This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Williams, C. J.
Right arrow Articles by Guidos, C. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Williams, C. J.
Right arrow Articles by Guidos, C. J.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, January 2001, p. 400-413, Vol. 21, No. 2
0270-7306/01/$04.00+0   DOI: 10.1128/MCB.21.2.400-413.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

Irradiation Promotes V(D)J Joining and RAG-Dependent Neoplastic Transformation in SCID T-Cell Precursors

Christine J. Williams,dagger Ildiko Grandal, Danny J. Vesprini, Urszula Wojtyra, Jayne S. Danska, and Cynthia J. Guidos*

Hospital for Sick Children Research Institute and Department of Immunology, University of Toronto, Toronto, Ontario, Canada

Received 31 July 2000/Returned for modification 8 September 2000/Accepted 17 October 2000


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Defects in the nonhomologous end-joining (NHEJ) pathway of double-stranded DNA break repair severely impair V(D)J joining and selectively predispose mice to the development of lymphoid neoplasia. This connection was first noted in mice with the severe combined immune deficient (SCID) mutation in the DNA-dependent protein kinase (DNA-PK). SCID mice spontaneously develop thymic lymphoma with low incidence and long latency. However, we and others showed that low-dose irradiation of SCID mice dramatically increases the frequency and decreases the latency of thymic lymphomagenesis, but irradiation does not promote the development of other tumors. We have used this model to explore the mechanistic basis by which defects in NHEJ confer selective and profound susceptibility to lymphoid oncogenesis. Here, we show that radiation quantitatively and qualitatively improves V(D)J joining in SCID cells, in the absence of T-cell receptor-mediated cellular selection. Furthermore, we show that the lymphocyte-specific endonuclease encoded by the recombinase-activating genes (RAG-1 and RAG-2) is required for radiation-induced thymic lymphomagenesis in SCID mice. Collectively, these data suggest that irradiation induces a DNA-PK-independent NHEJ pathway that facilitates V(D)J joining, but also promotes oncogenic misjoining of RAG-1/2-induced breaks in SCID T-cell precursors.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Lymphocytes require the faithful execution of DNA repair processes to generate a highly diverse repertoire of antigen receptors. The variable region exon of each T-cell receptor (TCR) and B-cell antigen receptor (BCR) gene is assembled by site-specific cleavage and rejoining of variable (V), diversity (D), and joining (J) gene segments in developing T and B lymphocytes. Tandem genomic arrays of dozens to hundreds of V, D, or J gene segments allow combinatorial diversification of the available germline repertoire during lymphocyte development to create a large number of clonally distinct VDJ or VJ genes. In addition, terminal deoxynucleotidal transferase (TdT), a lymphocyte-specific polymerase, inserts non-germline-encoded nucleotides at V(D)J junctions, providing additional somatic diversification of the available germline repertoire (30, 44, 67). Thus, V(D)J recombination endows T and B lymphocytes with the capacity to specifically recognize and destroy an almost infinite array of pathogens. However, DNA breaks are highly recombinogenic and must be repaired efficiently to maintain genomic stability and minimize the risk of oncogenic transformation (31, 33, 43, 49, 90, 104). A high frequency of lymphoid tumors have chromosomal translocations involving antigen receptor genes (reviewed in reference 101), raising the question as to whether the V(D)J recombination process threatens genomic stability in lymphoid lineages.

The molecular mechanism of V(D)J cleavage has recently been elucidated by elegant biochemical studies (reviewed in references 93 and 106). This process is mediated by the lymphoid-specific RAG-1 and RAG-2 proteins, which bind recombination signal sequences flanking V(D)J gene segments and nick one DNA strand precisely between the coding segment and the recombination signal. The nick is rapidly converted to a double-stranded DNA break (DSB), generating two types of intermediates: hairpin-terminated V, D, or J coding ends and blunt, 5' phosphorylated signal ends. The unusual hairpin structure of V(D)J coding ends is thought to reflect the evolutionary relationship of V(D)J recombination to DNA transposition (1, 56). Hairpin coding ends are short-lived intermediates that are not detectable in normal cells (102, 105), presumably because they are rapidly joined together. In contrast, signal ends are bound to RAG-1/2 proteins and persist (2, 55). In T-cell precursors, most signal ends are ligated together to form extrachomosomal circles that are lost during subsequent rounds of cell division (68, 81).

Repair of V(D)J breaks into signal joints and coding joints (CJ) occurs by nonhomologous end-joining (NHEJ), a major repair pathway in mammalian cells that can rejoin DSB originating from noncontiguous chromosomal segments (reviewed in reference 26). CJ formation is a specialized form of NHEJ requiring that the hairpin coding ends be opened prior to the end-joining reaction. The importance of NHEJ in lymphocyte-specific V(D)J recombination was first revealed by studies of SCID mice. These mice have a mutation in the NHEJ protein DNA-dependent protein kinase (DNA-PK) (6, 13, 28) that confers a global defect in DSB repair, causing hypersensitivity to ionizing radiation (9, 39, 53). The SCID mutation in DNA-PK also disrupts repair of RAG-1/2-induced DSB in lymphocyte precursors (105). This V(D)J joining defect severely impairs the generation of TCRbeta -containing pre-TCR and immunoglobulin µ chain (Igµ)-containing pre-BCR, causing arrested lymphocyte development. These receptors transmit signals that select progenitor T (pro-T) and pro-B cells for clonal expansion and maturation (61, 119). Similar defects in V(D)J joining and general DSB repair are caused by loss-of-function mutations in other NHEJ proteins, such as KU70, KU80, XRCC4, and DNA ligase IV (37, 47, 74, 91, 92, 121).

Mutations in DNA-PK qualitatively and quantitatively affect V(D)J joining. The efficiency of CJ formation is reduced from 10- to 1,000-fold relative to that of wild-type cells (34, 77, 98, 116), whereas signal joint formation occurs with relatively normal efficiency but reduced fidelity (14, 42, 70, 77, 114, 115). The defect in CJ formation is manifested by the abnormal accumulation of hairpin coding end intermediates in lymphocyte precursors (42, 105, 121, 122). However, in cells from SCID mice (11, 34, 62, 69, 98) or DNA-PK null mice (42, 70, 114, 120), low levels of CJ formation can take place. Analyses of these rare CJ suggests that DNA-PK also influences the way in which coding ends are processed prior to joining. For example, SCID CJ typically display more extensive deletion of nucleotides from the 5' and 3' coding ends than their wild-type counterparts (35, 86, 108). In addition, SCID CJ frequently have long, palindromic (P) nucleotide additions (35, 63, 107) which are generated by asymmetric cleavage of the hairpin coding ends. In contrast, P additions are infrequently found in wild-type CJ, and they are rarely longer than three nucleotides. Finally, TdT-mediated addition of N-regions to TCR coding junctions appears normal in SCID thymocytes (35, 62). On the basis of these observations, it has been suggested that DNA-PK is required to recruit and/or activate factors that mediate hairpin cleavage (12, 122), a process which must precede the formation of CJ.

In addition to defective V(D)J joining and SCID, lymphocyte progenitors from mice harboring genetic defects in NHEJ proteins are also particularly susceptible to oncogenic transformation. This lymphoma-prone phenotype was first revealed by studies showing that in some mouse colonies, up to 15% of SCID mice spontaneously develop thymic lymphoma with long latency (16, 27). However, in our SCID colony, <5% of SCID mice developed lymphoma by 2 years of age. Strikingly, low-dose (100 to 175 cGy) irradiation of newborn SCID mice induces thymic lymphoma, but not other tumors, with very high frequency and short latency (29, 79, 88). Mice harboring other mutations in DNA-PK or in KU70 were subsequently shown to spontaneously develop thymic lymphoma, but other tumor types have not been reported (48, 59, 73).

The molecular basis by which defective NHEJ selectively promotes the development of lymphoid neoplasia remains unexplained. It has been suggested that the prevalence of chromosomal translocations involving antigen receptors in human lymphoid tumors results from the misjoining of RAG-1/2-induced breaks to chromosomal DSB in lymphocytes (reviewed in reference 101). While defects in NHEJ proteins may increase such misjoining events, the importance of RAG-1/2-induced breaks to lymphoid oncogenesis in NHEJ mutant mice has not been assessed. Moreover, it is not clear how potentially oncogenic misjoining of these breaks would occur in the context of the profound NHEJ defect conferred by mutations in DNA-PK or KU70/80.

We have used the irradiated SCID model of thymic lymphomagenesis to explore the mechanistic basis by which defects in NHEJ confer selective and profound susceptibility to lymphoid neoplasia. First, using extrachromosomal V(D)J recombination substrates and a transient-transfection approach, we show that V(D)J CJ formation is quantitatively and qualitatively improved by low-dose irradiation of SCID thymic lymphoma cell lines. Second, we use two different genetic strategies to show that V(D)J recombinase activity is required for radiation-induced lymphomagenesis in SCID mice, demonstrating that RAG-1/2-induced breaks are potentially oncogenic in the context of defective NHEJ.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Cell lines and recombination assays. The VL3-3M2, LK6.2, and LK8 cell lines have been described previously (28, 46). Cell lines (3 × 106 cells) were transiently transfected with 150 ng of pDR42kappa /lambda (deletional coding joints) (46) or pWTSJDelta (deletional signal joints) (72) using DEAE-dextran and osmotic shock as previously described (78). Two days later, plasmid DNA was harvested, digested with DpnI, and electroporated into Escherichia coli as previously described (46). Because the SCID thymic lymphoma cells displayed poor survival after the transfection procedure, they were stably infected with a Bcl-2-containing retrovirus (118). The SJ1 primer (5'-CTG GTC CGG TAA CGT GCT GAG-3') was used to sequence the coding junctions of recombinant pDR42 clones by using an ABI 373 or ABI 377 automated sequencer. The origins and order (5' to 3') of recombination signal sequences on pDR42 are as follows: Jkappa RSS(23), Jlambda RSS(12), Vkappa RSS(12), and Vlambda RSS(23). All pDR42 recombinants shown had undergone recombination between Jkappa RSS(23) and Vkappa RSS(12).

