Previous Article | Next Article 
Molecular and Cellular Biology, September 2001, p. 6292-6311, Vol. 21, No. 18
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.18.6292-6311.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Mechanisms Controlling Subcellular Localization of
the G1 Cyclins Cln2p and Cln3p in Budding Yeast
Mary E.
Miller
and
Frederick R.
Cross*
The Rockefeller University, New York, New
York 10021
Received 1 May 2001/Returned for modification 7 June 2001/Accepted 25 June 2001
 |
ABSTRACT |
Different G1 cyclins confer functional specificity to
the cyclin-dependent kinase (Cdk) Cdc28p in budding yeast. The Cln3p G1 cyclin is localized primarily to the nucleus, while
Cln2p is localized primarily to the cytoplasm. Both binding to Cdc28p
and Cdc28p-dependent phosphorylation in the C-terminal region of Cln2p are independently required for efficient nuclear depletion of Cln2p,
suggesting that this process may be physiologically regulated. The
accumulation of hypophosphorylated Cln2 in the nucleus is an
energy-dependent process, but may not involve the RAN GTPase. Phosphorylation of Cln2p is inefficient in small newborn cells obtained
by elutriation, and this lowered phosphorylation correlates with
reduced Cln2p nuclear depletion in newborn cells. Thus, Cln2p may have
a brief period of nuclear residence early in the cell cycle. In
contrast, the nuclear localization pattern of Cln3p is not influenced
by Cdk activity. Cln3p localization requires a bipartite nuclear
localization signal (NLS) located at the C terminus of the protein.
This sequence is required for nuclear localization of Cln3p and is
sufficient to confer nuclear localization to green fluorescent protein
in a RAN-dependent manner. Mislocalized Cln3p, lacking the NLS, is much
less active in genetic assays specific for Cln3p, but more active in
assays normally specific for Cln2p, consistent with the idea that Cln3p
localization explains a significant part of Clnp functional specificity.
 |
INTRODUCTION |
Cyclin-dependent kinases (Cdks) are
serine/threonine protein kinases that are required for key events in
the cell division cycle. Cdk activity depends on conformational changes
induced by physical association with cyclin proteins and subsequent
cyclin-dependent targeting of Cdk activity to potential substrates
(3, 49, 50, 56). A single Cdk can carry out multiple
functions, dependent on the identity of its cognate cyclin partner. In
budding yeast, the Cdk Cdc28p is required for all key cell cycle
events. When bound by any one of three G1 (Cln)
cyclins, Cdc28p supports cell cycle entry (12). When bound
by one of six B-type (Clb) cyclins, Cdc28p supports later cell cycle
events, such as DNA replication and mitosis (54). For both
G1 Cln cyclins and B-type Clb cyclins, specific
cyclins provide functional specificity to the Cdk complex independent
of expression patterns and abundance of associated kinase activity
(14, 30, 38).
Deletion of all three G1-type cyclin
CLN genes results in a cell cycle arrest before cell cycle
initiation, as unbudded cells with 1C DNA content. CLN1,
CLN2, and CLN3 are functionally redundant, since
all double cln deletions result in viability. However, there are significant differences in the functional specificity of
CLN2 (representative of the highly homologous CLN1
CLN2 gene pair) and CLN3. Functional analysis of
CLN2 and CLN3 indicates that CLN3 is
primarily required for the expression of genes during late
G1, including CLN1 and
CLN2. This Cln3p activity requires the SCB transcription
complex, consisting of Swi4p and Swi6p (34). Once
expressed, Cln2p is believed to trigger events required for cell cycle
progression, such as bud emergence and activation of Clb-Cdc28p
complexes (7, 12, 15, 40). Bck2p also triggers SCB-dependent transcription in G1, most likely
working in parallel with Cln3p (17, 21). We have
characterized the subcellular localization patterns of the
G1 cyclins Cln2p and Cln3p and find strikingly
distinct localization patterns. These patterns are consistent with the
idea that Cln2p and Cln3p confer functional specificity to the Cdk
Cdc28p and support cell cycle entry by distinct mechanisms. Cln3p,
thought to be the physiologically relevant cyclin for activation of
transcription (19, 38, 70), is localized primarily to the
nucleus (45). Cln2, thought to trigger other events, such
as bud emergence (7, 12, 15, 40), is localized primarily
to the cytoplasm (45).
Differences in functional specificity between Cln2p and Cln3p can be
assayed in specific genetic backgrounds. For example, CLN2
is able to support viability in the absence of Swi4p, while CLN3 is not (38, 55, 57). This suggests that
the ability of CLN3 to rescue a cln1 cln2 strain
requires Cln3p- and Swi4p-dependent transcription. The PCL1
and PCL2 gene pair (encoding cyclin homologues that can bind
to and activate the Pho85p Cdk) is also essential for Cln3p-dependent
viability in the absence of cln1 and cln2 (38, 43, 57). PCL1 and PCL2 are
transcribed under the control of Swi4p (43, 57),
suggesting that at least some of the Swi4p requirement in the
cln1 cln2 background may be due to the Pcl1p, Pcl2p
requirement. This requirement may involve promoting functions important
for morphogenesis (37).
Studies of higher eukaryotic cyclins have established the importance of
spatial control for regulation of cyclin and/or Cdk activity. The most
extensively studied are the mitotic cyclin B1 and the
G1 cyclin D1. When unphosphorylated, cyclin B1
localizes to the cytoplasm through physical association with the
exportin CRM1. The physical association between cyclin B1
and CRM1 is abolished when cyclin B1 is phosphorylated, resulting in
localization to the nucleus, possibly through interactions with the
karyopherin
-
complex (46, 58, 82). Cyclin B1 may
also enter the nucleus through physical interactions with cyclin F or
independently through physical interactions with importin
(71). Phosphorylation of cyclin B1 has also been
implicated in triggering nuclear import, independent of inhibition of
binding to CRM1 (25, 83). Physical association of cyclin
B1 with Cdk does not significantly contribute to nuclear import
(46). In vitro studies show that both the cyclin B1-Cdk1
complex, mitogen-activated protein kinase, and casein kinase II are
able to phosphorylate cyclin B1 in the region that associates with CRM1
(28, 42). The D-type cyclins function at early stages in
the cell division cycle, responding to growth factor stimulation and
facilitating the activation of cyclin-Cdk2 complexes required for entry
into the phase of the cell cycle at which DNA replication occurs. The
shift in localization of cyclin D1 from the nucleus to the cytoplasm at
the onset of DNA replication is linked to the proteosomal degradation
of cyclin D1 and requires phosphorylation by glycogen synthase
kinase-3
on Thr-286. This shift in localization reflects
phosphorylation-dependent export of cyclin D1 (18). Two
different human B-type cyclins, B1 and B2, exhibit different
subcellular localization (to microtubules and to the Golgi apparatus)
(29). Interestingly, chimeras constructed that switch the
localization signal of cyclin B1 and cyclin B2 also influence their
ability to function, demonstrating that differences in subcellular
localization influence the functional specificity of these cyclins
(20).
In this paper, we analyze mechanisms that regulate localization of
Cln2p and Cln3p. We address the role of Cdc28p in regulated localization of G1 cyclins in budding yeast and
characterize the distinct mechanisms used to import different
G1 cyclins into the nucleus.
 |
MATERIALS AND METHODS |
The relevant genotypes of the yeast strains used are shown in
Table 1. All strains (except for the
grr1 strain, MMY42 strain, ACY212, MMY103, MMY106, and
controls) are congenic with BF264-15D (59). YPD
(dextrose), YPG (galactose), and synthetic complete (SC) media for
yeast growth were prepared as described previously (63).
Yeast cells were transformed with plasmid DNA as described previously
(24).
Plasmids.
The 9× myc-epitope-tagged CLN3 CEN/ARS
plasmid pMM99, Cln2mycp integrating construct
pMM56, and CEN/ARS plasmid pMM82
(CLN3::CLN2myc) have been
described previously (45). The 9× myc tag is engineered at the COOH terminus of the cyclin proteins in these constructs.
The genomic copy of
CLN2 was tagged by a COOH-terminal,
in-frame integration of a PCR-derived DNA fragment encoding the
immunoglobulin
G (IgG) binding domain of protein A. This DNA fragment
was amplified
from the plasmid pProtA/
HIS5, which carries
the
Schizosaccharomyces pombe HIS5 gene as its selectable
marker (
75), as described
previously (
1).
This results in the expression of protein A
(PA)-tagged
CLN2 from the
CLN2 promoter. Correct integration
of
the tag was confirmed by PCR analysis of genomic structure and
immunoblotting. Initial integration was carried out in the diploid
strain W303d, resulting in strain MMY17. This strain was sporulated,
and haploid cells expressing PA-tagged
CLN2 were obtained by
tetrad
dissection. The diploid strain MMY42, expressing both the PA-
and 9× myc epitope-tagged versions of
CLN2, was made by
mating
haploid MMY17 to haploid W303 strain expressing
CLN2myc (constructed with integration
vector pMM56 as described previously
[
45]).
The Cln3-

22
mycp expression plasmid (pMM98) was
constructed by PCR amplification of
CLN3 coding sequences
lacking the last 66
bp. The 3' primer for the
cln3-
22 amplifications was
5'-CTAGCGGCCGCTCAGTTGGGTGGG
GGCAGAGCATGGGTG-3', and the 5'
primer was 5'-CTTACATTCCATTGCATCTCCC-3'.
The plasmid pMM99
(
45) was used as the template for PCRs. PCR
products were
subsequently cloned into TOPOII vector with topoisomerase-based
ligations (Invitrogen).
EcoRI-
NotI cassettes from
the TOPOII clones
were used to replace the
EcoRI-
NotI
CLN3 sequences of pMM45 to
give rise to pMM96. The 9× myc epitope tag
NotI cassette
from
pAG4 (A. Gartner) was cloned into the
NotI site
following the
CLN3 sequences in pMM96 to give rise to pMM98.
The pMM98 plasmid
was sequenced to confirm the absence of the last 66 bp of
CLN3 coding sequence followed in frame by the 9× myc
epitope tag. The
nuclear localization signal (NLS), mutant
nonfunctional NLS (mnls),
nuclear export signal (NES), and mutant
nonfunctional NES (mnes)
Cln3-

