Previous Article | Next Article ![]()
Molecular and Cellular Biology, September 2001, p. 6254-6269, Vol. 21, No. 18
Division of Molecular Medicine, Wadsworth
Center, Albany, New York 12201-05091;
Department of Experimental Radiation Oncology, University of
Texas M. D. Anderson Cancer Center, Houston, Texas
770302; and Department of Biomedical
Sciences, State University of New York, Albany, New York
122223
Received 16 March 2001/Returned for modification 11 May
2001/Accepted 18 June 2001
Cyclin E is a G1 cyclin essential for S-phase entry and
has a profound role in oncogenesis. Previously this laboratory
found that cyclin E is overexpressed and present in
lower-molecular-weight (LMW) isoforms in breast cancer cells and
tumor tissues compared to normal cells and tissues. Such alteration of
cyclin E is linked to poor patient outcome. Here we report that
the LMW forms of cyclin E are hyperactive biochemically and they can
more readily induce G1-to-S progression in
transfected normal cells than the full-length form of the protein can.
Through biochemical and mutational analyses we have identified two
proteolytically sensitive sites in the amino terminus of human cyclin E
that are cleaved to generate the LMW isoforms found in tumor cells. Not
only are the LMW forms of cyclin E functional, as they phosphorylate
substrates such as histone H1 and GST-Rb, but also their
activities are higher than the full-length cyclin E. These nuclear
localized LMW forms of cyclin E are also biologically
functional, as their overexpression in normal cells increases the
ability of these cells to enter S and G2/M. Lastly, we show
that cyclin E is selectively cleaved in vitro by the elastase class of
serine proteases to generate LMW forms similar to those observed in
tumor cells. These studies suggest that the defective
entry into and exit from S phase by tumor cells is in part due to the
proteolytic processing of cyclin E, which generates hyperactive
LMW isoforms whose activities have been modified from that of the
full-length protein.
In the past decade, new findings in
the fields of cell biology and molecular genetics of cancer have
revealed a deregulation of the cell cycle as a critical event for the
onset of tumorigenesis. Progression through the cell cycle, the
sequence of events between two cell divisions, is governed by the
actions of positive and negative regulators in the eukaryotic cell. The
mammalian cell cycle is positively regulated by heterodimeric complexes
of stable cyclin-dependent kinases (CDKs) and unstable regulatory
cyclin subunits (1, 51). Mitogenic stimuli result in the
phosphorylation and thereby activation of cyclin-CDK complexes by
CDK-activating kinase (17, 22, 35). The activated
cyclin-CDK complexes in turn phosphorylate substrates such as the
retinoblastoma protein (pRb) throughout the cell cycle (16, 36,
51).
The connection between cyclins and cancer has been substantiated with
G1-type cyclins (25-27, 55). Cyclin
E, a G1 cyclin which forms complexes with CDK2,
is essential for S-phase entry (41, 47) and has a profound
role in oncogenesis (29, 31). In dividing cells, the
expression of cyclin E increases to a maximum at the
G1/S transition, with a peak expression level
near the restriction point (13, 34). When coupled to CDK2,
the active kinase follows cyclin D-CDK4 in progressively
phosphorylating pRb, releasing it from members of the E2F family
(15). As E2F is released it activates a number of S-phase
genes, including cyclin E and E2F-1 (18, 40). This state
of readiness to enter S phase requires cyclin E or cells will arrest at
this point in the cell cycle (42, 57). For example, the
functional knock out of cyclin E by injection of anti-cyclin E
antibodies into fibroblast cells causes cell arrest in the
G1 phase (42). Conversely, the
overexpression of cyclin E protein causes acceleration through G1 along with a decreased cell size (42,
48). In addition to its requirement for DNA synthesis, cyclin E
also plays a key role in senescence (14), development
(7, 48), and modulation of downstream signals involving
pRb (58) and E2F (18, 40). Normal expression
and activity of cyclin E play a crucial role in cell proliferation, and
any defects in its expression could have a critical effect in oncogenesis.
We and others have reinforced the linkage between oncogenesis and
cyclin E by correlating the altered expression of cyclin E to the loss
of growth control in breast cancer (8, 30, 32).
Furthermore, several tumor cohort studies (reviewed in reference
55) have documented a strong correlation between cyclin E
overexpression and poor patient outcome (31, 44) and lack of estrogen receptor expression (21, 39, 49). In addition, patients with high cyclin E levels in their tumors have a significantly increased risk of death and/or relapse from breast cancer even if they
are node negative (39, 44). Additionally, examination of
the oncogenic potential of cyclin E in transgenic mice under the
control of the bovine In normal cells, cyclin E is expressed precisely when needed and then
is rapidly degraded. In tumor cells, cyclin E expression is different
in several ways. First, amplification of the cyclin E gene and
overexpression of cyclin E mRNA by 64-fold have been reported in a
subset of breast cancer cell lines (8, 32). Second, the
protein expression and associated kinase activity are no longer
cell-cycle regulated (21, 50). Third, in addition to the
typical 50-kDa protein, a pattern of low-molecular-weight (LMW) forms
ranging in size from 49 to 33 kDa is also detected by immunoblotting
(23, 31, 32). However, despite the tumor-specific expression of LMW forms of cyclin E and the compelling prognostic evidence, very little is known about what gives rise to these isoforms.
Previously we reported that although cyclin E is subject to extensive
alternative splicing, these cyclin E mRNA variants do not account for
the LMW forms of the protein observed in tumor cells (43).
Here we show that the generation of these tumor-specific LMW forms of
cyclin E is predominantly derived from proteolytic processing of the
full-length cyclin E. Mass spectrometry analysis revealed that the
full-length cyclin E, which is 50 kDa and is found predominantly in
both normal and tumor cells, is the EL form (i.e., the 15-amino-acid
[aa] elongated variant of cyclin E [42]). By using
site-specific mutations and transient transfection, we have also
identified two protease-sensitive domains in cyclin E. Four of the five
LMW forms of cyclin E in tumor cells are accounted for by proteolysis
at these two sites, with posttranslational modification of the two
proteolytic forms creating closely migrating doublets. Mutation
analysis of amino-acyl residues within the proteolytic cleavage domain
suggests that cyclin E is a substrate for the elastase class of
proteases. In addition to these proteolytically derived bands, a fifth
band appears from an alternate translation start at M46 of cyclin EL.
More importantly, the cyclin E LMW forms are hyperactive, as they
display stronger activity toward their native substrates, such as
histone H1 and GST-Rb, than the full-length form does. Additionally,
these LMW isoforms of cyclin E are localized to the nucleus and can
stimulate the cell to progress through the cell cycle more effectively
than does the full-length form. The proteolysis of cyclin E described
here is a newly discovered level of tumor-specific cyclin regulation
distinct from the ubiquitin-proteasome pathway.
