Previous Article | Next Article 
Molecular and Cellular Biology, October 2001, p. 6851-6858, Vol. 21, No. 20
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.20.6851-6858.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Hematopoietic Protein Tyrosine Phosphatase
Suppresses Extracellular Stimulus-Regulated Kinase
Activation
Marcela
Gronda,1
Sara
Arab,1
Barbara
Iafrate,1
Haruhiko
Suzuki,2 and
Brent W.
Zanke1,3,*
Departments of
Medicine3 and Medical
Biophysics,1 University of Toronto, Princess
Margaret Hospital and Ontario Cancer Institute, Toronto, Ontario M5G
2M9, Canada, and Nagoya School of Medicine, Showa-ku,
Nagoya 464, Japan2
Received 13 February 2001/Returned for modification 13 March
2001/Accepted 19 July 2001
 |
ABSTRACT |
The mitogen-activated protein kinases (MAPKs) are signaling
molecules that become enzymatically activated through phosphorylation by diverse stimuli. Hematopoietic cytokines, growth factors, and stimulated lymphocyte antigen receptors may activate specific MAPKs by
altering the balance of MAPK-activating protein kinases and the protein
phosphatases that target their activation sites. Hematopoietic protein
tyrosine phosphatase (HePTP) is a hematopoiesis-specific cytoplasmic
protein tyrosine phosphatase whose expression is induced by mitogenic
stimuli. To investigate the role of HePTP in hematopoietic development,
we constructed mice deficient in this phosphatase using the technique
of homologous recombination. Primary lymphocytes from
HePTP
/
mice show enhanced activation of extracellular
stimulus-regulated kinase (ERK) after both phorbol myristate acetate
(PMA) and anti-CD3-mediated T-cell receptor (TCR) stimulation,
suggesting a true physiological relationship between these two
molecules. Activation of MEK, the physiological activator of ERK, by
anti-CD3 or PMA is not affected by HePTP deletion. The distribution of
hematopoietic lineages in bone marrow and peripheral blood samples and
the in vitro proliferative capacity of bone marrow progenitors from
HePTP deletion mice do not deviate from those of matched littermate
controls. Similarly, lymphocyte activation and development are
indistinguishable in HePTP
/
mice and controls. We
conclude that HePTP is a physiological regulator of ERK on the basis of
these studies and hypothesize that its deletion is well compensated for
in the developing mouse through reduction of ERK targets or enhancement
of physiologically opposed signaling pathways.
 |
INTRODUCTION |
Extracellular stimuli modify cells
by altering traffic through intracellular networks of protein kinases
and related molecules. The mitogen-activated protein kinase (MAPK)
family plays a central role in signaling pathways stimulated by
extracellular stimuli such as growth factors, cytokines, and
physical stress and is conserved over a huge evolutionary distance
(8). In higher organisms, this broad kinase family
includes the extracellular stimulus-regulated kinases (ERKs) and
two stress-stimulated kinase groups, the stress-activated protein
kinase/c-Jun N-terminal kinase (SAPK/JNK) and the
p38HOG kinases (2, 11, 19, 33).
In response to specific stimulation, the MAPKs are activated by
phosphorylation on conserved threonine and tyrosine amino acids which
are found within an activation motif (27, 28, 31). This
critical regulation site is located in a loop linking kinase domains
VII and VIII and varies in length between individual MAPKs (13,
16). Both the length of this loop and the identity of adjacent
amino acids determine the specificity of MAPK kinases, which are the
principal determinants of MAPK activity (16, 43).
While extracellular stimuli may induce activating phosphorylation of
MAPKs by activating MAPK kinases, the MAPK-specific dual specificity
protein phosphatases are potential negative regulators of mitogenic
cascades by targeting these same sites (24, 25, 35). These
nuclear MAPK phosphatases are typified by MAPK phosphatase 1 (MKP-1),
which targets both phosphothreonine and phosphotyrosine on most
activated MAPKs. Its overexpression can counter the transforming action
of Ras activation in fibroblasts (35), presumably by dephosphorylating activated ERK, antagonizing the activity of MAPK
kinases directly. The dual-specificity phosphatases MKP-3 and MKP-4
also inactivate the ERKs, while the phosphatase M3/6 may have
specificity for the SAPK/JNK family (24, 25). Similarly, the neuronal ERK tyrosine-specific phosphatases phosphoprotein phosphatase (PTP-SL) and striatum-enriched phosphatase-SL (STEP) associate with ERK through a specific docking site, termed the kinase
interaction motif (KIM), resulting in specific ERK inactivation through
tyrosine dephosphorylation (29).
