E6 protein has two distinct binding sites within p53, of which only one determines degradation.
J. Virol.
70:4509-4516[Abstract].
|
| 28.
|
Liu, Z. G.,
R. Baskaran,
E. T. Lea Chou,
L. D. Wood,
Y. Chen,
M. Karin, and J. Y. Wang.
1996.
Three distinct signalling responses by murine fibroblasts to genotoxic stress.
Nature
384:273-276[CrossRef][Medline].
|
| 29.
|
Mantovani, F., and L. Banks.
1999.
Inhibition of E6 induced degradation of p53 is not sufficient for stabilization of p53 protein in cervical tumour derived cell lines.
Oncogene
18:3309-3315[CrossRef][Medline].
|
| 30.
|
Maya, R.,
M. Balass,
S. T. Kim,
D. Shkedy,
J.-F. M. Leal,
O. Shifman,
M. Moas,
T. Buschmann,
Z. Ronai,
Y. Shiloh,
M. B. Kastan,
E. Katzir, and M. Oren.
2001.
ATM-dependent phosphorylation of Mdm2 on serine 395: role in p53 activation by DNA damage.
Genes Dev.
15:1067-1077[Abstract/Free Full Text].
|
| 31.
|
Molinari, M., and J. Milner.
1995.
p53 in complex with DNA is resistant to ubiquitin-dependent proteolysis in the presence of HPV-16 E6.
Oncogene
10:1849-1854[Medline].
|
| 32.
|
Momand, J.,
H. H. Wu, and G. Dasgupta.
2000.
MDM2-master regulator of the p53 tumor suppressor protein.
Gene
242:15-29[CrossRef][Medline].
|
| 33.
|
Nie, Y.,
H. H. Li,
C. M. Bula, and X. Liu.
2000.
Stimulation of p53 DNA binding by c-Abl requires the p53 C terminus and tetramerization.
Mol. Cell. Biol.
20:741-748[Abstract/Free Full Text].
|
| 34.
|
Renzing, J., and D. P. Lane.
1995.
p53-dependent growth arrest following calcium phosphate-mediated transfection of murine fibroblasts.
Oncogene
10:1865-1868[Medline].
|
| 35.
|
Roth, J.,
M. Dobbelstein,
D. A. Freedman,
T. Shenk, and A. J. Levine.
1998.
Nucleo-cytoplasmic shuttling of the hdm2 oncoprotein regulates the levels of the p53 protein via a pathway used by the human immunodeficiency virus rev protein.
EMBO J.
17:554-564[CrossRef][Medline].
|
| 36.
|
Scheffner, M.,
K. Munger,
J. C. Byrne, and P. M. Howley.
1991.
The state of the p53 and retinoblastoma genes in human cervical carcinoma cell lines Proc.
Natl. Acad. Sci. USA
88:5523-5527[Abstract/Free Full Text].
|
| 37.
|
Scheffner, M.,
B. A. Werness,
J. M. Huibregtse,
A. J. Levine, and P. Howley.
1990.
The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53.
Cell
63:1129-1136[CrossRef][Medline].
|
| 38.
|
Shafman, T.,
K. K. Khanna,
P. Kedar,
K. Spring,
S. Kozlov,
T. Yen,
K. Hobson,
M. Gatei,
N. Zhang,
D. Watters,
M. Egerton,
Y. Shiloh,
S. Kharbanda,
D. Kufe, and M. F. Lavin.
1997.
Interaction between ATM protein and c-Abl in response to DNA damage.
Nature
387:520-522[CrossRef][Medline].
|
| 39.
|
Shaul, Y.
2000.
c-Abl: activation and nuclear targets.
Cell Death Differ.
7:10-16[CrossRef][Medline].
|
| 40.
|
Sherr, C. J.
1998.
Tumor surveillance via the ARF-p53 pathway.
Genes Dev.
12:2984-2991[Free Full Text].
|
| 41.
|
Shieh, S. Y.,
J. Ahn,
K. Tamai,
Y. Taya, and C. Prives.
2000.