Materials, cell lines, culture conditions, and
transfections.
Serum was purchased from HyClone Laboratories
(Logan, Utah), and cell culture medium was obtained from Life
Technologies, Inc. (Grand Island, N.Y.). All other chemicals used were
reagent grade. The culture conditions for the normal 70N and 81N cell strains, immortalized MCF-10A cell line, and breast cancer MCF-7, MDA-MB-157, MDA-MB-231, and MDA-MB-436 cell lines were described previously (21). The 76N-E6 cell line (gift from V. Band,
Tufts Medical Institute, Boston, Mass.) was immortalized and cultured as described previously (1, 2). All cells were cultured and treated at 37°C in a humidified incubator containing 6.5% CO2 and maintained free of mycoplasma as
determined by Hoechst staining (24). Transfection by
electroporation was carried out on the tumor cell line MDA-MB-157 at
0.27 kV and 960 µF capacitance. For each condition, 1 × 107 cells were suspended in 0.5 ml of media
(serum free), with 40 µg of the indicated plasmid in a 0.4-cm gap
cuvette. Following transfection, cells were plated with complete medium
and harvested 24 h posttransfection for analysis. Transfection
with the FuGene Transfection Reagent was carried out in 70N, 81N,
MCF-10A, 76NE6, and MDA-MB-436 cells according to the manufacturer's
instructions (Roche Molecular Biochemicals, Indianapolis, Ind.). Cells
were harvested for analysis 24 h posttransfection.
Sorting and analysis of transfected cells.
Following
cotransfection of 81N cells with cyclin EL-FLAG and green fluorescent
protein (GFP) constructs, cells (1 × 107)
were harvested and resuspended in sterile ice-cold phosphate-buffered saline (PBS) and subjected to sorting with a Vantage
fluorescence-activated cell sorter (FACS) from Becton Dickinson with a
488-nm argon ion laser. The GFP fluorescence was measured using a
band-pass filter at 530/30 nm. Cell sorting was performed under sterile
conditions. The sorting gates were set to sort the GFP-negative cells
in the left tube and the GFP-positive cells in the right tube. Sorted cells were collected in a tube containing growth medium. The GFP transfection efficiency was 30%. GFP-positive cells were gated by
separating nonfluorescent cells, as generated by mock transfection, from the fluorescent cells. On average, 3 × 106 cells were collected in the GFP-negative tube
and 9 × 105 cells were collected in the
GFP-positive tube. After sorting, an aliquot of the sorted cells was
run on the FACS Vantage to check the purity of the two populations. A
purity of >99% was noted for each group. The remaining cell
suspensions for each condition were spun down and resuspended in
ice-cold PBS and used for three different analyses. DNA content
analysis was performed with 1 × 105 of the
GFP-positive cells collected from each transfectant group. FLAG
immunohistochemical analysis was performed on 5 × 104 GFP-positive and -negative cells collected
from each transfectant group, following their plating on glass
coverslips for 16 h. Lastly, Western blot analysis was performed
on the remaining sorted and unsorted cells as described below.
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.18.6254-6269.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Tumor-Specific Proteolytic Processing of Cyclin E
Generates Hyperactive Lower-Molecular-Weight Forms
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-lactoglobulin promoter revealed that lactating mammary glands of the transgenic mice overexpressing cyclin E
contain hyperplasia and over 10% also develop mammary carcinomas
(6). Lastly, constitutive overexpression of cyclin E (but
not cyclin D1 or A) in both immortalized rat embryo fibroblasts and
human breast epithelial cells results in chromosome instability (53). Collectively, these data provide strong support for
the role of cyclin E in breast cancer tumorigenesis.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Western blot, immunoprecipitation, and H1 kinase analysis. Cell lysates were prepared and subjected to Western blot analysis as previously described (45). Briefly, 50 µg of protein from each condition was electrophoresed in each lane of a 10% (cyclin E, FLAG, cyclin D1, and actin) or 13% (CDK2, CDK4, p21, p27, and actin) sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels and transferred to Immobilon P overnight at 4°C at 35 mV constant voltage. The blots were blocked overnight at 4°C in BLOTTO (5% nonfat dry milk in 20 mM Tris, 137 mM NaCl, 0.25% Tween, pH 7.6). After six 10-min washes in TBST (20 mM Tris, 137 mM NaCl, 0.05% Tween, pH 7.6), the blots were incubated in primary antibodies for 3 h. Primary antibodies used were cyclin E HE-12 and cyclin D1 monoclonal antibodies (Santa Cruz Biochemicals, Santa Cruz, Calif.) at 1 µg/ml, anti-FLAG polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, Calif.) at 0.25 µg/ml, monoclonal antibodies to p27, CDK2, and CDK4 (Transduction Laboratories, Lexington, Ky.) and monoclonal antibody to p21 (Oncogene Research Products/Calbiochem, San Diego, Calif.), all at 0.1 µg/ml in BLOTTO, and actin monoclonal antibody (Roche Molecular Biochemicals) at 0.63 µg/ml in BLOTTO. Following primary antibody incubation, the blots were washed and incubated with goat anti-mouse immunoglobulin-horseradish peroxidase conjugate at a dilution of 1:5,000 in BLOTTO for 1 h and finally washed and developed with the Renaissance chemiluminesence system as directed by the manufacturer (NEN Life Sciences Products, Boston, Mass.).
For immunoprecipitations followed by Western blot analysis, 300 µg of cell extracts was used per immunoprecipitation with polyclonal antibody to FLAG (Santa Cruz Biochemicals), as previously described (9). The immunoprecipitates were then electrophoresed in 13% gels, transferred to Immobolin P, blocked, and incubated with the indicated antibodies at dilutions described above. For the histone H1 and GST-Rb kinase assays, the immunoprecipitates were incubated with kinase assay buffer containing 60 µM cold ATP, 5 µCi of [32P]ATP, and 5 µg of histone H1 (Roche Molecular Biochemicals) or 1 µg of GST-Rb (Santa Cruz Biochemicals) in a final volume of 30 µl at 37°C for 30 min. The products of the reactions were then analyzed on either a 13% (histone H1) or 10% (GST-Rb) SDS-PAGE gel. The gels were then stained, destained, dried, and exposed to X-ray film. For quantitation, the protein bands corresponding to histone H1 and GST-Rb were excised and the radioactivity of each band was measured by Cerenkov counting.In vitro transcription and translation assays. To transcribe and translate the cyclin EL-FLAG constructs cloned in the pcDNA3.1 vector, we used the TNT Coupled Reticulocyte Lysate system (Promega, Madison, Wis.). Briefly, 1 µg of pCDNA3.1 plasmid containing either the cyclin EL-FLAG inserts or no insert was added to rabbit reticulocyte lysate in the presence of T7 RNA polymerase and 1 mM complete amino acid mixture in a total volume of 50 µl and incubated at 30°C for 90 min. One-microliter volumes of each of the translation products, containing both the rabbit reticulocyte lysate and the synthesized cyclin E protein, were then separated on SDS-PAGE gels and subjected to Western blot analysis using either a monoclonal antibody to cyclin E (clone HE-12) or a polyclonal antibody to FLAG (both from Santa Cruz Biochemicals).