22p-expressing plasmids were made by
replacing the
ClaI-
EcoRI
fragment of pMM98 with
the
ClaI-
EcoRI fragments of pMM83
(NLS-
CLN3-
1),
pMM84
(mnls-
CLN3-
1), pMM85
(NES-
CLN3-
1), and pMM86
(mnes-
CLN3-
1)
to give rise to pMM104, pMM105,
pMM106, and pMM107, respectively
(
45). The
cln3
mutant
cln3-A13 contains two amino acid substitutions
of
K106A and R108A. These mutations abolish detectable interactions
with
Cdc28p assayed by coimmunoprecipitation assay (unpublished
data).
The
CLN2-
4T3S mutant integration vector pMM68 was
made by replacing the 3× hemagglutinin (HA) tag of pMT480 (M. Tyers)
with
the
NotI 9× myc epitope tag. The resulting clone was
sequenced
to ensure identity and that the Cln coding sequences were
followed
in frame by the myc epitope tags. The
CLN3myc integration vector pMM162 was made
by inserting the
SalI-
SacII
cassette (containing
the
CLN3 promoter-driven 9× myc-tagged
CLN3)
of
pMM99 into the integration vector pRS404. Strain MMY32 was
produced by
integration of this vector into strain 1255-5C.
The
CLN3 promoter-driven 9× myc-tagged Cln2-4t3sp
expression plasmid (pMM108) was constructed by replacing the
SpeI-
NotI carboxy-terminal
CLN2
fragment of pMM82 (
45) with the
SpeI-
NotI carboxy-terminal
CLN2
fragment of pMM68 and subsequent addition of the
NotI
fragment
containing the 9× myc tag. The
CLN2
promoter-driven 9× myc-tagged
Cln2p(pMM159) and Cln2-4t3sp(pMM151)
expression plasmids were
constructed by replacing the
SalI-
ClaI
CLN3 promoter fragments
of
pMM82 and pMM108, respectively, with the
SalI-
ClaI
CLN2 promoter
fragment from
pKL007 (
38). The
CLN3 promoter-driven 9×
myc-tagged
Cln2-KAEAp expression plasmid (pMM66) was constructed by
replacing
the
NotI cassette containing the 3× HA tag of
pKL005 (
38) with
the
NotI cassette containing
9× myc of pMM99. The
CLN2 promoter-driven
9× myc-tagged
Cln2-KAEAp (pMM167) and Cln2-KAEA-4t3sp (pMM166)
expression plasmids
were constructed by replacing the
ClaI-
BclI
N-terminal
CLN2 fragments of pMM159 and pMM151,
respectively,
with the
ClaI-
BclI N-terminal
CLN2 fragment of pMM66. Plasmids
were sequenced to ensure
the presence of KAEA
mutations.
Plasmids expressing green fluorescent protein (GFP)-CLN fusions were
constructed by using pKW431 (
69). These plasmids encode
fusion proteins consisting of the simian virus 40 (SV40) NLS (the
nonfunctional mutant protein kinase inhibitor [PKI] NES) and two
GFP
molecules. The
HindIII-
EcoRI SV40 NLS
fragment of pKW431 was
replaced with the
CLN3 NLS by
homologous recombination in vivo,
resulting in pMM131. The
HindIII-CLN3 NLS-
EcoRI fragment was produced
by PCR amplification with the forward primer
5'ATACAATCT GCACAATATTTCAAGCTATACCAAGCATACAATAAGCTTATGAAAA
AGAGATCTACTTCCTCTGTGGAT3'
and the reverse primer
5'TTGTTGA TATCAAGACCTGCTAATTTCAAGGCTAATTCATTGAATTCGCGAGTT
TTCTTGAGGTTGCTACT3'.
Nonfunctional Cln3 mnls-GFP fusion proteins
were made by identical
means, except the primers contain base
changes that result in alanine
substitution of the basic clusters
at the beginning and end of the
Cln3p NLS. Mutation of both clusters
resulted in plasmid pMM133.
Mutation of the first basic cluster
resulted in pMM135, and mutation of
the second basic cluster resulted
in pMM137. The nonfunctional PKI NES
in these constructs was presumably
inert. Substitution of the
functional PKI NES in the Cln3 NLS
construct resulted in loss of
nuclear accumulation of Cln3 NLS-PKI
NES-GFP fusion (data not
shown).
Indirect immunolocalization and GFP localization.
Exponentially growing cultures expressing the myc-tagged Cln proteins
were fixed in growth medium with formaldehyde (1:10 dilution) for 60 min at 30°C with rotation. When indicated, cells were fixed by
"fast fixation." In this case, cells were harvested by filtration
and fixed in buffer (0.1 M
KH2PO4, 0.5 M
MgCl2, 40 mM KOH) with formaldehyde (1:10
dilution) for 5 min. The extended fixation time (up to 2 h) did
not change localization patterns with the fast fixation method, and
fast fixation gave essentially identical results to standard fixation.
Cells were prepared for indirect immunofluorescence as described
previously (
45). For detection of the myc epitope, primary
monoclonal antibody 9E10 (Santa Cruz Biotechnology) was diluted
1:200
in blocking solution, cleared for 2 min by centrifugation
in a
microcentrifuge, and incubated on the cells for 2 h. Secondary
antibody (Cy3-conjugated antimouse IgG; Jackson Immunochemicals)
was
diluted 1:200 in blocking solution, cleared, and incubated
on the wells
for 2 h. The negative control for integrated myc-tagged
Cln
proteins was the wild-type strain 1255-5C. The negative controls
for
plasmid-based expression of myc-tagged Cln proteins were the
vector
controls pRS414 and pRS416 (
66).
Cells expressing the GFP fusion proteins were grown to log phase,
sonicated, placed on polylysine-coated slides, and visualized
microscopically. To confirm the localization of Cln3 NLS-GFP signal
in
the nucleus, cells were sonicated briefly, washed in 1×
phosphate-buffered
saline (PBS), fixed for 12 min in 70% ethanol at
room temperature,
washed in 1× PBS, stained for 12 min with 1:1,000
dilution of
1-mg/ml 4',6'-diamidino-2-phenylindole (DAPI) at room
temperature,
washed in 1× PBS, and assayed for fluorescence. This
procedure
allows simultaneous detection of DAPI and GFP
signal.
Standard indirect immunofluorescence and GFP experiments were done on
an Axoplan universal microscope (Carl Zeiss, Inc.) with
a Hamamatsu
digital camera. Images were collected with Openlab
software version 1.2 (Improvision) and processed with Photoshop
version 4.0 (Adobe systems).
When noted, cells were analyzed with
the DeltaVision restoration
microscopy system (Applied Precision,
Inc.) with a Roper CH350
full-frame KAF1401E 12-bit high-resolution
charge-coupled device (CCD)
camera. The DeltaVision system was
mounted on an Olympus 1X-70
microscope, and the UplanApo100X oil
1.35NA objective was used. When
using the DeltaVision system,
images were collected, processed, and
deconvolved by using softWoRx
V2.5 software (Applied Precision, Inc.).
All images presented
in a single figure were captured and processed in
parallel by
identical means when
noted.
Functional assays.
Cell viability and volume assays were
carried out as described previously (45). Mutant strains
(Table 1) were transformed with the following plasmids: pMM82, pMM99,
pMM98, pMM104, pMM105, pMM106, pMM107, pMM60, pMM61, pMM92, pMM93 and
pRS416. All plasmids are episomal centromeric low-copy plasmids and
carry the TRP1 gene. The data presented are representative
of data from at least two independent experiments.
Protein extraction, immunoprecipitations, cellular fractionation,
and immunoblotting.
Total cellular protein lysates were obtained,
immunoprecipitated, and immunoblotted as previously described
(38, 45). Cellular fractionation was carried out exactly
as previously described (45). The monoclonal antibody
HA.11 was used for immunoprecipitation of HA-tagged Cdc28p. Polyclonal
HA.11 antibody was used for Western blot detection of
Cdc28hap present in immunoprecipitates. The
polyclonal antibody
-myc A-14 (Santa Cruz Biotechnology) was used to
detect the myc epitope in Western blot analysis. Detection was by
enhanced chemiluminescence (ECL) with the Super Signal ECL kit (Pierce).
Elutriation.
The diploid strain MMY42 contains
CLN2myc at one CLN2 locus and
CLN2PA at the other CLN2 locus;
both expressed from the CLN2 promoter. MMY42 was grown to
log phase (optical density at 660 nm [OD660] ~0.9) in YEPD at 30°C (1-liter culture), harvested by filtration, resuspended in icewater, sonicated, and separated on the basis of cell
size by centrifugal elutriation with a Beckman J6-M elutriating rotor
with a 40-ml chamber. Elutriation was carried out with 0°C water, and
the rotor chamber was maintained at 4°C throughout the elutriation.
The rotor was maintained at the speed of 2,400 rpm, and the first
fraction was taken at the flow rate of 70 ml/min. Four-hundred-milliliter fractions were collected with 10% increments in flow rates between fractions. The first fraction was saved when the
OD660 of the sample rose above 0.02. After
collection of fractions, equivalent amounts (as determined by OD) of
each fraction were concentrated by filtration, resuspended in ice-cold YPD medium, and immediately subjected to indirect immunofluorescence analysis and protein extraction. Unfixed samples were subjected to
Coulter counter analysis to determine the size of the fractions and
used to measure the OD660. Subsequent
immunoblotting analysis was carried out as described above.
Metabolic poisoning.
Metabolic poisoning was carried out as
described in reference 65. Exponential cultures (50 ml)
were harvested by filtration, washed with an equal volume of water, and
resuspended in 6 ml of metabolic poison (10 mM NaN3, 10 mM deoxyglucose
in YEP medium lacking glucose). Cells were incubated at 30°C with
rotation for 45 min. Cells were removed, collected by filtration, fast
formaldehyde fixed (see above), and processed for indirect
immunofluorescence (see above). The poison was washed out of the
culture by filtration followed by washing with an equal volume of
water. Cells were allowed to recover by resuspending the cells in YPD
medium and incubation at 30°C with rotation. Samples were collected
and fast formaldehyde fixed for indirect immunofluorescence after
various times of recovery.
 |
RESULTS |
Localization of Cln2p is regulated by Cdc28p-dependent
phosphorylation.
We showed previously that Cln2p was localized
primarily to the cytoplasm (45) (Fig.
1). Since Cdc28p binds to Cln2p,
phosphorylates Cln2p, and also localizes to the cytoplasm
(78; our unpublished data), we investigated the
possibility that Cdc28p activity might be important for Cln2p
cytoplasmic localization. We assayed the localization pattern of a
Cln2mycp mutant in which all seven potential
Cdc28p phosphorylation sites have been mutated to alanine
(Cln2-4t3smycp) (36, 62). Cln2-4t3sp
binds Cdc28p, but the mutant Cln2p is not phosphorylated
(36). myc-tagged CLN2-4T3S was
integrated at the CLN2 locus in a wild-type strain.
Wild-type Cln2p localizes primarily to the cytoplasm with clearly
detectable "holes" of nuclear depletion, while the
Cln2-4t3smycp mutant is no longer depleted in the
nucleus and shows some nuclear accumulation (Fig. 1). We note that this
nuclear accumulation is not complete, and a population of
Cln2-4t3smycp remains in the cytoplasm (Fig. 1).
It is unclear if the punctate nature of the Clnp staining in this assay
results from fixation or reflects a relevant localization pattern in
vivo. Consistent with these data, Cln2p also accumulates in the nucleus
when CDC28 has been inactivated by using the
temperature-sensitive allele cdc28-4 (Fig.
2); Cln2p phosphorylation
is strongly reduced under these conditions (data not
shown).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 1.
Indirect immunolocalization of Cln2mycp,
Cln2-4t3smycp, and Cln3mycp. Strains expressing
wild-type Cln2mycp (MMY1) (A), mutant
Cln2-4t3smycp (MMY4) (B), or wild-type Cln3mycp
(MMY32) (C) were assayed for indirect immunolocalization as described
in Materials and Methods. Images were collected, processed, and
deconvolved by using the DeltaVision restoration system (Applied
Scientific) as described in Materials and Methods. Shown are three
sections taken at 0.2-µm intervals labeled 1, 2, and 3. The DAPI
signal indicates the position of the nucleus (blue), the -myc signal
indicates the position of the myc-epitope-tagged cyclin (red), and the
merge combines these two images. The negative control (no myc-tagged
cyclin) strain 1255-5C gave no detectable signal (data not shown).
|
|

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 2.
Indirect immunolocalization of Cln2mycp.
cdc28-4 and cdc34 mutant
cells expressing integrated myc-epitope-tagged Cln2p from the
CLN2 promoter were assayed by indirect
immunofluorescence as described in Materials and Methods. Cells were
grown to log phase at 23°C. Cultures were split, and half was
incubated at 23°C and half was incubated at 37°C for 2 h. (A) Quantitation
of Cln2 localization. The percentage of cells showing nuclear depletion
(gray bars), signal throughout the cell (white bars), or nuclear
accumulation (black bars) is shown. A cell was scored positive for
nuclear depletion when the position of the nucleus (DAPI signal) could
be estimated correctly due to a reduction in Cln2mycp
signal. A cell was scored positive for nuclear accumulation when the
position of the nucleus (DAPI signal) could be estimated correctly due
to an increase in Cln2mycp signal. When the position of the
nuclei could not be determined based on Cln2mycp
localization, the cells were scored as having a signal throughout the
cell. Note that this procedure is unbiased in that the position of Cln2
depletion is determined from immunostaining before the position of the
nucleus is determined from DAPI staining. Cln2 depletion from the
vacuole will not be scored as nuclear depletion by this procedure. Data
for Cln2 localization in the presence of mutant
cdc28-4 and mutant cdc34
incubated at 23 and 37°C are shown. No fewer than 200 cells were
counted with the DeltaVision microscopy restoration system. (B and C)
Indirect immunolocalization of Cln2mycp expressed in mutant
cdc28-4 (B) and mutant
cdc34 (C) strains. The first row shows the indirect
immunofluorescence with monoclonal anti-myc antibody 9E10 ( -myc),
and the second row shows DAPI staining of DNA. Images were collected by
standard microscopy.
|
|
Hypophosphorylated Cln2-4t3sp is stabilized because
Cdc28p-dependent phosphorylation is required for Skp1-Cdc34-F-box
(SCF)-dependent
ubiquitination and subsequent degradation
(
36). We find that
increased protein stability is not
sufficient for the nuclear
accumulation of Cln2p.
CDC34
encodes the ubiquitin-conjugating
component of SCF (
6,
16,
77), and
GRR1 is an SCF component
that binds
specifically to phosphorylated Cln2p, and this binding
is required for
SCF-dependent ubiquitination of Cln2p (
6,
33,
41,
67,
68).
Inactivation of
CDC34 or
GRR1, resulting in
stabilization of Cln2p, does not alter Cln2p localization, since
nuclear depletion is still observed, and no nuclear accumulation
occurs
(Fig.
2) (data not shown). Nuclear exclusion of Cln2p in
the
absence of
CDC34 function is still dependent on
CDC28-dependent
phosphorylation, because Cln2p accumulates
in the nucleus in a
cdc28-
4 cdc34 double mutant
just as it does in a
cdc28-
4 single
mutant (Fig.
2) (data not
shown).
To confirm that hypophosphorylated Cln2p accumulates in the nucleus,
nuclear and cytoplasmic components of the cell were separated
and
analyzed for Cln2
mycp localization in cellular
fractionation experiments. Wild-type
Cln2
mycp
localizes primarily to the cytoplasm (Fig.
1) (
45) and
largely
cofractionates with cytoplasmic marker Pgk1p (Fig.
3) (
45).
The
Cln2-4t3s
mycp mutant shows an increase in nuclear
localization (Fig.
1), and
a subfraction cofractionates with nuclear
marker Nop1p (Fig.
3).
Consistent with the indirect immunofluorescence
experiments, a
significant amount of
Cln2-4t3s
mycp cofractionates with the cytoplasmic
Pgk1p (Fig.
3). Our ability
to easily visualize the smaller amount of
Cln2-4t3s
mycp accumulated in the nucleus is most
likely due to the smaller
size of the nuclear compartment compared to
the cytoplasm, effectively
concentrating the nuclear signal. (Note that
the protein gels
for the fractionation experiment in Fig.
3 are loaded
in cell-equivalent
amounts, not equal amounts of protein from the
different fractions,
to give a better representation of the overall
distribution.)
In both indirect immunofluorescence and cellular
fractionation
experiments, the
Cln2-4t3s
mycp mutant shows an increase in
nuclear localization compared with
wild-type
Cln2
mycp. (Although these fractionation
experiments were somewhat hampered
by variable nuclear breakage,
as indicated by recovery of the
nuclear marker Nop1p in inappropriate
fractions, concentration
of Cln2-4t3s
mycp
compared to that of wild-type Cln2
mycp in the
authentic nuclear fraction was reproducibly observed
in multiple
fractionations [data not shown].)