Mice. All mice were bred and housed in specific-pathogen-free conditions at the Hospital for Sick Children animal facility. RAG-2-/- C57BL/6 mice were obtained from GenPharm (Mountain View, Calif.) and were crossed with C.B-17 SCID (Prkdcscid/scid) mice in our animal facility to generate RAG-2+/- Prkdcscid/+ F1 mice. F1 progeny were then backcrossed with C.B-17 SCID mice to generate Prkdcscid/scid or Prkdcscid/+ mice, all of which have at least one copy of the wild-type RAG-2 allele. To identify Prkdcscid/scid progeny, peripheral blood was analyzed by flow cytometry for the absence of mature T or B cells with anti-TCRbeta (FITC-H57-597) and anti-IgM (biotinylated R6-60.2) antibody. Alternatively, PCR amplification of tail DNA was used to identify the wild-type and scid alleles of DNA-PK as previously described (13). RAG-2 genotypes were determined by PCR amplification of tail DNA by using the following primers: RAG2-3 (anti-sense), GCCTGCTTATTGTCTCCTGGTATG; NEO-3' (anti-sense), CCAACGCTATGTCCTGATAGCGGT; and RAG2-1 (sense), TTAATTCAACCAGGCTTCTCACTT. PCR amplification with the RAG2-1 and RAG2-3 primers detects the wild-type allele (973-bp amplicon), whereas amplification with the RAG2-3 and NEO-3' primers detects the mutant allele (1,107-bp amplicon). RAG-2+/- Prkdcscid/scid animals were intercrossed to generate RAG-2-/- Prkdcscid/scid progeny (referred to as RAG-2-/- SCID).

To generate TCRbeta transgenic Prkdcscid/scid (TCRbeta -SCID) mice, Prkdcscid/+ mice expressing a Vbeta 8.2 TCRbeta transgene were obtained from E. W. Shores and A. Singer (111) and backcrossed with C.B-17 SCID mice. Prkdcscid/scid progeny were identified as described above. TCRbeta transgenic animals were identified by PCR amplification of tail DNA by using a Vbeta 8 sense primer (TAAGCGGCCGCGAGGCTGCAGTCACCCAAA) and a Dbeta 2Jbeta 2.3 antisense primer (CAGCGTTTCTGCACTGTTATCACC). Prkdcscid/scid mice segregating the TCRbeta transgene were obtained from the progeny of TCRbeta +/- Prkdcscid/scid animals backcrossed with C.B-17 Prkdcscid/scid mice. The incidence of radiation-induced thymic lymphoma was evaluated after three and seven backcross generations, with similar results. Prkdcscid/scid mice were gamma -irradiated (100 cGy from a GammaCell 40 137Cs source, dose rate = 1.25 Gy/min) within 1 to 3 days of birth as previously described (29), and RAG-2-/- mice were irradiated as newborns (400 cGy) or as adults (750 cGy), as previously described (50).

Flow cytometry. Phenotypic analyses of thymocytes for surface expression of lineage and developmental markers were performed as previously described (29) using a FACScan flow cytometer with Lysis II software or a FACSCalibur flow cytometer with CellQuest software (Becton Dickinson & Co., Mountain View, Calif.). The following monoclonal antibodies were affinity purified from hybridoma culture supernatants by using protein A- or protein G-Sepharose (Pharmacia, Baie d'Urfe, Quebec, Canada): CD4 (YTS 191.1), CD8 (YTS 169.4), and TCRbeta (H57-597). Purified antibodies were conjugated to fluorescein isothiocyanate (FITC) or biotin using standard techniques. FITC-CD25 (7D4) and biotinylated mouse anti-IgM (R6-60.2) were purchased from Pharmingen (San Diego, Calif.). Streptavidin-phycoerythrin (Av-PE) was purchased from Caltag (South San Francisco, Calif.) and used as a second-stage reagent with biotinylated primary antibodies. Propidium iodide staining and flow cytometric evaluation of cell cycle analysis was performed as previously described (49).

RT-PCR. Reverse transcriptase (RT)-coupled PCR amplifications were performed as previously described (29). Briefly, total RNA was isolated from the thymuses of individual animals, and 2 µg of RNA was reverse transcribed into cDNA at 42°C in a reaction mixture containing 50 mM Tris (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol, 0.1 mg of bovine serum albumin/ml, 0.5 mM concentrations of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP; Promega, Madison, Wis.), 2.5 µg of oligo(dT) primer/ml, 25 U of ribonuclease inhibitor (Promega), and 2.5 U of RT (AMV-RT; Promega). cDNA was amplified (31 cycles, 55°C annealing) with a panel of eight TCR Vbeta -specific primers (Vbeta 1, Vbeta 3, Vbeta 5, Vbeta 7, Vbeta 9, Vbeta 11, Vbeta 14, and Vbeta 17) coupled with a TCR Cbeta 1/2 antisense primer in separate reactions (36). PCR products were resolved by agarose gel electrophoresis, Southern blotted, and hybridized to a radiolabeled [alpha -32P]dCTP-labeled TCR-Cbeta probe. Autoradiography was performed using a PhosphorImager with ImageQuant software (Molecular Dynamics, Sunnyvale, Calif.).

Detection of TCRdelta coding ends. High-molecular-weight DNA was prepared from homogenized kidney or single-cell thymocyte suspensions and was digested with restriction endonucleases, electrophoresed through 0.8% agarose, and transferred to a Gene Screen Plus nylon membrane (NEN DuPont, Boston, Mass.). Hybridization was carried out using random hexamer-primed [alpha -32P]dCTP-labeled Jdelta 1 probe no. 4 (82). Autoradiography was performed using a PhosphorImager with ImageQuant 3.0 software (Molecular Dynamics).


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Irradiation improves V(D)J CJ formation in SCID cells. Previously, we have shown that low-dose irradiation of SCID mice partially relieves the developmental arrest of CD4-CD8 double-negative (DN) pro-T cells and promotes their expansion and maturation to the CD4-CD8 double-positive (DP) pre-T-cell stage (29). Low-dose irradiation also promotes the appearance of thymocytes with functional rearrangements at the TCRbeta , TCRgamma , and TCRdelta loci (15, 29, 82). Analyses of these CJ sequences showed that they resembled those from normal thymocytes in several respects, suggesting that NHEJ activity is qualitatively or quantitatively enhanced during the cellular response to DNA damage. However, normal CJ can be made at very low frequencies in SCID cells (19, 21, 34, 54, 69, 98). Furthermore, there is strong selection in vivo for precursors that have made functional TCRbeta , TCRgamma , and TCRdelta rearrangements (60, 83, 85, 95). Thus, it is equally plausible that irradiation selects for rare SCID pro-T cells that have managed to repair their V(D)J breaks using the inefficient NHEJ machinery.

To distinguish between these two possibilities, we examined the effect of irradiation on CJ formation in wild-type versus SCID cell lines that were transiently transfected with an extrachromosomal recombination substrate plasmid, pDR42. In RAG-1/2-expressing cells, this plasmid undergoes deletional CJ formation (103). This cell culture strategy, which has been widely used to examine the efficiency and fidelity of CJ formation in SCID versus wild-type cells (reviewed in reference 71), allowed us to directly measure the effect of irradiation on CJ formation in the absence of TCR-mediated cellular selection events that occur in vivo. For these experiments we have used thymic lymphoma cell lines derived from wild-type or SCID mice because they have a pre-T-cell phenotype, exemplified by expression of CD4 and CD8, as well as RAG-1, RAG-2, and TdT (data not shown and reference 46). These cell lines express wild-type (VL3-3M2) or SCID mutant (LK6.2, LK3C, and LK8) DNA-PK (28).

To determine if irradiation increases the efficiency of CJ formation, cells were treated with 0 or 100 cGy of ionizing irradiation at different times before or after transfection with pDR42. Three to six independent experiments were performed with each cell line, and data from three representative experiments are shown in Table 1. As expected, CJ formation in the untreated SCID thymic lymphoma cell lines is <10% of that seen in VL3-3M2 in a given experiment. Since RAG-1/2 protein levels are similar among these cell lines (data not shown), the defect in CJ formation in LK6.2, LK3C, and LK8 is attributable to the SCID mutation in DNA-PK. Although irradiation had no reproducible effects on the efficiency of CJ formation in VL3-3M2, it improved the efficiency of CJ formation in the SCID cell lines by up to 17-fold, but more typically by three- to fourfold (Table 1). To determine if irradiation could also improve the repair of non-hairpin blunt DSB, we transfected cells with pWTSJDelta , a plasmid that undergoes deletional signal joint formation. As documented for other SCID cell lines (14, 77, 99, 116), LK6.2 and LK3C exhibit a normal frequency of signal joint formation but reduced fidelity, since <50% of the signal joints are precise (Table 2). The low precision of signal joint formation in SCID cells reflects deletion or N additions at the signal ends prior to joining (77). In contrast to CJ formation, irradiation did not increase the frequency or the fidelity of signal joint formation in LK6.2 or LK3C cells (Table 2), suggesting that irradiation specifically improves repair of DSB with hairpin ends.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Effect of irradiation on CJ formation in wild-type and SCID thymic lymphoma cellsa


                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Effect of irradiation on signal joint formation in wild-type and SCID thymic lymphomasa

Having observed that irradiation improved the efficiency of CJ formation in SCID cells, we sequenced the coding junctions of multiple recombinant pDR42 clones to determine if this improvement was also evident at the level of coding end processing. Coding junction sequences from independent recombinants are shown in Fig. 1 and 2, and the distribution of nucleotide deletions and P nucleotide additions is summarized in Tables 3 and 4. The coding junctions of recombinants derived from wild-type and SCID cells that were not irradiated showed the expected characteristics. For example, no coding ends from wild-type recombinants had deletions of >= 10 nucleotides, whereas 20 to 23% of those from LK6.2 and LK8 recombinants had large deletions (Table 3 and data not shown). The average length of coding end deletions was also considerably greater in the SCID cell lines (Table 3). The intact coding ends from the SCID recombinants also displayed substantially more P additions than those from VL3-3M2 recombinants (Table 4). Most notable was the high frequency (29 to 47%) of long (>3) P additions in LK6.2 and LK8 recombinants (Table 4 and data not shown). Finally, the length of P additions was significantly greater in the SCID recombinants. TdT-mediated addition of N nucleotides was similar in all cell lines (Fig. 1 and 2). These data confirm that V(D)J joining in LK6.2 and LK8 cells displays anomalies typical of SCID cells, consistent with the DNA-PK mutation in these cell lines (28).