Plasmid construction. Block deletions (e.g., from aa 67 through 69, creating DEL6769) and amino acid substitutions (e.g., methionine substituted by alanine at position 16, creating M16A) were prepared using quick-change site-directed mutagenesis (5) or PCR cloning. The plasmid pCDNA 3.1, containing the EL form of cyclin E and a FLAG epitope (boldface) 5'-GCAAGCTTTTCACTTGTCATCGTCGTCCTTGTAGTCCGCCATTTCCGGCCCGCT-3' at the carboxy terminus (pCDNA 3.1 EL-FLAG, [23]) was used as the starting template for all of the mutations. The following oligonucleotides were synthesized along with their antiparallel version to form a double-stranded DNA pair containing the desired mutation centered in the sequence: M16A, AAGGAGCGGGACACCGCGAAGGAGGACGGCGG; M46A, CCAGATGAAGAAGCGGCCAAAATCGAC; V67D, GACAATAATGCAGACTGTGCAGACCCC; C68D, AATAATGCAGTCGATGCAGACCCCTGC; A69D, AATGCAGTCTGTGATGACCCCTGCTCC; D70P, GCAGTCTGTGCACCCCCCTGCTCCCTG; D70A, GCAGTCTGTGCAGCCCCCTGCTCCCTG; DEL6769, TGGGACAATAATGCAGACCCCTGCTCCCTG; DEL6469, AGCCAGCCTTGGGACGACCCCTGCTCCCTG; DEL7075, CAATAATGCAGTCTGTGCACCCACACCTGACAAAG; DEL1621, TGCGAAGGAGCGGGACACCGCGGAGTTCTCGGCT; DEL2227, AAGGAGGACGGCGGCTCCAGGAAGAGGAAG; DEL2833, GAGTTCTCGGCTCGCAACGTGACCGTTTTT; DEL3439, AGGAAGAGGAAGGCACAGGATCCAGATGAA; DEL4045, GTGACCGTTTTTTTGATGGCCAAAATCGAC. PCRs were performed with 1 µg of template (pCDNA 3.1-EL-FLAG) using Pfu polymerase (Stratagene) in the buffer provided and 125 ng of each oligonucleotide pair for 16 cycles of 95°C for 30 s, 55°C for 60 s, and 68°C for 12 min. The methylated template plasmid (from growth in Escherichia coli host DH10B) was digested with DpnI restriction enzyme at 37°C for 1 h. The DpnI-resistant, unmethylated PCR product containing the mutation was desalted on a G-50 Sephadex spin column and electroporated into the E. coli host DH10B. The E. coli cells were plated on ampicillin plates, and colonies were picked and checked for successful mutation by restriction analysis and sequencing. The following mutations were made with a different strategy using oligonucleotides to PCR amplify the plasmid pLXSN containing the cyclin EL (42) cDNA as template. The DEL7681 forward primer (GTCTGTGCAGACCCCTGCTCCCTGATCGATGATGACCGG) was used with the reverse primer CE1247 (AGCAAACGCACGCCTCCGCTGCAACA). The DEL8287 (ACACCTGACAAAGAACCAAACTCAACGTGCAAG) and DEL8893 (ACACCTGACAAAGAAGATGATGACCGGGTTTACCCTCGGATTATTGCA) forward primers were combined with the bridge forward primer CE196 (GCAGTCTGTGCAGACCCCTGCTCCCTGATCCCCACACCTGACAAAGAA) and used with the reverse primer CE1247. The PCRs were performed with 10 ng of template (pLXSN-cyclin E EL) using Taq polymerase in the buffer provided for 18 cycles of 95°C for 30 s, 65°C for 20 s, and 72°C for 30 s. The PCR products were ligated into the T/A cloning vector pCRII and transformed into DH10B, and colonies were selected as above. Plasmids containing the correct mutation were digested with the restriction enzymes BsgI and AgeI, and the fragment was ligated into the same site of pCDNA 3.1 EL-FLAG. Transformation and colony selection were as described above.
Expression of the LMW forms of cyclin E in insect cells. Plasmids pVLCDK2, pVLcycE, pVLcycET1, and pVLcycET2 were constructed by subcloning the full-length cDNA fragments for CDK2, the EL form of cyclin E, and its truncated forms (i.e., T1 and T2), respectively, into the multiple cloning sites downstream of the polyhedrin promoter of baculovirus transfer vector pVL1392 (PharMingen, San Diego, Calif.) to generate the high-expression vector systems for these proteins. Recombinant viruses were produced by cotransfection of the above purified plasmids, separately, with linearized BaculoGold virus DNA (PharMingen) into Sf9 insect cells. For the resultant recombinant viruses, B.G.CDK2, B.G.cycE, B.G.cycET1, and B.G.cycET2, titers were determined by end-point dilution assay and amplifications were performed by infecting the Sf9 insect cells at a low multiplicity of infection (MOI) (0.7), maintaining the high percentage (99%) of the recombinant viruses in the large stock and therefore assuring the high expression of the desired proteins. The supernatants of viruses amplified were harvested around 60 h postinfection (p.i.). Protein extracts were subjected to Western blotting, immunoprecipitation, and H1 kinase analysis, as described above.
Coinfection of the viruses B.G.CDK2 plus B.G.cycE, B.G.CDK2 plus B.G.cycET1, and B.G.CDK2 plus B.G.cycET2 was carried out by mixing the two viruses at a 1:1 ratio and coinfecting the Sf9 insect cells at an MOI of 1.4 (0.7 of each virus). As controls, the Sf9 cells were also infected with the four different viruses separately, each at an MOI of 1.4, at the same time. After around 60 h p.i., infected cells were harvested and protein extracts from these cells were subjected to Western blotting, immunoprecipitation, and H1 kinase analysis, as described before.Porcine pancreatic elastase digestion.