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 3.
Localization of Cln2mycp and
Cln2-4t3smycp by subcellular fractionation. Fractions were
prepared as described in Materials and Methods. Duplicate samples of
each fraction were separated by sodium dodecyl sulfate-polyacrylamide
gel electrophoresis (12% polyacrylamide) and analyzed by Western
blotting. Fractions are indicated at the top of each set of blots.
Fraction 1 corresponds to the crude cytoplasmic fraction, fraction 2 corresponds to the surface of the sucrose gradient, fraction 3 corresponds to the surface-to-2.01 M sucrose interface, fraction 4 corresponds to the 2.01-to-2.1 M-sucrose interface, fraction 5 corresponds to the 2.1-to-2.3 M sucrose interface, and fraction 6 corresponds to the remaining pellet of the sucrose gradient. (A)
Immunoblot analysis of fractions from a strain expressing
Cln2mycp from the CLN2 promoter (MMY1). The
position of Cln2mycp is indicated by "Cln2."
Corresponding immunoblot analysis of the Nop1p and Pgk1p fractionation
is shown below the Cln2p blot. The nucleolar protein Nop1p detected
with the monoclonal antibody D77 (4) indicates which
fractions contain nuclear proteins. The cytoplasmic protein Pgk1p
detected with the anti-Pgk1p polyclonal antibody (Molecular
Probes) indicates which fractions contain cytoplasmic proteins.
(B) Immunoblot analysis of fractions from a strain expressing
Cln2-4t3smycp from the CLN2 promoter
(MMY4). The Cln2-4t3smycp, Nop1p, and Pgk1p
immunoblots are shown. A moderate level of nuclear breakage apparently
occurred in both fractionation experiments, as indicated by the leakage
of Nop1p into the intermediate and cytosolic fractions.
|
|
These data show a role of Cln2p phosphorylation by Cdc28p in regulated
Cln2p
localization.
Regulated subcellular localization of Cln2p requires binding to
Cdc28p.
To ask if Cdc28p binding is necessary for Cln2p
cytoplasmic localization, we made use of a Cln2p mutant
(Cln2-KAEAp) with crippling mutations (K129A E183A) in the cyclin
box region that mediates interaction with Cdc28p (27, 32,
38). The localization pattern of
Cln2-KAEAmycp differs from that of wild-type
Cln2mycp. Nuclear depletion is observed in
approximately 60% of the cells expressing
Cln2mycp, while it is observed in approximately
10% of the cells expressing Cln2-KAEAmycp (Fig.
4). Cln2p localization was also assayed
in a strain expressing a mutant Cdc28p,
Cdc28csr1-1p (cdc28-Q188P).
Cdc28csr1-1p shows 100-fold reduced binding to
wild-type Cln2p upon immunoprecipitation (39). Similar to
the KA, EA cln2 mutation, the
cdc28csr1-1 mutation causes
a drop in the percentage of cells with nuclear depletion of
Cln2mycp (Fig. 4). Residual binding between
mutant Cdc28csr1-1p and wild-type
Cln2p may occur, accounting for the remaining cells (approximately
30%) showing nuclear depletion. This residual binding may be lost in
the case of the Cln2-KAEAmycp mutant
(39). Using this mutant, we observed only a low level of
nuclear depletion in the presence of either wild-type or mutant Cdc28csr1-1p. These data suggest that the
physical association between Cln2p and Cdc28p is required for efficient
nuclear exclusion of Cln2mycp.


View larger version (96K):
[in this window]
[in a new window]
|
FIG. 4.
Requirement for binding to Cdc28p for regulated
Cln2mycp localization. (A) Strain 1255-5C containing
plasmids that express Cln2mycp (pMM159), mutant
Cln2-4t3smycp (pMM151), mutant Cln2-KAEAmycp
(pMM167), or mutant Cln2-KAEA-4t3smycp (pMM166) was assayed
for indirect immunolocalization as described in Materials and Methods.
Images were collected, processed, and deconvolved with the DeltaVision
restoration system (Applied Scientific) as described in Materials and
Methods. All plasmids are episomal CEN (low copy number) and express
the myc-tagged Cln2 protein from the CLN3 promoter.
Shown are three sections taken at 0.2-µm intervals labeled 1, 2, and
3 for each set. The DAPI signal indicates the position of the nucleus
(blue), the -myc signal indicates the position of the myc
epitope-tagged cyclin (red), and the merge combines these two images.
The negative control (no myc-tagged cyclin) strain 1255-5C containing
plasmid pRS416 gave no detectable signal (data not shown). (B)
Quantitation of Cln2 localization. Percentages of cells showing nuclear
depletion (gray bars), signal throughout the cell (white bars), or
nuclear accumulation (black bars) were determined as described in the
legend to Fig. 2. Data for Cln2 localization in the presence of
wild-type Cdc28p (CDC28) and Cdc28csr1-1p
(CDC28csr1-1) are shown. No
fewer than 200 cells were counted for each experiment. The data shown
are the average of three independent transformants with standard
deviation indicated by the error bar. Images in this figure were
captured and processed in parallel.
|
|
The hypophosphorylated Cln2-4t3s
mycp mutant shows
nuclear accumulation in approximately 80% of the cells assayed. These
data
indicate that the physical interaction between Cln2p and Cdc28p
is
not sufficient for Cln2p cytoplasmic localization, since Cln2-4t3sp
binds Cdc28p (
36) and accumulates in the nucleus (Fig.
1,
3,
and
4). Interestingly, the hypophosphorylated Cln2-4t3sp also
requires binding to Cdc28p for regulated localization, since when
the
Cdc28p binding of the hypophosphorylated
Cln2-4t3s
mycp is crippled (because of the
cln2-KAEA mutation, the
cdc28csr1-1 mutation, or both),
we no longer observe nuclear accumulation
of
Cln2-4t3s
mycp (Fig.
4). This may explain the lack
of strong nuclear accumulation
of KAEA
mycp (Fig.
4), which is hypophosphorylated like
Cln2-4t3s
mycp, but unlike
Cln2-4t3s
mycp binds to Cdc28p inefficiently
(
38; data not
shown).
These results on nuclear exclusion of Cln2p can be accounted for by
proposing that, first, only the localization of Cln2p-Cdc28p
complex is
regulated, but the Cln2p unbound to Cdc28p is distributed
throughout
the cell; and, second, that C-terminal phosphorylation
of Cln2p in the
Cln2p-Cdc28p complex is required for its efficient
nuclear exclusion.
The results with
cdc28-
4 (Fig.
2) are somewhat
complicated to interpret in this framework because we don't know
how
much Cdc28-4p-Cln2p binding occurs in
vivo.
We have been unable to identify an NLS or NES by inspection of the
Cln2p sequence. Fusion of the wild-type or phosphorylation
mutant Cln2p
C terminus (residues 291 through 545, containing
the seven Cdk
phosphorylation sites) to GFP does not result in
import of GFP to the
nucleus (data not shown) and therefore gives
no indication of an import
activity encoded within this region
of Cln2p. Also, no cytoplasmic
export of GFP was observed upon
fusing the Cln2p C terminus to an SV40
NLS-GFP fusion (data not
shown). Thus, we have no evidence that this
region of Cln2p provides
signals for import or export. However, these
regions of Cln2p
do not include the Cdc28p binding domain, and these
results might
reflect a requirement for physical association with Cln2p
for
regulated localization, as suggested
above.
Energy-dependent nuclear localization of Cln2p.
We assayed
cells expressing wild-type or mutant Cln2mycp for
energy-dependent localization by incubating the cells in metabolic poison and assaying Cln2p localization by indirect immunofluorescence. Exponential cultures were treated with metabolic poison as described previously (65). We find that after poison treatment, no
difference in the localization pattern of wild-type
Cln2mycp is observed (Fig.
5). In contrast, the
Cln2-4t3smycp showed a dramatic change in
localization, failing to accumulate in the nucleus in the presence of
the poison (Fig. 5). Additionally, nearly 50% of the cells show some
nuclear depletion of Cln2-4t3smycp (Fig. 5). We
find that the maximal shift in localization occurred at 45 min of
incubation with poison and did not change with longer incubations (up
to 2 h). We were able to reconstitute nuclear accumulation by
washing out the poison and incubating the cells in rich medium at
30°C. The nuclear accumulation of Cln2-4t3smycp
after the poison was washed out was rapid and maximized between 15 and
20 min (Fig. 5). Steady-state protein levels of
Cln2mycp did not change significantly when
incubated with poison (data not shown), though the population of
hypophosphorylated Cln2mycp increased. Upon
recovery, there was some reduction in Cln2mycp
levels combined with some recovery of Cln2mycp
phosphorylation. Cln2-4t3smycp abundance did not
change significantly when incubated with poison or during recovery
(data not shown). Overall, poison effects on Cln2p abundance seem
unlikely to account for the localization results.


View larger version (61K):
[in this window]
[in a new window]
|
FIG. 5.
Energy-dependent localization of Cln2mycp.
Strains expressing wild-type untagged Cln2 (1255-5C), wild-type
Cln2mycp (MMY1), Cln2-4t3smycp (MMY4), or
Cln2-KAEAmycp (pMM167 in strain 1255-5C) were treated with
metabolic poison and assayed for localization as described in Materials
and Methods. (A) Indirect immunofluorescence of strains growing
exponentially (log) after 45 min of treatment with metabolic poison
(poison) and 20 min after removal of poison and incubation in rich
medium at 30°C (recovery). Cells express untagged Cln2 (no tag),
wild-type Cln2mycp (Cln2), or hypophosphorylated Cln2
mutant (Cln2-4t3smyc). Negative controls (no tag) incubated
with poison and after recovery gave background signal identical to data
shown for exponentially growing cells. (B) Quantitation of
Cln2mycp localization during treatment with metabolic
poison. Percentages of cells showing nuclear depletion (gray bars),
signal throughout the cell (white bars), or nuclear accumulation (black
bars) are shown as follows: exponentially growing cells expressing
wild-type Cln2mycp without poison treatment (Cln2 poison), cells expressing Cln2mycp after 45 min of
treatment with poison (Cln2 + poison), cells expressing
Cln2mycp after poison had been washed out and allowed to
grow in rich medium for 20 min (Cln2 recovery 20), exponentially
growing cells expressing mutant Cln2-4t3smycp without the
addition of poison (Cln2-4t3s poison), cells expressing
Cln2-4t3smycp after 45 min of treatment with poison
(Cln2-4t3s + poison), cells expressing Cln2-4t3smycp after
poison had been washed out and allowed to grow in rich medium for 5, 10, and 20 min (Cln2-4t3s recovery 5, recovery 10, and recovery 20, respectively), cells expressing Cln2-KAEAmycp without
addition of poison (Cln2-KAEA poison), cells expressing
Cln2-KAEAmycp after 45 min of treatment with poison
(Cln2-KAEA + poison), and cells expressing Cln2-KAEAmycp
after poison had been washed out and allowed to grow in rich medium for
20 min (Cln2-KAEA recovery 20). Quantitation was performed as described
in the legend to Fig. 2. Essentially identical results were obtained
with plasmid-based and genomic expression of Cln2p and Cln2-4t3sp. No
fewer than 200 cells were counted for each experiment. The data shown
are the average of two independent experiments with standard deviation
indicated by the error bar. Images in this figure were captured and
processed in parallel.
|
|
These data suggest that the nuclear accumulation of hypophosphorylated
Cln2p occurs by energy-dependent active import. Nuclear
depletion after
incubation with poison introduces the possibility
that nuclear export
of Cln2-4t3s
mycp occurs in an energy independent
manner, although we cannot exclude
some contribution of nuclear
degradation of Cln2p under these
conditions. It is possible that once
the Cln2-4t3s
mycp mutant moves into the
cytoplasm, it is retained in the cytoplasm
by an energy-independent
mechanism, for example, by interaction
with cytoplasmic proteins.
Consistent with this, wild-type Cln2p
continues to show nuclear
depletion after up to 2 h of incubation
in poison (data not
shown).
Crippling the physical interaction between Cln2p and Cdc28p
by introducing the
cln2-KAEA or
cdc28csr1-1 mutation results in
apparent deregulation of Cln2p localization,
with the majority of cells
(approximately 80%) showing Cln2p signal
throughout the cell (Fig.
4).
To determine if the subpopulation
of unbound Cln2p present in the
nucleus entered by energy-dependent
import, we assayed localization
of the Cln2-KAEA
mycp mutant after
treatment with metabolic poison (Fig.
5). After
poison treatment,
Cln2-KAEA
mycp showed nuclear depletion in
approximately 50% of the cells assayed.
Washing out the poison rapidly
reconstituted localization of Cln2-KAEAp
throughout the cell.
Essentially identical results were obtained
with
Cln2-KAEA-4t3s
mycp and with the
cdc28csr1-1 mutant (data not shown). These data
suggest a constant energy-dependent
nuclear import of Cln2p that occurs
independent of Cln2p phosphorylation
or Cln2p-Cdc28p complex formation.
Nevertheless, interaction with
Cdc28p appears to be required for
efficient and phosphorylation-regulated
Cln2p
localization.
The metabolic energy requirement for nuclear accumulation of
Cln2-4t3s
mycp could result from a requirement for
GTP hydrolysis by the RAN
GTPase (
44,
47,
61). To test
this possibility, we assayed
wild-type Cln2
mycp
and mutant Cln2-4t3s
mycp localization in a
temperature-sensitive
ran mutant strain expressing
the
gsp1-
1 and
gsp1-
2 alleles
(
79). No change in wild-type
Cln2
mycp localization was observed at permissive
and nonpermissive temperatures
(data not shown) (Fig.
6). In this strain, the
Cln2-4t3s
mycp shows a localization pattern
primarily throughout the cell,
differing significantly from that
observed with wild-type Cln2
mycp. No
RAN-dependent change in the localization pattern of Cln2-4t3sp
was
observed at permissive and nonpermissive temperatures (Fig.
6).
Additionally, inactivation of the transport factors Crm1p,
Msn5p,
Los1p, Sxm1p, Mtr10p, Nmd5p, Kap104p, and Kap114p individually
does not
significantly alter wild-type or Cln2-4t3sp localization
(data not
shown). Localization of Cln2p might also be regulated
by physical
interactions with non-transport proteins, such as
members of the 14-3-3 family (reviewed in reference
22). However,
none of the
potential phosphorylation sites mutated in this study
clearly falls
within described 14-3-3 binding motifs (
52,
80).

