Previous Article | Next Article ![]()
Molecular and Cellular Biology, October 2001, p. 6507-6514, Vol. 21, No. 19
Sir William Dunn School of Pathology,
University of Oxford, Oxford OX1 3RE, United Kingdom
Received 29 January 2001/Returned for modification 9 May
2001/Accepted 2 July 2001
Our previous studies on nascent transcription across the human
The human Several kilobases upstream of the Our previous studies of transcription in the Plasmids and probes.
Probes were generated from GenBank
sequence accession no. AF064190 as follows: A (positions 1 to 512), B
(512 to 1122), D (1941 to 2645), E (2645 to 3222), F (3222 to 3971), G
(3971 to 4819), L17 (4818 to 5286), L18 (5286 to 5819), L19 (5819 to 6192), and L20 (6192 to 6509). Other globin probes were as previously described (3). Control probes for M13 (background),
VA, and HIS and 5S (adenovirus VAI gene, mouse
histone H4, and Xenopus laevis 5S DNA, respectively) have
also been described (see references listed in reference
3).
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.19.6507-6514.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Intergenic Transcription in the Human
-Globin
Gene Cluster
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-globin gene cluster revealed the presence of intergenic transcripts in addition to the expected genic transcripts. We now show that transcription into the
-globin locus control region (LCR) begins within an ERV9 endogenous retroviral long terminal repeat upstream of
DNase I hypersensitive site 5. However, in a transgenic mouse, which
has the human
-globin LCR but lacks the ERV9 LTR, transcription begins upstream of the transgenic locus. We postulate that in this
transgenic mouse nearby endogenous mouse promoters are activated by the
LCR. Intergenic transcription is also detected across the whole
transgenic globin gene locus independently of the stage of erythroid
development. Intergenic transcription in the
-globin cluster is
erythroid specific; however, it can be induced in nonerythroid cells by
several means: by transinduction with a plasmid transcribing part of
the cluster, by exogenous addition of transcription factors, and by
treatment with the histone deacetylase inhibitor trichostatin A.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-globin cluster, which
extends over 70 kb of chromosome 11, contains the five
-globin genes
(
, G
, A
,
, and
) arranged in the same orientation and in the order of their
expression during development. These genes are under the influence of a
number of erythroid-specific transcription factors (TFs) including
GATA-1 and its cofactor FOG-1 (30), NF-E2, and EKLF
(reviewed in reference 21).
-globin gene are at least five
DNase I-hypersensitive sites (HS1 to HS5) which constitute the locus
control region (LCR). These contain binding sites for GATA-1 and NF-E2
as well as CACC sites that bind a variety of general TFs including Sp1
(21). In transgenic mice the LCR is necessary for
position-independent, copy-number-dependent regulated expression of the
globin genes (13). Although HS2 has classical enhancer
activity (27), recent experiments have shown that the LCR
as a whole is orientation dependent and therefore does not fulfil the
classical definition of an enhancer (28). It has been
suggested that the LCR is responsible for the open chromatin structure
of the
-globin locus. Thus, in the naturally occurring Hispanic
chromosome, from which 35 kb including most of the LCR is deleted, the
entire cluster is DNase I resistant and the globin genes are
transcriptionally inactive (11). However, recent discrete targeted deletions of both human and mouse LCRs in their natural contexts suggest that sequences outside the region covered by the five
HSs may also play a role in the generation of a permissive chromatin
structure throughout the cluster (10, 22).
-globin cluster showed
that in addition to transcription of the five genic regions, there is
also transcription in the regions between the globin genes and across
the LCR (3). Transcription of the intergenic regions of
the
-globin cluster occurs on the same strand as that of the globin
genes and is specific to erythroid cells. Further work on the
phenomenon of intergenic transcription by Gribnau et al.
(12) has suggested that the level of intergenic
transcription can be correlated with the DNase I sensitivity in the
-globin cluster. We have now extended our studies of intergenic
transcription in the human
-globin cluster. We have mapped the most
5' extent of LCR transcription into the endogenous locus to a
retroviral element (ERV9) 5' to HS5. In contrast, intergenic
transcripts downstream of two of the globin genes (
and
A
) do not correspond to any definable promoter
and no precise transcription start site could be identified. We further
show that intergenic transcription occurs across the entire human
globin cluster in the adult erythroid cells of a transgenic mouse.
