Previous Article | Next Article 
Molecular and Cellular Biology, September 2001, p. 5879-5888, Vol. 21, No. 17
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.17.5879-5888.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Structural and Functional Analysis of an mRNP
Complex That Mediates the High Stability of Human
-Globin
mRNA
Jia
Yu1 and
J. Eric
Russell1,2,*
Departments of
Medicine1 (Hematology/Oncology) and
Pediatrics (Hematology),2 University of
Pennsylvania School of Medicine and The Children's Hospital of
Philadelphia, Philadelphia, Pennsylvania 19104
Received 12 April 2001/Returned for modification 10 May
2001/Accepted 7 June 2001
 |
ABSTRACT |
Human globins are encoded by mRNAs exhibiting high stabilities in
transcriptionally silenced erythrocyte progenitors. Unlike
-globin
mRNA, whose stability is enhanced by assembly of a specific messenger
RNP (mRNP)
complex on its 3' untranslated region (UTR), neither the
structure(s) nor the mechanism(s) that effects the high-level stability
of human
-globin mRNA has been identified. The present work
describes an mRNP complex assembling on the 3' UTR of the
-globin
mRNA that exhibits many of the properties of the stability-enhancing
complex. The
-globin mRNP complex is shown to contain one or
more factors homologous to
CP, a 39-kDa RNA-binding protein that is
integral to
-complex assembly. Sequence analysis implicates a
specific 14-nucleotide pyrimidine-rich track within its 3' UTR as the
site of
-globin mRNP assembly. The importance of this track to mRNA
stability is subsequently verified in vivo using mice expressing human
-globin transgenes that contain informative mutations in this
region. In combination, the in vitro and in vivo analyses indicate that
the high stabilities of the
- and
-globin mRNAs are maintained
through related mRNP complexes that may share a common regulatory pathway.
 |
INTRODUCTION |
Eukaryotic mRNAs display half-lives
(t1/2s) that range from as short as several
minutes (74) to as long as several days (1,
52). Although short-lived mRNAs are typically present in low
abundance, their steady-state levels rapidly adjust to reflect
fluctuations in gene transcriptional activity. In contrast, long-lived
mRNAs may accumulate to high levels that are relatively slow in
responding to changes in gene transcription. It is not surprising that
mRNAs encoding cytokines, proto-oncogenes, and factors that
regulate gene transcription, cell growth, and cell cycling are
generally short-lived (6, 49), while mRNAs encoding structural proteins (e.g., collagens) (24, 41) or highly
abundant functional products (e.g., crystallins and globins) (4,
36, 52, 66) display longer t1/2s.
Although the stabilities of most mRNAs are likely to be constitutive,
some
including mRNAs encoding the transferrin receptor
(34), histones (5), tubulin (15), and interleukin-2 (11, 12)
display
dynamic stabilities that vary in response to changing cellular
requirements or environmental conditions (reviewed in reference
49).
The t1/2s of individual mRNAs reflect the
combined effects of general and specific determinants of mRNA
stability. Two nearly invariant features of eukaryotic mRNAs
the
m7G(5')ppp(5')N cap (21, 60) and 3' poly(A)
tail (7, 37, 73)
are believed to provide a basal level of
stability to all mRNAs by preventing their degradation by cytoplasmic
exonucleases. The mRNA-stabilizing properties of the poly(A) tail have
been linked both to its poly(A)-binding protein-binding function
(7, 50) and to its capacity to stimulate active
translation (46; reviewed in references 49 and
57). In addition to these general determinants, a number of
well-defined cis elements appear to mediate the stabilities
of specific mRNAs. These structurally diverse elements include linear
A+U-rich (59) and C+U-rich (72) motifs, as
well as an array of stem-and-loop structures (34, 48, 58).
mRNA decay rates are modified, either positively or negatively, by a
specific trans-acting factor(s) that targets these sites.
With few exceptions (30, 61, 74), cis elements are positioned within the 3' UTR, where their functional interactions are not subject to steric disruption by actively translating ribosomes.
The cis elements required for full
-globin mRNA stability
have been particularly well defined. Early observations that
-globin mRNAs containing naturally occurring antitermination mutations failed
to accumulate in posttranscriptional reticulocytes, despite their
normal levels in transcriptionally active erythroid progenitors, led to
the hypothesis that one or more stability-enhancing elements might be
positioned within the
3' UTR (38). Analyses of
-globin mRNAs containing informative mutations in both cultured
cells (71, 72) and in animal models (45, 56)
confirmed the importance of the 3' UTR to
-globin mRNA stability.
The capacity of this region to function autonomously was demonstrated
in transgenic mice where the stability of human
-globin
(h
-globin) mRNA nearly doubled when its 3' UTR was replaced by an
3' UTR (56). Crucial mRNA-stabilizing activity was
subsequently mapped to a 3' UTR region containing a 16-nucleotide (nt)
sequence comprised entirely of cytosine and uridine residues (termed
the
pyrimidine-rich element or PRE) (33, 67). Although
site-specific PRE mutations destabilize
-globin mRNAs expressed
in cultured cells (67, 71, 72), their effects on mRNAs
expressed in whole-animal models have never been established.
The identification of sequences specifying high
-globin mRNA
stability has facilitated a detailed characterization of the mechanism
through which this property is effected. When incubated in cytoplasmic
extracts,
3' UTRs assemble a messenger RNP (mRNP)
complex that
is characterized by its mobility and sensitivity to competition by
specific homodeoxyribopolymers (28, 67). Mutations within
the
PRE have parallel effects on
complex assembly in vitro and
on
-globin mRNA stability in cultured cells, linking the mRNP
complex to its anticipated molecular function (33, 67).
The number and identity of trans-acting factors comprising
the complete
complex is still debated (13, 32, 68),
although there is general agreement that a ubiquitous 39-kDa RNA-binding factor,
CP, is a core participant (31, 33, 42, 67). Using an RNA titration recruitment assay and density
sedimentation analysis, Chkheidze and colleagues have concluded that
the
complex is a binary structure comprising the
3' UTR and
CP (13). In contrast, Kiledjian et al. have identified
AUF-1 (75) as a component of the
complex using a yeast
two-hybrid method (32). The same group subsequently
demonstrated that assembly of a stable high-order structure comprising
CP and poly(A)-binding protein preserved
-globin mRNA stability
by blocking access of an erythroid cell-specific endoribonuclease to
its target site within the
PRE (69, 70). Hence, there
has been considerable progress in identifying both the cis-
and trans-acting elements that are crucial to
-globin
mRNA stability, as well as the mechanism through which they function.
Unlike the
-globin mRNA, neither the cis elements nor the
trans factors that specify the high stability of
-globin
mRNA are known. Estimates from theoretical models (3), 3T3
cells (30), mouse erythroleukemia (MEL) cells (1,
35), cultured mouse spleen cells and reticulocytes
(4), human reticulocytes (52), and human bone
marrow (51) suggest a t1/2 for
-globin mRNA in the range of 16 to 20 h. Although several
hundred naturally occurring mutations are known to affect
-globin
gene expression, few offer clues as to the position of a specific mRNA
stability-enhancing region or its likely mechanism. Single-nucleotide
conversions affecting pre-mRNA splicing or resulting in premature
translational termination can accelerate
-globin mRNA degradation,
but through pathways that are unlikely to affect a specific
mRNA-stabilizing element (reviewed in references 8, 20, and
43). Likewise, frameshift mutations in the terminal coding
region that permit ribosomes to read through the proximal one-third of
the
3' UTR have relatively little impact on overall
-globin
expression (9, 18, 19, 54), suggesting that crucial
stability elements are downstream of this region. It has also been
suggested that
-globin mRNA stability might result from spatially
distinct but functionally redundant cis elements
(54). Hence, there is a need to define both the structure
and function of specific
-globin mRNA stability elements.
The present work investigates the structural basis for the high
stability of
-globin mRNA. In vitro conditions are established that
promote the assembly of a specific
-globin mRNP complex, whose
structural composition and functional properties are compared to those
of the stability-enhancing mRNP
complex. This analysis indicates
that the
mRNP complex contains an
CP-like factor(s) and
implicates a 14-nt PRE within the
-globin 3' UTR where it is likely
to act. The functional importance of this PRE is subsequently verified
in terminally differentiating erythroid progenitors in intact mice
carrying h
-globin transgenes with informative mutations in this
region. Our results indicate that structurally related mRNPs assemble
on PREs within the
- and
-globin 3' UTRs and that the
PRE is
crucial to the high stability of h
-globin mRNA. The data also
encourage speculation that the stabilities of the h
- and h
-globin
mRNAs might be coregulated through a related mechanism.
 |
MATERIALS AND METHODS |
Electrophoretic mobility shift assay (EMSA). (i) Preparation of
cytoplasmic extracts.