The human homologs of checkpoint kinases Chk1 and Cds1 (Chk2) phosphorylate p53 at multiple DNA damage-inducible sites.
Genes Dev.
14:289-300[Abstract/Free Full Text].
|
| 42.
|
Stommel, J. M.,
N. D. Marchenko,
G. S. Jimenez,
U. M. Moll,
T. J. Hope, and G. M. Wahl.
1999.
A leucine-rich nuclear export signal in the p53 tetramerization domain: regulation of subcellular localization and p53 activity by NES masking.
EMBO J.
18:1660-1672[CrossRef][Medline].
|
| 43.
|
Thomas, M.,
G. Matlashewski,
D. Pim, and L. Banks.
1996.
Induction of apoptosis by p53 is independent of its oligomeric state and can be abolished by HPV-18 E6 through ubiquitin mediated degradation.
Oncogene
13:265-273[Medline].
|
| 44.
|
Thomas, M.,
D. Pim, and L. Banks.
1999.
The role of the E6-p53 interaction in the molecular pathogenesis of HPV.
Oncogene
18:7690-7700[CrossRef][Medline].
|
| 45.
|
Vogt Sionov, R., and Y. Haupt.
1999.
The cellular response to p53: the decision between life and death.
Oncogene
18:6145-6157[CrossRef][Medline].
|
| 46.
|
Vogt Sionov, R.,
E. Moallem,
M. Berger,
A. Kazaz,
O. Gerlitz,
Y. Ben Neriah,
M. Oren, and Y. Haupt.
1999.
c-Abl neutralizes the inhibitory effect of Mdm2 on p53.
J. Biol. Chem.
274:8371-8374[Abstract/Free Full Text].
|
| 47.
|
Wen, S.-T.,
P. K. Jackson, and R. A. Van Etten.
1996.
The cytostatic function of c-Abl is controlled by multiple nuclear localization signals and requires the p53 and Rb tumor suppressor gene products.
EMBO J.
15:1583-1595[Medline].
|
| 48.
|
Yuan, Z.-M.,
Y. Huang,
M. M. Fan,
C. Sawyers,
S. Kharbanda, and D. Kufe.
1996.
Genotoxic drugs induce interaction of the c-Abl tyrosine kinase and the tumor suppressor protein p53.
J. Biol. Chem.
271:26457-26460[Abstract/Free Full Text].
|
| 49.
|
Yuan, Z.-M.,
Y. Huang,
T. Ishiko,
S. Kharbanda,
R. Weichselbaum, and D. Kufe.
1997.
Regulation of DNA damage-induced apoptosis by the c-Abl tyrosine kinase.
Proc. Natl. Acad. Sci. USA
94:1437-1440[Abstract/Free Full Text].
|
| 50.
|
Yuan, Z.-M.,
Y. Huang,
Y. Whang,
C. Sawyers,
R. Weichselbaum,
S. Kharbanda, and D. Kufe.
1996.
Role for c-Abl tyrosine kinase in growth arrest response to DNA damage.
Nature
382:272-274[CrossRef][Medline].
|
| 51.
|
Yuan, Z. M.,
Y. Huang,
T. Ishiko,
S. Nakada,
T. Utsugisawa,
H. Shioya,
Y. Utsugisawa,
K. Yokoyama,
R. Weichselbaum,
Y. Shi, and D. Kufe.
1999.
Role for p300 in stabilization of p53 in the response to DNA damage.
J. Biol. Chem.
274:1883-1886[Abstract/Free Full Text].
|
| 52.
|
Zimmermann, H.,
R. Degenkolbe,
H. U. Bernard, and M. J. O'Connor.
1999.
The human papillomavirus type 16 E6 oncoprotein can down-regulate p53 activity by targeting the transcriptional coactivator CBP/p300.
J. Virol.
73:6209-6219[Abstract/Free Full Text].
|