Although intergenic transcription of the
-globin cluster is specific
to erythroid cells, it can be induced in nonerythroid cells by the expression of transiently transfected globin genes, a process known as
transinduction. Even though the mechanism of transinduction is unknown,
the transfected plasmids are seen to colocalize with the genomic copies
of the cluster, and it is thought that this in some way releases the
intergenic regions for transcription (3). We now describe
two other means of inducing intergenic transcription in a nonerythroid
environment, by the introduction of exogenous TFs and by the histone
deacetylase inhibitor trichostatin A.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
back contains a
promoterless
-globin fragment (positions 62185 to 64301 of GenBank
sequence accession no. U01317) fused to the human immunodeficiency
virus (HIV) promoter in inverse orientation, so the antisense strand of
the gene is transcribed. In p
F+ a fragment corresponding to probe F
replaces the
-globin promoter at position 62211. p
EF+ also
contains the simian virus 40 (SV40) enhancer in reverse orientation with respect to
-globin. A
and
3'
flanking regions tested for promoter activity were fragments from
positions 21362 to 23325, 42152 to 43185, and 42152 to 43785. Stuart
Orkin kindly donated erythroid TF expression plasmids pXM GATA-1
(29), pMT2 FOG (30), and pEF1
-neo NF-E2 (14). Shona Murphy provided a plasmid which expresses the
GAL4 binding domain fused to the OCT-1 activation domain (P+NC in
reference 20).
Tissue culture. Subconfluent HeLa cells were transfected using Effectene (Qiagen) with 1 µg of VA plasmid, 1.5 µg of Tat plasmid and 5 µg of the globin and TF plasmids 24 h prior to nuclear run-on analysis (NRO). Hemin (40 µM) and trichostatin A (TSA) (3 µM) inductions were for 24 and 18 h prior to NRO, respectively.
NRO.
Nuclear isolation and run-on analyses of cultured cells
were performed as previously described (3). The line
72 transgenic mouse containing the human
-globin cluster has
been described (26). Mice were made anemic by treatment
with 0.04 mg of acetylphenylhydrazine per g of body weight. An 80 to
95% pure population of erythroblasts was generated on the sixth day of
treatment by gently scraping the surface of the excised spleen. These
cells were washed in Tris-buffered saline (pH 7), and nuclei were
prepared for NRO as for tissue culture cells.
RNA extraction and analysis.
Cytoplasmic RNA was isolated
48 h after transfection as previously described (9).
A BanII-AccI fragment encompassing the putative
ERV9 promoter and
-globin exon 1 in p
F+ was cloned into pGEM4 and
transcribed into an antisense riboprobe. Five hundred counts per second
of riboprobe was hybridized to 20 µg of cytoplasmic RNA in 80%
formamide-40 mM
piperazine-N,N'-bis(2-ethanesulfonic acid)
(PIPES) (pH 6.4)-1 mM EDTA-400 mM NaCl at 56°C overnight. RNase
protection was as described previously (24).
-globin exon 1 (GTAACGGCAGACTTCTCCTCAGG) was end labeled (24)
and purified using a G25 spin column. One thousand counts per second of
primer was hybridized to 20 µg of RNA at 55°C for 5 h and
reverse transcribed with avian myeloblastosis virus reverse
transcriptase as described previously (32). A sequencing
ladder was generated with labeled primer using Sequenase.
RT-PCR analysis. One microgram of cytoplasmic RNA was reverse transcribed using primer GRT (ATCTCCACATTATTTTAGTC) with Superscript II (Gibco BRL) according to the manufacturer's instructions. cDNA was amplified using Pfu Turbo (Stratagene) and the following primers spanning the ERV9 LTR: G3' (TTAATTGCAAGGGCTGTTGGAAA), FDOWN (TCGGGTCCCCTTCCACACTGT), FDS (CTCTCTACCAATCAGCAGGATGT), FU3 (ACCTTTGTGTGGACACTCTG), and F600 (TTGCTGGGGATGCGAAGAAC).
5' rapid amplification of cDNA ends (RACE) was carried out using the SMART RACE cDNA amplification kit (Clontech) according to the manufacturer's instructions. GRT was used for reverse transcription (RT), and amplification was performed with G3'. Genuine RACE products were identified by blotting and hybridization to probe G and were reamplified using nested primers prior to cloning and sequencing.| |
RESULTS |
|---|
|
|
|---|
The 5' extent of LCR transcription.
Previous studies of
the human
-globin cluster showed that all regions of the LCR up to
and including HS5 are transcribed (3). Using a variety of
techniques, we now map the 5' extent of transcription beyond the LCR in
the human erythroleukemic cell line K562, which endogenously expresses
both
- and
-globin genes.