Plasmids containing
the full-length cyclin EL, block deletions A to E, A', and point
mutations of cyclin E FLAG-tagged constructs as well as the
vector-alone construct were translated in vitro using a TNT kit
(Promega) as described above. A total of 10
4 U
of the porcine pancreatic elastase (Sigma Biochemicals) was mixed with
0.25 µl of the TNT reaction mixture (i.e., 5 µl of a 1:20 dilution)
in the elastase reaction buffer (50 mM Tris [pH 8.5], 250 mM NaCl)
and incubated at 30°C for 5 min. At the end of incubation the entire
reaction mixture (total volume, 20 µl) was subjected to SDS-PAGE and
Western blot analysis with anti-FLAG antibody.
Cyclin E purification and MS. Cyclin E was purified from 500 mg of MDA-MB-157 cell extract prepared by sonication and centrifugation as described previously (45). The extract was precleared with three successive incubations with 1 ml of Sepharose CL6B rotated at 4°C for 2 h. After preclearing, the extract was incubated overnight with 1 ml of the monoclonal antibody HE-111 cross-linked to Sepharose (Santa Cruz). The antibody resin was washed with Buffer A (50 mM Tris [pH 8.0], 1 mM EDTA, 0.5 M NaCl, 0.5% Nonidet P-40), Buffer B (50 mM Tris [pH 8.0], 1 mM EDTA, 0.15 M NaCl, 0.1% SDS, 0.5% Nonidet P-40), and Buffer C (50 mM Tris [pH 8.0], 1 mM EDTA, 0.15 M NaCl, 0.5% Nonidet P-40) and then eluted by boiling in SDS-polyacrylamide, reducing, sample buffer. The eluted sample was loaded onto a 10% polyacrylamide gel, electrophoresed, and silver stained (omitting the glutaraldehyde step [38]). A gel slice was excised and a 1-mm fragment was electrophoresed again and evaluated by Western blotting to confirm the presence of cyclin E. The gel slice was digested using modified trypsin from Boehringer Mannheim. Reactive cysteines were reduced with 10 mM dithiothreitol (DTT) and blocked with iodoacetamide (aminocarboxy methylation). The gel slice was dehydrated in acetonitrile for 30 min and then dried in a vacuum. The slice was rehydrated in 10 mM DTT, 100 mM ammonium bicarbonate at 55°C for 1 h. This solution was replaced with 55 mM iodoacetamide, 100 mM ammonium bicarbonate in the dark for 45 min at room temperature with vortexing. The slice was then washed with 100 mM ammonium bicarbonate for 10 min, dehydrated in acetonitrile for 30 min, and dried in a vacuum. One more round of hydration-dehydration was performed, and the gel slice was swollen in digestion buffer (50 mM ammonium bicarbonate, 5 mM CaCl2, 12.5 ng of trypsin/µl) and digested at 37°C for 18 h. The peptides were extracted and analyzed by matrix-assisted laser desorption-ionization time-of-flight mass spectrometry (MALDI-TOF MS) as follows. The gel slice was extracted twice with 0.1% trifluoroacetic acid (TFA) and 70% acetonitrile in a small volume for 45 min. The sample was concentrated using a Speed-Vac. The combined extracts were loaded onto a C18 Zip Tip (Millipore), washed with 0.1% TFA, and eluted with 10 to 70% acetonitrile. One microliter of the eluted sample was spotted on target along with 1 µl of matrix (10 mg of alpha-cyano-4-hydroxycinnamic acid/ml) solubilized in 70% acetonitrile and analyzed on a Bruker Reflex delayed-extraction MALDI-TOF apparatus.
| |
RESULTS |
|---|
|
|
|---|
MS identifies the predominant cyclin E as the EL form.
The
characteristic pattern of cyclin E processing found in tumor cells and
tumor tissues includes a number of LMW forms ranging in size from 33 to
45 kDa, in addition to the 50-kDa full-length form which is found in
both normal and tumor cells (31). We used MS to identify
the full-length 50-kDa cyclin E in tumor cells by determining the N
terminus directly from tryptic peptides of the purified cyclin E
protein. To this end, we purified cyclin E from 2 × 1010 MDA-MB-157 cells (500 mg of total
cellular extract) with a cyclin E monoclonal antibody (clone
HE-111) affinity column. The purified cyclin E was eluted from the
column and resolved by SDS-PAGE. After silver staining the gel, the
band corresponding to the full-length (i.e., 50 kDa) cyclin E was
excised, reduced, alkylated, and digested with trypsin according to
established procedures (52). The purified cyclin E tryptic
peptides were extracted from the gel slice and analyzed by MALDI-TOF
MS, which yielded 10 peptides with internally calibrated masses
matching predicted cyclin E peptides from both the N- and
C-terminal domains of cyclin E (Fig.
1). The mass spectrum of the purified
cyclin E tryptic digests as analyzed by MALDI-TOF is depicted in Fig.
1A. The alignments of the 10 peptides to cyclin E are shown underneath
the schematic representation of cyclin EL (Fig. 1B). The shaded region
defines the unique cyclin EL sequences not found in the 45-kDa cyclin
E. Cyclin EL is the 15-aa elongated variant of cyclin E identified in
1995 (42), while the 45-kDa cyclin E corresponds to the
gene identified in the yeast complementation studies first identifying
cyclin E (33, 34). Four of these tryptic peptides
(numbers 5, 7, 9, and 10) contain sequences from the N
terminus of the EL form of cyclin E which are not present in the 45-kDa
form of cyclin E (Fig. 1C). All four peptides contain an internal
methionyl residue from position 16 (M16) of the intact EL form of
cyclin E, which could only derive from the EL cyclin E and not the
45-kDa cyclin E, with a predicted translation start at M16. This MS
analysis of cyclin E purified from breast cancer cells confirms that
the 50-kDa full-length cyclin E found in these cells is the cyclin EL.
Therefore, we selected the EL form of cyclin E as the backbone for all
subsequent expression vectors.
|
Block deletions and amino-acyl substitutions define cyclin E
proteolysis in tumor cells.
Previously, we showed that the
processing of cyclin E required to generate the LMW forms detected only
in tumor cells occurs posttranslationally (23). To
identify the exact position where cyclin E is proteolytically
processed, we transiently transfected the full-length and selectively
deleted and/or mutated forms of C-terminus epitope-tagged, cyclin
EL-FLAG into tumor cells and analyzed their expression by Western
blotting using a FLAG antibody (Fig.
2B). The results
revealed that in the MDA-MB-157 tumor cell line the exogenously
expressed FLAG-tagged cyclin EL (Fig. 2B, lane EL) is processed very
similarly to the endogenous cyclin E (Fig. 2B, lane E-Tumor),
generating the same Western blotting pattern of bands. We used a
numbering system to facilitate the analysis of the cyclin E LMW forms.