View larger version (30K):
[in this window]
[in a new window]
 
FIG. 1.   Effect of irradiation on coding end processing in wild-type thymic lymphoma cells. VL3-3M2 cells were transfected with pDR42, at various times before (B) or after (C) treatment with 0 (A) or 100 cGy of gamma -irradiation, as indicated. After 48 h of culture, plasmid DNA was recovered and used to transform E. coli. pDR42 recombinant plasmids were purified from chloramphenicol-resistant colonies, and the coding junctions were sequenced. Shown are the 5' P (single underline), N, and 3' P (double underline) additions (P/N/P) at the CJ for each recombinant pDR42 clone. The number of nucleotides deleted from the 5' (Delta 5') and 3' (Delta 3') coding flanks are also indicated. P nucleotides were identified based on palindromy with the 3' end of the 5' coding flank (5'-ACAGGAAACAGGATC-3') or the 5' end of the 3' coding flank (5'-GATGATATCGTCGAC-3') sequences. For junctions where nucleotides could be assigned either to the coding flank or as P additions, the assignment was made to minimize the degree of P additions. The data represent independent clones derived from two independent transfections. The frequencies of independent recombinants sequenced were 93% (A), 100% (B), and 100% (C).


View larger version (36K):
[in this window]
[in a new window]
 
FIG. 2.   Effect of irradiation on coding end processing in SCID thymic lymphoma cells. LK6.2 cells were transfected with pDR42 3 h (B) or 0.5 h (C) before treatment with 0 (A) or 100 cGy of gamma -irradiation, as indicated. Recombinant pDR42 clones were isolated and sequenced as described for Fig. 1. The frequency of independent recombinants sequenced was 64% (A), 83% (B), and 65% (C). B, before treatment.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 3.   Effect of irradiation on coding end deletions in wild-type and SCID cellsa


                              
View this table:
[in this window]
[in a new window]
 
TABLE 4.   Effect of irradiation on P additions in wild-type and SCID cellsa

Irradiation did not significantly affect nucleotide deletion or P nucleotide addition at coding ends in VL3-3M2 cells (Tables 3 and 4). In marked contrast, irradiation had striking effects on the processing of coding ends in LK6.2 cells. Most notably, irradiation increased the frequency of intact coding ends lacking P additions from 18 to 43%, and it decreased the frequency of coding ends with long P nucleotides from 47 to 14% (Table 4). The average length of P additions in LK6.2 was also significantly decreased after irradiation. In contrast to the striking effect of irradiation on P additions, it did not ameliorate the extensive deletion from coding ends in SCID cells (Table 3). Collectively, these data suggest that low-dose irradiation selectively improves repair of CJ in SCID cells by facilitating the opening of hairpin coding ends.

RAG-2 deficiency protects SCID mice from radiation-induced thymic lymphoma. The above data demonstrate that irradiation partially restores V(D)J joining in SCID T-cell precursors, likely explaining why irradiation of neonatal SCID mice promotes some degree of normal T-cell development (29). However, most irradiated newborn SCID mice subsequently succumb to thymic lymphoma, suggesting that irradiation also promotes the development of neoplastic T-cell precursors. Given that the SCID mutation in DNA-PK impairs NHEJ, the role of irradiation in inducing lymphomagenesis in SCID mice could be to generate large numbers of DSB, some of which are mis-repaired to generate oncogenic chromosomal aberrations in T-cell precursors. However, we sought to determine whether there could be a mechanistic connection between radiation-induced CJ formation and tumorigenesis in T-cell precursors. To test the hypothesis that irradiation could induce oncogenic misjoining of RAG-1/2-mediated breaks that contribute to radiation-induced lymphomagenesis in SCID mice, we bred RAG-2-deficient SCID mice. Both the SCID and RAG-2 mutations block T-lymphocyte development at the DN pro-T-cell stage, due to failure to generate TCRbeta -containing pre-TCR complexes (87, 109). RAG-2 SCID double-mutant mice maintain the global SCID NHEJ defect but fail to create DSB adjacent to recombination signal sequences in lymphocyte progenitors. Thus, this strategy allowed us to determine whether RAG-induced breaks are essential for radiation-induced lymphomagenesis in SCID mice.

Mice were irradiated within 48 h of birth (100 cGy) and evaluated for the development of lymphoid tumors. Consistent with our previous studies (29), 73% of irradiated SCID mice (RAG-2+/+ or RAG-2+/-) developed thymic lymphoma between 13 and 18 weeks, as evidenced by invasive thymic masses that compromised respiration (Fig. 3). In some cases, dissemination of tumor to peripheral lymphoid organs was evident (data not shown). Ten tumors were assessed by flow cytometry: all had a DP pre-T-cell phenotype, and 4 out of 10 were TCRbeta and CD3 positive. That the tumor cells had a more mature phenotype than thymocytes from untreated SCID mice is consistent with our previous studies showing that low-dose irradiation promotes the development of TCRbeta + DP thymocytes from DN progenitors in SCID mice (29). Strikingly, all irradiated RAG-2-/- SCID and irradiated RAG-2-/- mice were healthy and showed no evidence of thymic lymphoma at the time of sacrifice at 16 to 20 weeks postirradiation (Fig. 3). These data demonstrate a mechanistic dependence on RAG function for the radiation-induced development of thymic lymphoma in SCID mice.


View larger version (26K):
[in this window]
[in a new window]
 
FIG. 3.   Effect of RAG-2 function on thymic lymphomagenesis in irradiated SCID mice. SCID (RAG-2+/+ or RAG-2+/-) and RAG-2-/- SCID mice were irradiated (100 cGy) within 48 h of birth. RAG-2-/- mice were irradiated as newborns (400 cGy) or adults (750 cGy) as previously described (50). Depicted is the percentage of tumor-free mice of each genotype up to 20 weeks postirradiation. Mice showing no signs of morbidity were sacrificed at 16 weeks (newborn RAG-2-/-), 18 weeks (SCID and RAG-2-/- SCID), or 20 weeks (adult RAG-2-/-) and showed no evidence of lymphoma by gross pathology. N, number of mice analyzed in each group.

TCRbeta -transgenic SCID mice are protected from radiation-induced thymic lymphoma. V(D)J recombination occurs at multiple different stages of T-cell development, but targeted disruption of the RAG-1 or RAG-2 genes universally ablates V(D)J recombinase activity. We sought to determine if SCID mice could be protected from radiation-induced thymic lymphoma by ablating V(D)J recombinase activity only at a particular developmental stage. The TCRbeta , -delta , and -gamma loci are all accessible to the V(D)J recombinase machinery in immature DN thymocytes, but recent data suggest that these loci rearrange at different developmental stages. In normal thymocytes, Vgamma -to-Jgamma rearrangements, Vdelta -to-DJdelta rearrangements, and Dbeta -to-Jbeta rearrangements are all evident at the CD44+CD25+ DN stage, whereas Vbeta to DJbeta rearrangements predominantly occur at the later CD44-CD25+ DN stage (18, 45). In contrast to successful rearrangements of TCRdelta or TCRgamma , in-frame Vbeta -DJbeta rearrangements promote a large burst of proliferation (57, 95). Expression of a functionally rearranged TCRbeta transgene allows the formation of a pre-TCR complex which specifically prevents the V-DJ step of endogenous TCRbeta rearrangement (4, 117). Therefore, we bred TCRbeta -transgenic SCID (TCRbeta -SCID) mice to determine whether inhibiting V(D)J recombinase activity specifically at the highly proliferative CD44-CD25+ DN stage was sufficient to protect against radiation-induced thymic lymphoma in SCID mice.

Transcripts of endogenous VDJbeta rearrangements involving 8 Vbeta and all 12 possible Jbeta gene segments were not detectable in TCRbeta -SCID thymocytes (untreated or irradiated) by RT-PCR (Fig. 4). These data agree with previous studies showing that transgenic expression of TCRbeta prevents Vbeta to DJbeta rearrangements in thymocytes (3, 4). This effect was specific for the TCRbeta locus, since Southern blot analysis showed that TCRbeta coding end breaks were present in TCRbeta -SCID thymocytes (Fig. 5). Partial (D-Jdelta or D-DJdelta ) rearrangements, which have been well-described for SCID thymocytes (20, 105), were also abundant in TCRbeta -SCID thymocytes (Fig. 5). As expected from previous studies (66, 111), we observed that the TCRdelta transgene bypasses the SCID defect in pre-TCR generation and promotes the development of DP thymocytes (Fig. 6). However, the number of CD25+ DN thymocytes, presumably the initial targets of the radiation-induced neoplastic process, was similar in newborn SCID and TCRbeta -SCID mice (Fig. 6). In wild-type mice, the DN-DP transition is accompanied by the onset of recombination at the TCRalpha locus, and we previously showed that TCRalpha coding end breaks are readily detectable in TCRbeta -SCID thymocytes (82). Finally, TCRbeta -SCID mice had similar frequencies of proliferating thymocytes as their transgene-negative littermates, and this frequency was not affected by irradiation (Table 5). Collectively, these observations confirm that the TCRbeta transgene selectively prevents Vbeta to DJbeta rearrangements in CD44-CD25+ DN thymocytes, but does not decrease proliferation or prevent the generation of TCRdelta or of TCRalpha coding end breaks in SCID thymocytes at earlier or later stages of T-cell development, respectively.


View larger version (47K):
[in this window]
[in a new window]
 
FIG. 4.   Endogenous TCRbeta expression in TCRbeta -SCID mice. Thymus RNA from individual 2-week-old untreated or irradiated TCRbeta -SCID mice was reverse transcribed into cDNA. RT-PCR was performed using eight different Vbeta -specific sense primers coupled with a TCR-Cbeta anti-sense primer. The products were Southern blotted and hybridized with a TCR-Cbeta probe. Note that, as expected, Vbeta 8 transcripts were detectable in all thymus samples from SCID mice expressing the Vbeta 8.2 transgene. Thymocyte RNA obtained from 4- to 6-week-old nontransgenic SCID and BALB/c mice were included as negative and positive controls, respectively, for the presence of TCRbeta transcripts.