S-100 extracts were prepared from cultured
MEL cells as previously described (56). Briefly, ~2 × 108 cells in the log phase of growth were washed in
excess phosphate-buffered saline (PBS), pelleted, and lysed in 3.5 ml
of buffer A (10 mM KCl, 1.5 mM MgCl2, 10 mM Tris, pH 7.4, 0.5 mM dithiothreitol [DTT], 200 ng of pepstatin/ml, 200 ng of
leupeptin/ml, and 10 µg of aprotinin/ml) by successive passages
through 23- and 25-gauge needles. The crude extract was clarified at
4°C by a 10-min spin at 2,000 × g (Sorvall RC-5B;
DuPont Instruments) followed by vacuum ultracentrifugation for 60 min
in an SW51Ti rotor at 32,500 rpm (Beckman, Columbia, Md.). The
supernatant was amended with 0.1 volume of glycerol and stored in
aliquots at
80°C. A protein yield of ~4 mg/ml was typical of this
method (bicinchoninic acid kit; Pierce, Rockford, Ill.).
(ii) Generation of mRNAs.
The construction of a cDNA
template for the in vitro transcription of h
mRNA 3' UTRs has been
previously described (53). A cDNA template for in vitro
transcription of h
3' UTR mRNA was generated by thermal
amplification of the cloned gene (54) by Taq
polymerase (New England BioLabs, Beverly, Mass.) using forward (5'
ATACg
AACTCgCTCgCTTTCTTgCTgTCC
3') and reverse (5' gCAATgAAAATAAATgTTTTTTATTA 3')
oligomers under standard reaction conditions. The forward
oligomer contains an SP6 promoter (doubly underlined) and its consensus
transcription initiation sequence (singly underlined). Amplified cDNAs
were purified over G50 spin columns (Boehringer Mannheim, Indianapolis,
Ind.) (56). In vitro transcriptions were carried out in
the presence of [
-32P]CTP (400 Ci/mmol, 10 mCi/ml;
Amersham, Arlington Heights, Ill.) using a Maxiscript SP6 kit under
conditions recommended by the manufacturer (Ambion, Austin, Tex.). An
aliquot of each reaction was resolved on a 6% acrylamide-8 M urea gel
to assess probe quality (56). Competitor oligomers
(Integrated DNA Technologies, Coralville, Iowa) were resuspended at 100 nmol/µl.
(iii) EMSA analyses.
As described previously
(56), reaction mixtures (15 µl) assembled from 4 µl of
S-100 extract and a ~50,000-cpm probe in 1× reaction buffer (150 mM
KCl, 1.5 mM MgCl2, 10 mM Tris, pH 7.4, 0.5 mM DTT, 200 ng
of pepstatin/ml, 200 ng of leupeptin/ml, and 10 µg of aprotinin/ml)
were incubated at room temperature for 30 min, supplemented with RNase
A (1 µl, 250 µg/ml) and RNase T1 (1 µl, 2,000 U/ml), and
incubated for an additional 10 min. Reactions were resolved on a
nondenaturing 6.5% polyacrylamide gel (56).
Generation of transgenic mice.
All animal experimentation in
this study fully complied with protocols approved by the Institutional
Animal Care and Use Committee at the University of Pennsylvania School
of Medicine. All of the transgenes utilized in this work derive
from a previously described transgene encoding wild-type human
-globin (h
WT) mRNA (27). This
pSP72-based plasmid contains a 6.5 kb micro-locus control region
(µLCR) within an engineered SstI polylinker site (27, 39, 63) and a 4.1-kb HpaI-XbaI
fragment of human genomic DNA encompassing the full-length
-globin
gene and its 5' promoter and 3' enhancer elements (65)
within a unique ClaI site. The cloning strategy preserves
the native order and orientation of the µLCR and h
-globin
fragments. EcoRI-EcoNI fragments of the
-globin gene (encompassing exon 3 coding and 3' UTR sequences and
692 bp of the contiguous 3' flanking region) that contained the
readthrough (
RT), deletion (
DEL), or
substitution (
SUB) mutations were ligated into the
corresponding site of the
WT transgene. A fragment
containing the
RT mutation was prepared from an
EcoRI-EcoNI digest of the previously constructed
p
B,Af plasmid (54). DNA fragments
containing the
DEL and
SUB mutations were
generated by splice-overlap-extension PCR (53, 56). To
prepare the
DEL fragment, a 166-bp DNA fragment
encompassing the exon 3 EcoRI site and the desired
deletion was generated by PCR amplification of the
-globin
sequence using forward (Fi 5' AACGTGCTGGTCTGTGTGCT 3')
and reverse (Del-R: 5' GTAGTTGGACTTCCTTTAATAGAAATTGGACAGC 3') oligomers. A second 822-bp DNA fragment encompassing the
mutation and the EcoNI site was generated from the
-globin gene using forward (Del-F: 5'
CTATTAAAGGAAGTCCAACTACTAAACTGGGGG 3') and reverse (R: 5'
AGAATGGGACTTCCATTTGG 3') oligomers. Fifty-microliter reactions containing 20 ng of DNA template, 100 nmol of each oligomer, and 2 mM
Mg2SO4 were amplified with Vent polymerase as
recommended by the manufacturer (New England BioLabs). A standard
amplification program was utilized (cycle 1, 95°C for 3 min, 58°C
for 15 s, and 73°C for 45 s; cycles 2 to 30, 92°C for 1 min,
58°C for 15 s, and 73°C for 45 s; and cycle 31, 73°C for
45 s). Aliquots of each of the initial reactions were combined and
reamplified using the two flanking oligomers (F and R) but with the
extension time prolonged to 60 s. The 980-bp product was digested
with EcoRI and EcoNI and was ligated into the
cognate site of the
WT transgene plasmid. The
SUB transgene was generated using a similar protocol but
with two different internal oligomers (Sub-F, 5'
GAAAAGAAGGAAAgAAGTCCAACTACTAAACTGGGGG 3'; Sub-R, 5'
CTTTCCTTCTTTTCCCTTTAATAGAAATTGGACAGC 3'). The fidelity of the
method was verified by sequencing through the coding, 3' UTR, and
proximal 3' flanking region. Each transgene was subsequently released
as a 10.6-kb SalI-EcoRV fragment, purified, and
provided to the Transgenic and Chimeric Mouse Facility at the
University of Pennsylvania for pronuclear injection (27, 45,
56). Positive founders identified by sequential dot blot and
Southern analysis were used to generate FI mice with germ
line transgene integration (27, 45, 56). Five independent
WT lines have been previously described
(27). Although 12
RT founders were
generated by multiple pronuclear injections performed over the course
of more than a year, only a single line could be established that
expressed the
RT mRNA (see Results). Three and two
independent
DEL and
SUB lines,
respectively, were generated.
Recovery and purification of mouse mRNA. (i) Preparation of
animals.
Sexually mature male and female mice were pretreated with
three intraperitoneal doses of acetyl-2-phenylhydrazine (40 µg/g of
body weight; Sigma) on days 0.0, 0.5, and 1.0 and were subsequently sacrificed on day 4.5. Bone marrow and blood were separately collected in PBS-heparin (20 U/ml) as previously described (39, 45, 56).
(ii) RNA purification.
Tissues were lysed in a 5 M guanidine
isothiocyanate solution (50 mM Tris [pH 7.4], 10 mM EDTA, 700 mM
-mercaptoethanol, and 1% sarcosyl) and were centrifuged through a
5.7 M CsCl cushion at 42,000 rpm for 16 h in a TL-55 rotor
(Beckman). RNAs were resuspended in 10 mM Tris, pH 7.4, 1 mM EDTA, and
1% sodium dodecyl sulfate, extracted twice with
phenol-chloroform-isoamyl alcohol, and precipitated. The concentration
of the resuspended mRNAs was established spectrophotometrically by
densitometry at a wavelength of 260 nm (39, 45, 56).
RNase protection assay (RPA). (i) Generation of antisense
probes.
A previously constructed cDNA template containing a
contiguous region of intron 1 and exon 2 from the mouse
-globin
(m
-globin) gene (39) encodes a 235-nt antisense RNA
that protects a 179-nt fragment of the fully processed m
-globin
mRNA. A cDNA template encoding an antisense h
-globin mRNA probe was
generated from a cDNA fragment containing contiguous regions of intron
1 and exon 2 using forward (5' GATCCCCGGGTACCCTGATAGGCACTGACTCTCT
3') and reverse (5' TTGCATGCCTGCAGCAGCTTGTCACAGTGCAGCT 3')
oligomers in a standard thermal amplification reaction. The
261-bp PstI-KpnI fragment of the PCR-amplified
product was inserted into the cognate polylinker site of pSP72, and the
sequence was confirmed by automated sequencing. DNAs linearized with
EcoRI were transcribed in vitro using SP6 polymerase to
generate a 287-nt probe protecting a 199-nt fragment of h
exon 2. 32P-labeled m
- and h
-globin probes were transcribed
in vitro as described above.
(ii) RPA method.
Purified bone marrow (~1,500 ng) and
peripheral blood (~100 ng) RNAs were desiccated and resuspended in 20 µl of Berk buffer {80% formamide, 40 mM PIPES
[piperazine-N,N'-bis(2-ethane sulfonic acid)] [pH 6.4],
400 mM NaCl, and 1 mM EDTA} supplemented with h
and m
probes,
heat denatured for 10 min at 80°C, and incubated overnight at 52°C.