The full-length 50-kDa form of cyclin E is EL1. Below EL1 is a doublet
migrating at 45 and 44 kDa and designated as EL2 and EL3. A single band
migrating at 40 kDa is EL4, and another doublet below this at 35 and 33 kDa is designated EL5 and EL6. The Western blotting patterns of cyclin
EL-FLAG isoforms EL1 to -6 were comparable in other transfected breast
cancer cell lines (see below).
|
The cyclin E 45-kDa form is not expressed in tumor cells. We suspected that bands EL2 and -3 represented protein translated from the M16 start site originally thought to be the primary form of cyclin E (33, 34). However, we were surprised when an M16A substitution did not affect the expression of bands EL2 and -3 (Fig. 2D). For these analyses, we compared the in vitro-translated products of cyclin EL1 and of cyclin EL1 mutated at M16 or M46 to an alanyl residue, with the proteolytically processed protein products from transfected tumor cells (Fig. 2D). When the protein from EL1-FLAG-transfected MDA-MB-157 was run side by side with the in vitro-translated cyclin E products from the same vector, the bands EL2 and EL3 clearly migrated faster than the in vitro translation products from the M16 translation start site (Fig. 2D, compare lanes 1 and 2). This difference in migration between the M16 in vitro-translated band and EL2 and -3 in the tumor cells was a hint that M16 may not be required to generate EL2. EL2 is the LMW band we suspected was the 45-kDa cyclin E wild type (33, 34). We then replaced the methionyl residues at positions 16 and 46 with an alanyl residue, knocking out any alternative translation initiation from these sites (Fig. 2D). The M16A and M46A substitutions clearly eliminated translation starts from these sites when translated in vitro (lanes 3 and 5). However, only the M46A substitution eliminated EL4 from transfected MDA-MB-157 cells (lane 6), while the M16A substitution had no effect on the generation of EL2 (lane 4). Even though EL2 and -3 migrate closely to the cyclin E translated from M16, these bands are most likely created by proteolysis rather than by alternate translation at M16. The in vitro mutagenesis of cyclin E shown here and the MS data (Fig. 1) collectively provide strong evidence that the high-molecular-weight, full-length form of cyclin E found in tumor cells is translated from the cyclin EL mRNA (42) and not the cyclin E wild-type form initially cloned as this G1 cyclin (33, 34). Furthermore, while the EL5 and -6 and EL2 and -3 LMW forms are due to proteolytic processing, EL4 can be accounted for by an alternate translation start site, as shown by the elimination of this band after the mutation of the methionyl at residue 46 into alanyl, both in transfected cells and when the protein is translated (i.e., TNT assay) in vitro (Fig. 2D, lanes 5 and 6).
Lastly, an examination of the proteolytic process generating EL2 and EL3 was performed similarly to the process used to define EL5 and EL6. Successive 6-aa block deletions in cyclin E were created in the EL-FLAG vector used to transfect the tumor cell line MDA-MB-157. These block deletions span the region from M16 to M46 (Fig. 2E). The results from FLAG Western blot analysis of cells transfected with these block deletions reveal that the processing of cyclin E into EL2 and EL3 is not eliminated by block deletions spanning aa 16 to 39. However, the block deletion of aa 40 to 45 results in the prevention of cyclin E proteolysis into bands EL2 and EL3 when transfected into MDA-MB-157 cells (Fig. 2D). These results suggest that the amino acids targeted by proteolysis to generate cyclin EL2 and EL3 are within residues 40 to 45 of the cyclin EL protein.The LMW forms of cyclin E are hyperactive.
To examine the
biochemical activity of the LMW forms of cyclin E compared to that of
the full-length form, we used three different constructs of cyclin E
that were FLAG tagged at the C terminus in transfection assays using
normal and tumor cells. The three constructs are cyclin EL-FLAG, Trunk
1, and Trunk 2, as described previously (23). Trunks 1 and
2 bracket only the LMW isoforms of cyclin E and not the full-length
form, while cyclin EL represents the full-length form. Trunk 1 initiates at aa 40 and brackets EL2-6 (Fig. 2E, lane 8), and Trunk 2 initiates at aa 65 and brackets EL5 and EL6 (Fig. 2D, lane 7). We have
examined the biochemical activities associated with the protein
products of cyclin EL, Trunk 1, and Trunk 2 constructs in several
normal and tumor cell lines (Fig. 3).
|
|
The LMW forms of cyclin E facilitate S-phase entry. Next, we examined the biological activity of the LMW forms of cyclin E by addressing if their overexpression in normal cells would have a mitogenic effect on the cell cycle and increase progression of cells through S phase. For these studies, we transfected the three cyclin E constructs (i.e., cyclin EL-FLAG, Trunk 1-Flag, and Trunk 2-Flag) into a normal mammary epithelial 81N cell strain. These constructs were cotransfected with a plasmid containing enhanced GFP (EGFP). Sixteen hours following cotransfection, cells were harvested and subjected to FACS analysis to isolate the GFP-positive cells from GFP-negative cells. Following sorting of cells, the EGFP-positive cells were divided into three samples. The first group of EGFP-positive cells was extracted and prepared for Western blot analysis along with the EGFP-negative sorted and unsorted cells (Fig. 4A). The second group of EGFP-positive cells was fixed and prepared for cell cycle analysis (DNA content with PI) using flow cytometry (Fig. 4B and C). The third sample was plated onto coverslips for analysis by anti-Flag immunofluorescence (Fig. 4D).