View larger version (42K):
[in this window]
[in a new window]
 
FIG. 5.   Southern blot detection of TCRdelta coding end breaks and rearrangements in TCRbeta -SCID thymocytes. (A) Genomic DNA was extracted from thymocyte cell suspensions prepared from 4 individual 6-week-old TCRbeta -SCID mice and a nontransgenic littermate, as well as from the thymus and kidney of a 4-week-old wild-type C57BL/6 animal. The DNA was digested with EcoRI, electrophoresed, and Southern blotted. The membrane was hybridized with probe no. 4, which detects a single germline fragment between Jdelta 1 and Jdelta 2 and allows detection of rearrangement to Jdelta 1 (82). The positions of germline fragments, Ddelta 2 coding end breaks (CE), DJdelta or D-DJdelta partial rearrangements, and complete V-D-Jdelta rearrangements are indicated. Molecular size standards are included in the far right lane, with sizes in kilobases. (B) Partial TCRdelta locus map. The position of probe no. 4 within the TCRdelta locus is displayed (adapted from reference 82). EcoRI sites are indicated, as are the CE breaks and germline fragment detected in this assay.


View larger version (50K):
[in this window]
[in a new window]
 
FIG. 6.   Impact of TCRbeta transgene on T-cell development in SCID mice. Thymocytes from two 4-day-old TCRbeta -SCID mice and a nontransgenic littermate were evaluated for CD4 and CD8 expression by flow cytometry. One TCRbeta -SCID mouse treated with 100 cGy of gamma -irradiation 24 h prior to this analysis is also shown for comparison. The cellularity of each thymus is indicated. The absolute number of CD25+ DN cells in each sample did not vary by more than twofold.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 5.   Effect of TCRbeta transgene on proliferation of SCID thymocytesa

To measure the impact of the TCRbeta transgene on radiation-induced lymphomagenesis in SCID mice, newborn litters from SCID × TCRbeta -SCID matings were left untreated or were irradiated and examined 16 to 24 weeks later (Table 6). DP thymocytes are extremely radiosensitive in wild-type as well as in SCID mice (25, 84), and few remained 24 h after irradiation of TCRbeta -SCID mice (Fig. 6). Consistent with our previous findings (29), four out of six (60%) of irradiated nontransgenic SCID littermates were moribund 16 to 24 weeks after irradiation and, upon necropsy, were found to have large thymic masses composed primarily of DP lymphoblasts (Table 6). In marked contrast, all irradiated TCRbeta -SCID mice appeared healthy at 16 to 24 weeks. Given our relatively small sample size, it is possible that we could have missed low-frequency long-latency tumors in irradiated TCRbeta -SCID mice. However, we believe this is unlikely because the cellularity of their thymuses was no different than that of age-matched control (untreated) TCRbeta -SCID mice (Table 6). Thus, we could find no evidence of thymic hyperplasia that might be indicative of a preneoplastic thymus (Table 6). In addition, given that 70 to 90% of nontransgenic SCID mice develop thymic lymphoma by 24 weeks of age (Table 6 and reference 29), the complete absence of thymic hyperplasia and morbidity in irradiated TCRbeta -SCID mice at this time point is striking. These data suggest that preventing Vbeta to DJbeta rearrangement in SCID pro-T cells confers complete protection from radiation-induced lymphomagenesis in SCID mice.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 6.   Effect of TCRbeta transgene on irradiation-induced thymic lymphomagenesis in SCID micea


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

In this paper we demonstrate that low-dose irradiation quantitatively and qualitatively improves CJ formation in SCID cells, in the absence of TCR-mediated cellular selection. We also show that V(D)J recombinase activity is required for radiation-induced thymic lymphomagenesis in SCID mice. Together, these findings suggest that the radiation-induced NHEJ activity also results in the oncogenic misjoining of RAG-1/2-induced breaks in T-cell precursors. Below, we discuss the implications of these observations on mechanisms of V(D)J joining as well as mechanisms by which defective NHEJ promotes lymphoid neoplasia.

Irradiation transiently improves V(D)J joining in SCID lymphocyte progenitors. The SCID defect in CJ formation results in the accumulation of hairpin coding ends in lymphocyte precursors (105, 122). Thus, it has been suggested that DNA-PK is required to recruit and/or activate factors that mediate hairpin cleavage (12, 122), a process which must precede the formation of CJ. Although CJ can be formed inefficiently in SCID cells, they frequently have long P nucleotide additions (35, 63, 107), possibly reflecting a role for DNA-PK in directing the site of hairpin cleavage to within a few nucleotides of the tip. Data presented in Table 1 show that irradiation improves the efficiency of CJ formation in SCID cells. More strikingly, few of these junctions displayed long P nucleotide additions, which are hallmarks of inefficient CJ formation in untreated SCID cells (Table 4). Binnie et al. have recently reported that irradiation of different SCID thymic lymphoma cell lines had no effect on the efficiency of CJ formation (10). In addition, Binnie et al. showed that irradiation decreased the frequency of coding ends with P additions slightly (by 18%), but it had no effect on the length of P additions. These authors included caffeine (which has undefined effects on recombination) in some of their assays. Moreover, the cell lines they used did not display the excessive coding end deletion characteristic of SCID cells. Thus, differences in assay conditions or cell line characteristics may explain why we observed a more pronounced effect of irradiation on CJ formation in SCID cell lines.

Our observations suggest that irradiation has induced an activity that facilitates cleavage of hairpin coding ends, increasing the efficiency of CJ formation in SCID cells and decreasing the frequency of coding ends with long P additions from 47 to 14% (Table 4). Proteins shown to have hairpin endonuclease activity include RAG-1/2 (8, 110) and MRE11 (96, 97). However, the protein(s) responsible for hairpin opening in vivo has not been identified, so it is difficult to speculate on how irradiation might affect its expression and/or functions in cells harboring the SCID mutation in DNA-PK.

The rare coding junctions that form in SCID cells typically display excessive deletion (35, 86, 108), suggesting that the processing of opened hairpin ends is also regulated by DNA-PK. However, in contrast to hairpin cleavage, irradiation did not ameliorate the extensive deletion from coding ends in SCID cells (Table 3). Similarly, irradiation did not improve signal joint formation in SCID cells, and most signal joints remained imprecise (Table 2). Although we (29, 82) and others (120) did not report extensive deletions at TCR coding junctions in thymocytes from irradiated DNA-PK mutant mice, this likely reflected strong selection in vivo for precursors that could form pre-TCR. Thus, the absence of cellular pre-TCR-mediated cellular selection in the experiments we report here revealed a differential effect of irradiation on hairpin opening versus exonucleolytic processing of coding ends, suggesting that the two events are mediated by separate biochemical entities.

How does irradiation improve CJ formation in SCID cells? The hypothesis that irradiation increases the activity of mutant DNA-PK present in SCID cells seems unlikely for several reasons. First, SCID mutant DNA-PK is truncated (6, 13, 28), and protein levels are reduced 10- to 50-fold relative to those of wild-type cells (28). Second, irradiation promotes caspase-mediated cleavage and inactivation of DNA-PK kinase activity (22, 23, 52, 112, 113). Finally, cells from mice with null mutations in DNA-PK show virtually identical defects in NHEJ and V(D)J recombination to those seen in SCID cells, suggesting that the SCID mutation in DNA-PK is effectively null (42, 70, 114, 120). These studies suggest that a DNA-PK-independent NHEJ pathway can inefficiently effect CJ formation (120), and we favor the notion that irradiation improves the efficiency and fidelity of this pathway in SCID cells. Such a pathway may be analogous to DNA damage inducible DNA repair activities in bacteria (38) and yeast (32).

The role of V(D)J recombinase activity in radiation-induced lymphomagenesis in SCID mice. We have shown that V(D)J recombinase activity plays an essential role in radiation-induced lymphomagenesis in SCID mice. The role of V(D)J recombinase activity could simply be to promote precursor proliferation through the production of pre-TCR. Given the NHEJ defect conferred by the SCID mutation, the probability of a cell sustaining oncogenic mutations could be greatly enhanced by the repeated cell division that is induced by pre-TCR signals. However, introduction of a TCRbeta transgene promotes the development and proliferation of DP thymocytes in SCID mice (Fig. 6 and reference 66) but does not promote the development of thymic lymphoma (Table 5). These findings demonstrate that a proliferative stimulus, per se, is not sufficient to induce neoplastic transformation of SCID thymocytes.

A more likely mechanism to explain the essential function of V(D)J recombinase activity for thymic lymphomagenesis in irradiated SCID mice is that oncogenic mutations are generated by the radiation-induced misjoining of RAG-1/2-mediated breaks to random DSB. This notion is consistent with our demonstration that irradiation specifically improves the joining of RAG-1/2-mediated hairpin coding ends. V(D)J misjoining events are thought to give rise to the chromosomal translocations between antigen receptor genes and proto-oncogenes that are found in many lymphocytic leukemias and lymphomas (101). We used fluorescent in situ hybridization probes specific for chromosome 6 (TCRbeta ) or chromosome 14 (TCRalpha /delta ) to look for translocations in four thymic lymphomas from irradiated SCID mice, but none were found (D. Vesprini, C. J. Guidos, and J. S. Danska, unpublished data). However, this technique is not sufficiently sensitive to detect deletions, insertions, or small translocations.

V(D)J recombinase-dependent genetic alterations could also give rise to oncogenic mutations that do not involve antigen receptor genes. The recent demonstration that RAG-1/2 functions as a transposase provides one possible mechanism by which RAG-induced DSB could be generated outside antigen receptor loci (1, 56). Indeed, RAG-1/2-mediated cleavage of "cryptic" or nonconsensus recombination signal sequences has been shown to occur at non-Ig or non-TCR loci (72). Cryptic site recombination appears to underlie several different oncogenic deletions, not detected by standard karyotype analyses, found in patients with T-cell acute lymphoblastic leukemia (5, 17, 24). Moreover, recurring site-specific deletions between closely linked cryptic recombination signal sequences in the hypoxanthine-guanine phosphoribosyltransferase gene are frequently found in the peripheral T cells of healthy individuals (40, 41). It has been estimated that there are millions of potential cryptic sites in the human genome, and several of these were shown to function as joining signals in recombination substrate plasmids (72). Indeed, a recent study has shown that two DSB on different chromosomes are sufficient to promote frequent translocations (104). Thus, cryptic site recombination may be an important type of RAG-1/2-induced genetic alteration contributing to transformation of T-cell precursors in irradiated SCID mice.