Important signaling events may reflect the balance between MAPK kinases
and MAPK phosphatases. MAPK phosphatases may be controlled as part of a
coordinated cellular response to extracellular signals. For example,
stress stimuli, acting through the JNK (SAPK) family of MAPKs, induce
the expression of MKP-1, which targets sites of activating
phosphorylation on ERK (4). Such cross-regulation may act
to prevent the activation of physiologically conflicting pathways after
multiple stimuli. Alternatively, MAPK phosphatases may be activated in
parallel to their targets, causing the activation of these powerful
signaling molecules to be self-limited. For instance, the MAPK
phosphatase MKP-3 is activated after phosphorylation of ERK-2 by
binding of ERK-2 to the noncatalytic amino terminus of MKP-3
(6).
We have described a hematopoiesis-specific protein tyrosine phosphatase
(HePTP) that is induced in primary lymphocytes by extracellular stimuli
such as the mitogens concanavalin A, phytohemagglutinin, and
interleukin-2 (IL-2) and by gene transfer of activated Lck or c-Raf
(1, 44). Overexpression of HePTP reduces T-cell receptor
(TCR)-induced activation of ERK2 and blocks TCR-induced transcriptional
activation of an interleukin-2 promoter-derived ERK-responsive element
(32). Overexpression of HePTP also reduces ERK activation
after phorbol myristate acetate (PMA) or TCR stimulation of cultured
Jurkat cells and interferes with PMA- and growth factor-induced MAPK
activation in myeloid cells. Consistent with its role as an ERK
phosphatase, HePTP contains a KIM, as observed in PTP-SL and STEP
(29). Collectively these data suggest that HePTP may have
a unique role in hematopoietic mitogenic signaling cascades, possibly
through direct ERK dephosphorylation.
While existing data suggest that HePTP may be an ERK tyrosine
phosphatase, studies based on gene transfer-induced overexpression and
in vitro enzymatic reactions often do not identify true physiological activities. For example, MEKK1, a mammalian kinase related to the
Saccharomyces cerevisiae pheromone signaling kinase Ste11, was initially identified through cell transfection experiments as an
activator of the ERK kinase MEK (from which it derives its name)
(20). Subsequent studies demonstrated that MEKK-1 is
unlikely to be a physiologic activator of MEK-1, having much higher
specificity for SEK-1, the upstream activator of the SAPK/JNK family
(42). To further characterize the role of HePTP in
hematopoietic cell signaling, we generated mice deficient in this
enzyme using the technique of homologous recombination. We report here
that HePTP
/
mice are fertile and healthy in
appearance, with normal solid organ and bone marrow morphology. Despite
increased ERK activation observed after PMA or TCR stimulation of
HePTP
/
lymphocytes, proliferative response
and cytokine secretion are normal. This work demonstrates that HePTP is
a physiologically relevant ERK hematopoietic phosphatase, though its
absence appears to be well compensated for in genetically deficient mice.
 |
MATERIALS AND METHODS |
Generation of mice genetically deficient in HePTP.
A plasmid
used to introduce a targeted HePTP mutation by homologous recombination
was constructed by inserting the pMC1Neo gene cassette between the
PstI site in exon 2 and the BglII site found in
the second intron of the HePTP gene. This plasmid was transfected into
the E14K embryonic stem (ES) cell line (kindly provided by K. Rajewsky,
Cologne, Germany) by electroporation. G418-resistant ES clones were
screened by PCR using primers producing products distinguishing
wild-type and mutant forms. Two cell lines with proper homologous
recombination were obtained and verified by Southern hybridization
analysis. Each cell line was injected into blastocysts of C57BL/6 mice
(Jackson Laboratory), producing chimeras. These chimeric mice, derived
from two different ES clones, were mated with C57BL/6 mice. Tail DNA
from offspring with agouti coat color was analyzed by PCR or Southern
hybridization to confirm the germ line integration of the mutated HePTP
gene. Heterozygous mice were mated to generate +/+ and
/
littermates to be used for experimentation. Mice were mated and
maintained in the animal facility of the Ontario Cancer Institute.