-amanitin,
indicating that they are due to transcription by RNA polymerase II.
|
50 members as well as
4,000 single
LTRs (15). It therefore seems likely that at least some of
the signals we observe over probes E through G in K562 cells are
derived from other ERV9 elements.
To determine whether any part of the signal we observe over probes E
through G is due to transcription of the ERV9 element upstream of the
-globin cluster, we carried out RT-PCR analysis of this region. RNA
was reverse transcribed using a primer located in the unique region
downstream of the ERV9 LTR (GRT). The downstream (nested) PCR primer (G3') was also located within
the unique region. Of four 5' PCR primers that hybridize to sites
across the ERV9 LTR, three gave RT-PCR products (Fig. 1B), indicating that the
-globin ERV9 element is transcribed in erythroid cells. However, as two of these primers lie upstream of the LTR promoter, it
is unclear whether this promoter itself contributes to LCR transcription. Our most upstream primer failed to give an RT-PCR product, suggesting that the signal we detected over probe E in our
run-on experiments is derived from transcribed ERV9 elements elsewhere
in the genome.
The ERV9 family of endogenous retroviruses has previously been studied
by La Mantia et al. (16), who defined a minimal promoter, mapped transcription start sites, and studied the expression pattern of
the ERV9 elements. To confirm that the ERV9 LTR promoter upstream of
the
-globin cluster is active, we used a transient reporter gene
assay. A DNA fragment corresponding to probe F, which contains the
putative promoter and transcription start site, was fused to a
promoterless
-globin gene both in the presence and in the absence of
the SV40 enhancer (p
EF+ and p
F+, respectively). The
-globin
gene provides a stable 3' end for the ERV9 LTR transcript, and
following transfection into HeLa cells, steady-state RNA was analyzed
quantitatively by RNase protection (Fig.
2A) and by primer extension to accurately
map the 5' ends (Fig. 2B). A cluster of transcription start sites
similar to those mapped by La Mantia et al. was found in the
-globin
ERV9 LTR promoter. When normalized to the VA transfection control, the
SV40 enhancer provided an approximately threefold stimulation of
transcription, although the
-cluster ERV9 LTR promoter alone was
able to efficiently initiate transcription in HeLa cells. The ERV9
promoter activity was also confirmed in both K562 and HeLa cells using
a luciferase reporter gene system (data not shown).
|
Definition of other intergenic transcripts.
We have also
attempted to assign start sites and promoter activity to the intergenic
transcripts downstream of the human
and A
genes. NRO suggests that intergenic transcription begins approximately 3.5 kb downstream of both
and A
(3) (Fig. 4). Using the luciferase reporter gene system we found no evidence for promoter activity in either of these regions, despite testing a variety of fragments in the presence of an enhancer and in both erythroid and nonerythroid cells. We also attempted to
detect 5' ends from endogenous intergenic transcripts in K562 cells
using 5' RACE; however, we were able to detect only a low-level population of random ends (data not shown). Since some of these apparent 5' ends lie upstream of the region suggested by NRO, it is not
clear whether they represented random initiation events. It is possible
that in embryonic and fetal erythroid cells such as K562 a small
amount of read-through from the expressed
and A
genes occurs. Random premature termination
of RT of such transcripts could then produce the population of
transcripts we detected.
Intergenic transcription in a transgenic
-globin cluster.
We have also detected intergenic transcription in mice carrying the
human
-globin cluster as a transgene. These data therefore provide
the first description of intergenic transcripts detected by NRO reading
across the human
-globin gene cluster in an authentic erythroid
tissue. Previously, intergenic transcripts were analyzed in erythroid
tissue only by in situ hybridization.
-globin cluster. The single copy of
the human
-globin cluster stretches from just upstream of HS5 (probe
L17) to several kilobases downstream of the
-globin gene and notably
lacks the ERV9 LTR. Erythroblasts isolated from the spleen of anemic
adult mice were analyzed by NRO. Erythroblasts from nontransgenic mice
were analyzed alongside, so that any contributions to NRO signals made
by the mouse
-globin cluster could be determined. Transcription was
seen across the entire LCR (Fig. 3),
including the most 5' region of the transgene (i.e., probe 17). We
postulate that in the absence of the ERV9 LTR, transcription in the
line 72 transgenic mouse can initiate from endogenous mouse promoter(s) activated by the transgenic LCR, since even the most upstream part of
the transgene is transcribed. Transcription of the human
-globin
gene was also apparent (probes B5 and B6), while
and the
genes
were silent (probes E6 and AG3), as would be expected in adult tissue.