We have previously shown that irradiation increases a different kind of misjoining event in SCID thymocytes, known as trans-rearrangement, by 50- to 100-fold (80). In trans-rearrangement, V(D)J coding ends originating from antigen receptor loci on different chromosomes are joined together. The ratio of cis-to-trans rearrangements is 500 to 1,000:1 in normal cells (7, 80). Similarly, trans-joining of coding ends is severely impaired relative to cis-joining in normal cells simultaneously transfected with two different recombination substrate plasmids, and this bias is enforced at the joining, rather than the cleavage, step of V(D)J recombination (51). However, in thymocytes from irradiated SCID mice, the ratio of cis-to-trans rearrangements is approximately 5:1 (80), suggesting that the absence of functional DNA-PK greatly promotes interlocus misjoining events. Thus, an important function of DNA-PK may be to minimize trans-joining and other misjoining events by tethering coding ends within the post-cleavage complex, which contains the cleaved coding and signal ends, RAG-1/2 proteins, and DNA-PK (2, 55, 64). Although trans-joining events are not pathogenic per se, they serve as a good marker for genomic instability and the risk of oncogenic misjoining events in lymphocytes (reviewed in reference 65).

Surprisingly, we found that a TCRbeta transgene was as effective as the RAG-2 null mutation in protecting SCID mice from radiation-induced thymic lymphomas. In contrast to the RAG-2 mutation, which ablates all V(D)J recombinase activity, the TCRbeta transgene specifically inhibits recombinase activity only for the Vbeta to DJbeta rearrangement step in CD44-CD25+ DN thymocytes. It is possible that this particular rearrangement event is more prone to generate oncogenic translocations than other TCR rearrangements. However, we favor the view that it is the developmental stage specificity of this rearrangement event that is crucial, rather than the nature of the rearrangement. In contrast to most rearrangements of TCRgamma , TCRdelta , and TCRalpha , Vbeta -to-DJbeta rearrangement takes place in CD44-CD25+ DN thymocytes that have a high proliferative potential (18, 45). Thus, we suggest that misjoining of RAG-1/2-induced breaks has greater oncogenic potential at this highly proliferative stage of T-cell development.

Differential impact of NHEJ and DNA damage checkpoint defects on mechanisms of lymphomagenesis. The NHEJ defect imparted by KU70 deficiency promotes the spontaneous development of thymic lymphomas (48, 73). In contrast to the SCID mutation in DNA-PK, KU70 disruption permits limited T-cell development to occur, and this is accompanied by the generation of some normal TCRbeta rearrangements (48, 94). In contrast, no complete IgH rearrangements occurred, and B-cell development was completely ablated in KU70-/- mice. Thus, the development of thymic lymphoma is correlated with a limited degree of normal TCR gene rearrangement and T-cell development in both irradiated SCID mice and in KU70-deficient mice. These parallels lead us to suggest that defective NHEJ activity, though capable of mediating V(D)J joining with low efficiency, confers a high risk of sustaining oncogenic V(D)J misjoining events in T-cell precursors. In agreement with this notion, Alt and colleagues have recently shown that the absence of the NHEJ protein ligase 4 causes frequent nonreciprocal translocations in fibroblasts (33).

Mutations in p53 and ATM, which disrupt DNA damage checkpoints, also confer a high risk of developing thymic lymphomas in mice. It was suggested that disruption of the checkpoint could promote survival or proliferation of thymocytes carrying oncogenic chromosomal translocations involving antigen receptor genes. Surprisingly, however, RAG-1/2 deficiency had little impact on lymphomagenesis in p53-deficient mice (76, 89), but protected (75) or significantly reduced the frequency and latency (100) of thymic lymphomagenesis in ATM-deficient mice. Interestingly, the tumors that developed with short latency in the RAG-2+ ATM-deficient mice had cytogenetic abnormalities within the TCRalpha /delta locus, suggesting a role for aberrant V(D)J recombination in these malignancies (100). Although ATM is primarily thought of as a checkpoint protein, several lines of evidence suggest that ATM-deficient cells also have DSB repair defects, though more subtle than the SCID NHEJ defect (reviewed in reference 58). Based on the differing extents to which V(D)J recombinase activity contributes to thymic lymphoma risk in ATM, p53, and SCID mutant mice, we suggest that there are at least two lymphomagenesis pathways in thymocytes: a pathway promoted by defective DSB repair (in SCID and ATM mice) that is dependent on V(D)J recombinase activity and a second pathway promoted by defective DNA damage checkpoints (in p53 and ATM mutant mice) that is independent of V(D)J recombinase activity.


    ACKNOWLEDGMENTS

We thank David Schatz, Ferenc Livak, and Stephen Meyn for critical reading of the manuscript. We also thank David Schatz and Ferenc Livak for the TCRdelta probe, Susanna Lewis for the pWTSJDelta plasmid and advice on the use of extrachromosomal recombination substrate plasmids, Gill Wu for pDR42, Al Singer and Wendy Shores for TCRbeta -transgenic mice, and Andrew Paterson for statistical calculations.

C.W. was supported by a RESTRACOMP studentship from the Hospital for Sick Children. J.D. and C.G. hold Scientist Awards from the National Cancer Institute of Canada and the Medical Research Council of Canada, respectively. This work was supported by the National Cancer Institute of Canada (with funds from the Canadian Cancer Society).


    FOOTNOTES

* Corresponding author. Mailing address: Program in Developmental Biology, Rm. 8104, Hospital for Sick Children Research Institute, 555 University Ave., Toronto, Ontario M5G 1X8, Canada. Phone: (416) 813-8810. Fax: (416) 813-8823. E-mail: guidos{at}sickkids.on.ca.