Sorting cells based on EGFP cotransfection proved effective as a means of selecting Flag-tagged cyclin E-expressing cells (Fig. 4A, top panels). The unsorted cells in the first four lanes showed a typical pattern of expression of the Flag-tagged cyclin E constructs in normal cells (Fig. 4A, Unsorted). The next four lanes represent the EGFP-negative cells, dramatically demonstrating the efficiency of FACS. There is no detectable Flag signal present in these EGFP-negative sorted cells. The final four lanes show the Western blot signal from the EGFP-positive cells. Complementing the findings shown in the previous four lanes, these lanes show a strong Flag signal. Compared to the unsorted cells, the EGFP-positive cells have a much stronger Flag signal, reflecting the lack of dilution from the untransfected cells. These results indicate that most, if not all, of the GFP transfected cells also expressed the protein products of the cyclin E-FLAG constructs, while none of the GFP-negative cells expressed the cyclin E-FLAG protein products and hence were not cotransfected with the FLAG constructs. If cyclin E-FLAG has mitogenic activity on the cell cycle, it may also affect the expression of other cell cycle regulators. To test this hypothesis, we examined the expression of CDK2, cyclin E (endogenous), cyclin D1, p21, and p27 in the GFP-expressing cells (Fig. 4A). Our results revealed that CDK2 levels increased substantially in cells transfected with the cyclin E-FLAG constructs compared to vector-alone controls. Ectopic expression of Trunk 1, one of the LMW forms of cyclin E, had the most profound effect on CDK2 expression. However, the full-length cyclin E and Trunk 2 also increased CDK2 expression over vector-alone transfectants. Furthermore, the levels of p27 and p21 were decreased (slightly, however) in the FLAG transfectants. Levels of cyclin D1 were unaffected. Lastly, the mere overexpression of the exogenous cyclin E-FLAG constructs, up to 10-fold over that of endogenous cyclin E, did not result in proteolytic processing of cyclin E in these normal cells (Fig. 4A, Cyclin E panel). Collectively, these results suggest that the LMW forms of cyclin E, and to a lesser degree the full-length form, are involved in a positive feedback loop, where CDK2 levels, and presumably its activity, are increased and p27 and p21 levels are decreased. Such a positive feedback loop would be predictive of facilitated progression through G1 and into S phase. We next examined the cell cycle progression of EGFP-positive, FLAG-transfected cells by staining the sorted cells with PI and analyzing them by flow cytometry for DNA content (Fig. 4B and C). These results revealed that transfection of full-length cyclin E (i.e., EL), Trunk 1, or Trunk 2 resulted in a significant progression of the cells into S and G2/M. Trunk 1 was the most mitogenic form of cyclin E, decreasing the G1 phase from 70 to 45% and increasing the S-plus-G2/M phases from 30 to 55%. However, full-length cyclin E and Trunk 2, the smallest of the LMW forms of cyclin E, were also quite effective in facilitating G1-to-S-phase progression. On average, the G1 phase in cells harboring EL, Trunk 1, or Trunk 2 dropped between 20 and 37% while the S-plus-G2/M content of cells increased by 147 to 265%, i.e., over twofold in Trunk 1-transfected cells (Fig. 4C). These results suggest that overexpression of at least two of the LMW forms of cyclin E in normal cells has a profound mitogenic effect, stimulating the cells to progress through the cell cycle. The effect on G2 accumulation by Trunk 1 and Trunk 2 is different, with Trunk 1 having a more profound G2 accumulation than Trunk 2. These observations suggest that there may be two different mechanisms at work promoting tumor survival, one involving Trunk 1 (EL2/3) and another involving Trunk 2 (EL5/6). We also examined the intracellular localization of the LMW forms of cyclin E compared to that of the full length. It has been well established that the endogenous cyclin E full-length form is predominantly nuclear (42). To determine the subcellular localization of the LMW forms of cyclin E, the GFP-positive sorted cells were stained with affinity-purified anti-FLAG antibody (Fig. 4D). The fluorescence microscopy images in Fig. 4D show transfected, EGFP-positive sorted cells in the upper panels. In the same cells, the immunofluorescence localization of the cotransfected Flag-tagged cyclin E is shown in the lower panels. In each case, Flag-tagged cyclin E localized to the nucleus. The expression levels of the Flag-tagged cyclin E isoforms varied from cell to cell, yet even the highest expression levels showed no cytoplasmic staining above background. This shows that the nuclear localization of cyclin E can occur even when a significant amount of the N terminus has been deleted (Fig. 4D, T2 panels).Hyperactive LMW forms of cyclin E have increased affinity for
CDK2.
The results from our transfection experiments (Fig. 3)
revealed that the tumor-specific LMW forms of cyclin E promote more kinase activity than the full-length protein, explaining their selection in tumor cells. Furthermore, these LMW forms of cyclin E can
also induce the expression of more total CDK2 protein in transfected
human cells (Fig. 4A). These data raise the question of whether the LMW
forms are hyperactive due to their preferentially inducing the
expression of more CDK2 or whether these forms are hyperactive
regardless of how much CDK2 is present in the cell. To directly address
this question quantitatively, we overexpressed full-length cyclin E and
its LMW forms and CDK2 in insect cells using a baculovirus expression
system (Fig. 5). Insect cells were coinfected with the recombinant baculovirus containing CDK2 and either
full-length cyclin E, cyclin E-T1, or cyclin E-T2 cDNAs (Fig. 5). As a
control for expression of individual proteins, insect cells were also
infected with only one baculovirus, representing each of the
aforementioned cDNAs. Sixty hours p.i., cells were harvested and
subjected to Western blotting (Fig. 5A) and histone H1 and GST-Rb
kinase (Fig. 5B) and immunoprecipitation (Fig. 5C) analyses. Western
blot analysis with FLAG or CDK2 antibodies showed that there were
similar levels of expression of the three cyclin E forms and of CDK2 in
the infected insect cells. Furthermore, whether CDK2 was infected alone
or in combination with the three cyclin E forms, equal levels of the
protein were expressed in these cells. CDK2 kinase assays using either
histone H1 or GST-Rb as substrate revealed that the truncated forms of
cyclin E activate a greater amount of kinase activity than the EL form
(Fig. 5B) under conditions where equal amounts of CDK2 were
immunoprecipitated from each sample (Fig. 5C). In the coinfected insect
cells, Trunk 1 and Trunk 2 phosphorylated histone H1 and GST-Rb between
two- and sixfold more effectively than the full-length cyclin E. (The bands corresponding to histone H1 and GST-Rb were excised and quantitated by scintillation counting [data not shown].)
Interestingly, the fold increase in the hyperactivity of the LMW forms
of cyclin E over the full length was very similar in the insect cell
baculovirus expression system and the transfection experiments in
normal mammary epithelial cells (Fig. 3). Immunoprecipitation analysis
revealed that the hyperactivity of the LMW forms of cyclin E was not
due to different levels of CDK2 in the cell, since the amount of CDK2 immunoprecipitated was identical in all the coinfected samples (Fig.
5C). What is different among the three forms of cyclin E is their
ability to bind to CDK2. The LMW forms of cyclin E bind more
effectively to CDK2 than the full-length form, as was apparent in CDK2
immunoprecipitates blotted with FLAG (Fig. 5C) (cyclin E immunoblots
showed identical results [data not shown]). These experiments suggest
that even though the same amounts of cyclin E and CDK2 are present in
the cell and equal amounts of CDK2 are immunoprecipitated from each
sample, the LMW forms of cyclin E can bind to CDK2 more effectively
than the full-length form, resulting in their hyperactivity. The
results from the insect cell baculovirus expression system (Fig. 5)
clearly recapitulated the results from our transient-transfection
assays (Fig. 3 and 4) and collectively suggest that the LMW forms of
cyclin E are indeed hyperactive.
|
Identification of an elastase class of enzymes as the protease generating the LMW forms of cyclin E in vitro. Since the LMW isoforms of cyclin E have a significant biochemical and biological function in inducing G1-to-S-phase progression, we next set out to identify the putative protease responsible for the aberrant cleavage of cyclin E in tumor cells. The results shown in Fig. 2 suggest a novel type of proteolysis cleaving cyclin E into EL5 and EL6. We refer to the cyclin E protease domain stretching from A66 to P71 as AVCADP. This is a short hydrophobic stretch of amino acids followed by aspartate-proline and embedded in a random coil (GOR4-predicted) secondary structure (termed loop 2) bearing a striking similarity to the scissile domains of the serine proteinase inhibitors plasminostrepsin and streptomyces subtilisin inhibitor, making the AVCADP sequence accessible to the protease (3). A second cleavage point nearer to the N terminus in the domain from K32 to K48 (anticipated to generate EL2/3) has the sequence VFLQDP, similar to AVCADP, appears to be in a similar random coil structure (GOR4), and is termed loop 1.