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 6.
Immunolocalization of Cln2mycp and
Cln2-4t3smycp in the absence of Ran activity.
GSP1 deletion strains carrying a plasmid that expresses
either the wild-type GSP1, mutant
gsp1-1, or mutant
gsp1-2 alleles and integrated myc
epitope-tagged Cln2p from the CLN2 promoter were assayed
by indirect immunofluorescence as described in Materials and Methods.
Cells were grown to log phase at 23°C. Cultures were split, and half
was incubated at 23°C and half was incubated at 37°C for 2 h.
(A) Indirect immunolocalization of Cln2mycp and
Cln2-4t3smycp expressed in wild-type GSP1
strain (top row), gsp1-1 strain (second
row) and gsp1-2 strain (third row)
incubated at 37°C. The first column shows the indirect
immunofluorescence with monoclonal anti-myc antibody 9E10 (red), the
second column shows DAPI staining of DNA (blue), and the third column
shows the merge of these two images. Images were collected with the
DeltaVision microscopy restoration system. (B) Quantitation of
Cln2 localization. The percentage of cells showing nuclear
depletion (gray bars), signal throughout the cell (white bars), or
nuclear accumulation (black bars) is shown. Quantitation was
performed as described in the legend to Fig. 2. Data for
Cln2mycp and Cln2-4t3smycp localization in the
presence of wild- type and mutant GSP1
incubated at 37°C are shown. No fewer than 200 cells were counted
with the DeltaVision microscopy restoration system.
|
|
These data suggest that the nuclear accumulation of hypophosphorylated
Cln2p-Cdc28p occurs by a Ran-independent, yet energy-dependent
form of
active transport (Fig.
5 and
6). Export of Cln2p-Cdc28p
from the
nucleus may occur in an energy-independent manner (Fig.
5).
Cln2p nuclear depletion may be inefficient early in the cell
cycle.
We analyzed Cln2p phosphorylation and subcellular
localization in a population of rapidly growing cells separated by
centrifugal elutriation into fractions of different cell size. The
smallest (newborn) cells obtained from the elutriation contain
Cln2p that is significantly underphosphorylated compared
to larger unbudded cells (Fig.
7A). This is true for 9×
myc-epitope-tagged Cln2p, as well as for protein A-tagged Cln2p (in
both cases integrated at the CLN2 locus). Indirect
immunofluorescence shows little or no detectable depletion of
Cln2pmyc from the nucleus of the smallest
unbudded cells (Fig. 7B and C), consistent with the idea that Cln2p
shuttles between the cytoplasm and nucleus. These data also suggest the
possibility that shuttling is differentially regulated, with more
nuclear Cln2p present very early in the cell cycle.

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 7.
Cell-cycle-regulated nuclear depletion of Cln2p. Rapidly
growing cultures of diploid strain MMY42 were chilled and subjected to
centrifugal elutriation to obtain fractions of cells of increasing size
as described in Materials and Methods. (A) Fractions were subjected to
protein extraction and immunoblot analysis to detect 9× myc
epitope-tagged or PA epitope-tagged Cln2p, each expressed from a
different allele from the CLN2 promoter. Nop1p levels
were monitored as a loading control. (B) Fractions were assayed by
indirect immunofluorescence to detect Cln2mycp
localization. The bar graph shows cells that were scored for the
presence of nuclear depletion as described in the legend to Fig. 2. No
nuclear accumulation was observed in these fractions. The percentage of
budded cells is the percentage of cells with buds in the population of
cells in each fraction. The percentage of the total is the percentage
of cell mass present in a fraction of the total amount of cell mass as
determined by OD of samples. (C) Representative immunofluorescence
results of two MMY42 elutriations (sets 1 and 2). Cells were assayed by
indirect immunofluorescence as described in Materials and Methods. The
first row shows differential interference contrast (DIC) images
(cells), the second row shows the indirect immunofluorescence with
monoclonal anti-myc antibody 9E10 ( -myc), and the third row shows
DAPI staining of DNA. The untagged control from this experiment
consisted of exponentially growing cells of strain W303d. The amounts
of cells of fractions 1, 2, 3, and 4 were 66, 73, 78, and 89 fl,
respectively, as determined by identification of peak channels by
Coulter Counter analysis of cells.
|
|
We showed previously that addition of an NES to Cln2p significantly
weakened its biological activity (
45), implying that
Cln2p
might spend some time in the nucleus and that this nuclear
residence
might be important for its function. Our present results
suggest that
physical association with Cdc28p and phosphorylation
may regulate
nuclear accumulation of Cln2p; this binding or phosphorylation
may be
cell cycle regulated, leading to the potential for Cln2p
to function in
the nucleus specifically very early in the cell
cycle.
Another hypothesis that could explain loss of nuclear exclusion
of Cln2p in cells early in the cell cycle would be that
Cln2p-Cdc28p
complex formation is inefficient at this time. We do
not yet have
information on this point, because the extremely low
yield of
cells at this point in the cell cycle from the elutriating
rotor
(Fig.
7) makes a definitive analysis of Cln2p-Cdc28p complex
formation
in these cells technically
challenging.
Hypophosphorylated Cln2p could occur early in the cell cycle because of
low kinase activity or because of the activity of
a phosphatase. We
tested the idea that the Cdc14p phosphatase,
which is known to reverse
other Cdk phosphorylations (
31,
73),
might also
dephosphorylate Cln2p. This idea seemed reasonable,
since we detect
hypophosphorylated Cln2p early in the cell cycle,
not long after Cdc14p
has been released from the nucleolus late
in mitosis (
5,
64). We found, though, that strong overexpression
of Cdc14p from
the
GAL1 promoter sufficient to arrest the cell
cycle
(
73) or deletion of the Cdc14p regulator
CFI1
(
74) has
little or no effect on Cln2p phosphorylation or
localization (data
not
shown).
Cln3p localization does not require Cdc28p activity or
binding.
In contrast to Cln2p localization, the localization of
Cln3p does not appear to be influenced by Cdc28p activity. Cln3p
remains nuclear when expressed in the cdc28-4
strain at permissive and nonpermissive temperatures (data not shown).
Additionally, mutations within the cyclin box of Cln3p that eliminate
detectable interaction with Cdc28p (M. Miller, unpublished
observations) do not alter Cln3p nuclear localization (data not shown).
Nuclear localization of both wild-type and cyclin box-defective Cln3p
was also observed in the presence of Cdc28csr1-1p
mutant Cdc28p (data not shown); this Cdc28 mutation reduces immunoprecipitable Cln3p-Cdc28p complexes by about 10-fold
(39). Thus, we were unable to detect any Cdc28p
requirement for Cln3p localization.
Carboxy-terminal Cln3p bipartite NLS.
The
CLN3-1 truncation lacks the C-terminal 177 amino
acids of Cln3 and shows a partial increase of cytoplasmic localization when compared to full-length Cln3p (45). These data
suggest that sequences important for the nuclear localization are
present in the carboxy-terminal tail. The last 22 amino acids of Cln3p contain a potential bipartite NLS (this was proposed as a candidate NLS
previously, although it was not tested functionally
[81]). Deletion of the last 22 amino acids of Cln3p
(Cln3-
22p) resulted in a primarily cytoplasmic localization, unlike
the nuclear localization of Cln3mycp (Fig.
8). Thus, the last 22 amino acids are
required for nuclear localization of Cln3p.

View larger version (87K):
[in this window]
[in a new window]
|
FIG. 8.
Indirect immunolocalization of
Cln3- 22mycp. Wild-type (1255-5C) cells were transformed
with plasmids pRS414 (vector), pMM99 (Cln3mycp), and pMM98
(Cln3- 22mycp). All plasmids are episomal CEN (low copy
number) and express the myc-tagged Cln3 protein from the
CLN3 promoter. Transformants were assayed by indirect
immunofluorescence as described in Materials and Methods. The first row
shows DIC images (cells), the second row shows indirect
immunofluorescence with monoclonal anti-myc antibody 9E10 ( -myc),
and the third row shows DAPI staining of DNA. Images in this figure
were captured and processed in parallel.
|
|
To determine if the putative Cln3p NLS is sufficient for nuclear
localization, the last 22 amino acids of Cln3p were fused
to the N
terminus of the GFP expressed from the transport assay
plasmid pKW431
(
69). Since this sequence consists of two basic
clusters
separated by 15 amino acids (diagrammed in Fig.
9A),
we also constructed mutant versions
of the Cln3p NLS fused to
GFP, in which the clusters of basic residues
are mutated to alanine
singly or together (Cln3p KA, AK, or AA NLS).
The GFP proteins
containing the Cln3p NLS show a staining pattern in
living cells
consistent with nuclear localization, while the GFP
fusions containing
the mutant Cln3p mnls sequences were cytoplasmic
(Fig.
9B). To
ensure that the Cln3p NLS shifts the localization of GFP
into
the nucleus, cells were fixed and assayed for both GFP
localization
and DAPI staining. The Cln3p-NLS-GFP fusion colocalized
with the
nuclear DAPI signal, although this procedure weakened the GFP
signal significantly (data not shown).

View larger version (87K):
[in this window]
[in a new window]
|
FIG. 9.
Cln3-NLS-GFP localization. (A) Amino acid sequence of
the bipartite-type Cln3 NLS. The mutant Cln3 nls AA substitutes the
basic residues in the first and second basic clusters to alanine. The
mutant Cln3 nls AK substitutes the first basic cluster with alanines,
and the mutant Cln3 nls KA substitutes the second basic cluster with
alanines. Mutated residues are underlined. (B) Immunofluorescent
localization of the various Cln3 NLS-GFP in living cells. The top row
shows DIC images (cells), and the bottom row shows GFP signal in an
identical field of cells. Images in this figure were captured and
processed in parallel.
|
|
Taken together, these data indicate that the CLN3p NLS is a bipartite
NLS, which is necessary and sufficient for nuclear
localization.
Cln3-
22p protein characterization.
To determine if deletion
of the Cln3 NLS alters steady-state expression levels, Western blot
analyses were carried out on a wild-type strain expressing
Cln3mycp and
Cln3-
22mycp.
Cln3-
22mycp was expressed at levels as high as
wild-type Cln3mycp, and in 3 out of 5 experiments
Cln3-
22mycp was expressed at higher levels
than wild-type Cln3mycp (Fig.
10B, lanes 1 and 2 and data not shown).