dagger Present address: Cutaneous Biology Research Center, Massachusetts General Hospital East, Charlestown, MA 02129.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Agrawal, A., Q. M. Eastman, and D. G. Schatz. 1998. Transposition mediated by RAG1 and RAG2 and its implications for the evolution of the immune system. Nature 394:744-751[CrossRef][Medline].
2. Agrawal, A., and D. G. Schatz. 1997. RAG1 and RAG2 form a stable postcleavage synaptic complex with DNA containing signal ends in V(D)J recombination. Cell 89:43-53[CrossRef][Medline].
3. Anderson, S. J., K. M. Abraham, T. Nakayama, A. Singer, and R. M. Perlmutter. 1992. Inhibition of T-cell receptor beta  chain rearrangement by overexpression of the non-receptor protein tyrosine kinase p56lck. EMBO J. 11:4877-4886[Medline].
4. Anderson, S. J., S. D. Levin, and R. M. Perlmutter. 1993. Protein tyrosine kinase p56lck controls allelic exclusion of T-cell receptor beta -chain genes. Nature 365:552-554[CrossRef][Medline].
5. Aplan, P. D., D. P. Lombardi, A. M. Ginsberg, J. Cossman, V. L. Bertness, and I. R. Kirsch. 1990. Disruption of the human SCL locus by "illegitimate" V-(D)-J recombinase activity. Science 250:1426-1429[Abstract/Free Full Text].
6. Araki, R., A. Fujimori, K. Hamatani, K. Mita, T. Saito, M. Mori, R. Fukumura, M. Morimyo, M. Muto, M. Itoh, K. Tatsumi, and M. Abe. 1997. Nonsense mutation at Tyr-4046 in the DNA-dependent protein kinase catalytic subunit of severe combined immune deficiency mice. Proc. Natl. Acad. Sci. USA 94:2438-2443[Abstract/Free Full Text].
7. Bailey, S. N., and N. Rosenberg. 1997. Assessing the pathogenic potential of the V(D)J recombinase by interlocus immunoglobulin light-chain gene rearrangement. Mol. Cell. Biol. 17:887-894[Abstract].
8. Besmer, E., J. Mansilla-Soto, S. Cassard, D. J. Sawchuk, G. Brown, M. Sadofsky, S. M. Lewis, M. C. Nussenzweig, and P. Cortes. 1998. Hairpin coding end opening is mediated by RAG1 and RAG2 proteins. Mol. Cell 2:817-828[CrossRef][Medline].
9. Biedermann, K. A., J. Sun, A. J. Giaccia, L. M. Tosto, and J. M. Brown. 1991. Scid mutation in mice confers hypersensitivity to ionizing radiation and a deficiency in DNA double-strand break repair. Proc. Natl. Acad. Sci. USA 88:1394-1397[Abstract/Free Full Text].
10. Binnie, A., S. Olson, G. E. Wu, and S. M. Lewis. 1999. Gamma-irradiation directly affects the formation of coding joints in SCID cell lines. J. Immunol. 163:5418-5426[Abstract/Free Full Text].
11. Blackwell, T. K., B. A. Malynn, R. R. Pollock, P. Ferrier, L. R. Covey, G. M. Fulop, R. A. Phillips, G. D. Yancopoulos, and F. W. Alt. 1989. Isolation of scid pre-B cells that rearrange kappa light chain genes: formation of normal signal but abnormal coding joins. EMBO J. 8:735-742[Medline].
12. Blunt, T., N. J. Finnie, G. E. Taccioli, G. C. M. Smith, J. Demengeot, T. M. Gottlieb, R. Mizuta, A. J. Varghese, F. W. Alt, P. A. Jeggo, and S. P. Jackson. 1995. Defective DNA-dependent protein kinase activity is linked to V(D)J recombination and DNA repair defects associated with the murine scid mutation. Cell 80:813-823[CrossRef][Medline].
13. Blunt, T., D. Gell, M. Fox, G. E. Taccioli, A. R. Lehmann, S. P. Jackson, and P. A. Jeggo. 1996. Identification of a nonsense mutation in the carboxyl-terminal region of DNA-dependent protein kinase catalytic subunit in the scid mouse. Proc. Natl. Acad. Sci. USA 93:10285-10290[Abstract/Free Full Text].
14. Bogue, M. A., C. Jhappan, and D. B. Roth. 1998. Analysis of variable (diversity) joining recombination in DNA-dependent protein kinase (DNA-PK)-deficient mice reveals DNA-PK-independent pathways for both signal and coding joint formation. Proc. Natl. Acad. Sci. USA 95:15559-15564[Abstract/Free Full Text].
15. Bogue, M. A., C. Zhu, E. Aguilar-Cordova, L. A. Donehower, and D. B. Roth. 1996. p53 is required for both radiation-induced differentiation and rescue of V(D)J rearrangement in scid mouse thymocytes. Genes Dev. 10:553-565[Abstract/Free Full Text].
16. Bosma, G. C., R. P. Custer, and M. J. Bosma. 1983. A severe combined immunodeficiency mutation in the mouse. Nature 301:527-530[CrossRef][Medline].
17. Brown, L., J. T. Cheng, Q. Chen, M. J. Siciliano, W. Crist, G. Buchanan, and R. Baer. 1990. Site-specific recombination of the tal-1 gene is a common occurrence in human T cell leukemia. EMBO J. 9:3343-3351[Medline].
18. Capone, M., R. D. Hockett, Jr., and A. Zlotnik. 1998. Kinetics of T cell receptor beta, gamma, and delta rearrangements during adult thymic development: T cell receptor rearrangements are present in CD44(+)CD25(+) Pro-T thymocytes. Proc. Natl. Acad. Sci. USA 95:12522-12527[Abstract/Free Full Text].
19. Carroll, A. M., and M. J. Bosma. 1988. Detection and characterization of functional T cells in mice with severe combined immune deficiency. Eur. J. Immunol. 18:1965-1971[Medline].
20. Carroll, A. M., and M. J. Bosma. 1991. T-lymphocyte development in scid mice is arrested shortly after the initiation of T-cell receptor delta  chain recombination. Genes Dev. 5:1357-1366[Abstract/Free Full Text].
21. Carroll, A. M., R. R. Hardy, and M. J. Bosma. 1989. Occurrence of mature B (Ig+ and B220+) and T (CD3+) lymphocytes in scid mice. J. Immunol. 17:1467-1471.
22. Casciola-Rosen, L., D. W. Nicholoson, T. Chong, K. R. Rowan, N. A. Thornberry, D. K. Miller, and A. Rosen. 1996. Apopain/CPP32 cleaves proteins that are essential for cellular repair: a fundamental principle of apoptotic cell death. J. Exp. Med. 183:1957-1964[Abstract/Free Full Text].
23. Casciola-Rosen, L. A., G. J. Anhalt, and A. Rosen. 1995. DNA-dependent protein kinase is one of a subset of autoantigens specifically cleaved early during apoptosis. J. Exp. Med. 182:1625-1634[Abstract/Free Full Text].
24. Cayuela, J. M., B. Gardie, and F. Sigaux. 1997. Disruption of the multiple tumor suppressor gene MTS1/p16(INK4a)/CDKN2 by illegitimate V(D)J recombinase activity in T-cell acute lymphoblastic leukemias. Blood 90:3720-3726[Abstract/Free Full Text].
25. Clarke, A. R., C. A. Purdie, D. J. Harrison, R. G. Morris, C. C. Bird, M. L. Hooper, and A. H. Wyllie. 1993. Thymocyte apoptosis induced by p53-dependent and independent pathways. Nature 362:849-852[CrossRef][Medline].
26. Critchlow, S. E., and S. P. Jackson. 1998. DNA end-joining: from yeast to man. Trends Biochem. Sci. 23:394-398[CrossRef][Medline].
27. Custer, R. P., G. C. Bosma, and M. J. Bosma. 1985. Severe combined immunodeficiency (scid) in the mouse. Am. J. Pathol. 120:464-477[Abstract].
28. Danska, J. S., D. P. Holland, S. Mariathasan, K. W. Williams, and C. J. Guidos. 1996. Biochemical and genetic defects in the DNA-dependent protein kinase in murine scid lymphocytes. Mol. Cell. Biol. 16:5507-5517[Abstract].
29. Danska, J. S., F. Pflumio, C. Williams, O. Huner, J. E. Dick, and C. J. Guidos. 1994. Rescue of T cell-specific V(D)J recombination in SCID mice by DNA-damaging agents. Science 266:450-455[Abstract/Free Full Text].
30. Davis, M. M., and P. J. Bjorkman. 1988. T-cell antigen receptor and T-cell recognition. Nature 334:395-402[CrossRef][Medline].
31. Difilippantonio, M. J., J. Zhu, H. T. Chen, E. Meffre, M. C. Nussenzweig, E. E. Max, T. Ried, and A. Nussenzweig. 2000. DNA repair protein Ku80 suppresses chromosomal aberrations and malignant transformation. Nature 404:510-514[CrossRef][Medline].
32. Elledge, S. J. 1996. Cell cycle checkpoints: preventing an identity crisis. Science 274:1664-1672[Abstract/Free Full Text].
33. Ferguson, D. O., J. M. Sekiguchi, S. Chang, K. M. Frank, Y. Gao, R. A. DePinho, and F. W. Alt. 2000. The nonhomologous end-joining pathway of DNA repair is required for genomic stability and the suppression of translocations. Proc. Natl. Acad. Sci. USA 97:6630-6633[Abstract/Free Full Text].
34. Ferrier, P., L. R. Covey, S. C. Li, H. Suh, B. A. Malynn, T. K. Blackwell, M. A. Morrow, and F. W. Alt. 1990. Normal recombination substrate Vh to DJh rearrangements in pre-B cell lines from scid mice. J. Exp. Med. 171:1909-1918[Abstract/Free Full Text].
35. Fish, S. M., and M. J. Bosma. 1994. Abnormal deletions in the T-cell receptor delta locus of mouse thymocytes. Mol. Cell. Biol. 14:4455-4464[Abstract/Free Full Text].
36. Fox, C. J., and J. S. Danska. 1997. Molecular analysis of mouse T cell receptor expression using PCR, p. 10.27.1-10.27.20. In J. E. Coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach, and W. Strober (ed.), Current protocols in immunology, vol. 2. John Wiley and Sons, Inc., New York, N.Y.
37. Frank, K. M., J. M. Sekiguchi, K. J. Seidl, W. Swat, G. A. Rathbun, H. L. Cheng, L. Cheng, L. Davidson, L. Kangaloo, and F. W. Alt. 1998. Late embryonic lethality and impaired V(D)J recombination in mice lacking DNA ligase IV. Nature 396:173-177[CrossRef][Medline].
38. Friedberg, E. C., G. C. Walker, and W. Siede. 1995. SOS responses and DNA damage tolerance in prokaryotes, p. 407-464. In E. C. Friedberg (ed.), DNA repair and mutagenesis. ASM Press, Washington, D. C.
39. Fulop, G., and R. Phillips. 1990. The scid mutation in mice causes a general defect in DNA repair. Nature 347:479-482[CrossRef][Medline].
40. Fuscoe, J. C., L. J. Zimmerman, K. Harrington-Brock, L. Burnette, M. M. Moore, J. A. Nicklas, J. P. O'Neill, and R. J. Albertini. 1992. V(D)J recombinase-mediated deletion of the hprt gene in T-lymphocytes from adult humans. Mutat. Res. 283:13-20[CrossRef][Medline].
41. Fuscoe, J. C., L. J. Zimmerman, M. J. Lippert, J. A. Nicklas, J. P. O'Neill, and R. J. Albertini. 1991. V(D)J recombinase-like activity mediates hprt gene deletion in human fetal T-lymphocytes. Cancer Res. 51:6001-6005[Abstract/Free Full Text].
42. Gao, Y., J. Chaudhuri, C. Zhu, L. Davidson, D. T. Weaver, and F. W. Alt. 1998. A targeted DNA-PKcs-null mutation reveals DNA-PK-independent functions for KU in V(D)J recombination. Immunity 9:367-376[CrossRef][Medline].
43. Gao, Y., D. O. Ferguson, W. Xie, J. P. Manis, J. Sekiguchi, K. M. Frank, J. Chaudhuri, J. Horner, R. A. DePinho, and F. W. Alt. 2000. Interplay of p53 and DNA-repair protein XRCC4 in tumorigenesis, genomic stability and development. Nature 404:897-900[CrossRef][Medline].
44. Gilfillan, S., A. Dierich, M. Lemeur, C. Benoist, and D. Mathis. 1993. Mice lacking TdT: mature animals with an immature lymphocyte repertoire. Science 261:1175-1178[Abstract/Free Full Text].
45. Godfrey, D. I., J. Kennedy, P. Mombaerts, S. Tonegawa, and A. Zlotnik. 1994. Onset of TCR-beta gene rearrangement and role of TCR-beta expression during CD3-CD4-CD8-thymocyte differentiation. J. Immunol. 152:4783-4792[Abstract].
46. Groves, T., P. Katis, Z. Madden, K. Manickam, D. Ramsden, G. E. Wu, and C. J. Guidos. 1995. In vitro maturation of clonal CD4+CD8+ cell lines in response to TCR engagement. J. Immunol. 154:5011-5022[Abstract].
47. Gu, Y., S. Jin, Y. Gao, D. T. Weaver, and F. W. Alt. 1997. Ku70-deficient embryonic stem cells have increased ionizing radiosensitivity, defective DNA end-binding activity, and inability to support V(D)J recombination. Proc. Natl. Acad. Sci. USA 94:8076-8081[Abstract/Free Full Text].
48. Gu, Y., K. J. Seidl, G. A. Rathbun, C. Zhu, J. P. Manis, N. van der Stoep, L. Davidons, H.-L. Cheng, J. M. Sekiguchi, K. Frank, P. Stanhope-Baker, M. S. Schlissel, D. B. Roth, and F. W. Alt. 1997. Growth retardation and leaky SCID phenotype of Ku70-deficient mice. Immunity 7:653-665[CrossRef][Medline].
49. Guidos, C. J., C. J. Williams, I. Grandal, G. Knowles, M. Huang, and J. S. Danska. 1996. V(D)J recombination activates a p53-dependent DNA damage checkpoint in scid lymphoycte precursors. Genes Dev. 10:2038-2054[Abstract/Free Full Text].
50. Guidos, C. J., C. J. Williams, G. E. Wu, C. J. Paige, and J. S. Danska. 1995. Development of CD4+CD8+ thymocytes in RAG-deficient mice through a T cell receptor beta  chain-independent pathway. J. Exp. Med. 181:1187-1195[Abstract/Free Full Text].
51. Han, J. O., S. B. Steen, and D. B. Roth. 1999. Intermolecular V(D)J recombination is prohibited specifically at the joining step. Mol. Cell 3:331-338[CrossRef][Medline].
52. Han, Z., N. Malik, T. Carter, W. H. Reeves, J. H. Wyche, and E. A. Hendrickson. 1996. DNA-dependent protein kinase is a target for a CPP32-like apoptotic protease. J. Biol. Chem. 271:25035-25040[Abstract/Free Full Text].
53. Hendrickson, E. A., X.-Q. Qin, E. A. Bump, D. G. Schatz, M. Oettinger, and D. T. Weaver. 1991. A link between double-strand break-related repair and V(D)J recombination: the scid mutation. Proc. Natl. Acad. Sci. USA 88:4061-4065[Abstract/Free Full Text].
54. Hendrickson, E. A., M. S. Schissel, and D. T. Weaver. 1990. Wild-type V(D)J recombination in scid pre-B cells. Mol. Cell. Biol. 10:5397-5407[Abstract/Free Full Text].
55. Hiom, K., and M. Gellert. 1998. Assembly of a 12/23 paired signal complex: a critical control point in V(D)J recombination. Mol. Cell 1:1011-1019[CrossRef][Medline].
56. Hiom, K., M. Melek, and M. Gellert. 1998. DNA transposition by the RAG1 and RAG2 proteins: a possible source of oncogenic translocations. Cell 94:463-470[CrossRef][Medline].
57. Hoffman, E. S., L. Passoni, T. Crompton, T. M. Leu, D. G. Schatz, A. Koff, M. J. Owen, and A. C. Hayday. 1996. Productive T-cell receptor beta-chain gene rearrangement: coincident regulation of cell cycle and clonality during development in vivo. Genes Dev. 10:948-962[Abstract/Free Full Text].
58. Jeggo, P. A., A. M. Carr, and A. R. Lehmann. 1998. Splitting the ATM: distinct repair and checkpoint defects in ataxia-telangiectasia. Trends Genet. 14:312-316[CrossRef][Medline].
59. Jhappan, C., H. C. Morse, R. D. Fleischman, M. M. Gottesman, and G. Merlino. 1997. DNA-PKcs: a T-cell tumour suppressor encoded at the mouse scid locus. Nat. Genet. 17:483-485[CrossRef][Medline].
60. Kang, J., M. Coles, D. Cado, and D. H. Raulet. 1998. The developmental fate of T cells is critically influenced by TCRgammadelta expression. Immunity 8:427-438[CrossRef][Medline].