The samples were digested at room temperature for 25 min in 200 µl of
buffer (10 mM Tris [pH 7.5], 300 mM NaCl, 5 mM EDTA, 20 mg of RNase
A/ml, and 1 mg of RNase T1/ml), and the reaction terminated by addition
of 17 µl of stop solution (8% sodium dodecyl sulfate and 2 mg of
proteinase K/ml) and incubating at 37°C for an additional 20 min. The
samples were extracted with phenol-chloroform-isoamyl alcohol,
precipitated with ethyl alcohol, resolved on a denaturing
polyacrylamide-urea gel, and quantitated by PhosphorImager analysis
(Molecular Dynamics). RNA stability is defined as
[(h
)/(m
)]PB/[(h
)/(m
)]BM, where
PB and BM indicate peripheral blood and bone marrow, respectively.
Northwestern analysis.
EMSA reaction mixtures were resolved
on nondenaturing polyacrylamide gels as described above and were then
transferred at 4°C to a nitrocellulose membrane (Schleicher & Schuell, Keene, N.H.) in transfer buffer (25 mM Tris [pH 7.4], 190 mM
glycine, and 20% methanol) at 30 V using a Hoefer Transphor Tank
apparatus (Amersham Pharmacia Biotech, San Francisco, Calif.).
Membranes were rinsed in PBS and then gently shaken for 2 h at room
temperature in Northwestern buffer (10 mM Tris [pH 7.4], 50 mM NaCl,
1 mM EDTA, and 1× Denhardt's solution) augmented with 1 mM DTT.
Membranes were subsequently incubated for 2 h at room temperature in
Northwestern buffer augmented with 5 µg of heparin/ml, 10 µg of
tRNA/ml, and ~20,000 cpm of 32P-labeled RNA probe/ml and
were then washed in Northwestern buffer and exposed to autoradiography.
Reactions containing no 32P-labeled RNA were run in
parallel as controls.
Supershift assay.
EMSA reactions supplemented with 1 µl of
affinity-purified rabbit antiserum recognizing two independent
CP
isoforms (
CP-1 and -2; kind gift of S. Liebhaber
[13]) were resolved on nondenaturing polyacrylamide gels
as described above. Reactions incubated in the absence of antiserum,
either with or without homodeoxyribopoly(C) as competitor, were run in
parallel as controls.
 |
RESULTS |
The
-globin 3' UTR assembles an mRNP complex that comigrates
with the authentic
complex.
Although the long
t1/2 of
-globin mRNA (1, 35, 40, 51,
52), as well as its close phylogenetic relationship to
-globin mRNA (22, 23), suggested the possibility that
the
-globin 3' UTR might contain a conserved
-like PRE, a direct structural comparison failed to reveal any significant sequence homologies (not shown). Consequently, an alternate approach was employed to directly determine whether the
3' UTR could assemble an
mRNP complex with attributes similar to those of the
stability-enhancing
complex (67). Specifically, these
characteristics include similar migration on a nondenaturing
polyacrylamide gel (28), a high sensitivity to competition
by homodeoxyribopoly(C) but not by other homodeoxyribopolymers
(28, 67), and a sensitivity to competition by PREs from
other mRNAs (28). RNA EMSAs indicate that the
migration of in vitro-transcribed 32P-labeled
3' UTRs
is substantially retarded when they are preincubated in cytoplasmic
extract prepared from MEL cells (Fig. 1,
lanes 4 and 6). In contrast, 32P-labeled
3' UTRs
incubated with proteinase K-treated extracts migrate normally (data not
shown). These results indicate that the
3' UTR assembles with
trans-acting factors into an mRNP complex that we have
termed the
complex. Importantly, the
and
complexes
comigrate on nondenaturing polyacrylamide gels (Fig. 1, lanes 3 and 6).
Identical mRNP complexes readily assemble on heat-denatured
32P-labeled
or
3' UTRs, suggesting that the
participating cis elements are thermodynamically stable and
kinetically accessible (data not shown). In contrast to the
complex, the
complex appears to be relatively intolerant of
variations in buffer pH and salt concentration, possibly reflecting
differences in the affinities of shared trans-acting factors
for structurally dissimilar
and
cis elements (data
not shown).

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 1.
h - and h -globin mRNA 3' UTRs assemble comigrating
mRNP complexes in vitro. An EMSA was performed by incubating
32P-labeled and 3' UTR probes in MEL cell
cytoplasmic (S-100) extract and resolving the RNase-resistant mRNP
products on a nondenaturing 6.5% polyacrylamide gel. Extract-free
reactions assembled in the absence (lanes 1 and 4) or presence (lanes 2 and 5) of added RNase were run in parallel as controls. The composition
of each reaction is indicated at the top of the autoradiograph, and the
migration of the mRNP complexes is shown on the left.
|
|
The
and
complexes display similar competition
profiles.
To further establish its similarity to the
complex,
the efficiency of
complex assembly was tested in the presence of
specific homodeoxyribopolymers (Fig. 2).
The
complex is efficiently competed by unlabeled
homodeoxyribopoly(C) but not by homodeoxyribopoly(A) or -(G) (Fig. 2,
lanes 10 to 13). This competition pattern reproduces the effect of
these polymers on
complex assembly (Fig. 2, lanes 3 to 6)
(67). In contrast to the
complex,
complex assembly appears to be modestly sensitive to competition by homodeoxyribopoly(T) (Fig. 2, compare lanes 7 and 14), a characteristic that might predict a
high uridine content for the
cis element.

View larger version (84K):
[in this window]
[in a new window]
|
FIG. 2.
Assembly of - and -globin mRNP complexes is
inhibited by homodeoxyribopoly(C) but not by other
homodeoxyribopolymers. EMSA reactions were performed on
32P-labeled and 3' UTRs supplemented with 100 µg
of unlabeled competitor homodeoxyribopolymer (dC, dA, dG, and dT).
Control lanes demonstrate migration of RNase-undigested 3' UTRs (lanes
1 and 8) and RNase-digested 3' UTRs (lanes 2 and 9) in extract-free
reactions. The components of each reaction are indicated at the top of
the autoradiograph, and the positions of the and mRNP complexes
are shown on the left.
|
|
The
and
mRNP complexes cross-compete for labeled
mRNAs.
The structural identity of the
and
complexes was
further tested using standard cross-competition experiments.
32P-labeled
3' UTRs were incubated with cytoplasmic
S-100 extracts in the presence of known quantities of unlabeled
- or
-globin 3' UTRs (Fig. 3A, lanes 4 to 6 and 7 to 9, respectively). For completeness, the converse
experiment
competing 32P-labeled
3' UTRs with
unlabeled
and
3' UTRs
was also performed (Fig. 3B). In both
cases, the 32P-labeled probes were efficiently competed by
increasing levels of either of the two unlabeled competitor RNAs. The
outcome of the experiment was not affected by the order in which the
cytoplasmic extract, 32P-labeled 3' UTRs, or unlabeled
competitor 3' UTRs were added to the reaction (data not shown).
Confirming experiments indicated that the
3' UTRs might be
marginally better competitors than the
3' UTRs, consistent with the
hypothesis that trans-acting components bind to the two 3'
UTRs with different affinities. Nevertheless, the observation that the
and
3' UTRs assemble identically migrating, cross-competing
mRNP complexes that are effectively competed by homodeoxyribopoly(C)
suggests that the
complex shares structural characteristics, and
possibly functional properties, with the stability-enhancing
complex.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 3.
Binding specificity of trans-acting factors
for and 3' UTRs. EMSA analyses were performed using in
vitro-transcribed 32P-labeled -globin 3' UTRs (A) and
-globin 3' UTRs (B) incubated in MEL cell S-100 extract. Reactions
were supplemented with defined quantities of unlabeled - or -mRNA
3' UTR competitor. The composition of each reaction mixture is
indicated above the autoradiograph, and the positions of the and
complexes are shown on the left.
|
|
Fully assembled
and
mRNP complexes efficiently bind both
and
3' UTRs.
An independent method, Northwestern analysis,
was used to confirm the structural similarities between the
and
complexes suggested by the preceding experiments. Unlabeled
and
complexes were resolved in triplicate on the same gel and transferred
to nitrocellulose, and the renatured protein complexes were
probed with 32P-labeled
or
3' UTRs (Fig.
4). On the same gel a
32P-labeled
complex was resolved as a migration marker
(Fig. 4, lane 3). 32P-labeled
and
3' UTR probes
were observed to bind to lanes containing (unlabeled)
and
complexes at positions corresponding to the control
complex (Fig.
4, compare lane 3 to lanes 6, 7, 9, and 10). Control lanes containing
cytoplasmic extract alone (Fig. 4, lanes 5 and 8) bound the
32P-labeled 3' UTR probes at a similar position but with
severalfold-lower efficiency, suggesting that mRNP complexes, believed
to be assembled on murine globin mRNAs, persist at low levels within
the S-100 extract. A control blot probed with a 32P-labeled
RNA corresponding to the pSP72 polylinker sequence did not display the
mRNP complex band (Fig. 4, lanes 11 to 13). These results indicate a
high relative specificity of the
and
complexes for both the
and
3' UTRs and support the hypothesis that the two mRNP complexes
are structurally related.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 4.