Note that the signal detected by probe E2 is due to cross-hybridization
to both the human
and mouse
MAJ genes as
this probe is within the conserved exon 2 of the gene. These data
demonstrate that there are relatively even levels of intergenic
transcription across the human cluster. Consequently they are at
variance with the results of Gribnau et al. (10), who
reported that in adult erythroid cells intergenic transcription was
greatly reduced in the regions surrounding the embryonic and fetal
and
genes, as shown by RNA fluorescent in situ hybridization (FISH)
analysis. As a further control we also compared the
and
intergenic transcription levels in K562 cells (Fig. 3, lower panels)
and again found them to be similar in this embryonic erythroid cell
line.
|
Induction of LCR transcription in nonerythroid cells.
We have
previously described one way of inducing intergenic transcription in
the
-globin cluster in nonerythroid cell lines, namely by
transinduction. Transiently transfected plasmids expressing sequences
within the
-globin cluster colocalize with the chromosomal copy of
the cluster and activate intergenic transcription in an as yet
undetermined way (3). All regions of the
-globin
cluster tested (genic and intergenic) are able to transinduce
intergenic transcription, and this effect is independent of the
orientation of the expression plasmid (Fig.
4). This is entirely consistent with our
previous suggestions that transinduction is mediated at the DNA level
by the colocalization of the actively transcribed plasmid and the
endogenous
-globin locus (3).
|
-globin cluster in HeLa cells. Expression plasmids were obtained
for the NF-E2 heterodimer, GATA-1, and FOG-1, and the GAL4 DNA
binding domain fused to the OCT-1 activation domain provided a
nonerythroid control. Following transfection of these plasmids into
HeLa cells we used NRO to look for induction of transcription at the
nascent level. All three erythroid TFs were able to stimulate
transcription of all the intergenic regions and the LCR (Fig. 4),
although no combination of transfected plasmids was able to activate
the globin genes themselves (combinations not shown). The GAL4/OCT-1
fusion protein did not induce globin intergenic transcription, although
it has been previously shown to activate transcription linked to GAL4
binding sites (20).
A third way in which intergenic transcription can be induced in a
nonerythroid environment is by treatment with TSA. TSA is a histone
deacetylase inhibitor and as such causes a global increase in the level
of acetylated histones (35). Although the exact method by
which histone acetylation leads to an opening of chromatin is not clear
(25), it has recently been shown that treatment with TSA
can activate retroviral promoters, presumably by releasing them from a
repressive chromatin environment (6). Treatment of HeLa
cells with TSA induces all of the globin intergenic transcripts but
fails to stimulate transcription of the globin genes (Fig. 4B and data
not shown). The signals observed for the LTR probes (F and especially
G) are disproportionately high following TSA induction, presumably
because ERV9 elements elsewhere in the genome are also activated.
We have noticed that when transcription of the
-cluster is induced
by any of the means described above, patchy antisense transcription can
be detected in the LCR (data not shown). This is at variance with the
previously reported strand-specific LCR transcription of K562 cells
(3) and may suggest that during induction intergenic
transcription occurs as a consequence of a general opening of the
chromatin domain. However, it is also clear that on the sense strand
the initiation and termination sites of induced transcription coincide
with the intergenic transcripts of erythroid cells (Fig. 4B) and the
gene transcript (probes E2 to E9, as shown by hybrid selection NRO
[8]) is completely absent.
| |
DISCUSSION |
|---|
|
|
|---|
These studies extend our knowledge of the nature and significance
of nongenic transcripts derived from the human
-globin gene cluster.
We have used several approaches to determine where transcription of the
-globin LCR begins in the human erythroleukemic cell line K562.
These experiments reveal that there is no sense strand transcription
upstream of an ERV9 endogenous retroviral element 1.1 kb upstream of
HS5. This isolated LTR includes the retroviral promoter, which in
transient assays was active in both erythroid and nonerythroid cells.
However, although our analysis of endogenous RNA confirms that the ERV9
promoter is active and contributes to transcription of the LCR,
transcripts that may initiate within the U3 repeats of the LTR were
also detected. Our results extend the preliminary transcription
analysis which accompanied a detailed sequence analysis of the region
by Long et al. (18). However, these authors failed to
detect transcripts initiating within the U3 region, and in this respect
our analysis has been more refined. In view of the more extended region
of DNase I sensitivity surrounding the
-globin gene cluster, we have
also looked for transcription on the antisense strand, towards the
odorant receptor genes embedded within the same chromatin domain
(5). A small amount of antisense transcription was seen over the repetitive probes (E through G) but did not extend into unique
probes A through D or 17 through 20 (data not shown) and was likely to
derive from ERV9 elements elsewhere in the genome. However, two
additional probes which lie close to HOR5'
1 (GenBank accession no.