Animals were housed in a semibarrier set which includes sterile static
microisolators, acidified (pH 2.8) drinking water by bottle, and
sterile standard laboratory rodent chow. Animal cages were serviced in
HEPA-filtered room air.
Products of HePTP matings were characterized at the HePTP locus by PCR.
Mice were weaned and ear-marked at day 21. At week 4, 2 mm of tail was
cut using a surgical blade, and mice were bled using a heparinized
capillary tube (Microvette CB 300; Sarsted). Total DNA was extracted
from blood (40 µl) and the tail tip using a DNeasy tissue kit
(Qiagen). Extracted DNA (0.1 µg) was used as a template in 50 µl of
a final reaction mixture which contained deoxynucleoside triphosphates
(100 µM each) (Gibco-BRL), HePTP E2-S2 primer
(CAAGAAGCATGTGCGCCTGC) (10 µM), HePTP E3-AS primer (TGCTGTAGCGACCAGCGTGT) (10 µM),
MgCl2 (1.5 mM) (Gibco-BRL), and Taq
polymerase enzyme (0.25-µl stock) (Gibco-BRL).
HePTP
/
mice were identified by a 1.8-kb
amplification product, since amplification of template genomic DNA from
HePTP+/+ mice produces a 0.7-kb band.
Lymphocyte proliferation assays.
Spleen, thymus, and lymph
nodes were surgically removed and meshed to obtain a single-cell
suspension. Cells were washed, counted, and cultured in Iscove
modified Dulbecco's medium (IMDM) containing fetal calf serum (FCS)
(10%). Spleen cells (105/100 µl) were placed
in 96-well plates in the presence of anti-CD3E with anti-CD28 (both
from PharMingen) (12). Proliferation studies were
performed using [3H]dT (1 µCi/well) (NEN)
added for 16 h after 24 and 48 h of stimulation. Cells were
harvested (Packard Filtermate cell harvester), and the incorporated
thymidine was measured on a Top Count NXT (Packard). Cells harvested at
different intervals were stained with biotinylated anti-CD69 and
anti-CD25 and analyzed using a FACScan (Becton Dickinson).
Hematopoietic colony assay.
Marrow cells were flushed from
the femora of 8- to 12-week-old HePTP+/+ and
HePTP
/
littermate mice. Cells were
resuspended in IMDM, counted, and plated at various concentrations in
methylcellulose (1 ml) containing erythropoietin (1 U) (EPO; Kirin
Brewery), fetal bovine serum (4%; ICN/Flow), bovine serum albumin
(0.5%; Sigma), human transferrin (0.1 mg/ml; Boehringer), recombinant
human IL-11 (rhIL-11) (0.01 µg; Genetics Institute), rhIL-1
(0.001 µg; Biogen), cystine (0.02 mg; Sigma), insulin (0.01 mg; Sigma),
lipids mix (1.6 µl; Sigma), IL-3-containing conditioned medium (15 U), CHO cell line-conditioned medium containing the c-kit ligand (3%),
and 5637 cell line-conditioned medium (10%) (39).
Cultures were incubated for 3 to 10 days at 37°C in a humidified
atmosphere containing CO2 (5%). Myeloid, erythroid, and megakaryocytic colonies were identified morphologically using May-Grunwald-Giemsa staining.
Immunostaining and flow cytometry.
Single-cell suspensions
(106 cells) from thymus, spleen, or
axillary/cervical lymph nodes were resuspended in phosphate-buffered saline (PBS) and incubated for 30 min on ice with phycoerythrin (PE),
fluorescein isothiocyanate (FITC), or biotin-conjugated anti-CD4,
anti-CD8, anti-TCR
, anti-CD3, anti-CD25/IL-2R
, anti-CD28, anti-CD69, anti-CD5, anti-immunoglobulin M (IgM), anti-CD11B, anti-CD45, or anti-B220. Biotinylated antibodies were visualized using
streptavidin-RED670 (Life Sciences). Samples were analyzed using a
FACScan (Becton Dickinson).
Detection of MAPK and MEK phosphorylation in primary mouse
lymphoid tissues.