Fully assembled and complexes exchange - and
-globin 3' UTRs. In vitro-transcribed - and -globin 3' UTRs
were incubated in MEL cell S-100 extract and then resolved on a single
polyacrylamide gel. (Left) A reaction utilizing 32P-labeled
3' UTR indicates the migration of the complex (lane 3).
Undigested and fully digested probes, as well as a
homodeoxyribopoly(C)-competed reaction, were included as controls
(lanes 1, 2, and 4). The composition of each reaction is indicated
above the autoradiograph, and the position of the complex is shown
on the left. (Right) On the same gel, reactions utilizing 3' UTRs
(lanes 6, 9, and 12) and 3' UTRs (lanes 7, 10, and 13) were
resolved in triplicate. Control lanes 5, 8, and 11 contained S-100
extract alone. The complexes were transferred to a nylon membrane and
were subsequently probed with either 32P-labeled 3'
UTR, 32P-labeled 3' UTR, or an unrelated
[32P]mRNA control (indicated at bottom), and
autoradiographs were exposed. The composition of each reaction is
indicated above the autoradiograph. A double-headed arrow emphasizes
comigration of the complex and the membrane-bound mRNP complexes
that exchange 32P-labeled and 3' UTRs.
|
|
Antibodies to
CP recognize elements of the
complex.
To
directly assess whether elements of the
and
complexes were
structurally related, supershift analysis of the
complex was
carried out using two independently generated rabbit antisera recognizing the core component of the
complex. Affinity-purified antiserum against two different
CP isoforms (
CP-1 and
CP-2) were utilized, as both isoforms are known to participate in the mRNP
complex (13, 42). Reactions utilizing the antiserum, both alone and in combination, displayed a reduction in the intensity of the
complex and the reciprocal appearance of a more slowly migrating band (Fig. 5). It is likely
that the new band comprises antibody-bound
complex, although we
cannot rule out the possibility that it represents a secondary mRNP
complex that assembles as a result of antibody sequestration of
CP.
Both possibilities directly implicate
CP or an
CP-like factor as
a participant in both the
and
complexes and suggest a
structural basis for the functional similarities that they exhibit.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 5.
Anti- CP antibodies bind the mRNP complex.
32P-labeled 3' UTR was incubated in MEL cell S-100
extract in the absence (lanes 1 and 2) or presence (lanes 3 to 5) of
anti- CP antibodies, and the reactions were resolved on a
nondenaturing polyacrylamide gel. FF1 and FF3 denote rabbit antisera
raised against CP-1 and CP-2 isoforms, respectively. The reaction
shown in lane 2 was supplemented with homodeoxyribopoly(C) to verify
the position of the complex. The composition of each reaction is
indicated at the top of the gel, and the positions of the native and
supershifted complexes are given on the left.
|
|
PREs are present in the 3' UTR of h
-globin mRNA.
In light
of the above observations, the
-globin 3' UTR was reexamined to
identify pyrimidine-rich tracks containing any combination of cytosine
and/or uridine residues (Fig. 6).
Although the C+U content of the
and
3' UTRs is similar (62 and
58%, respectively), nearly half of the 76 pyrimidines within the
3' UTR are clustered into three tracks that we have designated
PRE-1, -2, and -3. Of these three elements, we hypothesized that the
longest,
PRE-2, was likeliest to play a functional role in
-globin mRNA stability. In contrast to the
PRE,
PRE-2 has a
higher proportion of uridine residues (57 versus 31%)
(28) and is interrupted by a single-nucleotide purine
G. These features are consistent with the heterogeneity in both
overall length and cytosine/uridine ratio that characterize PREs
assembling
complexes on
globin (67), tyrosine
hydroxylase (16), 15-lipoxygenase (47), and
1(I)-collagen (62) mRNAs.
-Globin genes containing
antitermination frameshift mutations permitting ribosomes to read
through
PRE-1 to a UAA termination codon 10 codons into the 3' UTR
are expressed at normal or near-normal levels (9, 18, 19,
54), suggesting that the structural integrity of
PRE-1 is
not required for high
-globin mRNA stability. Likewise,
PRE-3 is
a less attractive candidate than
PRE-2 as a stabilizing
cis element because of its short length (10 nt), cytosine
deficiency (a single residue), and positioning 3' to the AAUAAA
polyadenylation hexanucleotide. These structural considerations predicted that
PRE-2 would be the likeliest of the three C+U-rich tracks to effect high
-globin mRNA stability.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 6.
The -globin 3' UTR contains three extended PREs. The
-globin 3' UTR is displayed with the native UAA termination codon
and AAUAAA polyadenylation signal doubly underlined.
-Globin mRNAs carrying naturally occurring +2 frameshift
antitermination mutations terminate translation at an in-frame UAA 10 codons into the 3' UTR (underlined; see text). Pyrimidine-rich
tracks designated PRE-1, -2, and -3 are boldfaced and labeled.
|
|
Generation of mice containing h
-globin transgenes with
antitermination mutations.
The preceding structural considerations
predicted that the
-globin 3' UTR, and specifically
PRE-2, might
play a functional role in
-globin mRNA stability. To investigate
this possibility, we generated a series of transgenic mouse lines that
expressed h
-globin mRNAs containing informative site-specific
mutations. Previous work using transiently transfected MEL cells
demonstrated that full-length h
-globin mRNAs can be destabilized by
a pair of site-specific mutations (Fig.
7A) (54). We generated
transgenic mice containing this
RT gene (Fig. 7A) linked
in its native orientation to a
µLCR (27, 63). Only a
single transgenic line expressing the
RT mRNA could be
established from 12
RT founders, despite repeated
pronuclear injections using independently prepared DNAs, reflecting the
possible toxicity of extended h
-globin chains to mouse erythroid
progenitors (reviewed in reference 64). The tandem
mutations permit ribosomes to read 36 codons past the native UAA into
the 3' UTR where they sterically disrupt functional high-order mRNA
structures and mRNP interactions (Fig. 7B). In addition to the
RT transgenics, five independent
WT
transgenic lines were generated from the cloned h
-globin gene for
use as controls (27) (Fig. 7A). Where possible, age- and sex-matched mice were used for all subsequent studies.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 7.
Construction of transgenes encoding WT
and RT -globin mRNAs. (A) Transgene structures. The
WT and RT transgenes comprise the
full-length h -globin gene, including native promoter (P) and 3'
enhancer (E) elements, linked in their native orientation to a µLCR (LCR) (63). The two transgenes are identical except
for two tandem mutations (asterisks) in exon 3 of the RT
transgene (54). Tick marks indicate the positions of the
native translation initiation and termination codons. (B) Structures of
WT and RT mRNAs. The 5'-cap ( ),
poly(A) tail (An), and native translation initiation and
termination codons (tick marks) are indicated. Asterisks denote the
positions of tandem mutations in the RT mRNA. The region
of each mRNA that is actively translated is indicated by an arrow.
|
|
An antitermination mutation destabilizes h
-globin mRNA.
The
stabilities of the
WT and
RT mRNAs were
assessed using a previously described method designed specifically for
this purpose (38, 45, 56). The assay tests the decline in
transgenic mRNA levels, relative to the levels of endogenous
m
-globin mRNA, in the transcriptionally silent interval between the
marrow and peripheral reticulocyte stages of terminal erythroid
differentiation. One advantage of this method is that it does not
require the use of global transcriptional inhibitors, such as
actinomycin D or 5,6-dichloro-1-
-D-ribofuranosylbenzimidazole (DRB), that
may produce anomalous results (26) and can paradoxically
stabilize some mRNAs (61).
The levels of
WT and
RT mRNAs in paired
marrow and reticulocyte samples were determined by an RPA in which
32P-labeled antisense h

and m

probes protected
defined fragments
of the transgenic h

- and endogenous m

-globin
mRNAs. Two or more
mice from each independent transgenic line were each
analyzed
at least twice using this method. A representative two-probe
RPA
demonstrates that the stability of
WT mRNA is nearly
threefold greater than that of the
RT mRNA (Fig.
8A; for each mouse compare any change in
the level
of h

mRNA between the marrow and reticulocyte samples to
the
change in m

mRNA levels between these two tissues). Analyses
of
mice from all transgenic lines indicate that the average stability
of
WT mRNA was reduced nearly threefold by the introduction
of the
tandem readthrough mutations (Fig.
8B). This result confirms in
a whole-animal model the destabilizing effect of readthrough mutations
on

-globin mRNA initially established in transiently transfected
MEL
cells (
54), thus indicating the existence of a stability
determinant in the

-globin 3' UTR.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 8.