AF137396, positions 29195 to 29737 and 30600 to 31024) did show
erythroid-specific antisense transcription, which will be the subject
of further studies.
Long et al. also suggest that the ERV9 LTR promoter has inherently
erythroid properties. Although it is difficult to compare transfection
experiments in different cell lines, our transient reporter gene
analysis shows that ERV9 can be active in a nonerythroid environment at
a level approaching its activity in erythroid cells. Furthermore,
transinduction of HeLa cells shows that transcription from the
endogenous
-globin ERV9 LTR can be activated to quite high levels
(comparable to those seen in K562 cells) in the absence of erythroid
TFs, again suggesting that the promoters driving intergenic
transcription are not inherently erythroid specific. By increasing the
global level of histone acetylation using a histone deacetylase
inhibitor (TSA), we were again able to induce intergenic transcription,
which suggests that in nonerythroid cells the block to transcription is
at the level of chromatin structure. A number of erythroid-specific TFs
(NF-E2, GATA-1, and FOG-1) can also independently activate intergenic
transcription. There are potential binding sites for GATA-1 within the
U3 repeats of the ERV9 LTR (18) which may contribute to
this activation. However, it is also possible that exogenously supplied
TFs act through the LCR to open the chromatin which normally represses intergenic transcription in nonerythroid cells. We have not been able
to activate transcription of the globin genes themselves, despite using
a combination of the above induction methods. This may be because we
have not accounted for all of the erythroid factors necessary for
authentic globin gene expression, although it is also possible that the
globin promoters are repressed in nonerythroid cells.
The finding that transcription of the LCR in part starts at the ERV9
LTR promoter is interesting because this region is not present in many
transgenic mice which express the
-globin genes normally. It is also
absent from the endogenous mouse locus, the LCR of which is transcribed
as shown by FISH analysis (3). It is therefore apparent
that the ERV9 LTR is not required per se for LCR transcription. We have
looked for transcription of the LCR in the transgenic mouse line 72, which has previously been described (13, 26) and which
lacks the ERV9 LTR. Transcription of the human LCR was detected up to
the most 5' probe present in the transgene (L17). We suggest that in
this mouse the human LCR activates nearby endogenous mouse promoter(s)
to serve as a transcription start site. However, it should be noted
that our results do not rule out the possibility of additional
transcription initiation events within the LCR, for example from HS2
(4, 31) and HS3 (17), as has been reported
previously. It may be that initiation as far upstream as we observe is
not essential for transcription of the LCR and that in some transgenic
mice initiation at sites within the LCR provides the sole means by which it is transcribed. However, it is also possible that the absence
of these upstream transcripts accounts for some of the minor position
effects still seen in LCR-containing mice (2).
Our model of the ways in which transcription across the human
-globin locus can be activated is shown in Fig.
5. In nonerythroid cells (Fig. 5a) the
globin chromatin domain is normally closed so that no transcription
occurs. In erythroid cells nearby promoters, which are not inherently
erythroid specific, are activated, possibly through enhancer-type
interactions with the LCR or else due to the partial opening of the
-globin chromatin domain by the binding of erythroid TFs at the HSs
(Fig. 5b). In the case of the endogenous human
-globin gene cluster
the most upstream promoter is in the ERV9 LTR, but in transgenic mice
other promoters may be recruited. The globin genes are also activated
by the combination of erythroid TFs binding to sites within their
promoters as well as enhancer interactions with the LCR and the overall
opening of the chromatin structure. Intergenic transcription can be
induced in nonerythroid cells by at least three means: during
transinduction by an unknown mechanism involving colocalization of the
transfected plasmid and endogenous locus; by inhibition of histone
deacetylases, resulting in a global opening of chromatin allowing
access to these intergenic promoters (Fig. 5c); and by exogenously
supplied erythroid TFs again either through enhancer-type interactions
with the LCR or because of improved access due to the opening of the
-globin chromatin domain (Fig. 5d). In each case the globin genes
themselves are not transcribed, as the full complement of erythroid TFs
are not present.
|
While it has long been appreciated that the degree of chromatin
condensation affects the ability of a region of DNA to be transcribed,
it has recently become apparent that the opposite is also true and that
transcription can affect the nature of chromatin. Thus, it has been
demonstrated that the Saccharomyces cerevisiae elongator complex, which is integral to the transcribing polymerase II
complex, has histone acetylase activity which may disrupt the chromatin
structure facilitating rounds of transcription (34). Chromatin-remodeling factors have also been isolated as part of the
polymerase II complex in both mammalian and yeast cells (7, 33). Such data suggest that intergenic transcription could
maintain or extend the DNase I sensitivity initiated by the binding of TFs. Indeed, a recent report (17) shows that when
erythroid TFs bind to the
-globin HS2 and HS3 hypersensitivity is
established over the core of the HSs in the absence of chromatin.