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 10.
Comparison of myc-tagged Cln3 proteins. (A) Indirect
immunolocalization of NLS-Cln3- 22mycp. Wild-type
(1255-5C) cells were transformed with plasmids pMM99
(Cln3mycp), pMM98 (Cln3- 22mycp), and pMM104
(NLS-Cln3- 22mycp). All plasmids are episomal CEN (low
copy number) and express the myc-tagged Cln3 protein from the
CLN3 promoter. Transformants were assayed by indirect
immunofluorescence as described in Materials and Methods. The first row
shows DIC images (cells), the second row shows indirect
immunofluorescence with monoclonal anti-myc antibody 9E10 ( -myc),
and the third row shows DAPI staining of DNA. The vector control from
this experiment (data not shown) gave no detectable signal. (B)
Wild-type strain (1255-5c) transformed with plasmids pMM99
(Cln3myc, set 1), pMM98 (Cln3- 22myc, set 2),
pMM104 (NLS-Cln3- 22myc, set 3), pMM105
(mnls-Cln3- 22myc, set 4), pMM106
(NES-Cln3- 22myc, set5), and pMM107
(mnes-Cln3- 22myc, set 6). All plasmids are episomal CEN
(low copy number) and express the myc-tagged Cln protein from the
CLN3 promoter. Cellular lysates of two independent
transformants for each clone were separated by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (10% polyacrylamide) and
analyzed by Western blot analysis as described in Materials and
Methods. (C) Coimmunoprecipitation assays were carried out as described
in Materials and Methods. Strain 1559-3B-7 expressing HA-epitope-tagged
Cdc28p was transformed with plasmids pRS414 (vector), pMM99
(CLN3myc), and pMM98
(cln3- 22myc). The
top panel shows the anti-HA immunoblot of immunoprecipitated
Cdc28hap. The middle panel shows the anti-myc immunoblot of
Cln3myc protein present in the immunoprecipitation. The
bottom panel shows the anti-myc immunoblot of Cln3myc
protein present in the total cellular lysate used for the
immunoprecipitation.
|
|
The NLS could overlap with functional PEST sequences in the Cln3p
C-terminal third (
13,
81); alternatively, altering Cln3p
localization could directly affect Cln3p stability. To test this,
exogenous localization signals (SV40 NLS or PKI NES) were added
to
Cln3-

22
mycp to accentuate or correct the
localization defect. The NLS resulted
in a partial accumulation of
Cln3-

22
mycp in the nucleus (Fig.
10A). In
repeated immunofluorescence experiments,
the PKI NES appeared to result
in a tighter exclusion of Cln3-

22
mycp from the
nucleus (data not shown), although the effect is subtle,
since the bulk
of Cln3-

22
mycp is already cytoplasmic even
without the NES. The mnls and mnes
mutant sequences (containing
single-amino-acid changes that disrupt
the localization activity of
the sequences) did not significantly
alter the localization of
Cln3-

22
mycp (data not shown). No
significant difference was observed between
the steady-state levels of
the NLS-Cln3-

22
mycp (shifted to the nucleus
[Fig.
10]) versus mnls-Cln3-

22
mycp
(cytoplasmic [data not shown]); therefore, mislocalization does
not
appear to cause the increase in steady-state levels of
Cln3-

22
mycp (Fig.
10B). The increase in
steady-state expression of Cln3-

22
mycp may be
due to stabilization, since part of the final Cln3p PEST
region is
missing in this deletion (
81). The effect of this
mutation
on Cln3
mycp accumulation is significantly less
than the effect of complete
deletion of the C-terminal 177 amino acids
of Cln3p (
45), consistent
with the presence of additional
PEST sequences in Cln3p (
81).
Differences in subcellular localization of Cln3p verses Cln3-

22p may
influence Clnp-Cdc28p complex formation. To test this
idea, a strain
expressing HA-tagged Cdc28p was transformed with
plasmids that express
9× myc-tagged Cln3p or Cln3-

22p. Immunoprecipitations
of the
HA-epitope-tagged Cdc28p results in coimmunoprecipitation
of the
myc-epitope-tagged Cln3p. We find that levels of Cln3p
able to
coimmunoprecipitate with Cdc28p correspond to the expression
levels of
these proteins found in total cellular lysates (Fig.
10C). These data
indicate that the deletion of the last 22 amino
acids of Cln3p does not
significantly alter the ability of Cln3p
to associate with
Cdc28p.
Functional consequences of Cln3p mislocalization.
The last 22 amino acids of Cln3p encode an NLS that is important for the nuclear
localization of Cln3p. Functional analysis was carried out to determine
if this NLS was significant for Cln3p function in vivo. Previously, we
demonstrated that shifts in the localization patterns of Cln3p
correlate with changes in the functional profile of Cln3p. This study
was carried out with the Cln3-1p mutant, which lacks the
carboxy-terminal 177 amino acids of Cln3p. In addition to missing the
C-terminal 22 amino acids (NLS characterized above), this mutant lacks
several PEST domains and demonstrates a dramatic stabilization
phenotype (13, 45, 81). In contrast, the Cln3-
22p
mutant is a much smaller deletion, missing only the NLS and parts of a
single PEST domain and causes significantly less stabilization of the
protein than the deletion of the C-terminal 177 amino acids. In
addition to determining if the C-terminal NLS defined in this study is
a functionally significant NLS in vivo, we were also interested in
whether the changes in the functional profile previously observed for
the mislocalized Cln3-1p mutant (45) required hyperstabilization.
A
cln1 cln2 cln3 GAL1::
CLN1 strain is
inviable on glucose medium (which turns off the
GAL1::CLN1 cassette, resulting in
cln1 cln2
cln3 inviability). We introduced plasmids encoding Cln3-

22p
with or without mislocalization signals into this strain and
compared
the ability of these plasmid-bearing strains to form colonies
on glucose-containing medium. The strain expressing NES-Cln3-

22p
was
inviable, while the strains expressing NLS-, mnls-, or
mnes-Cln3-

22p
and Cln3-

22p were viable (Fig.
11A). This result is different
from that obtained with the Cln3-1p mutant and
reveals an essential
nuclear requirement for Cln3p not previously
observed. The ability
of NES-Cln3-1p to support viability in this
strain may result
from its overexpression. These data indicate that
nuclear localization
of Cln3p is required for efficient rescue of the
triple
cln deletion.
The ability of Cln3-

22p to rescue
the
cln1 cln2 cln3 strain may
reflect residual nuclear
accumulation of Cln3-

22p, which may
be eliminated by NES (but not
mnes) addition.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 11.
Functional assays for Cln3- 22p. Mutant
strains, each containing a
GAL1::CLN for viability, were
transformed with CLN plasmids. For each transformant,
10-fold serial dilutions were prepared from independent pools of
transformants (5 to 10 colonies), and 3 µl of each dilution was
plated onto both YPD (dextrose) and YPG (galactose) plates. Plates were
incubated at 30°C, except where 38°C is indicated. The
CLN plasmids used are pMM82
(CLN2myc), pMM99
(CLN3myc), pMM98
(cln3- 22myc), pMM104
(NLS-cln3- 22myc),
pMM105 (mnls-cln3- 22myc),
pMM106 (NES-cln3- 22myc),
pMM107
(mnes-cln3- 22myc),
pMM60 (NLS-CLN2myc), pMM61
(mnls-CLN2myc), pMM92
(NES-CLN2myc), and pMM93
(mnes-CLN2myc). All plasmids are episomal
CEN (low copy number) and express the myc-tagged Cln protein from the
CLN3 promoter. Strains are listed in Table 1. Genotypes
are as follows (lowercase denotes deletion; uppercase denotes wild
type, and GAL1:: CLN gene not indicated):
cln1 cln2 cln3 and cln1 cln2 cln3 bck2
(A); cln1 cln2 cln3 pcl1 pcl2 and cln1 cln2 CLN3
pcl1 pcl2 (B); cln1 cln2 CLN3 swi4 and
cln1 cln2 cln3 swi4 (C). (cl1 clz cl3 swi4
data were reproduced for comparison to the cln1 cln2 CLN3
swi4 strain from reference 45.)
|
|
The genetic requirement for Cln3p is increased in the absence of the
BCK2 gene product, since Bck2p works in parallel with
Cln3p
to trigger transcription of SCF- and MBF-regulated genes
in late
G
1 (see Introduction). Cln3-

22p has a reduced
ability
to rescue the
bck2 cln1 cln2 cln3 strain, at least
at elevated
temperatures, compared to wild-type Cln3p (Fig.
11A). This
defect
was rescued by addition of the NLS to Cln3-

22p, consistent
with
the idea that this defect is specifically due to the largely
cytoplasmic
localization of Cln3-

22p. Addition of the mnls to
Cln3-

22p was
significantly less effective at restoring its activity
(Fig.
9A).
These data indicate that the C-terminal NLS of Cln3p is
functionally
significant, consistent with the idea that nuclear
localization
of Cln3p is important for function (
45).
These data also reveal
an essential role of nuclear Cln3p in the
cln strain that was
not previously detected with Cln3-1p.
Deletion of
pcl1 and
pcl2 results in the
inability of
CLN3, but not
CLN1 or
CLN2, to provide the essential
CLN function for
cell cycle initiation (see Introduction). Thus a
cln1 cln2 cln3 pcl1 pcl2 GAL1::
CLN1 strain is rescued on
glucose medium by
CLN2, but not by
CLN3 on
plasmids. As observed for the
CLN3-
1 mutant
(
45),
CLN3-
22 exhibits a weak
ability to rescue this strain
(Fig.
11B). This rescue was
abolished by addition of the NLS (but
not the mnls) to Cln3-

22p,
suggesting that significant cytoplasmic
localization of Cln3-

22p was
required for rescue. As expected
from the inability of NES-Cln3-

22p
to rescue the
cln1 cln2 cln3 strain (Fig.
11A), it was also
unable to rescue the
cln1 cln2 cln3 pcl1 pcl2 strain (data
not shown). Taken together, these results
could imply that rescue of
the
cln1 cln2 cln3 pcl1 pcl2 strain
by Cln3-

22p required
both cytoplasmic Cln3-

22p and some residual
nuclear Cln3-

22p. If
this were correct, then we would predict
that the combination of
wild-type nuclear Cln3p and the strongly
cytoplasmic
NES-Cln3-

22p might complement each other for rescue
of a
cln1 cln2 cln3 pcl1 pcl2 strain. Indeed, this was observed
(Fig.
11B): provision of wild-type
CLN3 in the chromosome
and
NES-CLN3-
22 on a plasmid resulted in
significant viability in the absence
of
pcl1,
pcl2,
cln1, and
cln2, while neither
one alone was sufficient
(Fig.
11B) (data not shown). Essentially
similar results were obtained
with a
swi4 cln1 cln2 CLN3
GAL1::
CLN1 deletion strain (data not
shown).
Therefore, as with
pcl1 pcl2, deletion of
swi4 appears
to uncover a strong requirement for both
cytoplasmic and nuclear
CLN activity.
Consistent with this, we found previously that addition of an NES (but
not an mnes) to Cln2p strongly reduced its ability
to rescue a
cln1 cln2 cln3 swi4 strain (
45). According to
the
hypothesis that both nuclear and cytoplasmic
CLN
activities may
be required in this context, NES-Cln2p should complement
Cln3p
for rescue of a
cln1 cln2 cln3 swi4 strain, since
Cln3p should
provide the nuclear
CLN function and NES-Cln2p
should provide
the cytoplasmic
CLN function. This was
observed (Fig.
11C): provision
of wild-type
CLN3 in the
chromosome and
NES-CLN2 on a plasmid
resulted in significant
viability in the absence of
pcl1,
pcl2,
cln1, and
cln2, while
CLN3 alone was
insufficient and
NES-CLN2 alone was very inefficient (Fig.
11C).
Thus, wild-type Cln3p requires nuclear localization to carry out its
normal roles, probably including activation of
G
1/S transcription
(see Introduction), so that
its mislocalization to the cytoplasm
blocks its ability to rescue the
cln1 cln2 cln3 strain. In contrast,
mislocalization of Cln3p
to the cytoplasm allows it to carry out
some biological roles normally
restricted to the cytoplasmic Cln2p.
These results confirm and extend
our previous results with mislocalized
Cln3-1p, with much less
experimental confounding of localization
and protein abundance
effects.
Localization-dependent cell size control by Cln3p.
We also
assayed for CLN activity by monitoring cell volume.
Initiation of the cell cycle requires CLN activity for bud
emergence and activation of Clbp-Cdc28p complexes. Cells with reduced
CLN activity will have a delay in these events resulting in
a population of relatively large cells due to a longer period of cell
growth after cell division and before cell cycle initiation.
Conversely, high CLN activity will result in a population of
relatively small cells (11, 48, 53). Links between cell
cycle progression and cellular growth may also exist in higher
eukaryotic cells, suggesting that this process could be conserved (as
reviewed in reference 10). Plasmids encoding the various
mutant Cln3 proteins were introduced into a cln2 cln3
strain, and transformants were assayed for cell volume. (A cln2
cln3 strain was used to sensitize the assay to CLN
function.) As expected, expression of Cln2mycp
and Cln3mycp confers smaller cell volume than
that of the vector control. Expression of
NES-Cln3-
22mycp (but not the mnes controls)
produces populations of cells with larger cell volumes, near the volume
of control vector transformants (Fig.
12). These data show a strong reduction
of CLN3 functional activity when Cln3p is exported out of
the nucleus and into the cytoplasm through the combination of the Cln3p
NLS deletion and addition of the PKI NES. Thus, as with the cln1
cln2 cln3 rescue assay, the cell volume assay for CLN
activity leads to the conclusion that nuclear Cln3 may be required to
efficiently drive cell cycle initiation.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 12.
Cell size assay for CLN gene function.
CLN1 cln2 cln3 cells (1421-21D) were transformed with
plasmids containing various CLN2 and CLN3
constructs (see the legend to Fig. 9). Cell size analysis was carried
out as described in Materials and Methods. Data for two transformants
are shown on each graph.
|
|
Although we expected the shift of Cln3-