Splenocytes, thymocytes, or lymph node cells
were washed and incubated in IMDM containing FCS (0.5%) with either
anti-CD3E antibody (10 µg/ml) (PharMingen) or PMA (10 nM) (Sigma)
to induce ERK pathway activation. Sorbitol (400 mM) was used to induce
p38HOG and SAPK activation. Cells (2 × 107) were placed in lysis buffer (200 µl)
consisting of Nonidet P-40 (0.1%), Tris (pH 7.5) (50 mM), NaCl (150 mM), sodium orthovanadate (5 mM), dibasic sodium pyrophosphate (50 mM),
and the protease inhibitors leupeptin (1 µg/ml), aprotinin (1 µg/ml), and phenylmethylsulfonyl fluoride (1 mM) (all from Sigma).
Protein concentration was measured in each lysate using Bio-Rad
reagent. Equal amounts of proteins were analyzed by polyacrylamide gel
electrophoresis (PAGE) followed by Western analysis using antibodies
specific for the enzymatically activated phospho-specific forms of
SAPK, p38HOG, MEK, and ERK1 and -2 (all from New
England Biolabs). Western blots to detect total MAPK and MEK were
performed to ensure equal loading in each lane.
Capture ELISA.
Lymph node cells from
HePTP+/+ and HePTP
/
mice were cultured in IMDM containing FCS (10%) in the presence of
anti-CD3E (1 µg/ml) plus anti-CD28 (1 µg/ml) (both from
PharMingen). After 24 and 48 h of stimulation, supernatants (100 µl/well) were collected and kept at
70°C for subsequent IL-2
determination. IL-2 levels were measured with the mouse IL-2 Duo Set
enzyme-linked immunosorbent assay (ELISA) development system (R&D)
using a Bio-Rad plate reader.
Th1 and Th2 differentiation.
Spleen cells from
HePTP+/+ and HePTP
/
mice were passed through a stainless steel screen to make single-cell
suspensions. The cells were washed in
minimal essential medium
(
MEM) (Gibco) supplemented with glutamine (2 mM), sodium pyruvate (1 mM), HEPES (pH 7.3) (15 mM), mercaptoethanol (50 µM), and FCS (10%).
Splenocytes (4 × 106 cells) were cultured
for 48 h in 24-well flat-bottomed plates as described
(15), and T cells were activated by incubation with a 1:40
dilution of anti-CD3E monoclonal antibody culture supernatant.
Cultures were harvested, and activated T cells were recovered by
centrifugation with Lympholyte and reactivated by incubation for an
additional 16 h in 96-well plates coated with anti-CD3E
antibody. During the last 3 h of incubation, cells were exposed to
brefeldin A (10 µg/ml; Sigma). Cells were subsequently washed in PBS,
fixed with paraformaldehyde (4%), and permeabilized with saponin
(0.1%). T-cell subsets were identified by flow cytometry using
appropriate concentrations of monoclonal antibodies directed against
CD4, CD8, IL-4, IL-10, tumor necrosis factor alpha (TNF-
), and gamma
interferon (IFN-
) as described (14).
 |
RESULTS |
Generation of HePTP deletion mice.
To further characterize the
physiological role of HePTP, we generated deletion mice through the
process of homologous recombination. Exon 2 of the HePTP gene was
disrupted in E14K embryonic stem cells using a replacement construct
containing the pMC1Neo gene expression cassette (Fig.
1A) (38). The neo
gene was inserted between the PstI site in exon 2 and the
BglII site found in the second intron of the HePTP gene. Two
recombinant ES cell clones were identified by PCR and confirmed on
Southern blotting of DNA (Fig. 1B). Each clone was injected into
blastocysts of C57BL/6 mice, producing chimeras which were mated with
C57BL/6 mice. Tail DNA from offspring with agouti coat color were
analyzed by PCR or Southern hybridization to confirm the germ line
integration of the mutated HePTP gene. Expression of HePTP was tested
by Western analysis of protein extracts from mouse tissues. As shown in
Fig. 1C, expression was totally absent in
HePTP
/
mice, which are fertile and appear
healthy. The distribution of genotypes +/+,
/
, and +/
followed
Mendelian inheritance (data not shown).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 1.