Translation antitermination mutations reduce the
stability of h -globin mRNA in intact erythroid cells. (A)
Representative two-probe RPA. RNA prepared from bone marrow progenitors
(B) and peripheral blood reticulocytes (P) obtained from representative
mice containing the WT transgene (lanes 3 and 4) or the
RT transgene (lanes 5 and 6) was analyzed using
32P-labeled probes complementary to h -globin (h ) and
m -globin (m ) mRNAs. The migration of the protected m and h
probe fragments is indicated by control reactions utilizing either of
the probes alone (lanes 1 and 2). The composition of each reaction and
the migration of the protected fragments are shown above and to the
left of the autoradiograph, respectively. Control lanes indicating
functional probe excess, performed for every experiment, were cropped
from the figure to maintain clarity. (B) Stabilities of
WT and RT mRNAs in multiple transgenic
lines. The average stabilities of WT and
RT mRNAs in each of five and one independent line,
respectively, are plotted ( ). For each line, a minimum of two mice
were studied on at least two separate occasions using the two-probe
(h and m ) RPA. The stability of each mRNA, averaged across all
lines, is indicated as a bar; the stability of m -globin mRNA,
defined as 1.0, is denoted by a dashed line.
|
|
-Globin mRNA is destabilized by replacement or deletion of
PRE-2.
The in vivo effects of antitermination mutations
(indicating the importance of the 3' UTR to
-globin mRNA stability),
the in vitro EMSA analyses (demonstrating functional similarity between the mRNP
complex and the stability-enhancing
complex), and results from supershift experiments (indicating participation of
CP
in both the
and
complexes) each suggested an important role for
PRE-2 in effecting the high stability of
-globin mRNA. To test
the functional properties of this region, we constructed
-globin
transgenes in which
PRE-2 was replaced by an equal-length polypurine sequence (
SUB) or deleted in its entirety
(
DEL) (Fig. 9A).
Independent mouse lines were generated that contained the
SUB (two lines) or
DEL transgenes (three
lines), and the presence of the relevant mutation was confirmed by
sequencing the appropriate reverse transcriptase PCR product from
reticulocyte mRNA (data not shown). The stabilities of the
SUB and
DEL mRNAs were tested in
duplicate in at least two mice from each independent line using the
two-probe RPA described above. A typical autoradiograph indicates a
reduction in the stability of the
WT mRNA when
PRE-2
was either replaced or deleted (Fig. 9B). Data from each of the five
independent lines demonstrate that either replacement or deletion of
PRE-2 results in a twofold reduction in
-globin mRNA stability
(Fig. 9C). These data indicate the functional importance of
PRE-2
to normal
-globin mRNA stability in terminally differentiating
erythroid progenitors.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 9.
-Globin mRNAs containing deletion or replacement of
PRE-2 are destabilized in vivo. (A) Structures of wild-type and variant
-globin mRNA 3' UTRs. Transgenes encoding variant -globin
mRNAs were constructed from the WT transgene by
exchanging PRE-2 for an equal-length purine-rich sequence
( SUB) or deleting it in its entirety
( DEL). The relevant segments of the WT,
DEL, and SUB 3' UTRs have been aligned
for comparison. The µLCR (LCR), promoter (P), and 3' enhancer
elements (E) are indicated. (B) Relative stabilities of
WT, SUB, and DEL mRNAs in
representative transgenic mice. RNAs recovered from bone marrow (B) and
peripheral blood (P) erythroid cells from mice containing the
WT, SUB, and DEL
transgenes were analyzed by two-probe RPA. The positions of the
protected [32P]-labeled m and h RNA fragments are
indicated on the left. (C) Stabilities of SUB and
DEL mRNAs in multiple transgenic lines. The average
stabilities of SUB and DEL mRNAs in each
of two and three independent transgenic lines, respectively, are
plotted ( ). For each line, a minimum of two mice was studied on at
least two separate occasions using two-probe (h and m ) RPA. The
stability of each mRNA, averaged across all lines, is indicated as a
bar; the stability of m -globin mRNA, defined as 1.0, is denoted by a
dashed line. A bar indicating the average stability of transgenic human
WT mRNA is reproduced from Fig. 8 for comparison.
|
|
 |
DISCUSSION |
The normal expression of human globins is crucially dependent upon
the high stability of their encoding mRNAs. Over a period lasting at
least 4 days, erythroid progenitor cells in the marrow cease
transcription, extrude their nuclei, and migrate into the peripheral
circulation as RNA-rich reticulocytes. With their long t1/2s, globin mRNAs survive at high levels in
these cells and continue to translate substantial quantities of their
cognate globin proteins. Consequently, small changes in globin mRNA
stabilities can disproportionately impact the levels of their encoded
protein products. Studies of fos-
-globin chimeras
(30) and informative
-globin mRNA variants
(54) suggest that 3' UTR determinants may be crucial to
normal
-globin mRNA stability. This arrangement would be consistent
with the observation that stability-determining elements are commonly
positioned in that region, including one that dictates the stability of
h
-globin mRNA. The present report confirms that the
-globin 3'
UTR harbors at least one such stability element that maps to a 14-nt
PRE. The data also directly demonstrate in a whole-animal model system
that site-specific PRE mutations can destabilize globin mRNAs.
The structural similarities of the mRNP complexes effecting their
long t1/2s suggest that the stabilities of the
- and
-globin mRNAs may be coregulated.
At least three factors have impeded previous attempts to identify
specific stability-defining regions of
-globin mRNA. First, unlike
-globin mRNA (14, 17, 25, 44), naturally occurring mutations that destabilize
-globin mRNA by disrupting the function of a specific mRNA stability element are not known to exist. Although
-globin genes have been described that contain single-nucleotide substitutions or small deletions within their 3' UTRs, these mutations do not appear to affect globin mRNA stability (2, 10, 29; data not shown).
-Globin genes containing frameshift antitermination mutations (permitting ribosomes to read through the initial third of
the 3' UTR) are expressed at near-normal levels (9, 18, 19), suggesting that mRNA stability-defining determinants are positioned further downstream.
-Globin mRNAs containing engineered mutations that permit ribosomes to read further into the 3' UTR are
destabilized both in cultured MEL cells (54), as well as in situ in whole-animal models (Fig. 7 and 8). Replacement or deletion
of
PRE-2 within this downstream region reduces
-globin mRNA
stability by half (Fig. 9), implicating this element as crucial for
normal
-globin mRNA stability. Hence, the importance of the 3' UTR,
as well as specific internal regions, can be demonstrated in mice
containing artificial readthrough mutations.
The structural dissimilarity between the
and
3' UTRs is a
second factor that has misdirected efforts to identify a
-globin mRNA stability element. The expectation that the stabilities of the two
mRNAs were similarly regulated was inconsistent with the fact that the
3' UTR did not contain a cytosine-rich PRE homologous to the
PRE. It has recently been recognized that
complexes can assemble on
PREs sharing minimal homology (16, 47, 62, 67), suggesting
that pyrimidine content, and not the cytosine-to-uridine ratio per se,
might define functionally important stability determinants. Using this
criteria we identified three candidate
PREs that were 10, 14, and
10 nt in length (Fig. 6). The largest,
PRE-2, displays a higher
uridine content than the
PRE, possibly explaining both the modest
susceptibility of the
complex to competition by poly(T) as well as
its sensitivity to small changes in buffer pH and salt concentrations
(Fig. 2 and data not shown). This possibility is consistent with
previous demonstrations that the efficiency of mRNP complex assembly
can be significantly altered by single-nucleotide changes within the
PRE (28, 56). We suggest that the observed heterogeneity in functional PREs may permit distinct RNAs to exhibit different t1/2s while coordinating their
relative levels of expression through a common regulatory pathway. Such
a mechanism would account for the nearly fourfold difference in the
t1/2s of the homologous
- and
-globin
mRNAs (51) and might possibly play a role in balancing the
expression of
- and
-globin proteins both in normal and in
thalassemic erythroid cells.
Finally, previously stated conclusions that the stabilities of the
-
and
-globin mRNAs are independently regulated reference unsuccessful
attempts to identify candidate mRNP complexes on the
-globin 3' UTR
(55, 67). In contrast, we readily assembled mRNP complexes
on the
-globin 3' UTR that were nearly indistinguishable from the
authentic
complex, with the exception that assembly of the
complex appeared to be more sensitive to competition by
homodeoxyribopoly(T) (Fig. 1 to 4). Our success in assembling
complexes may reflect unintended but fortuitous variations in the
buffer pH or salt concentrations utilized, which we have noted to be
crucial determinants of in vitro
-globin mRNP assembly. In addition,
we (and others) have noted that the quality of S-100 extracts may vary
among independent preparations, affecting the efficiency of mRNP
assembly for reasons that remain unclear (data not shown). Each of
these possibilities emphasizes the importance of confirming EMSA
findings (Fig. 1 to 5) with alternate, preferably functional, analyses
(Fig. 7 to 9).
The functional similarities between the
and
complexes (Fig. 1
to 4) predicted that the two mRNPs might share specific structural
features. Antibodies raised against
CP, a critical component of the
complex, bind to
complex epitopes, indicating that an
CP-like factor, perhaps even
CP itself, participates in both the
mRNP
and
complexes (Fig. 5). The expanding number of mRNAs that
support assembly of
CP-containing mRNPs suggests that these factors
may coordinate the expression of multiple genes that are active during
the terminal stages of erythroid cell differentiation. The likelihood
that the
- and
-globin genes are posttranscriptionally coregulated may also have important implications relating to the pathophysiology of thalassemias characterized by imbalance in the
levels of the
- and
-globin mRNAs.