22p to the cytoplasm (even
without the NES) to decrease its activity in this assay,
we find only a
slight shift and widening of the peak distribution
of cells expressing
Cln3-

22p compared to wild-type Cln3p. This
slight, but reproducible
change is relieved by addition of the
functional SV40 NLS, but not the
mnls control (Fig.
12). These
data are relevant to models describing
the regulation of cell
size in response to Clnp dosage resulting from
Cln3p compartmentalization
in the nucleus. Assuming that the nucleus
maintains a constant
volume through G
1, as cells
grow, the concentration of nuclear
Cln3p could increase until some
critical threshold is reached
allowing cell cycle progression (as
proposed in reference
23 and quantitatively modeled by
reference
8). If so, the prediction
would be that the
redistribution of a significant amount of Cln3p
to the cytoplasm (via
deletion of the Cln3 NLS) should reduce
the amount of Cln3p in the
nucleus, thus delaying the ability
of the nuclear Cln3p to reach this
critical threshold. In this
case, Cln3-

22p should give a delay in
cell cycle progression
compared to that of the wild type and a
commensurate increase
in cell size. This prediction is complicated in
our experiment
by the fact that Cln3-

22p is present at an elevated
level compared
to wild-type Cln3 (Fig.
10). Increased Cln3p protein
levels are
known to accelerate cell cycle progression (
11,
53), consistent
with the quantitative model (
8).
Hence, the lack of phenotype
observed with Cln3-

22p may reflect a
balance between accelerated
cell cycle progression due to higher
steady-state levels of Cln3p
(at least some of which is likely to be
nuclear) and slowed cell
cycle progression due to the reduction of
nuclear Cln3p. However,
comparison of the NLS-Cln3-

22p and the
mnls-Cln3-

22p provides
us with a situation in which a clear
difference in subcellular
localization is observed by indirect
immunofluorescence (Fig.
10), with no significant changes in expression
levels (Fig.
10).
In this case, we find only minor changes in cell size
distribution
dependent on subcellular localization, contrary to
predictions
made based on models in which nuclear compartmentalization
of
Cln3p is crucial for cell size control. It is possible that there
is
some compensating acceleration of cell cycle initiation by
cytoplasmic
Cln3p in this
case.
Taken together, these data suggest that efficient nuclear localization
of Cln3p is important for maintaining cell size, since
NES-Cln3-

22p
is almost unable to function in this assay. However,
the relationship
between Cln3p function, nuclear localization,
and cell size control may
be somewhat
complex.
 |
DISCUSSION |
Different mechanisms control localization of the G1
cyclins Cln2p and Cln3p.
In addition to activating Cdks through
conformational changes associated with cyclin-Cdk binding, the spatial
context in which cyclin proteins function is an important component of
Cdk regulation. In previous work, we found that the localization
pattern of the G1cyclin Cln2p is primarily
cytoplasmic and that of the G1 cyclin Cln3p is
primarily nuclear (45). Here we have investigated the role
that the Cdk Cdc28p plays in the control of distinct subcellular localization patterns of these cyclins. Using a mutant Cln2p in which
all potential Cdc28p target sites have been mutated, we find a partial
accumulation of Cln2p in the nucleus (Fig. 1). Inactivation of
CDC28 also results in a partial accumulation of Cln2p in the
nucleus as demonstrated by indirect immunofluorescence (Fig. 2). The
nuclear accumulation of hypophosphorylated Cln2p does not reflect Cln2p
stabilization, since stabilization of Cln2p via mutation of the
CDC34 gene or deletion of the GRR1 gene does not
alter Cln2p localization (Fig. 2 and data not shown). Taken together,
these data are consistent with direct Cdc28p-dependent phosphorylation
of Cln2 being required for nuclear depletion of Cln2p. Additionally,
there is a requirement of Cln2p-Cdc28p complex formation in regulated
Cln2p localization. Both nuclear depletion and nuclear accumulation are
influenced by physical association with Cdc28p, as seen with mutations
in Cln2p that are defective in binding Cdc28p and with mutations in
Cdc28p that are defective for binding Cln2p (Fig. 4).
We also find a cell cycle-dependent shift in the phosphorylation state
of Cln2p. Populations of small unbudded cells harvested
by centrifugal
elutriation from a log-phase culture (presumably
the youngest cells in
the population) contain largely hypophosphorylated
Cln2p compared to
populations of larger unbudded cells (presumably
from later in the cell
cycle). These newborn cells with hypophosphorylated
Cln2p show little
or no depletion of Cln2p from the nucleus. These
data are consistent
with regulated shuttling of Cln2p in and out
of the nucleus, where
nonphosphorylated Cln2p is enriched in the
nucleus and phosphorylated
Cln2p is enriched in the
cytoplasm.
Phosphorylation of Cln2p also triggers Cln2p degradation. It remains
unclear if the phosphorylation sites that target Cln2p
for degradation
are the same as the phosphorylation sites that
regulate Cln2p
localization. It is possible that the localization
and stability of
Cln2p are linked, such that the localization
of Cln2p in the cytoplasm
increases the instability of this protein.
It also remains possible
that multiple phosphorylation sites are
involved in regulation of Cln2p
localization. This might allow
multiple cellular inputs to regulate
Cln2p localization, as has
been described for the higher eukaryotic
cyclin B1 (
83). We
are currently investigating these
possibilities.
Our findings on Cln2p localization can be explained by the model that
Cln2p-Cdc28p complex can enter the nucleus in an energy-dependent
manner and can probably leave the nucleus in an energy-independent
manner. We do not yet know if Cln2p phosphorylation increases
the rate
of energy-independent nuclear export, decreases the rate
of
energy-dependent import, or influences potential cytoplasmic
retention. All Cln2p traffic appears to be Ran independent. Some
aspect of this regulation is interfered with in cells early in
the cell
cycle, which may allow a brief period of nuclear residence
of
Cln2p.
Unlike Cln2p, the localization of Cln3p does not require Cdc28p
activity or binding (data not shown). Nuclear localization
of Cln3p
requires a C-terminal bipartite-type NLS. Deletion of
this sequence
results in a shift in localization of Cln3p to the
cytoplasm, and
fusion of this sequence to GFP results in nuclear
localization of GFP;
therefore, this sequence is necessary and
sufficient for nuclear
localization. The ability of this region
to confer nuclear localization
to GFP requires two basic clusters
within the sequence, consistent with
a bipartite-type structure
of the Cln3p NLS. Additionally, we find that
the Cln3p NLS-GFP
fusion protein is defective for nuclear localization
in a
gsp1-
1 Ran temperature-sensitive mutant
strain (data not
shown).
Our data indicate that the localization patterns of Cln2p and Cln3p are
actively maintained in the cell and regulated by distinct
mechanisms.
The movement of Cln2p-Cdc28 complex into the nucleus
is energy
dependent and regulated by Cdc28p-dependent phosphorylation,
yet
appears to involve a nonclassical route, since Cln2p transport
appears
Ran independent. In contrast, Cln3p nuclear import appears
Cdc28p
independent and requires a bipartite-type localization
signal that is
RAN dependent. The existence of distinct mechanisms
that regulate the
subcellular localization patterns of the Cln2p
and Cln3p cyclins may
influence cyclin function and specificity
(discussed
below).
G1 cyclin localization is significant for cyclin
function and specificity.
There are at least two ways in which
subcellular localization of the G1 cyclins might
be important for cyclin function. First, a cyclin might need to be in
its usual location to carry out its normal function, so that
mislocalization due to removal of localization signals and/or addition
of mistargeting signals could reduce or eliminate its normal function.
We see several examples of this in the present work. The strongly
mistargeted NES-Cln3-
22p lacks biological activity in the cln1
cln2 cln3 rescue and cell volume assays (Fig. 11 and 12). (We
assume that the function of Cln3-
22p is due to residual nuclear
localization of Cln3-
22p.) Deletion of BCK2 sensitizes
the cell to Cln3p activity (38, 45). In a bck2 cln1
cln2 cln3 background, Cln3-
22p is reduced in rescue activity
compared to that of wild-type Cln3p (Fig. 11). This defect is rescued
by addition of the SV40 NLS, which partially restores nuclear
localization of this mutant. Interestingly, addition of an NES to Cln2p
strongly reduces some activities of Cln2p that may specifically require
transient Cln2p nuclear residence (45).
Previous attempts to detect functional defects of mislocalized Cln3p
(Cln3-1p) in the absence of additional
CLN genes (but
in an
otherwise wild-type strain) were unsuccessful (
45). This
is most likely due to additional effects of the larger
CLN3-
1 deletion compared to the 22-amino-acid
C-terminal deletion in
cln3-
22. Cln3-1p
exhibits stronger nuclear localization than
Cln3-

22p and also
accumulates to a much higher level than Cln3-

22p.
These effects are
likely due to the presence of other sequences
affecting Cln3p
localization in the C-terminal 177 amino acids
and to the presence of
additional functional PEST sequences in
this region (
13,
72,
81). The present results obtained with
the Cln3-

22p mutant
are significantly more clear, because the
deletion is much more
precise, being restricted to the NLS rather
than removing a large
segment of protein with major effects on
Cln3p
stability.
A second way in which subcellular localization patterns of the
G
1 cyclins might be important for cyclin function
is that localization
could keep a cyclin from performing a task
normally performed
by a different cyclin. In this case, mislocalization
due to removal
of localization signals and/or addition of mistargeting
signals
could result in an alteration in the functional spectrum of a
cyclin. Removal of Cln3p from the nucleus by deletion of its NLS
results in Cln3p acquiring functional activities that are normally
restricted to the cytoplasmic Cln2p, such as rescue of a
cln1 cln2 CLN3 pcl1 pcl2 strain (Fig.
11). Mislocalized Cln3p is not
as
efficient in these assays as Cln2p, indicating that additional
factors
beyond simple nuclear versus cytoplasmic localization
may contribute to
cyclin functional
specificity.
Complementation between nuclear Cln3p and artificially cytoplasmic Cln
(either NES-Cln2p or NES-Cln3p-

22) (Fig.
11) provides
strong
evidence that cyclin functional specificity can be altered
just by
changing
localization.
The Cln2 phosphorylation mutant, Cln2-4t3sp, has been reported to
result in reduced mating factor sensitivity and accelerated
cell cycle
initiation (
36). These defects may result from the
stabilization of Cln2p, as suggested previously; but the defects
could
also result from the mislocalization of Cln2-4t3sp to the
nucleus or
from a combination of these factors. We showed previously
that addition
of an NES (but not an mnes) to Cln2p significantly
reduced its
biological activity (
45). In this study, we find
a
transient population of Cln2p that is hypophosphorylated and
that fails
to exhibit nuclear depletion. These observations, combined
with the
observation that elimination of Cln2p phosphorylation
resulted in a
nuclear population of Cln2p (Fig.
1 and
2), suggest
the hypothesis that
Cln2p is able to reside in the nucleus when
unphosphorylated, but not
when phosphorylated, and that nuclear
residence of Cln2p is important
for its
function.
The finding that hypophosphorylated Cln2p no longer enters the nucleus
in the presence of metabolic poison indicates that
the nuclear import
of Cln2p is active. No evidence of active Cln2p
export was observed in
our studies. Our data establish a role
for Cdk activity in the
subcellular localization pattern of a
G
1 cyclin,
Cln2p. Previous work with higher eukaryotic cells indicates
that Cdk
activity might regulate the localization of the mitotic
cyclin B1
(
28,
42). Phosphorylation of cyclin B1 at serine
113, resulting in nuclear localization, has the opposite effect
on
localization from phosphorylation of Cln2p, which results in
cytoplasmic localization. In the case of cyclin B1, phosphorylation
results in the inhibition of export (
83). It has also been
reported
that nuclear import of cyclin B1 is positively regulated by
phosphorylation
at multiple sites in cyclin B1 (
25,
83),
again, having an
opposite effect from that observed with Cln2p in our
study. The
phosphorylation-dependent localization of cyclin B1 also
most
likely occurs independent of physical interactions with cyclin
F,
since they involve phosphorylation events within the defined
cytoplasmic retention sequence (CRS) domain of cyclin B1
(
35).
Interestingly, a Ran-independent mechanism for
cyclin B1 nuclear
import has been described. In this case, the
Ran-independent transport
of cyclin B1 required importin

(
71), and seems to function
independent of
phosphorylation-dependent import (
25,
83).
We are
currently addressing whether similar requirements exist
for Cln2p
nuclear import. Other examples of Ran-independent, energy-dependent
transport have been characterized, including spliced mRNA
(
9),
the U1A and U1B spliceosome proteins
(
26), the inhibitor of