Generation of mice deficient in HePTP through homologous
recombination. (A) A 2.6-kb EcoRI-EcoRI
genomic fragment encompassing the first three exons of HePTP was cloned
into pUC19. An antisense neo gene cassette replaced
sequence between the PstI site in exon 2 and the
BglII site found in the second intron. This construct
was transfected into the E14K ES cell line by electroporation.
G418-resistant ES clones were screened by PCR using primers at
positions indicated by arrows. The solid bar indicates the probe used
for Southern confirmation of homologous recombination. (B) Southern
analysis of DNA from PCR-positive ES cells, demonstrating successful
single-site homologous integration. wt, wild-type ES; m, mutant ES. The
mutant HindIII-cut fragment is increased in size by the
inserted neomycin gene, while the mutant EcoRI fragment
is reduced in size due to the introduction of a new
EcoRI site within the neomycin gene. (C) Northern blot
analysis of tissues from HePTP wild-type and / mice for HePTP mRNA
expression. The wild-type form of the mRNA (arrow) is expressed in
thymus and spleen cells obtained from wild-type animals but not from
/ mice. In the latter, a higher-molecular-weight form is expressed
as a consequence of the neo cassette insertion. A human
-actin probe (Clontech) was used as a loading control. (D) Western
blot analysis of tissues from HePTP+/+ and
HePTP / mice for HePTP expression. While
HePTP+/+ mice express this phosphatase in spleen,
HePTP / mice show no expression in any organ, confirming
gene targeting. Equal amounts of total protein (20 µg) were loaded in
each lane. Antitubulin immunoblotting demonstrates organ-specific
equivalence.
|
|
ERK stimulation is enhanced in HePTP
/
primary
lymphoid cells.
To address the intersection of HePTP and the ERK
signaling cascades, we evaluated PMA-induced ERK and MEK activation in
mouse lymphocytes lacking HePTP. Isolated spleen cells were incubated ex vivo with PMA at various concentrations. Western blot analysis using
antibodies specific for the phosphorylated forms of ERK showed enhanced
phosphorylation in HePTP
/
cells in comparison
to HePTP+/+ cells, while no change in MEK
activation was observed (Fig. 2A). Since
HePTP may inhibit TCR-induced ERK activation (32), ERK and
MEK activity after antibody-induced TCR stimulation of
HePTP
/
lymphocytes was also evaluated.
Lymphocytes incubated with anti-CD3E for 0 to 60 min were immediately
lysed in buffer containing protease and phosphatase inhibitors. Despite
equivalent total ERK expression, TCR-stimulated
HePTP
/
lymphocytes demonstrated enhanced
TCR-mediated ERK phosphorylation. MEK expression and activation were
unchanged (Fig. 2B). When splenic lymphocytes were treated with
sorbitol to induce p38HOG and SAPK activation,
no difference was noted between HePTP
/
and
HePTP+/+ mice, suggesting that ERK but not the
stress-induced kinase cascades are altered in
HePTP
/
mice (Fig. 2C and D). These data
suggest that HePTP is a physiologic downmodulator of TCR-stimulated ERK
activity and does not seem to have an inhibitory effect on the other
MAPKs or on proximal signaling pathways.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 2.
PMA- and TCR-induced ERK activation is increased in
spleen cells from HePTP / mice. (A) Spleen cells (2 × 107) were unstimulated or stimulated with 10 nM PMA for
15, 30, and 60 min. Activated, phosphorylated ERK, total ERK, activated
phosphorylated MEK, and total MEK were detected by immunoblotting.
While HePTP+/+ and HePTP / splenocytes have
similar amounts of total ERK and MEK, HePTP / cells
demonstrate increased activation of ERK but not MEK after PMA
stimulation. (B) TCR stimulation-induced activation of ERK and MEK was
evaluated in total splenocytes from wild-type and HePTP deletion mice.
Cells were incubated for 0, 15, 30, or 60 min with anti-CD3E (10 µg/ml), lysed, and evaluated by immunoblotting for ERK1-2, MEK,
phospho-ERK, and phospho-MEK. HePTP / lymphocytes
demonstrate increased activation of ERK after TCR stimulation compared
with that of wild-type controls but no difference in MEK activation. (C
and D) p38HOG activation (C) and SAPK activation
(D) in HePTP+/+ and HePTP / splenocytes.