Transcripts initiating within the core of both hypersensitive regions
were also generated. A role for intergenic transcription in propagating DNase sensitivity in the
-globin locus is clearly an attractive conclusion.
Support for this idea and for the importance of transcripts initiating
upstream of HS5 comes from recent work by Reik et al. (22). A targeted deletion of HS2 to HS5 (
2-5) in
the human
-globin LCR was generated so that the role of the LCR in
globin gene expression could be assessed in its natural chromosomal
location. Although globin gene expression was disrupted by this
deletion, the cluster retained its erythroid-specific DNase I
sensitivity. In contrast, the Hispanic thalassemia deletion causes the
locus to become DNase I resistant in addition to affecting globin
expression (11). Significantly, the Hispanic deletion
includes the ERV9 LTR, whereas the 5' limit of the targeted deletion
lies between HS5 and ERV9. We suggest that the DNase I sensitivity of
the globin cluster is retained in the
2-5 mutation because
transcription initiating within the ERV9 LTR can be activated by
elements outside the deleted region; however, it has not yet been shown
whether what remains of the LCR is transcribed following either of
these deletions.
In a recent study of the human
-globin cluster in transgenic mice,
Gribnau et al. (12) suggest that the cluster can be divided into three differentially active subdomains: the embryonic and
fetal 
subdomain, the fetal and adult 
subdomain, and an
LCR subdomain active at all developmental stages. The production of
intergenic transcripts in each case coincided with enhanced DNase I
sensitivity and in the case of the 
and 
subdomains coincided with the activities of the genes themselves. Although the
causal link between transcription and open chromatin suggested by these
observations is attractive, our data are somewhat contradictory. We see
equivalent levels of intergenic transcription in all three subdomains
in adult (line 72 spleen) and embryonic (K562) cells and also during
any of the induction methods that we have described. The discrepancy
between our data and those of Gribnau et al. is likely to reflect the
different sensitivities of the two techniques used, with NRO using
several different probes providing a more quantitative measure of
nascent transcription than does FISH.
Ultimate proof of a role for intergenic and LCR transcription in
maintaining an open chromatin structure and through this mechanism
affecting
-globin gene expression must come from disrupting these
transcripts in a whole-locus setting (either in transgenic mice or by
targeted disruption of the endogenous locus in cell lines). While those
experiments are currently in progress, the data presented here and
recent work by others lead us to predict that nongenic transcription
will have an important role in these processes. Furthermore, the
demonstration that the intergenic regions of other gene clusters (e.g.,
IL-4/IL-13 [23]) are transcribed leads us to anticipate
that intergenic transcription will be a feature of at least some
mammalian gene loci.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by Wellcome Project grant 051855 and a Wellcome Prize Studentship (052044) to S.J.E.R.
We gratefully acknowledge Joan Monks for technical assistance. Stuart
Orkin and Shona Murphy generously provided TF clones. Thanks to Frances
Mortimer for work on the A
region, to Simon
Brackenridge, Mick Dye, and Allie Binnie for helpful discussions, and
to Bill Wood for help with the transgenic mice.
K.E.P. and S.J.E.R. contributed equally to this work.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Sir William Dunn School of Pathology, University of Oxford, Oxford OX1 3RE, United Kingdom. Phone: 44-(0)1865 275566. Fax: 44-(0)1865 275556. E-mail: nicholas.proudfoot{at}path.ox.ac.uk.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Adams, S. E.,
I. D. Johnson,
M. Braddock,
A. J. Kingsman,
S. M. Kingsman, and R. M. Edwards.
1988.
Synthesis of a gene for the HIV transactivator protein Tat by a novel single stranded approach involving invivo gap repair.
Nucleic Acids Res.
16:4287-4298 |
| 2. |
Alami, R.,
J. M. Greally,
K. Tanimoto,
S. Hwang,
Y. Q. Feng,
J. D. Engel,
S. Fiering, and E. E. Bouhassira.
2000.
Beta-globin YAC transgenes exhibit uniform expression levels but position effect variegation in mice.
Hum. Mol. Genet.
9:631-636 |
| 3. |
Ashe, H. L.,
J. Monks,
M. Wijgerde,
P. Fraser, and N. J. Proudfoot.
1997.