B

(I

B

)
(
60),

-catenin (
60), and histone 2b
(
76). The
data with Cln2p are reminiscent of the data
obtained with cyclin
D1, in which glycogen synthase kinase 3

phosphorylation results
in cytoplasmic localization and subsequent
degradation of cyclin
D1 (
18). However, in the case of
cyclin D1, phosphorylation
results in the physical interaction with the
Crm1 exportin, leading
to active export (
2). We do not
believe that a similar mechanism
exists for Cln2p localization, since
we found no evidence of active
export in our experiments, and the
localization pattern of Cln2p
is not changed in a mutant
crm1 strain (Fig.
5) (data not shown).
Additionally, in the
case of Cln2p, the phosphorylation most likely
occurs through the bound
Cdk. Our data are consistent with the
idea that phosphorylation of
Cln2p forces the Cln2-Cdc28p complex
into a regulated localization
pattern, through a novel nonclassical
pathway, altering the
accessibility of critical substrates for
active
Cdk.
 |
ACKNOWLEDGMENTS |
We thank Mike Tyers, Stephan Lanker, Anita Corbett, Mike Rout,
Karsten Weis, and Lucy Pemberton for generously providing plasmids and
strains. We thank Alison North, Matt Jacobson, Yelena Fishilevich, Martha Klovstad, Caihong Li, Ben Timney, Ralph Waesch, and David Miller
for helpful discussions and technical assistance.
This work was supported by NIH grant GM47238 to F.R.C. M.E.M. was
supported by NRSA GM18782. This study was made possible in part by
funds granted by the Charles H. Revson Foundation.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: The Rockefeller
University, 1230 York Ave., New York, NY 10021. Phone: (212) 327-7686. Fax: (212) 327-7193. E-mail:
fcross{at}rockvax.rockefeller.edu.
Present address: Rhodes College, Memphis, TN 38112.
 |
REFERENCES |
| 1.
|
Aitchison, J. D.,
M. P. Rout,
M. Marelli,
G. Blobel, and R. W. Wozniak.
1995.
Two novel related yeast nucleoporins Nup170p and Nup157p: complementation with the vertebrate homologue Nup155p and functional interactions with the yeast nuclear pore-membrane protein Pom152p.
J. Cell Biol.
131:1133-1148[Abstract/Free Full Text].
|
| 2.
|
Alt, J. R.,
J. L. Cleveland,
M. Hannink, and J. A. Diehl.
2000.
Phosphorylation-dependent regulation of cyclin D1 nuclear export and cyclin D1-dependent cellular transformation.
Genes Dev.
14:3102-3114[Abstract/Free Full Text].
|
| 3.
|
Andrews, B., and V. Measday.
1998.
The cyclin family of budding yeast: abundant use of a good idea.
Trends Genet.
14:66-72[CrossRef][Medline].
|
| 4.
|
Aris, J. P., and G. Blobel.
1988.
Identification and characterization of a yeast nucleolar protein that is similar to a rat liver nucleolar protein.
J. Cell Biol.
107:17-31[Abstract/Free Full Text].
|
| 5.
|
Bardin, A. J.,
R. Visintin, and A. Amon.
2000.
A mechanism for coupling exit from mitosis to partitioning of the nucleus.
Cell
102:21-31[CrossRef][Medline].
|
| 6.
|
Barral, Y.,
S. Jentsch, and C. Mann.
1995.
G1 cyclin turnover and nutrient uptake are controlled by a common pathway in yeast.
Genes Dev.
9:399-409[Abstract/Free Full Text].
|
| 7.
|
Benton, B. K.,
A. H. Tinkelenberg,
D. Jean,
S. D. Plump, and F. R. Cross.
1993.
Genetic analysis of Cln/Cdc28 regulation of cell morphogenesis in budding yeast.
EMBO J.
12:5267-5275[Medline].
|
| 8.
|
Chen, K. C.,
A. Csikasz-Nagy,
B. Gyorffy,
J. Val,
B. Novak, and J. J. Tyson.
2000.
Kinetic analysis of a molecular model of the budding yeast cell cycle.
Mol. Biol. Cell
11:369-391[Abstract/Free Full Text].
|
| 9.
|
Clouse, K. N.,
M. Luo,
Z. Zhou, and R. Reed.
2000.
A Ran-independent pathway for export of spliced mRNA.
Nat. Cell Biol.
3:97-99.
|
| 10.
|
Coelho, C. M., and S. J. Leevers.
2000.
Do growth and cell division rates determine cell size in multicellular organisms?
J. Cell Sci.
113:2927-2934[Abstract].
|
| 11.
|
Cross, F. R.
1988.
DAF1, a mutant gene affecting size control, pheromone arrest, and cell cycle kinetics of Saccharomyces cerevisiae.
Mol. Cell. Biol.
8:4675-4684[Abstract/Free Full Text].
|
| 12.
|
Cross, F. R.
1995.
Starting the cell cycle: what's the point?
Curr. Opin. Cell Biol.
7:790-797[CrossRef][Medline].
|
| 13.
|
Cross, F. R., and C. M. Blake.
1993.
The yeast Cln3 protein is an unstable activator of Cdc28.
Mol. Cell. Biol.
13:3266-3271[Abstract/Free Full Text].
|
| 14.
|
Cross, F. R.,
M. Yuste-Rojas,
S. Gray, and M. D. Jacobson.
1999.
Specialization and targeting of B-type cyclins.
Mol. Cell
4:11-19[CrossRef][Medline].
|
| 15.
|
Cvrcková, F., and K. Nasmyth.
1993.
Yeast G1 cyclins CLN1 and CLN2 and a GAP-like protein have a role in bud formation.
EMBO J.
12:5277-5286[Medline].
|
| 16.
|
Deshaies, R. J.,
V. Chau, and M. Kirschner.
1995.
Ubiquitination of the G1 cyclin Cln2p by a Cdc34p-dependent pathway.
EMBO J.
14:303-312[Medline].
|
| 17.
|
Di Como, C. J.,
H. Chang, and K. T. Arndt.
1995.
Activation of CLN1 and CLN2 G1 cyclin gene expression by BCK2.
Mol. Cell. Biol.
15:1835-1846[Abstract].
|
| 18.
|
Diehl, J. A.,
M. Cheng,
M. F. Roussel, and C. J. Sherr.
1998.
Glycogen synthase kinase 3beta regulates cyclin D1 proteolysis and subcellular localization.
Genes Dev.
15:3499-3511.
|
| 19.
|
Dirick, L.,
T. Böhm, and K. Nasmyth.
1995.
Roles and regulation of Cln-Cdc28 kinases at the start of the cell cycle of Saccharomyces cerevisiae.
EMBO
14:4803-4813[Medline].
|
| 20.
|
Draviam, V. M.,
S. Orrechia,
M. Lowe,
R. Pardi, and J. Pines.
2001.
The localization of human cyclins B1 and B2 determines their substrate specificity and neither enzyme requires MEK to disassemble the Golgi apparatus.
J. Cell Biol.
152:1-15[Abstract/Free Full Text].
|
| 21.
|
Epstein, C. B., and F. R. Cross.
1994.
Genes that can bypass the CLN requirement for Saccharomyces cerevisiae cell cycle START.
Mol. Cell. Biol.
14:2041-2047[Abstract/Free Full Text].
|
| 22.
|
Fu, H.,
R. Subramanian, and S. C. Masters.
2000.
14-3-3 proteins: structure, function, and regulation.
Annu. Rev. Pharmacol. Toxicol.
40:617-647[CrossRef][Medline].
|
| 23.
|
Futcher, B.
1996.
Cyclins and the wiring of the yeast cell cycle.
Yeast
12:1635-1646[CrossRef][Medline].
|
| 24.
|
Gietz, R. D., and R. H. Schiestl.
1991.
Applications of high efficiency lithium acetate transformation of intact yeast cells using single-stranded nucleic acids as carrier.
Yeast
7:253-263[CrossRef][Medline].
|
| 25.
|
Hagting, A.,
M. Jackman,
K. Simpson, and J. Pines.
1999.
Translocation of cyclin B1 to the nucleus at prophase requires a phosphorylation-dependent nuclear import signal.
Curr. Biol.
9:680-689[CrossRef][Medline].
|
| 26.
|
Hetzer, M., and I. W. Mattaj.
2000.
An ATP-dependent, Ran-independent mechanism for nuclear import of the U1A and U2B" spliceosome proteins.
J. Cell Biol.
148:293-303[Abstract/Free Full Text].
|
| 27.
|
Huang, K. N.,
S. A. Odinsky, and F. R. Cross.
1997.
Structure-function analysis of the Saccharomyces cerevisiae G1 cyclin Cln2.
Mol. Cell. Biol.
17:4654-4666[Abstract].
|
| 28.
|
Izumi, T., and J. L. Maller.
1991.
Phosphorylation of Xenopus cyclins B1 and B2 is not required for cell cycle transitions.
Mol. Cell. Biol.
11:3860-3867[Abstract/Free Full Text].
|
| 29.
|
Jackman, M.,
M. Firth, and J. Pines.
1995.
Human cyclins B1 and B2 are localized to strikingly different structures: B1 to microtubules, B2 primarily to the Golgi apparatus.
EMBO J.
14:1646-1654[Medline].
|
| 30.
|
Jacobson, M. D.,
S. Gray,
M. Yuste-Rojas, and F. R. Cross.
2000.
Testing cyclin specificity in the exit from mitosis.
Mol. Cell. Biol.
20:4483-4493[Abstract/Free Full Text].
|
| 31.
|
Jaspersen, S. L.,
J. F. Charles, and D. O. Morgan.
1999.
Inhibitory phosphorylation of the APC regulator Hct1 is controlled by the kinase Cdc28 and the phosphatase Cdc14.
Curr. Biol.
9:227-236[CrossRef][Medline].
|
| 32.
|
Jeffrey, P. D.,
A. A. Russo,
K. Polyak,
E. Gibbs,
J. Hurwitz,
J. Massague, and N. Pavletich.
1995.
Mechanism of CDK activation revealed by the structure of a cyclin A-CDK2 complex.
Nature
376:313-320[CrossRef][Medline].
|
| 33.
|
Kishi, T., and F. Yamao.
1998.
An essential function of Grr1 for the degradation of Cln2 is to act as a binding core that links Cln2 to Skp1.
J. Cell Sci.
111:3655-3661[Abstract].
|
| 34.
|
Koch, C., and K. Nasmyth.
1994.
Cell cycle regulated transcription in yeast.
Curr. Opin. Cell Biol.
6:451-459[CrossRef][Medline].
|
| 35.
|
Kong, M.,
E. A. Barnes,
V. Ollendorff, and D. J. Donoghue.
2000.
Cyclin F regulates the nuclear localization of cyclin B1 through a cyclin-cyclin interaction.
EMBO J.
19:1378-1388[CrossRef][Medline].
|
| 36.
|
Lanker, S.,
M. H. Valdivieso, and C. Wittenberg.
1996.
Rapid degradation of the G1 cyclin Cln2 induced by CDK-dependent phosphorylation.
Science
271:1597-1601[Abstract].
|
| 37.
|
Lenburg, M. E., and E. K. O'Shea.
2001.
Evidence for a morphogenic function of the Saccharomyces cerevisiae Pho85 cyclin-dependent kinase.
Genetics
157:39-51[Abstract/Free Full Text].
|
| 38.
|
Levine, K.,
K. Huang, and F. R. Cross.
1996.
Saccharomyces cerevisiae G1 cyclins differ in their intrinsic functional specificities.
Mol. Cell. Biol.
16:6794-6803[Abstract].
|
| 39.
|
Levine, K.,
L. J. W. M. Oehlen, and F. R. Cross.
1998.
Isolation and characterization of new alleles of the cyclin-dependent kinase gene CDC28 with cyclin-specific functional and biochemical defects.
Mol. Cell. Biol.
18:290-302[Abstract/Free Full Text].
|
| 40.
|
Lew, D. J., and S. I. Reed.
1993.
Morphogenesis in the yeast cell cycle: regulation by Cdc28 and cyclins.
J. Cell Biol.
120:1305-1320[Abstract/Free Full Text].
|
| 41.
|
Li, F. N., and M. Johnston.
1997.
Grr1 of Saccharomyces cerevisiae is connected to the ubiquitin proteolysis machinery through Skp1: coupling glucose sensing to gene expression and the cell cycle.
EMBO J.
16:5629-5638[CrossRef][Medline].
|
| 42.
|
Li, J.,
A. N. Meyer, and D. Donoghue.
1997.
Nuclear localization of cyclin B1 mediates its biological activity and is regulated by phosphorylation.
Proc. Natl. Acad. Sci. USA
94:502-507[Abstract/Free Full Text].
|
| 43.
|
Measday, V.,
L. Moore,
J. Ogas,
M. Tyers, and B. Andrews.
1994.
The PCL2 (ORFD)-PHO85 cyclin-dependent kinase complex: a cell cycle regulator in yeast.
Science
266:1391-1395[Abstract/Free Full Text].
|
| 44.
|
Melchior, F.,
B. Paschal,
E. Evans, and L. Gerace.
1993.
Inhibition of nuclear protein import by nonhydrolyzable analogues of GTP and identification of the small GTPase Ran/TC4 as an essential transport factor.