The data in this report do not rule out the possibility that additional
stability elements may exist elsewhere within the
-globin mRNA.
-Globin mRNAs containing tandem readthrough mutations (Fig. 8)
appear to be less stable than mRNAs with deletion or purine replacement
of
PRE-2 (Fig. 9). This observation suggests that the function of
additional (unrecognized) 3' UTR stability elements located outside the
PRE-2 may be compromised by undiscriminating readthrough
ribosomes. The hypothesis that multiple regions contribute to mRNA
stability could be tested by combinatorial mutations of one, two, or
all three
PREs, although the extensive sequence alterations
required for this approach might nonspecifically affect
-globin mRNA
stability. The manner in which multiple elements might interact to
maintain the high stability of human
-globin mRNAs during terminal
differentiation would benefit from fine mapping studies of the
3'
UTR, focusing initially on the
PRE-2 element identified in the
present work.
 |
ACKNOWLEDGMENTS |
This work was supported in part by grant HL56038 from the
National Heart, Lung and Blood Institute (J. E. R.).
We thank Z. He for expert technical assistance.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Abramson
Research Building, Room 316F, The Children's Hospital of Philadelphia,
34th St. and Civic Center Blvd., Philadelphia, PA 19104. Phone: (215) 590-3880. Fax: (215) 590-4834. E-mail:
jeruss{at}mail.med.upenn.edu.
 |
REFERENCES |
| 1.
|
Aviv, H.,
Z. Voloch,
R. Bastos, and S. Levy.
1976.
Biosynthesis and stability of globin mRNA in cultured erythroleukemic Friend cells.
Cell
8:495-503[CrossRef][Medline].
|
| 2.
|
Basak, A.N.,
A. Ozer,
B. Kirdar, and N. Akar.
1993.
A novel 13 bp deletion in the 3'UTR of the -globin gene causes -thalassemia in a Turkish patient.
Hemoglobin
17:551-555[Medline].
|
| 3.
|
Bastos, R., and H. Aviv.
1977.
Theoretical analysis of a model for globin messenger RNA accumulation during erythropoiesis.
J. Mol. Biol.
110:205-218[CrossRef][Medline].
|
| 4.
|
Bastos, R.,
Z. Volloch, and H. Aviv.
1977.
Messenger RNA population analysis during erythroid differentiation: a kinetic approach.
J. Mol. Biol.
110:191-203[CrossRef][Medline].
|
| 5.
|
Baumbach, L. L.,
G. S. Stein, and J. L. Stein.
1987.
Regulation of human histone gene expression: transcriptional and posttranscriptional control in the coupling of histone messenger RNA stability with DNA replication.
Biochemistry
26:6178-6187[CrossRef][Medline].
|
| 6.
|
Beelman, C., and R. Parker.
1995.
Degradation of mRNA in eukaryotes.
Cell
81:179-183[CrossRef][Medline].
|
| 7.
|
Bernstein, P.,
S. W. Peltz, and J. Ross.
1989.
The poly(A)-poly(A)-binding protein complex is a major determinant of mRNA stability in vitro.
Mol. Cell. Biol.
9:659-670[Abstract/Free Full Text].
|
| 8.
|
Bunn, H. F., and B. G. Forget.
1986.
Hemoglobin: molecular, genetic, and clinical aspects.
The W. B. Saunders Co., Philadelphia, Pa.
|
| 9.
|
Bunn, H. F.,
G. J. Schmidt,
D. N. Haney, and R. G. Dluhy.
1975.
Hemoglobin Cranston, an unstable variant having an elongated beta chain due to nonhomologous crossover between two normal beta chain genes.
Proc. Natl. Acad. Sci. USA
72:3609-3613[Abstract/Free Full Text].
|
| 10.
|
Cai, S. P.,
B. Eng,
W. H. Francombe,
N. F. Olivieri,
A. G. Kendall,
J. S. Waye, and D. H. Chui.
1992.
Two novel beta-thalassemia mutations in the 5' and 3' noncoding regions of the beta-globin gene.
Blood
79:1342-1346[Abstract/Free Full Text].
|
| 11.
|
Chen, C. Y.,
F. Del Gatto-Koncziak,
Z. Wu, and M. Karin.
1998.
Stabilization of interleukin-2 mRNA by the c-Jun NH2-terminal kinase pathway.
Science
280:1945-1949[Abstract/Free Full Text].
|
| 12.
|
Chen, C. Y.,
R. Gherzy,
J. S. Andersen,
G. Gaietta,
K. Jurchott,
H. D. Royer,
M. Mann, and M. Karin.
2000.
Nucleolin and YB-1 are required for JNK-mediated interleukin-2 mRNA stabilization during T-cell activation.
Genes Dev.
14:1236-1258[Abstract/Free Full Text].
|
| 13.
|
Chkheidze, A. N.,
D. L. Lyakhov,
A. V. Makeyev,
J. Morales,
J. Kong, and S. A. Liebhaber.
1999.
Assembly of the -globin mRNA stability complex reflects binary interaction between the pyrimidine-rich 3' untranslated region determinant and poly(C) binding protein CP.
Mol. Cell. Biol.
19:4572-4581[Abstract/Free Full Text].
|
| 14.
|
Clegg, J. B.,
D. J. Weatherall,
I. Contopolou-Griva,
K. Cartousos,
P. Poungouras, and H. Tsevrenis.
1974.
Haemoglobin Icaria, a new chain-termination mutant which causes thalassemia.
Nature
251:245-247[CrossRef][Medline].
|
| 15.
|
Cleveland, D. W.,
M. A. Lopata,
P. Sherline, and M. W. Kirschner.
1981.
Unpolymerized tubulin modulates the level of tubulin mRNAs.
Cell
25:537-546[CrossRef][Medline].
|
| 16.
|
Czyzyk-Krzeska, M. F., and J. E. Beresh.
1996.
Characterization of the hypoxia-inducible protein binding site within the pyrimidine-rich tract in the 3'-untranslated region of the tyrosine hydroxylase mRNA.
J. Biol. Chem.
271:3293-3299[Abstract/Free Full Text].
|
| 17.
|
De Jong, W. W.,
P. Meera Khan, and L. F. Bernini.
1975.
Hemoglobin Koya Dora: high frequency of a chain termination mutant.
Am. J. Hum. Genet.
27:81-90[Medline].
|
| 18.
|
Delanoe-Garin, J.,
Y. Blouquit,
N. Arous,
J. Kister,
C. Poyart,
M. L. North,
J. Bardakdjian,
C. Lacombe,
J. Rosa, and F. Galacteros.
1988.
Hemoglobin Saverne: a new variant with elongated beta chains: structural and functional properties.
Hemoglobin
12:337-352[Medline].
|
| 19.
|
Flatz, G.,
J. L. Kinderlerer,
J. V. Kilmartin, and H. Lehmann.
1971.
Haemoglobin Tak: a variant with additional residues at the end of the beta-chains.
Lancet
i:732-733.
|
| 20.
|
Frischmeyer, P. A., and H. C. Dietz.
1999.
Nonsense-mediated mRNA decay in health and disease.
Hum. Mol. Genet.
8:1893-1900[Abstract/Free Full Text].
|
| 21.
|
Furuichi, Y.,
A. LaFiandra, and A. J. Shatkin.
1977.
5'-Terminal structure and mRNA stability.
Nature
266:235-239[CrossRef][Medline].
|
| 22.
|
Goodman, M.
1981.
Decoding the pattern of protein evolution.
Prog. Biophys. Mol. Biol.
38:105-164[CrossRef][Medline].
|
| 23.
|
Goodman, M.,
M. L. Weiss, and J. Czelusniak.
1982.
Molecular evolution above the species level: branching patterns, rates, and mechanisms.
Sys. Zool.
31:376-399[CrossRef].
|
| 24.
|
Hamalainen, L.,
J. Oikarinen, and K. I. Kivirikko.
1985.
Synthesis and degradation of type I procollagen mRNAs in cultured human skin fibroblasts and the effect of cortisol.
J. Biol. Chem.
260:720-725[Abstract/Free Full Text].
|
| 25.
|
Hanash, S. M.,
W. P. Winter, and D. L. Rucknagel.
1977.
Synthesis of haemoglobin Wayne in erythroid cells.
Nature
269:717-719[CrossRef][Medline].
|
| 26.
|
Harrold, S.,
C. Genovese,
B. Kobrin,
S. L. Morrison, and C. Milcarek.
1991.
A comparison of apparent mRNA half-life using kinetic labeling techniques vs decay following administration of transcriptional inhibitors.
Anal. Biochem.
198:19-29[CrossRef][Medline].
|
| 27.
|
He, Z.,
L. Lian,
T. Asakura, and J. E. Russell.
2000.