The AVCADP and VFLQDP sequences in cyclin E, whose cleavage generates EL5/6 and EL2/3, respectively, are consensus sequences for the elastase class of serine proteases (3). In order to demonstrate the elastase quality of cyclin E proteolysis, cyclin E was synthesized through in vitro translation using rabbit reticulocyte lysate and then partially digested with porcine pancreatic elastase (Fig. 6). Each of the mutations described in Fig. 2B and C were also used in this in vitro study. These analyses clearly showed that the proteolysis of cyclin E in cells is very similar to proteolysis of cyclin E in vitro using commercial elastase (Fig. 6A and B). In vitro-translated (reticulocyte lysate) wild-type cyclin E and similar proteins translated from constructs containing mutations previously used for transfection all digest in vitro with a porcine pancreatic elastase, generating a Western blot pattern similar to the in vivo (i.e., transfected) pattern (compare Fig. 6A with Fig. 2B). Incubation of the purified elastase enzyme with in vitro-translated cyclin EL products resulted in generation of EL3 and EL6 (Fig. 6A; compare lanes 1 and 2). Block deletions A and B knocked out EL6 production, while block deletions A', C, D, and E were incapable of knocking out the EL6, similar to tumor cell transfection of FLAG-tagged cyclin EL mutant constructs (i.e., Fig. 2B). Incubation of the point mutations of cyclin EL constructs by elastase also generated or knocked out the LMW forms of cyclin E as seen with the tumor cell transfection of the same constructs (compare Fig. 6B with Fig. 2C). For example, incubation of the in vitro-translated mutant constructs V67D and C68D generated EL6 and EL3, while mutant constructs A69D and D70P eliminated EL6 but not EL3. Additionally, elastase enzyme also induced the cleavage of cyclin E (presumably at the loop 1 domain) to generate EL3 in all EL and mutant vectors containing V67D, C68D, and A69D point mutations (Fig. 6B). This result clearly demonstrates that the cleavage site for generation of the EL2/3 doublet is distinct from the site that gives rise to EL5/6. Hence, elastase cleaves preferentially at two sites, one defined by the mutations shown in Fig. 2B and C and Fig. 6A and B as well as a site downstream of the M16 position (Fig. 2E). This is seen as the appearance of a second band below the M16 start site (Fig. 6C, lane 2). This band is generated by elastase cleavage, as clearly seen in Fig. 6C, lanes 1 and 2, where the M16A mutation lacking a band at the M16 position is still cleaved by elastase. Furthermore, as was the case with EL5/6, we believe the generation of the EL2/3 doublet in cell transfection is the result of posttranslational modification (e.g., phosphorylation) of EL3, which cannot be generated in vitro.
|
-ketooxadiazole (CE-2072). Elastatinol and MPCMK are potent
elastase-specific substrate-based inhibitors of elastases (37,
56). CE-2072 is a specific and potent reversible inhibitor of
human neutrophil elastase (i.e., with a Ki
of 0.025 nM) (12, 59). We found that with all three
inhibitors, the elastase-mediated cleavages of cyclin EL into EL3 and
EL6 were inhibited (Fig. 6C).
Cyclin E processing takes place intracellularly.
The data
presented in Fig. 6 suggest that the LMW forms of cyclin E are
enzymatically produced, very likely by the elastase class of proteases.
Since elastase is a secreted enzyme, it may be possible that upon
breaking open the cells, the secreted elastase can come into contact
with the intracellular cyclin E and induce the cleavage in lysed cells.
We have addressed this issue and found by using three different
approaches that the fragmentation pattern observed with cyclin E in
tumor cells occurs intracellularly prior to homogenization of cells
(Fig. 7A to C). Initially (Fig. 7A), we
blocked the membrane-bound proteases from contacting cyclin E during
the lysis procedures and found that the LMW forms of cyclin E in tumor
cells preexist prior to lysis in intact cells. Our usual procedure for
preparing tumor and normal cell extracts is to sonicate the cells in
PBS containing a protease inhibitor cocktail (Fig. 7). Under these
conditions, we detected the full complement of the LMW forms of cyclin
E (Fig. 7A, lane 3). Additionally, in order to prevent active
extracellular proteases from contacting cyclin E during lysis, sample
buffer (containing
-mercaptoethanol and 10% SDS) was added
directly to cells, immediately boiled for 10 min, and then subjected to
SDS-PAGE and Western blot analysis with cyclin E antibody (lane 1). We
also prepared cell extracts by sonicating them in only PBS (lane 2).
This experiment revealed that the fragmentation pattern was the same
regardless of the buffers used. Next, to address directly whether
any extracellular elastase activity could potentially cleave cyclin E
during the lysis procedure, resulting in the generation of LMW forms,
we added a cocktail of elastase inhibitors during lysis (lane
4). The pattern of cyclin E LMW forms remained unchanged by the
elastase inhibitors (compare lanes 1 and 4). These results indicate
that the LMW forms of cyclin E in tumor cells are likely to preexist in
the cells prior to extraction.
|
| |
DISCUSSION |
|---|
|
|
|---|
In this report we describe a novel proteolysis of cyclin E, occurring only in tumor cell lines and tissues, which generates the LMW forms of cyclin E in tumor cells. A total of six cyclin E proteins were detected in tumor cells ranging in molecular mass from 50 to 33 kDa. We have termed the 50-kDa cyclin E as EL1 and the five cyclin E protein products from 45 to 33 kDa as the LMW isoforms cyclin EL2 to EL6. All of the detectable LMW forms of cyclin E found in tumor cells can be explained as the result of three mechanisms at work. First, alternate translation at M46, but not at M16, accounts for the band we call EL4 (Fig. 2D). M16 alternate translation does not occur in cells, even though it can readily occur in reticulocyte lysate (Fig. 2D and 6A and B). Second, proteolysis of cyclin E occurs around the carboxyl side of A69, generating bands at EL5 and -6 (Fig. 2B and C). These bands are a doublet resulting from the third process, a posttranslation modification such as phosphorylation or deacetylation. Finally, bands EL2 and -3 arise from a similar proteolysis and posttranslational modification as EL5 and -6 at aa 40 to 45. We have also identified the full-length cyclin E as the EL form (Fig. 1 and 2D) described previously as the 15-aa alternatively spliced elongated form of cyclin E (42).