J. Cell Biol.
123:1649-1659[Abstract/Free Full Text].
|
| 45.
|
Miller, M. E., and F. R. Cross.
2000.
Distinct subcellular localization patterns contribute to functional specificity of the Cln2 and Cln3 cyclins of Saccharomyces cerevisiae.
Mol. Cell. Biol.
20:542-555[Abstract/Free Full Text].
|
| 46.
|
Moore, J. D.,
J. Yang,
R. Truant, and S. Kornbluth.
1999.
Nuclear import of Cdk/cyclin complexes: identification of distinct mechanisms for import of Cdk2/cyclin E and Cdc2/cyclin B1.
J. Cell Biol.
144:213-224[Abstract/Free Full Text].
|
| 47.
|
Moore, M. S., and G. Blobel.
1993.
The GTP-binding protein Ran/TC4 is required for protein import into the nucleus.
Nature
365:661-663[CrossRef][Medline].
|
| 48.
|
Moore, S. A.
1990.
Cell size specific binding of the fluorescent dye calcofluor to budding yeast.
Biochim. Biophys. Acta
1035:206-213[Medline].
|
| 49.
|
Morgan, D. O.
1997.
Cyclin-dependent kinases: engines, clocks, and microprocessors.
Annu. Rev. Cell Dev. Biol.
13:261-291[CrossRef][Medline].
|
| 50.
|
Morgan, D. O.
1995.
Principles of CDK regulation.
Nature
374:131-134[CrossRef][Medline].
|
| 51.
|
Moroianu, J.
1999.
Nuclear import and export: transport factors, mechanisms and regulation.
Crit. Rev. Eukaryot. Gene Expr.
9:89-106[Medline].
|
| 52.
|
Muslin, A. J.,
J. W. Tanner, and P. M. Allen.
1996.
Interaction of 14-3-3 with signaling proteins is mediated by the recognition of phosphoserine.
Cell
84:889-897[CrossRef][Medline].
|
| 53.
|
Nash, R.,
G. Tokiwa,
S. Anand,
K. Erickson, and A. B. Futcher.
1988.
The WHI1+ gene of Saccharomyces cerevisiae tethers cell division to cell size and is a cyclin homolog.
EMBO. J.
7:4335-4346[Medline].
|
| 54.
|
Nasmyth, K.
1996.
At the heart of the budding yeast cell cycle.
Trends Genet.
12:405[CrossRef][Medline].
|
| 55.
|
Nasmyth, K., and L. Dirick.
1991.
The role of SW14 and SW16 in the activity of G1 cyclins in yeast.
Cell
66:995-1013[CrossRef][Medline].
|
| 56.
|
Nigg, E. A.
1995.
Cyclin-dependent protein kinases: key regulators of the eukaryotic cell cycle.
Bioessays
16:471-480.
|
| 57.
|
Ogas, J.,
B. J. Andrews, and I. Herskowitz.
1991.
Transcriptional activation of CLN1, CLN2, and a putative new G1 cyclin (HCS26) by SWI4, a positive regulator of G1-specific transcription.
Cell
66:1015-1026[CrossRef][Medline].
|
| 58.
|
Pines, J., and T. Hunter.
1994.
The differential localization of human cyclins A and B is due to a cytoplasmic retention signal in cyclin B.
EMBO J.
13:3772-3781[Medline].
|
| 59.
|
Richardson, H. E.,
C. Wittenberg,
F. Cross, and S. I. Reed.
1989.
An essential G1 function for cyclin-like proteins in yeast.
Cell
59:1127-1133[CrossRef][Medline].
|
| 60.
|
Sachdev, A.,
S. Bagchi,
D. D. Zhang,
A. C. Mings, and M. Hannink.
2000.
Nuclear import of I B is accomplished by a Ran-independent transport pathway.
Mol. Cell. Biol.
20:1571-1582[Abstract/Free Full Text].
|
| 61.
|
Schlendstedt, G.,
E. Hurt,
V. Doyle, and P. A. Silver.
1993.
Reconstitution of nuclear-protein transport with semi-intact yeast cells.
J. Cell Biol.
123:785-798[Abstract/Free Full Text].
|
| 62.
|
Schneider, B. L.,
E. E. Patton,
S. Lanker,
M. D. Mendenhall,
C. Wittenburg,
B. Futcher, and M. Tyers.
1998.
Yeast G1 cyclins are unstable in G1 phase.
Nature
395:86-89[CrossRef][Medline].
|
| 63.
|
Sherman, F.,
G. R. Fink, and J. B. Hicks.
1989.
Laboratory course manual for methods in yeast genetics.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 64.
|
Shou, W.,
J. H. Seol,
A. Shevchenko,
C. Baskerville,
D. Moazed,
Z. W. Chen,
J. Jang,
A. Shevchenko,
H. Charbonneau, and R. J. Deshaies.
1999.
Exit from mitosis is triggered by Tem1-dependent release of the protein phosphatase Cdc14 from nucleolar RENT complex.
Cell
97:233-244[CrossRef][Medline].
|
| 65.
|
Shulga, N.,
P. Roberts,
Z. Gu,
L. Spitz,
M. M. Tabb,
M. Nomura, and D. Goldfarb.
1996.
In vivo nuclear transport kinetics in Saccharomyces cerevisiae: a role for heat shock protein 70 during targeting and translocation.
J. Cell Biol.
135:329-339[Abstract/Free Full Text].
|
| 66.
|
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27[Abstract/Free Full Text].
|
| 67.
|
Skowyra, D.,
K. L. Craig,
M. Tyers,
S. J. Elledge, and J. W. Harper.
1997.
F-box proteins are receptors that recruit phosphorylated substrates to the SCF ubiquitin-ligase complex.
Cell
91:209-219[CrossRef][Medline].
|
| 68.
|
Skowyra, D.,
D. M. Koepp,
T. Kamura,
M. N. Conrad,
R. C. Conaway,
J. W. Conaway,
S. J. Elledge, and J. W. Harper.
1999.
Reconstitution of G1 cyclin ubiquitination with complexes containing SCFGrr1 and Rbx1.
Science
284:662-665[Abstract/Free Full Text].
|
| 69.
|
Stade, K.,
C. S. Ford,
C. Guthrie, and K. Weis.
1997.
Exportin 1(Crm1p) is an essential nuclear export factor.
Cell
90:1041-1050[CrossRef][Medline].
|
| 70.
|
Stuart, D., and C. Wittenberg.
1995.
CLN3, not positive feedback, determines the timing of CLN2 transcription in cycling cells.
Genes Dev.
9:2780-2794[Abstract/Free Full Text].
|
| 71.
|
Takizawa, C. G.,
K. Weis, and D. Morgan.
1999.
Ran-independent nuclear import of cyclin B1-Cdc2 by importin B.
Proc. Natl. Acad. Sci. USA
96:7938-7943[Abstract/Free Full Text].
|
| 72.
|
Tyers, M.,
G. Tokiwa,
R. Nash, and B. Futcher.
1992.
The Cln3-Cdc28 kinase complex of S. cerevisiae is regulated by proteolysis and phosphorylation.
EMBO J.
11:1773-1784[Medline].
|
| 73.
|
Visintin, R.,
K. Craig,
E. S. Hwang,
S. Prinz,
M. Tyers, and A. Amon.
1998.
The phosphatase Cdc14 triggers mitotic exit by reversal of Cdk-dependent phosphorylation.
Mol. Cell
2:709-718[CrossRef][Medline].
|
| 74.
|
Visintin, R.,
E. S. Hwang, and A. Amon.
1999.
Cfi1 prevents premature exit from mitosis by anchoring Cdc14 phosphatase in the nucleolus.
Nature
398:818-823[CrossRef][Medline].
|
| 75.
|
Wach, A.,
C. Brachet,
C. Alberti-Segui,
C. Rebischung, and P. Philippsen.
1997.
Heterologous HIS3 marker and GFP reporter modules for PCR-targeting in Saccharomyces cerevisiae.
Yeast
13:1065-1075[CrossRef][Medline].
|
| 76.
|
Wiechens, N., and F. Fagotto.
2001.
CRM1- and Ran-independent nuclear export of -catenin.
Curr. Biol.
11:18-27[CrossRef][Medline].
|
| 77.
|
Willems, A. R.,
S. Lanker,
E. E. Patton,
K. L. Craig,
T. F. Nason,
N. Mathias,
R. Kobayashi,
C. Wittenberg, and M. Tyers.
1996.
Cdc53 targets phosphorylated G1 cyclins for degradation by the ubiquitin proteolytic pathway.
Cell
86:453-463[CrossRef][Medline].
|
| 78.
|
Wittenberg, C.,
S. L. Richardson, and S. I. Reed.
1987.
Subcellular localization of a protein kinase required for cell cycle initiation in Saccharomyces cerevisiae: evidence for an association between the CDC28 gene product and the insoluble cytoplasmic matrix.
J. Cell Biol.
105:1527-1538[Abstract/Free Full Text].
|
| 79.
|
Wong, D. H.,
A. H. Corbett,
H. M. Kent,
M. Stewart, and P. Silver.
1997.
Interaction between the small GTPase Ran/Gsp1p and Ntf2p is required for nuclear transport.
Mol. Cell. Biol.
17:3755-3767[Abstract].
|
| 80.
|
Yaffe, M. B.,
K. Rittinger,
S. Volinia,
P. R. Caron,
A. Aitken,
H. Leffers,
S. J. Gamblin,
S. J. Smerdon, and L. C. Cantely.
1996.
The structural basis for 14-3-3: phosphopeptide binding specificity.
Cell
91:961-971.
|
| 81.
|
Yaglom, J.,
M. H. K. Linskens,
S. Sadis,
D. M. Rubin,
B. Futcher, and D. Finley.
1995.
p34Cdc28-mediated control of Cln3 cyclin degradation.
Mol. Cell. Biol.
15:731-740[Abstract].
|
| 82.
|
Yang, J.,
E. S. Bardes,
J. D. Moore,
J. Brennan,
M. A. Powers, and S. Kornbluth.
1998.
Control of cyclin B1 localization through regulated binding of the nuclear export factor CRM1.
Genes Dev.
12:2131-2143[Abstract/Free Full Text].
|
| 83.
|
Yang, J.,
H. Song,
S. Walsh,
E. S. G. Bardes, and S. Kornbluth.
2001.
Combinatorial control of cyclin B1. Nuclear trafficking through phosphorylation at multiple sites.
J. Biol. Chem.
276:3604-3609[Abstract/Free Full Text].
|
Molecular and Cellular Biology, September 2001, p. 6292-6311, Vol. 21, No. 18
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.18.6292-6311.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ashe, M., de Bruin, R. A. M., Kalashnikova, T., McDonald, W. H., Yates, J. R. III, Wittenberg, C.
(2008). The SBF- and MBF-associated Protein Msa1 Is Required for Proper Timing of G1-specific Transcription in Saccharomyces cerevisiae. J. Biol. Chem.
283: 6040-6049
[Abstract]
[Full Text]
-
Hungerbuehler, A. K., Philippsen, P., Gladfelter, A. S.
(2007). Limited Functional Redundancy and Oscillation of Cyclins in Multinucleated Ashbya gossypii Fungal Cells. Eukaryot Cell
6: 473-486
[Abstract]
[Full Text]
-
Niepel, M., Strambio-de-Castillia, C., Fasolo, J., Chait, B. T., Rout, M. P.
(2005). The nuclear pore complex-associated protein, Mlp2p, binds to the yeast spindle pole body and promotes its efficient assembly. JCB
170: 225-235
[Abstract]
[Full Text]
-
Alberghina, L., Rossi, R. L., Querin, L., Wanke, V., Vanoni, M.
(2004). A cell sizer network involving Cln3 and Far1 controls entrance into S phase in the mitotic cycle of budding yeast. JCB
167: 433-443
[Abstract]
[Full Text]
-
Queralt, E., Igual, J. C.
(2004). Functional Distinction Between Cln1p and Cln2p Cyclins in the Control of the Saccharomyces cerevisiae Mitotic Cycle. Genetics
168: 129-140
[Abstract]
[Full Text]
-
Chen, K. C., Calzone, L., Csikasz-Nagy, A., Cross, F. R., Novak, B., Tyson, J. J.
(2004). Integrative Analysis of Cell Cycle Control in Budding Yeast. Mol. Biol. Cell
15: 3841-3862
[Abstract]
[Full Text]
-
Queralt, E., Igual, J. C.
(2003). Cell Cycle Activation of the Swi6p Transcription Factor Is Linked to Nucleocytoplasmic Shuttling. Mol. Cell. Biol.
23: 3126-3140
[Abstract]
[Full Text]
-
Huang, D., Moffat, J., Andrews, B.
(2002). Dissection of a Complex Phenotype by Functional Genomics Reveals Roles for the Yeast Cyclin-Dependent Protein Kinase Pho85 in Stress Adaptation and Cell Integrity. Mol. Cell. Biol.
22: 5076-5088
[Abstract]
[Full Text]
-
Berset, C., Griac, P., Tempel, R., La Rue, J., Wittenberg, C., Lanker, S.
(2002). Transferable Domain in the G1 Cyclin Cln2 Sufficient To Switch Degradation of Sic1 from the E3 Ubiquitin Ligase SCFCdc4 to SCFGrr1. Mol. Cell. Biol.
22: 4463-4476
[Abstract]
[Full Text]
-
Wijnen, H., Landman, A., Futcher, B.
(2002). The G1 Cyclin Cln3 Promotes Cell Cycle Entry via the Transcription Factor Swi6. Mol. Cell. Biol.
22: 4402-4418
[Abstract]
[Full Text]