Cells (2 × 107) were treated with sorbitol (400 mM)
for the indicated times. Lysates were analyzed by Western blotting for
total p38HOG or SAPK and for the phosphorylated
activated forms as indicated. Cells from wild-type HePTP and
HePTP / mice show similar activation profiles for
p38HOG and SAPK.
|
|
Myelopoiesis and lymphopoiesis are normal in HePTP
/
mice.
Since ERK stimulation is an important component of
hematopoietic clonal expansion and development, we performed a
quantitative analysis of bone marrow cells in
HePTP+/+ and HePTP
/
mice. Bone marrow samples were stained with May-Grunwald-Giemsa stain,
and differential cell counts were performed. Figure
3 shows that no significant difference
was found in the distribution of cell lineages between wild-type and
HePTP-deleted mice.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 3.
In vitro development of bone marrow progenitor cells is
similar in HePTP / mice (open bars) to that in
HePTP+/+ (solid bars) mice. Bone marrow progenitor cells
were harvested from mouse femora and plated in methylcellulose
suspension for 10 days in the presence of standard growth factors and
cytokines, as described in Materials and Methods. Granulomonocytic
(GM), pure mature erythroid (PME), erythromegakaryocytic (EMk),
megakaryocytic (Mk), granulomegakaryocytic (MkG), and
erythogranulomegakaryocytic (EGMk) colonies were identified
morphologically by inverted light microscopy. Colony counts from
duplicate experiments are shown with 95% confidence limits.
|
|
To study hematopoiesis in vitro, bone marrow progenitor cell
development was evaluated by methylcellulose culture. At days
3 and 7, pure erythroid, granulocytic, megakaryocytic, and mixed
colonies were
identified morphologically and counted. No significant
difference was
found between HePTP
/
and
HePTP
+/+ mice (Fig.
4).

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 4.
Mature bone marrow cytology is not different between
HePTP / and HePTP+/+ mice. Bone marrow
samples were obtained from the femora of two pairs of age matched
HePTP / and HePTP+/+ mice and stained with
May-Grünwald-Giemsa stain. One thousand cell differential counts
were performed for each sample. Data are mean percentages ± standard deviations (SD).
|
|
Spleen, thymus, and lymph nodes from HePTP
/
and HePTP
+/+ mice were stained with
hematoxylin-eosin (HE) and studied by light microscopy.
Fresh
single-cell suspensions from these organs were also isolated,
and
different lymphoid subpopulations were determined by flow
cytometry. No
difference in organ architecture between
HePTP
/
and HePTP
+/+
mice was observed. Levels of surface expression of all lymphoid
markers
were similar in lymphoid organs from both mice, suggesting
the
preservation of lymphoid subsets (Table
1).
Mitogen-induced expression of activation-induced surface marker and
proliferation are not affected by HePTP deletion.
Since HePTP is
expressed in differentiated blood cells, we examined proliferation and
activation of mature lymphocytes in cells lacking this phosphatase.
Expression of the ERK-dependent activation marker CD69 after PMA or
anti-CD3 stimulation of splenic lymphocytes was evaluated (36,
37). The levels of expression of CD69 were comparable in
HePTP+/+ and HePTP
/
mice (Table 1) (5, 37).
Proliferation of spleen cells after TCR and CD28 stimulation was
evaluated by pulse-labeling with tritiated thymidine. Isolated
cells
were stimulated for 24 and 48 h and incubated for 16 h with
[
3H]dT to detect induced entry into S phase.
No significant difference
was found between stimulated
HePTP
+/+ and HePTP
/
cells (Fig.
5). As an additional marker
of T-cell activation,
IL-2 production was measured using capture ELISA
after TCR and
CD28 stimulation of primary lymphocytes. No significant
difference
was found between HePTP
/
and
HePTP
+/+ cells in the level of IL-2 produced
(Fig.
6).

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 5.
Levels of activation-induced proliferation of spleen
cells are similar in HePTP / (solid squares) and
HePTP+/+ (open squares) mice. Spleen cell suspensions
(105) were incubated in 96-well dishes with anti-CD3 at the
concentrations shown and with anti-CD28 (1 µg/ml) for 24 h (A)
or 48 h (B). Proliferation was assessed by the incorporation of
[3H]dT and expressed as counts per minute (cpm). No
significant difference was observed between HePTP+/+ and
HePTP / splenocytes. Mean [3H]dT
uptake ± SD is shown.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 6.