61. Karasuyama, H., A. Rolink, and F. Melchers. 1996. Surrogate light chain in B cell development. Adv. Immunol. 63:1-41[Medline].
62. Kienker, L. J., W. A. Kuziel, B. A. Garni-Wagner, V. Kumar, and P. W. Tucker. 1991. T cell receptor gamma and delta gene rearrangements in scid thymocytes. Similarity to those in normal thymocytes. J. Immunol. 147:4351-4359[Abstract].
63. Kienker, L. J., W. A. Kuziel, and P. W. Tucker. 1991. T cell receptor gamma and delta gene junctional sequences in SCID mice: excessive P nucleotide insertion. J. Exp. Med. 174:769-773[Abstract/Free Full Text].
64. Kim, D. R., and M. A. Oettinger. 1998. Functional analysis of coordinated cleavage in V(D)J recombination. Mol. Cell. Biol. 18:4679-4688[Abstract/Free Full Text].
65. Kirsch, I. R., and F. Lista. 1997. Lymphocyte-specific genomic instability and risk of lymphoid malignancy. Semin. Immunol. 9:207-215[CrossRef][Medline].
66. Kishi, H., P. Borgulya, B. Scott, K. Karjalainen, A. Traunecker, J. Kaufman, and H. Von Boehmer. 1991. Surface expression of the beta  T cell receptor (TCR) chain in the absence of other TCR or CD3 proteins on immature T cells. EMBO J. 10:93-100[Medline].
67. Komori, T., A. Okada, V. Stewart, and F. W. Alt. 1993. Lack of N regions in antigen receptor variable region genes of TdT-deficient lymphocytes. Science 261:1171-1175[Abstract/Free Full Text].
68. Kong, F. K., C. L. Chen, A. Six, R. D. Hockett, and M. D. Cooper. 1999. T cell receptor gene deletion circles identify recent thymic emigrants in the peripheral T cell pool. Proc. Natl. Acad. Sci. USA 96:1536-1540[Abstract/Free Full Text].
69. Kotloff, D. B., M. J. Bosma, and N. R. Ruetsch. 1993. Scid mouse pre-B cells with intracellular µ chains: analysis of recombinase activity and IgH gene rearrangements. Int. Immunol. 5:383-391[Abstract/Free Full Text].
70. Kurimasa, A., H. Ouyang, L.-J. Dong, S. Wang, X. Li, C. Cordon-Cardo, D. J. Chen, and G. C. Li. 1999. Catalytic subunit of DNA-dependent protein kinase: impact of lymphocyte development and tumorigenesis. Proc. Natl. Acad. Sci. USA 96:1403-1408[Abstract/Free Full Text].
71. Lewis, S. M. 1994. The mechanism of V(D)J joining: lessons from molecular, immunological, and comparative analyses. Adv. Immunol. 56:27-149[Medline].
72. Lewis, S. M., E. Agard, S. Suh, and L. Czyzyk. 1997. Cryptic signals and the fidelity of V(D)J joining. Mol. Cell. Biol. 17:3125-3136[Abstract].
73. Li, G. C., H. Ouyang, X. Li, H. Nagasawa, J. B. Little, D. J. Chen, C. C. Ling, Z. Fuks, and C. Cordon-Cardo. 1998. Ku70: a candidate tumor suppressor gene for murine T cell lymphoma. Mol. Cell 2:1-8[CrossRef][Medline].
74. Li, Z., T. Otevrel, Y. Gao, H. L. Cheng, B. Seed, T. D. Stamato, G. E. Taccioli, and F. W. Alt. 1995. The XRCC4 gene encodes a novel protein involved in DNA double-strand break repair and V(D)J recombination. Cell 83:1079-1089[CrossRef][Medline].
75. Liao, M. J., and T. Van Dyke. 1999. Critical role for Atm in suppressing V(D)J recombination-driven thymic lymphoma. Genes Dev. 13:1246-1250[Abstract/Free Full Text].
76. Liao, M. J., X. X. Zhang, R. Hill, J. Gao, M. B. Qumsiyeh, W. Nichols, and T. Van Dyke. 1998. No requirement for V(D)J recombination in p53-deficient thymic lymphoma. Mol. Cell. Biol. 18:3495-3501[Abstract/Free Full Text].
77. Lieber, M. R., J. E. Hesse, S. Lewis, G. C. Bosma, N. Rosenberg, K. Mizuuchi, M. J. Bosma, and M. Gellert. 1988. The defect in murine severe combined immune deficiency: joining of signal sequences but not coding segments in V(D)J recombination. Cell 55:7-16[CrossRef][Medline].
78. Lieber, M. R., J. E. Hesse, K. Mizuuchi, and M. Gellert. 1987. Developmental stage specificity of the lymphoid V(D)J recombination activity. Genes Dev. 1:751-761[Abstract/Free Full Text].
79. Lieberman, M., G. A. Hansteen, E. K. Waller, I. L. Weissman, and A. Sen-Majumdar. 1992. Unexpected effects of the severe combined immunodeficiency mutation on murine lymphomagenesis. J. Exp. Med. 176:399-405[Abstract/Free Full Text].
80. Lista, F., V. Bertness, C. J. Guidos, J. S. Danska, and I. R. Kirsch. 1997. The absolute number of trans-rearrangements between the TCRgamma and TCRbeta loci is predictive of lymphoma risk: a severe combined immune deficiency (SCID) murine model. Cancer Res. 57:4408-4413[Abstract/Free Full Text].
81. Livak, F., and D. G. Schatz. 1996. T cell receptor alpha  locus V(D)J recombination by-products are abundant in thymocytes and mature T cells. Mol. Cell. Biol. 16:609-618[Abstract].
82. Livak, F., S. Welsh, C. J. Guidos, I. N. Crispe, J. S. Danska, and D. G. Schatz. 1996. Transient restoration of gene rearrangement at multiple T cell receptor loci in gamma -irradiated scid mice. J. Exp. Med. 184:419-428[Abstract/Free Full Text].
83. Livak, F., A. Wilson, H. R. MacDonald, and D. G. Schatz. 1997. Alpha beta lineage-committed thymocytes can be rescued by the gamma delta T cell receptor (TCR) in the absence of TCR beta chain. Eur. J. Immunol. 27:2948-2958[Medline].
84. Lowe, S. W., E. M. Schmitt, S. W. Smith, B. A. Osborne, and T. Jacks. 1993. p53 is required for radiation-induced apoptosis in mouse thymocytes. Nature 362:847-849[CrossRef][Medline].
85. Mallick, C., E. Dudley, J. Viney, M. Owen, and A. Hayday. 1993. Rearrangement and diversity of T cell receptor beta  chain genes in thymocytes: a critical role for the beta  chain in development. Cell 73:513-519[CrossRef][Medline].
86. Malynn, B. A., T. K. Blackwell, G. M. Fulop, G. A. Rathbun, A. J. W. Furley, P. Ferrier, L. B. Heinke, R. A. Phillips, G. D. Yancopolous, and F. W. Alt. 1988. The scid defect affects the final step of the immunoglobulin VDJ recombinase mechanism. Cell 54:453[CrossRef][Medline].
87. Mombaerts, P., J. Iacomini, R. Johnson, K. Herrup, S. Tonegawa, and V. Papaioannou. 1992. RAG-1-deficient mice have no mature B and T lymphocytes. Cell 68:869-877[CrossRef][Medline].
88. Murphy, W. J., S. K. Durum, M. R. Anver, D. K. Ferris, D. W. McVicar, J. J. O'Shea, S. K. Ruscetti, M. R. Smith, H. A. Young, and D. L. Longo. 1994. Induction of T cell differentiation and lymphomagenesis in the thymus of mice with severe combined immune deficiency (SCID). J. Immunol. 153:1004-1014[Abstract].
89. Nacht, M., and T. Jacks. 1998. V(D)J recombination is not required for the development of lymphoma in p53-deficient mice. Cell Growth Differ. 9:131-138[Abstract].
90. Nacht, M., A. Strasser, Y. R. Chan, A. W. Harris, M. Schlissel, R. T. Bronson, and T. Jacks. 1996. Mutations in the p53 and SCID genes cooperate in tumorigenesis. Genes Dev. 10:2055-2066[Abstract/Free Full Text].
91. Nussenzweig, A., C. Chen, V. Costa Soares, M. Sanchez, K. Sokol, M. C. Nussenzweig, and G. C. Li. 1996. Requirement for Ku80 in growth and immunoglobulin V(D)J recombination. Nature 382:551-555[CrossRef][Medline].
92. Nussenzweig, A., K. Sokol, P. Burgman, L. Li, and G. C. Li. 1997. Hypersensitivity of Ku80-deficient cell lines and mice to DNA damage: the effects of ionizing radiation on growth, survival, and development. Proc. Natl. Acad. Sci. USA 94:13588-13593[Abstract/Free Full Text].
93. Oettinger, M. A. 1999. V(D)J recombination: on the cutting edge. Curr. Opin. Cell Biol. 11:325-329[CrossRef][Medline].
94. Ouyang, H., A. Nussenzweig, A. Kurimasa, V. da Costa Soares, X. Li, C. Cordon-Cardo, W.-H. Li, N. Cheong, M. Nussenzweig, G. Iliakis, D. J. Chen, and G. C. Li. 1997. Ku70 is required for DNA repair but not for T cell antigen receptor recombination in vivo. J. Exp. Med. 186:921-929[Abstract/Free Full Text].
95. Passoni, L., E. S. Hoffman, S. Kim, T. Crompton, W. Pao, M. Q. Dong, M. J. Owen, and A. C. Hayday. 1997. Intrathymic delta selection events in gammadelta cell development. Immunity 7:83-95[CrossRef][Medline].
96. Paull, T. T., and M. Gellert. 1998. The 3' to 5' exonuclease activity of Mre11 facilitates repair of DNA double-strand breaks. Mol. Cell 1:969-979[CrossRef][Medline].
97. Paull, T. T., and M. Gellert. 1999. Nbs1 potentiates ATP-driven DNA unwinding and endonuclease cleavage by the Mre11/Rad50 complex. Genes Dev. 13:1276-1288[Abstract/Free Full Text].
98. Pennycook, J. L., Y. Chang, J. Celler, R. A. Phillips, and G. E. Wu. 1993. High frequency of normal DJH joints in B cell progenitors in severe combined immune deficiency mice. J. Exp. Med. 178:1007-1016[Abstract/Free Full Text].
99. Pergola, F., M. Z. Zdzienicka, and M. R. Lieber. 1993. V(D)J recombination in mammalian cell mutants defective in DNA double-strand break repair. Mol. Cell. Biol. 13:3464-3471[Abstract/Free Full Text].
100. Petiniot, L. K., Z. Weaver, C. Barlow, R. Shen, M. Eckhaus, S. M. Steinberg, T. Ried, A. Wynshaw-Boris, and R. J. Hodes. 2000. Recombinase-activating gene (RAG) 2-mediated V(D)J recombination is not essential for tumorigenesis in Atm-deficient mice. Proc. Natl. Acad. Sci. USA 97:6664-6669[Abstract/Free Full Text].
101. Rabbitts, T. H. 1994. Chromosomal translocations in human cancer. Nature 372:143-149[CrossRef][Medline].
102. Ramsden, D. A., and M. Gellert. 1995. Formation and resolution of double-strand break intermediates in V(D)J rearrangement. Genes Dev. 9:2409-2420[Abstract/Free Full Text].
103. Ramsden, D. A., and G. E. Wu. 1991. Mouse kappa  light chain recombination signal sequences mediate recombination more frequently than do those of lambda  light chain. Proc. Natl. Acad. Sci. USA 88:10721-10725[Abstract/Free Full Text].
104. Richardson, C., and M. Jasin. 2000. Frequent chromosomal translocations induced by DNA double-strand breaks. Nature 405:697-700[CrossRef][Medline].
105. Roth, D., J. Menetski, P. Nakajima, M. Bosma, and M. Gellert. 1992. V(D)J recombination: broken DNA molecules with covalently sealed (hairpin) coding ends in scid mouse thymocytes. Cell 70:983-991[CrossRef][Medline].
106. Schatz, D. G. 1997. V(D)J recombination moves in vitro. Semin. Immunol. 9:149-159[CrossRef][Medline].
107. Schuler, W., N. R. Ruetsch, M. Amster, and M. J. Bosma. 1991. Coding joint formation of endogenous T cell receptor genes in lymphoid cells from scid mice: unusual P-nucleotide additions in VJ-coding joints. Eur. J. Immunol. 21:589-596[Medline].
108. Schuler, W., I. J. Weiler, A. Schuler, R. A. Phillips, N. Rosenberg, T. W. Mak, J. F. Kearney, R. P. Perry, and M. J. Bosma. 1986. Rearrangement of antigen receptor genes is defective in mice with severe combined immune deficiency. Cell 46:963-972[CrossRef][Medline].
109. Shinkai, Y., G. Rathbun, K. P. Lam, E. Oltz, V. Stewart, M. Mendelsohn, J. Charron, M. Datta, F. Young, A. Stall, and F. Alt. 1992. RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell 68:855-867[CrossRef][Medline].
110. Shockett, P. E., and D. G. Schatz. 1999. DNA hairpin opening mediated by the RAG1 and RAG2 proteins. Mol. Cell. Biol. 19:4159-4166[Abstract/Free Full Text].
111. Shores, E., T. Nakayama, D. Wiest, Y. Takahama, S. Sharrow, and A. Singer. 1993. Structurally distinct T cell receptor complexes on developmentally distinct T cell populations in severe combined immunodeficiency mice expressing a TCRbeta transgene. J. Immunol. 150:1263-1275[Abstract].
112. Song, Q., S. R. Burrows, G. Smith, S. P. Lees-Miller, S. Kumar, D. W. Chan, J. A. Trapani, E. Alnemri, G. Litwack, H. Lu, D. J. Moss, S. Jackson, and M. F. Lavin. 1996. Interleukin-1 beta-converting enzyme-like protease cleaves DNA-dependent protein kinase in cytotoxic T cell killing. J. Exp. Med. 184:619-626[Abstract/Free Full Text].
113. Song, Q., S. P. Lees-Miller, S. Kumar, Z. Zhang, D. W. Chan, G. C. Smith, S. P. Jackson, E. S. Alnemri, G. Litwack, K. K. Khanna, and M. F. Lavin. 1996. DNA-dependent protein kinase catalytic subunit: a target for an ICE-like protease in apoptosis. EMBO J. 15:3238-3246[Medline].
114. Taccioli, G. E., A. G. Amatucci, H. J. Beamish, D. Gell, X. H. Xiang, M. I. Torres Arzayus, A. Priestley, S. P. Jackson, A. Marshak Rothstein, P. A. Jeggo, and V. L. Herrera. 1998. Targeted disruption of the catalytic subunit of the DNA-PK gene in mice confers severe combined immunodeficiency and radiosensitivity. Immunity 9:355-366[CrossRef][Medline].
115. Taccioli, G. E., H.-L. Cheng, A. J. Varghese, G. Whitmore, and F. W. Alt. 1994. A DNA repair defect in Chinese hamster ovary cells affects V(D)J recombination similarly to the murine scid mutation. J. Biol. Chem. 269:7439-7442[Abstract/Free Full Text].
116. Taccioli, G. E., G. Rathbun, E. Oltz, T. Starnato, P. A. Jeggo, and F. W. Alt. 1993. Impairment of V(D)J recombination in double-strand break repair mutants. Science 260:207-210[Abstract/Free Full Text].
117. Uematsu, Y., S. Ryser, Z. Dembic, P. Borgulya, P. Krimpenfort, A. Berns, H. von Boehmer, and M. Steinmetz. 1988. In transgenic mice the introduced functional T cell receptor beta gene prevents expression of endogenous beta genes. Cell 52:831-841[CrossRef][Medline].
118. Vaux, D. L., S. Cory, and J. M. Adams. 1988. Bcl-2 gene promotes haemopoietic cell survival and cooperates with c-myc to immortalize pre-B cells. Nature 335:440-442[CrossRef][Medline].
119. von Boehmer, H., and H. J. Fehling. 1997. Structure and function of the pre-T cell receptor. Annu. Rev. Immunol. 15:433-452[CrossRef][Medline].
120. Wang, C., M. A. Bogue, A. P. Nguyen, and D. B. Roth. 1999. Irradiation-induced rescue of thymocyte differentiation and V(D)J recombination in mice lacking the catalytic subunit of DNA-dependent protein kinase. J. Immunol. 163:6065-6071[Abstract/Free Full Text].
121. Zhu, C., M. A. Bogue, D. Lim, P. Hasty, and D. B. Roth. 1996. Ku86-deficient mice exhibit severe combined immune deficiency and defective processing of V(D)J recombination intermediates. Cell 86:379-389[CrossRef][Medline].
122. Zhu, C., and D. B. Roth. 1995. Characterization of coding ends in thymocytes of scid mice: implications for the mechanism of V(D)J recombination. Immunity 2:101-112[CrossRef][Medline].