Functional effects of replacing human and globins with their embryonic globin homologues in defined haemoglobin heterotetramers.
Br. J. Haematol.
109:882-890[CrossRef][Medline].
|
| 28.
|
Holcik, M., and S. A. Liebhaber.
1997.
Four highly stable eukaryotic mRNAs assemble 3' untranslated region RNA-protein complexes sharing cis- and trans components.
Proc. Natl. Acad. Sci. USA
94:2410-2414[Abstract/Free Full Text].
|
| 29.
|
Jankovic, L.,
A. J. Dimovski,
P. Kollia,
M. Karageorga,
D. Loukopoulos, and T. H. J. Huisman.
1991.
A C----G mutation at nt position 6 3' to the terminating codon may be the cause of a silent beta-thalassemia.
Int. J. Hematol.
54:289-293[Medline].
|
| 30.
|
Kabnick, K. S., and D. E. Housman.
1988.
Determinants that contribute to cytoplasmic stability of human c-fos and -globin mRNAs are located at several sites in each mRNA.
Mol. Cell. Biol.
8:3244-3250[Abstract/Free Full Text].
|
| 31.
|
Kiledjian, M.,
N. Day, and P. Trifillis.
1999.
Purification and RNA binding properties of the polycytidylate-binding proteins CP1 and CP2.
Methods
17:84-91[CrossRef][Medline].
|
| 32.
|
Kiledjian, M.,
C. T. DeMaria,
G. Brewer, and K. Novick.
1997.
Identification of AUF1 (heterogeneous nuclear ribonucleoprotein D) as a component of the -globin mRNA stability complex.
Mol. Cell. Biol.
17:4870-4876[Abstract].
|
| 33.
|
Kiledjian, M.,
X. Wang, and S. A. Liebhaber.
1995.
Identification of two KH domain proteins in the alpha-globin mRNP stability complex.
EMBO J.
14:4357-4364[Medline].
|
| 34.
|
Klausner, R. D.,
T. A. Rouault, and J. B. Harford.
1993.
Regulating the fate of mRNA: the control of cellullar iron metabolism.
Cell
72:19-28[CrossRef][Medline].
|
| 35.
|
Krowczynska, A.,
R. Yenofsky, and F. Brawerman.
1985.
Regulation of messenger RNA stability in mouse erythroleukemia cells.
J. Mol. Biol.
181:231-239[CrossRef][Medline].
|
| 36.
|
Li, X. A., and D. C. Beebe.
1991.
Messenger RNA stabilization in chicken lens development: a reexamination.
Dev. Biol.
146:239-241[CrossRef][Medline].
|
| 37.
|
Lieberman, A. P.,
P. M. Pitha, and M. L. Shin.
1992.
Poly(A) removal is the kinase-regulated step in tumor necrosis factor mRNA decay.
J. Biol. Chem.
267:2123-2126[Abstract/Free Full Text].
|
| 38.
|
Liebhaber, S. A., and Y. W. Kan.
1983.
Alpha thalassemia caused by an unstable alpha-globin mutant.
J. Clin. Investig.
71:461-466.
|
| 39.
|
Liebhaber, S. A.,
Z. Wang,
F. E. Cash,
B. Monks, and J. E. Russell.
1996.
Developmental silencing of the embryonic -globin gene: concerted action of the promoter and the 3'-flanking region combined with stage-specific silencing by the transcribed segment.
Mol. Cell. Biol.
16:2637-2646[Abstract].
|
| 40.
|
Lodish, H. F., and B. Small.
1976.
Different lifetimes of reticulocyte messenger RNA.
Cell
7:59-65[CrossRef][Medline].
|
| 41.
|
Maatta, A.,
E. Ekholm, and R. P. Penttinen.
1995.
Effect of the 3'-untranslated region on the expression levels and mRNA stability of alpha 1 (I) collagen gene.
Biochim. Biophys. Acta
1260:294-300[Medline].
|
| 42.
|
Makeyev, A. V.,
A. N. Chkheidze, and S. A. Liebhaber.
1999.
A set of highly conserved RNA-binding proteins, CP-1 and CP-2, implicated in mRNA stabilization, are coexpressed from an intronless gene and its intron-containing paralog.
J. Biol. Chem.
274:24849-24857[Abstract/Free Full Text].
|
| 43.
|
Maquat, L. E.
1995.
When cells stop making sense: effects of nonsence codons on RNA metabolism in vertebrate cells.
RNA
1:453-465[Abstract].
|
| 44.
|
Milner, P. F.,
J. B. Clegg, and D. J. Weatherall.
1971.
Haemoglobin H disease due to a unique haemoglobin variant with an elongated -chain.
Lancet
i:729-732.
|
| 45.
|
Morales, J.,
J. E. Russell, and S. A. Liebhaber.
1997.
Destabilization of human alpha globin mRNA by translation anti-termination is controlled during erythroid terminal differentiation and paralleled by phased shortening of the poly(A) tail.
J. Biol. Chem.
272:6607-6613[Abstract/Free Full Text].
|
| 46.
|
Munroe, D., and A. Jacobson.
1990.
mRNA poly(A) tail, a 3' enhancer of translation initiation.
Mol. Cell. Biol.
10:3441-3455[Abstract/Free Full Text].
|
| 47.
|
Ostareck-Lederer, A.,
D. H. Ostareck,
N. Standart, and B. J. Thiele.
1994.
Translation of 15-lipoxygenase mRNA is inhibited by a protein that binds to a repeated sequence in the 3' untranslated region.
EMBO J.
13:1476-1481[Medline].
|
| 48.
|
Pandey, N. B., and W. F. Marzluff.
1987.
The stem-loop structure at the 3' end of histone mRNA is necessary and sufficient for regulation of histone mRNA stability.
Mol. Cell. Biol.
7:4557-4559[Abstract/Free Full Text].
|
| 49.
|
Ross, J.
1995.
mRNA stability in mammalian cells.
Microbiol. Rev.
59:423-450[Abstract/Free Full Text].
|
| 50.
|
Ross, J.,
G. Kobs,
G. Brewer, and S. W. Peltz.
1987.
Properties of the exonuclease activity that degrades H4 histone mRNA.
J. Biol. Chem.
262:9374-9381[Abstract/Free Full Text].
|
| 51.
|
Ross, J., and A. Pizarro.
1983.
Human beta and delta globin messenger RNAs turn over at different rates.
J. Mol. Biol.
167:607-617[CrossRef][Medline].
|
| 52.
|
Ross, J., and T. D. Sullivan.
1985.
Half-lives of beta and gamma globin messenger RNAs and of protein synthetic capacity in cultured human reticulocytes.
Blood
66:1149-1154[Abstract/Free Full Text].
|
| 53.
|
Russell, J. E., and S. A. Liebhaber.
1998.
Reversal of lethal and thalassemias in mice by expression of human embryonic globins.
Blood
92:3057-3063[Abstract/Free Full Text].
|
| 54.
|
Russell, J. E., and S. A. Liebhaber.
1996.
The stability of human beta-globin mRNA is dependent on structural determinants positioned within its 3' untranslated region.
Blood
87:5314-5323[Abstract/Free Full Text].
|
| 55.
|
Russell, J. E.,
J. Morales, and S. A. Liebhaber.
1997.
The role of globin mRNA stability in the control of globin gene expression.
Prog. Nucleic Acid Res. Mol. Biol.
57:259-287.
|
| 56.
|
Russell, J. E.,
J. Morales,
A. V. Makeyev, and S. A. Liebhaber.
1998.
Sequence divergence in the 3' untranslated regions of human - and -globin mRNAs mediates a difference in their stabilities and contributes to efficient -to- gene developmental switching.
Mol. Cell. Biol.
18:2173-2183[Abstract/Free Full Text].
|
| 57.
|
Sachs, A. B.,
P. Sarnow, and M. W. Hentze.
1997.
Starting at the beginning, middle, and end: translation initiation in eukayotes.
Cell
89:831-838[CrossRef][Medline].
|
| 58.
|
Scheper, W.,
D. Meinsma,
P. E. Holthuizen, and J. S. Sussenbach.
1995.
Long-range RNA interaction of two sequence elements required for endonucleolytic cleavage of human insulin-like growth factor II mRNAs.
Mol. Cell. Biol.
15:235-245[Abstract].
|
| 59.
|
Shaw, G., and R. Kamen.
1986.
A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation.
Cell
46:659-667[CrossRef][Medline].
|
| 60.
|
Shimotohno, K.,
Y. Kodama,
J. Hashimoto, and K. I. Miura.
1977.
Importance of 5'-terminal blocking structure to stabilize mRNA in eukaryotic protein synthesis.
Proc. Natl. Acad. Sci. USA
74:2734-2738[Abstract/Free Full Text].
|
| 61.
|
Shyu, A. B.,
M. E. Greenberg, and J. G. Belasco.
1989.
The c-fos transcript is targeted for rapid decay by two distinct mRNA degradation pathways.
Genes Dev.
3:60-72[Abstract/Free Full Text].
|
| 62.
|
Stefanovic, B.,
C. Hellerbrand,
M. Holcik,
M. Briendl,
S. A. Liebhaber, and D. A. Brenner.
1997.