IL-2 production by stimulated spleen cells is the same
in HePTP / and HePTP+/+ mice. Freshly
harvested spleen cells from HePTP+/+ and
HePTP / mice were incubated for 24 or 48 h in the
presence of anti-CD3 plus anti-CD28 (1 µg/ml each). Supernatants were
collected, and IL-2 levels were determined by capture ELISA. No
significant difference was detected between HePTP / and
HePTP+/+ mice. Mean production of IL-2 ± SD is
shown.
|
|
The differentiation of T helper 1 and T helper 2 cells from naive T
cells requires the presence of exogenous cytokines during
primary
antigenic stimulation. While IL-12 promotes differentiation
into Th1
cells through a p38
HOG-dependent pathway, IL-4
supports Th2 differentiation by cross
talk between the TCR-mediated
activation of the RAS/ERK pathway
and the IL-4 receptor
(IL-4R)-mediated STAT6 pathway (
30). We
therefore tested
Th2 differentiation in HePTP
/
mice.
Spleen-derived naive T lymphocytes were stimulated with
anti-CD3E
antibody. The production of Th2 cells was assessed by
intracellular
cytokine staining with anti-IL-4 and anti-IL-10
antibodies.
Differentiation into Th1 cells was identified by IFN-
and IFN-

expression using flow cytometry analysis. Comparison
of
HePTP
+/+ and HePTP
/
mouse Th1 subpopulations did not reveal significant differences
(data
not
shown).
 |
DISCUSSION |
Phosphorylation of signaling protein kinases can stimulate their
enzymatic activity, as is observed after MAPK phosphorylation (8), or can be inhibitory, as is seen after
phosphorylation of Src family kinases, such as Lck (3).
Protein phosphatases are hypothesized to be important counterbalances
to the activities of regulatory kinases. Through gene targeting and
other techniques, specific physiological roles for some phosphatases
are becoming understood. For instance, the tyrosine phosphatase CD45
functions in signaling from the lymphocyte antigen receptors by
specifically removing phosphate from a carboxy-terminal inhibitory
tyrosine residue from Lck (18, 26). The very restricted
pattern of CD45 expression to hematopoietic cells is consistent with
such a central role in cell signaling. For few tyrosine phosphatases has such a discrete molecular activity been defined.
The MAPK phosphatase/PAC1 family of dual-specificity phosphatases
target conserved phosphoserine and phosphothreonine residues found
within the activation motif of the MAPKs (17, 21-25, 34, 40-47,
49). MKP-1, the best-characterized member of this growing family, dephosphorylates ERK2, SAPK, and p38HOG
in transient-transfection studies (7). Its expression is
induced in U937 cells by PMA, coincident with the eventual inactivation of ERK and consistent with its presumed role as a MAPK repressor (10). Overexpression of MKP-1 prevents ERK activation and
prevents Ras-induced stimulation of DNA synthesis. Interestingly, mice deficient in this gene, unlike HePTP
/
mice,
still activate ERK normally, suggesting functional redundancy within
this gene family (7, 9, 35). The physiologic role of MKP-1
and others in this family of nuclear dual specificity phosphatases may
be both to reset MAPK signaling pathways and to regulate the relative
traffic through each of them. For example, SAPK activation induces
MKP-1 expression, inhibiting ERK activation, thereby limiting cell
division during times of cell stress (4).
HePTP is expressed only in the cytoplasm of cells of hematopoietic
origin, such as mature erythrocytes, macrophages, neutrophils, and
megakaryocytes, and also macrophagic progentor cells. Like MKP-1, its
expression is induced by mitogens, although the temporal profiles
differ. While MKP-1 expression is maximal 4 h after PMA stimulation of U937 cells, significant expression of HePTP is not
observed in primary lymphocytes until 24 h after
lipopolysaccharide or concanavalin A stimulation (10, 44).