Molecular and Cellular Biology, January 2001, p. 400-413, Vol. 21, No. 2
0270-7306/01/$04.00+0   DOI: 10.1128/MCB.21.2.400-413.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Belanger, S. D., St-Pierre, Y. (2005). Role of selectins in the triggering, growth, and dissemination of T-lymphoma cells: implication of L-selectin in the growth of thymic lymphoma. Blood 105: 4800-4806 [Abstract] [Full Text]  
  • Li, L., Salido, E., Zhou, Y., Bhattacharyya, S., Yannone, S. M., Dunn, E., Meneses, J., Feeney, A. J., Cowan, M. J. (2005). Targeted Disruption of the Artemis Murine Counterpart Results in SCID and Defective V(D)J Recombination That Is Partially Corrected with Bone Marrow Transplantation. J. Immunol. 174: 2420-2428 [Abstract] [Full Text]  
  • Tsuji, H., Ishii-Ohba, H., Katsube, T., Ukai, H., Aizawa, S., Doi, M., Hioki, K., Ogiu, T. (2004). Involvement of Illegitimate V(D)J Recombination or Microhomology-Mediated Nonhomologous End-Joining in the Formation of Intragenic Deletions of the Notch1 Gene in Mouse Thymic Lymphomas. Cancer Res. 64: 8882-8890 [Abstract] [Full Text]  
  • Sakata, J., Inoue, J., Ohi, H., Kosugi-Okano, H., Mishima, Y., Hatakeyama, K., Niwa, O., Kominami, R. (2004). Involvement of V(D)J recombinase in the generation of intragenic deletions in the Rit1/Bcl11b tumor suppressor gene in {gamma}-ray-induced thymic lymphomas and in normal thymus of the mouse. Carcinogenesis 25: 1069-1075 [Abstract] [Full Text]  
  • Sadofsky, M. J. (2001). The RAG proteins in V(D)J recombination: more than just a nuclease. Nucleic Acids Res 29: 1399-1409 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Williams, C. J.
Right arrow Articles by Guidos, C. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Williams, C. J.
Right arrow Articles by Guidos, C. J.