Intergenic transcription and transinduction of the human beta-globin locus.
Genes Dev.
11:2494-2509 |
| 4. | Bohl, D., S. Kong, C. Li, A. Wickrema, S. Krantz, and D. Tuan. 1995. The locus control region far upstream of the human P-like globin genes is transcribed in erythroid cells in a direction toward the globin genes. Blood 86:2501. |
| 5. |
Bulger, M.,
J. H. vonDoorninck,
N. Saitoh,
A. Telling,
C. Farrell,
M. A. Bender,
G. Felsenfeld,
R. Axel, and M. Groudine.
1999.
Conservation of sequence and structure flanking the mouse and human beta-globin loci: the beta-globin genes are embedded within an array of odorant receptor genes.
Proc. Natl. Acad. Sci. USA
96:5129-5134 |
| 6. |
Chen, W. Y., and T. M. Townes.
1999.
Molecular mechanism for silencing virally transduced genes involves histone deacetylation and chromatin condensation.
Proc. Natl. Acad. Sci. USA
97:377-382 |
| 7. |
Cho, H.,
G. Orphanides,
X. Sun,
X. J. Yang,
V. Ogryzko,
E. Lees,
Y. Nakatani, and D. Reinberg.
1998.
A human RNA polymerase II complex containing factors that modify chromatin structure.
Mol. Cell. Biol.
18:5355-5363 |
| 8. | Dye, M. J., and N. J. Proudfoot. 2001. Multiple transcript cleavage precedes polymerase release in termination by RNA polymerase II. Cell 105:669-681[CrossRef][Medline]. |
| 9. | Eggermont, J., and N. J. Proudfoot. 1993. Poly(A) signals and transcriptional pause sites combine to prevent interference between RNA polymerase-II promoters. EMBO J. 12:2539-2548[Medline]. |
| 10. | Epner, E., A. Reik, D. Cimbora, A. Telling, M. A. Bender, S. Fiering, T. Enver, D. I. K. Martin, M. Kennedy, G. Keller, and M. Groudine. 1998. The beta-globin LCR is not necessary for an open chromatin structure or developmentally regulated transcription of the native mouse beta-globin locus. Mol. Cell 2:447-455[CrossRef][Medline]. |
| 11. |
Forrester, W. C.,
E. Epner,
M. C. Driscoll,
T. Enver,
M. Brice,
T. Papayannopoulou, and M. Groudine.
1990.
A deletion of the human beta-globin locus activation region causes a major alteration in chromatin structure and replication across the entire beta-globin locus.
Genes Dev.
4:1637-1649 |
| 12. | Gribnau, J., K. Diderich, S. Pruzina, R. Calzolari, and P. Fraser. 2000. Intergenic transcription and developmental remodeling of chromatin subdomains in the human beta globin locus. Mol. Cell 5:377-386[CrossRef][Medline]. |
| 13. | Grosveld, F., G. B. Vanassendelft, D. R. Greaves, and G. Kollias. 1987. Position-independent, high-level expression of the human beta-globin gene in transgenic mice. Cell 51:975-985[CrossRef][Medline]. |
| 14. | Kotkow, K. J., and S. H. Orkin. 1995. Dependence of globin gene-expression in mouse erythroleukemia-cells on the NF-E2 heterodimer. Mol. Cell. Biol. 15:4640-4647[Abstract]. |
| 15. |
La Mantia, G.,
D. Maglione,
G. Pengue,
A. Dicristofano,
A. Simeone,
L. Lanfrancone, and L. Lania.
1991.
Identification and characterization of novel human endogenous retroviral sequences preferentially expressed in undifferentiated embryonal carcinoma-cells.
Nucleic Acids Res.
19:1513-1520 |
| 16. |
La Mantia, G.,
B. Majello,
A. DiCristofano,
M. Strazzullo,
G. Minchiotti, and L. Lania.
1992.
Identification of regulatory elements within the minimal promoter region of the human endogenous ERV9 proviruses: accurate transcription is controlled by an Inr-like element.
Nucleic Acids Res.
20:4129-4136 |
| 17. |
Leach, K. M.,
K. Nightingale,
K. Igrashi,
P. P. Levings,
J. D. Engel,
P. B. Becker, and J. Bungert.
2001.
Reconstitution of human beta-globin locus control region hypersensitive sites in the absence of chromatin assembly.
Mol. Cell. Biol.