The proteolytic processing of cyclin E is unique to tumor cell lines and tissues. This tumor-specific pattern is not the result of overexpression or constitutive expression since normal cells transfected with cyclin E under a strong constitutive promoter do not further process cyclin E into its LMW forms (23; Fig. 3). The proteolysis we have described also differs from the proteasome-dependent proteolysis of cyclin E described by two other laboratories (11, 62). In these studies, the ubiquitination of cyclin E was dependent upon a specific phosphorylation at threonine 380. Although the destruction of cyclin E may be mediated through the ubiquitination-proteasome pathway in tumor cells, the generation of the LMW forms observed under steady state conditions in tumor cells and tissues is not likely to be generated by the proteasome pathway. Additionally, the LMW forms of cyclin E are present constitutively in the tumor cells and are not subject to cell cycle regulation (29). Furthermore, the LMW forms of cyclin E do not seem to represent the intermediate proteolytic products of degradative machinery (Fig. 7D). We conclude that these LMW forms of cyclin E are more likely due to the action of a different protease.
The way cyclin E is processed into LMW isoforms is also different than the proteolysis of other cyclins in the cell. For example, cyclin D1 is degraded by a calpain protease (10). Cyclin A is cleaved in vitro by a p27-dependent protease which removes the destruction box and allows evasion from proteasomal degradation (4). The proteolysis we describe here for cyclin E at A69 to D70 does not appear to occur to other cyclins. This site is homologous to elastase protease substrate sequences containing essential small hydrophobic residues (3). When A69 is replaced with an aspartyl residue, the proteolysis is nearly completely blocked (Fig. 2 and 6). A D70P substitution completely blocks degradation, presumably due to the unique imino-peptide bond afforded by the proline residue within the scissile bond. The effect of proline at position 70 is not surprising since this is commonly used in the design of peptide inhibitors of proteases (46). The involvement of an aspartyl residue in the cleavage site raises the possibility that a caspase protease might be involved, yet the typical DEVD motif is not present. In addition, the cyclin E protease appears to cleave on the N-terminal side of D70, contrary to a caspase cleavage on the C-terminal side of aspartyl residues. For example, a caspase activity which cleaves cyclin A during apoptosis in Xenopus embryos cleaves downstream of a critical aspartyl residue (54). In the case of cyclin E, the aspartyl residue is not essential since the D70A mutation does not block proteolysis of cyclin E and in fact may encourage it (Fig. 2).
The sequence analysis of the specific regions in cyclin E cleaved to produce EL5/6 (loop 2, A66 to P71; the AVCADP motif) and EL2/3 (loop 1, K32 to K48; the VFLQDP motif) suggested that the protease cleaving these regions is a serine protease of the elastase class (3). These regions within cyclin E form a hairpin loop type of structure making them accessible to the protease. We showed that in vitro-translated wild-type and mutant cyclin E proteins all digest in vitro with a porcine pancreatic elastase, generating a Western blot pattern similar to the in vivo pattern (compare Fig. 2 and 6). The striking similarity of in vivo and in vitro cleavage is supporting evidence that the elastase class of enzymes may actively cleave cyclin E in the cell. There are two possible ways to interpret how cyclin E is cleaved into its LMW forms by the elastase class of enzymes in tumor cells but not normal cells: (i) there is more elastase activity in tumor cells than in normal cells; or (ii) normal cells express high levels of elafin, an inhibitor of elastase. There is precedent for both these possibilities. Several studies have shown that the elastases are overexpressed in human cancer (20, 63, 64). Additionally, recent studies have reported that elafin, a potent elastase inhibitor for human leukocyte elastase and porcine pancreatic elastase (60), is differentially expressed in normal versus tumor-derived mammary epithelial cells, with very high levels in normal cells and undetectable levels in breast cancer cells (65). Collectively, these studies suggest that normal cells may be protected from the proteolytic effects of elastase by overexpressing elafin, while in tumor cells elastase expression may promote increased cyclin E activation and subsequent accelerated S-phase entry.
The specific cyclin E proteolysis at the AVCADP and VFLQDP motifs may separate a substrate-targeting domain (28) from the active cyclin E-CDK2 complex or affect the binding of an inhibitor protein. In addition, since the efficiency of proteasome proteolysis does not leave partial peptides, we presume the proteolysis of cyclin E generating bands EL2 through EL6 occurs prior to the reported proteasome degradation (11, 61). Hence, although the proteasome pathway is involved in degrading cyclin E, the proteolysis of cyclin E described here is a newly discovered level of cyclin regulation distinct from the ubiquitin-proteasome pathway. The elastase proteolysis of cyclin E may have a specialized role in the regulation of cyclin E-CDK2 activity, substrate selection, or subcellular localization rather than a role regulating the timely destruction of cyclin E.
The LMW forms of cyclin E seem to have a regulatory role distinct from that of the full-length protein. Our results clearly show that the LMW forms are biochemically hyperactive, as they can phosphorylate substrates such as histone H1 and GST-Rb much more efficiently than the full-length form. We used two different systems to examine the biochemical activity of the LMW forms of cyclin E compared to the full-length form. The two systems used, namely the transient-transfection assay in normal human mammary epithelial cells and the insect cell baculovirus expression system, both revealed that the LMW forms of cyclin E are two- to sixfold more active than the full-length form. Furthermore, the insect cell system, which is more quantitative, revealed that the hyperactivity of the LMW forms of cyclin E is in part due to an increased affinity of these forms for CDK2. Cyclin kinase inhibitors may also play a role in the cyclin E LMW form hyperactivity (data not shown). This high level of kinase activity associated with the LMW forms of cyclin E may be a significant contributor to the tumor phenotype directly through the action of the overexpressed kinase. The effect of the LMW forms (i.e., T1 and T2 transient expression) on normal cell growth also reflects this stimulated CDK2 kinase activity. When normal cells, which are devoid of any LMW forms, are forced to express the LMW forms of cyclin E, the cells progress through S phase very effectively. This fits the pattern seen in tumor cells, which already overexpress the LMW forms of cyclin E. Apparently, the tumor cells have adapted to this state since they are less responsive to the T1 and T2 transient expression (Fig. 3 and data not shown). Lastly, we showed that the LMW forms of cyclin E appear to retain the ability to localize to the nucleus even with a significant loss of the N terminus. Obviously, the nuclear targeting or retention signal is not found in the N terminus of cyclin E (19). The conclusion from these studies is that the LMW forms of cyclin E are not only functional but also h