Posttranscriptional regulation of collagen 1(I) mRNA in hepatic satellite cells.
Mol. Cell. Biol.
17:5201-5209[Abstract].
|
| 63.
|
Talbot, D.,
P. Collis,
M. Antoniou,
M. Vidal,
F. Grosveld, and D. R. Greaves.
1989.
A dominant control region from human beta-globin locus conferring integration site independent gene expression.
Nature
33:352-355.
|
| 64.
|
Thein, S. L.
2001.
Structural variants with a -thaslassemic phenotype, p. 342-355.
In
M. A. Steinberg, B. G. Forget, D. R. Higgs, and R. L. Nagel (ed.), Disorders of hemoglobin: genetics, pathophysiology, and clinical management. Cambridge University Press, Cambridge, England.
|
| 65.
|
Trudel, M., and F. Constantini.
1987.
A 3' enhancer contributes to the stage-specific expression of the human beta-globin gene.
Genes Dev.
1:954-961[Abstract/Free Full Text].
|
| 66.
|
Volloch, V., and D. Housman.
1981.
Stability of globin mRNA in terminally differentiating murine erythroleukemia cells.
Cell
23:509-514[CrossRef][Medline].
|
| 67.
|
Wang, X.,
M. Kiledjian,
I. M. Weiss, and S. A. Liebhaber.
1995.
Detection and characterization of a 3' untranslated region ribonucleoprotein complex associated with human -globin mRNA stability.
Mol. Cell. Biol.
15:1769-1777[Abstract].
|
| 68.
|
Wang, Z.,
N. Day,
P. Trifillis, and M. Kiledjian.
1999.
An mRNA stability complex functions with poly(A)-binding protein to stabilize mRNA in vitro.
Mol. Cell. Biol.
19:4552-4560[Abstract/Free Full Text].
|
| 69.
|
Wang, Z., and M. Kiledjian.
2000.
Identification of an erythroid-enriched endoribonuclease activity involved in specific mRNA cleavage.
EMBO J.
19:295-305[CrossRef][Medline].
|
| 70.
|
Wang, Z., and M. Kiledjian.
2000.
The poly(A)-binding protein and an mRNA stability protein jointly regulate an endoribonuclease activity.
Mol. Cell. Biol.
20:6334-6341[Abstract/Free Full Text].
|
| 71.
|
Weiss, I. M., and S. A. Liebhaber.
1994.
Erythroid cell-specific determinants of -globin mRNA stability.
Mol. Cell. Biol.
14:8123-8132[Abstract/Free Full Text].
|
| 72.
|
Weiss, I. M., and S. A. Liebhaber.
1995.
Erythroid cell-specific mRNA stability elements in the (2)-globin 3' nontranslated region.
Mol. Cell. Biol.
15:2457-2465[Abstract].
|
| 73.
|
Wilson, T., and R. Treisman.
1988.
Removal of poly(A) and consequent degradation of c-fos mRNA facilitated by 3' AU-rich sequences.
Nature
336:396-399[CrossRef][Medline].
|
| 74.
|
Wisdom, R., and W. Lee.
1991.
The protein coding region of c-myc mRNA contains a sequence that specifies rapid mRNA turnover and induction by protein synthesis inhibitors.
Genes Dev.
5:232-243[Abstract/Free Full Text].
|
| 75.
|
Zhang, W.,
B. Wagner,
K. Ehrenman,
A. W. Schaefer,
C. T. DeMaria,
D. Crater,
K. DeHaven,
L. Long, and G. Brewer.
1993.
Purification, characterization, and cDNA cloning of an AU-rich element RNA-binding protein, AUF-1.
Mol. Cell. Biol.
13:7652-7665[Abstract/Free Full Text].
|
Molecular and Cellular Biology, September 2001, p. 5879-5888, Vol. 21, No. 17
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.17.5879-5888.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Du, Z., Fenn, S., Tjhen, R., James, T. L.
(2008). Structure of a Construct of a Human Poly(C)-binding Protein Containing the First and Second KH Domains Reveals Insights into Its Regulatory Mechanisms. J. Biol. Chem.
283: 28757-28766
[Abstract]
[Full Text]
-
Grosso, M., Palumbo, I., Morelli, E., Puzone, S., Sessa, R., Izzo, P.
(2008). Defective mRNA levels are responsible for a {beta}-thalassemia phenotype associated with Hb Federico II, a novel hemoglobin variant [{beta}-106 (G8) Leu->Val]. haematol
93: 1096-1098
[Full Text]
-
He, Z., Russell, J. E.
(2007). Dynamic posttranscriptional regulation of {epsilon}-globin gene expression in vivo. Blood
109: 795-801
[Abstract]
[Full Text]
-
Holtkamp, S., Kreiter, S., Selmi, A., Simon, P., Koslowski, M., Huber, C., Tureci, O., Sahin, U.
(2006). Modification of antigen-encoding RNA increases stability, translational efficacy, and T-cell stimulatory capacity of dendritic cells. Blood
108: 4009-4017
[Abstract]
[Full Text]
-
Xu, L., Harada, H., Taniguchi, A.
(2006). The Exon 6ABC Region of Amelogenin mRNA Contribute to Increased Levels of Amelogenin mRNA through Amelogenin Protein-enhanced mRNA Stabilization. J. Biol. Chem.
281: 32439-32444
[Abstract]
[Full Text]
-
Kong, J., Sumaroka, M., Eastmond, D. L., Liebhaber, S. A.
(2006). Shared Stabilization Functions of Pyrimidine-Rich Determinants in the Erythroid 15-lipoxygenase and {alpha}-globin mRNAs. Mol. Cell. Biol.
26: 5603-5614
[Abstract]
[Full Text]
-
Jiang, Y., Xu, X.-S., Russell, J. E.
(2006). A Nucleolin-Binding 3' Untranslated Region Element Stabilizes {beta}-Globin mRNA In Vivo.. Mol. Cell. Biol.
26: 2419-2429
[Abstract]
[Full Text]
-
Bank, A.
(2006). Regulation of human fetal hemoglobin: new players, new complexities. Blood
107: 435-443
[Abstract]
[Full Text]
-
Chakalova, L., Osborne, C. S., Dai, Y.-F., Goyenechea, B., Metaxotou-Mavromati, A., Kattamis, A., Kattamis, C., Fraser, P.
(2005). The Corfu {delta}{beta} thalassemia deletion disrupts {gamma}-globin gene silencing and reveals post-transcriptional regulation of HbF expression. Blood
105: 2154-2160
[Abstract]
[Full Text]
-
Sidiqi, M., Wilce, J. A., Vivian, J. P., Porter, C. J., Barker, A., Leedman, P. J., Wilce, M. C. J.
(2005). Structure and RNA binding of the third KH domain of poly(C)-binding protein 1. Nucleic Acids Res
33: 1213-1221
[Abstract]
[Full Text]
-
Thiele, B.-J., Doller, A., Kahne, T., Pregla, R., Hetzer, R., Regitz-Zagrosek, V.
(2004). RNA-Binding Proteins Heterogeneous Nuclear Ribonucleoprotein A1, E1, and K Are Involved in Post-Transcriptional Control of Collagen I and III Synthesis. Circ. Res.
95: 1058-1066
[Abstract]
[Full Text]
-
Chkheidze, A. N., Liebhaber, S. A.
(2003). A Novel Set of Nuclear Localization Signals Determine Distributions of the {alpha}CP RNA-Binding Proteins. Mol. Cell. Biol.
23: 8405-8415
[Abstract]
[Full Text]
-
Persson, P. B., Skalweit, A., Mrowka, R., Thiele, B.-J.
(2003). Control of renin synthesis. Am. J. Physiol. Regul. Integr. Comp. Physiol.
285: R491-R497
[Abstract]
[Full Text]
-
Skalweit, A., Doller, A., Huth, A., Kahne, T., Persson, P. B., Thiele, B.-J.
(2003). Posttranscriptional Control of Renin Synthesis: Identification of Proteins Interacting With Renin mRNA 3'-Untranslated Region. Circ. Res.
92: 419-427
[Abstract]
[Full Text]
-
Walter, B. L., Parsley, T. B., Ehrenfeld, E., Semler, B. L.
(2002). Distinct Poly(rC) Binding Protein KH Domain Determinants for Poliovirus Translation Initiation and Viral RNA Replication. J. Virol.
76: 12008-12022
[Abstract]
[Full Text]
-
Emery, D. W., Yannaki, E., Tubb, J., Nishino, T., Li, Q., Stamatoyannopoulos, G.
(2002). Development of virus vectors for gene therapy of beta chain hemoglobinopathies: flanking with a chromatin insulator reduces gamma -globin gene silencing in vivo. Blood
100: 2012-2019
[Abstract]
[Full Text]
-
Rodgers, N. D., Wang, Z., Kiledjian, M.
(2002). Characterization and Purification of a Mammalian Endoribonuclease Specific for the alpha -Globin mRNA. J. Biol. Chem.
277: 2597-2604
[Abstract]
[Full Text]