21:2629-2640 |
| 18. | Long, Q. M., C. Bengra, C. H. Li, F. Kutlar, and D. Tuan. 1998. A long terminal repeat of the human endogenous retrovirus ERV-9 is located in the 5' boundary area of the human beta-globin locus control region. Genomics 54:542-555[CrossRef][Medline]. |
| 19. |
Matz, M.,
D. Shagin,
E. Bogdanova,
O. Britanova,
S. Lukyanov,
L. Diatchenko, and A. Chenchik.
1999.
Amplification of cDNA ends based on template-switching effect and step-out PCR.
Nucleic Acids Res.
27:1558-1560 |
| 20. |
Murphy, S.
1997.
Differential in vivo activation of the class II and class III snRNA genes by the POU-specific domain of Oct-1.
Nucleic Acids Res.
25:2068-2076 |
| 21. |
Orkin, S. H.
1995.
Transcription factors and hematopoietic development.
J. Biol. Chem.
270:4955-4958 |
| 22. |
Reik, A.,
A. Telling,
G. Zitnik,
D. Cimbora,
E. Epner, and M. Groudine.
1998.
The locus control region is necessary for gene expression in the human beta-globin locus but not the maintenance of an open chromatin structure in erythroid cells.
Mol. Cell. Biol.
18:5992-6000 |
| 23. | Rogan, D. F., D. J. Cousins, and D. Z. Staynov. 1999. Intergenic transcription occurs throughout the human IL-4/IL-13 gene cluster. Biochem. Biophys. Res. Commun. 255:556-561[CrossRef][Medline]. |
| 24. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Press, Cold Spring Harbor, N.Y. |
| 25. | Strahl, B. D., and C. D. Allis. 2000. The language of covalent histone modifications. Nature 403:41-45[CrossRef][Medline]. |
| 26. |
Strouboulis, J.,
N. Dillon, and F. Grosveld.
1992.
Developmental regulation of a complete 70-Kb human beta-globin locus in transgenic mice.
Genes Dev.
6:1857-1864 |
| 27. | Talbot, D., and F. Grosveld. 1991. The 5'HS2 of the globin locus-control region enhances transcription through the interaction of a multimeric complex binding at 2 functionally distinct NF-E2 binding-sites. EMBO J. 10:1391-1398[Medline]. |
| 28. | Tanimoto, K., Q. H. Liu, J. Bungert, and J. D. Engel. 1999. Effects of altered gene order or orientation of the locus control region on human beta-globin gene expression in mice. Nature 398:344-348[CrossRef][Medline]. |
| 29. | Tsai, S. F., D. I. K. Martin, L. I. Zon, A. D. Dandrea, G. G. Wong, and S. H. Orkin. 1989. Cloning of cDNA for the major DNA-binding protein of the erythroid lineage through expression in mammalian-cells. Nature 339:446-451[CrossRef][Medline]. |
| 30. | Tsang, A. P., J. E. Visvader, C. A. Turner, Y. Fujiwara, C. N. Yu, M. J. Weiss, M. Crossley, and S. H. Orkin. 1997. FOG, a multitype zinc finger protein, acts as a cofactor for transcription factor GATA-1 in erythroid and megakaryocytic differentiation. Cell 90:109-119[CrossRef][Medline]. |
| 31. |
Tuan, D.,
S. M. Kong, and K. Hu.
1992.
Transcription of the hypersensitive site HS2 enhancer in erythroid cells.
Proc. Natl. Acad. Sci. USA
89:11219-11223 |
| 32. | Williams, J. G., and P. J. Mason. 1985. Hybridisation in the analysis of RNA, p. 139-160. In B. D. Hames, and S. J. Higgins (ed.), Nucleic acid hybridisation: a practical approach. Academic Press, Inc., New York, N.Y. |
| 33. | Wilson, C. J., D. M. Chao, A. N. Imbalzano, G. R. Schnitzler, R. E. Kingston, and R. A. Young. 1996. RNA polymerase II holoenzyme contains SWI/SNF regulators involved in chromatin remodeling. Cell 84:235-244[CrossRef][Medline]. |
| 34. | Wittschieben, B. O., G. Otero, T. deBizemont, J. Fellows, H. ErdjumentBromage, R. Ohba, Y. Li, C. D. Allis, P. Tempst, and J. Q. Svejstrup. 1999. A novel histone acetyltransferase is an integral subunit of elongating RNA polymerase II holoenzyme. Mol. Cell 4:123-128[CrossRef][Medline]. |
| 35. |
Yoshida, M.,
M. Kijima,
M. Akita, and T. Beppu.
1990.
Potent and specific inhibition of mammalian histone deacetylase both in vivo and in vitro by trichostatin A.
J. Biol. Chem.
265:17174-17179 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»