To study the physiological role of HePTP in vivo, we generated and
evaluated mice in which HePTP was disrupted by homologous recombination. We demonstrated that ERK activation in
HePTP
/
mice is enhanced in response to TCR
stimulation and mitogens such as PMA. MEK activation after mitogen
stimulation is not HePTP dependent, suggesting that ERK is a
physiological target for this phosphatase but proximal signaling
elements are unaffected.
Since HePTP is expressed widely in mature hematopoietic cells, we
examined the development and function of bone marrow, peripheral blood,
and lymphoid tissues in HePTP
/
mice. We show
that HePTP
/
mice have normal hematopoiesis,
as indicated by bone marrow cultures. Lymphocyte subset numbers and
function are normal in HePTP
/
mice, as shown
by anti-CD3-induced proliferation and IL-2 production.
Marked physiological derangement of HePTP
/
mice induced by ERK activation may be attenuated through compensatory
biochemical pathways which become induced during development. The
consequences of physiologically inappropriate ERK activation may be
modified through the downregulation of ERK targets or the induction of counterbalancing signaling pathways in HePTP
/
mice. Opposite mechanisms may be operative in mice deficient in
p44ERK1, which appear normal, having only subtle
changes in thymocyte maturation (22). In these mice,
p44ERK2 activation and other alterations may
compensate for the deficiency of this major effector of mitogenic signaling.
While there are many examples of nuclear threonine/tyrosine
phosphatases, few cytoplasmic MAPK-targeted phosphatases have been
recognized. The neuron-specific tyrosine phosphatases PTP-SL and STEP
bind to ERK through a 14-residue KIM, consisting of the consensus motif
LQERRGSNVXLXLD (29). These two tyrosine
phosphatases extinguish ERK enzymatic activity and are themselves
phosphorylated by ERK. HePTP contains the sequence LQERRGSNVALMLD
(residues 16 to 30), which is consistent with its ability to associate
with ERK (44). These observations suggest that HePTP,
PTP-SL, and STEP have similar tissue-specific functions as cytoplasmic
regulators of ERK-dependent signaling cascades.
Hematopoietic cells are exposed to a spectrum of antigenic or cytokine
stimuli which may potentially induce all three families of MAPKs. ERK
stimulation, induced by both growth factors and mitogenic cytokines,
often propels cells into division or differentiation, while SAPK and
p38HOG activation may be associated with cell
growth delay, differentiation, or apoptosis. Additional intracellular
mechanisms of MAPK control are needed to integrate potentially
conflicting signals and allow a coordinated cell outcome. MAPK
phosphatases, such as the MKPs, PAC1, and HePTP, provide an additional
layer of regulation over MAPK-induced physiological responses to
extracellular stimuli. For instance, prolonged stimulation of
hematopoietic cells by inflammatory cytokines, a circumstance in which
HePTP is induced, may trigger relative stimulation of the SAPK pathway,
since HePTP preferentially inactivates ERK and
p38HOG. Unopposed SAPK or
p38HOG activation in this circumstance may lead
to growth arrest or apoptosis, thus limiting the inflammatory response.
Although HePTP is among the first examples of an inducible tyrosine
phosphatase that acts as a mammalian MAPK inhibitor, several have been
identified in S. cerevisiae, suggesting phylogenetic conservation of tyrosine phosphatase-induced control of MAPK
activation. The Schizosaccharomyces pombe MAPK StyI, like
mammalian MAPKs, becomes activated through dual phosphorylation,
initiating mitotic fission. StyI is regulated by the MAPK kinase Wis1,
which is sensitive to changes in external osmolarity. Under conditions
of hyperosmolality, Wis1 induces the transcription of pyp2, a tyrosine
phosphatase functionally redundant to pyp1, which specifically targets
StyI, resulting in its inactivation (21). Similarly, in
budding yeast, the tyrosine phosphatases PTP2 and PTP3 specifically
target the Hog1 MAPK, thereby inactivating the response to osmotic
stress. Similar to pyp2 in fission yeast, PTP2 and PTP3 are induced by osmotic stress, suggesting that they function in a negative feedback loop (41). We have shown that HePTP is induced by mitotic
stimuli such as PMA and concanavalin A in murine lymphocytes
(44). The regulation of mitotic signaling by HePTP is in
this way similar to the regulation of the yeast hyperosmolar response
by PTP2 and PTP3, suggesting conservation of a general signaling mechanism.
 |
ACKNOWLEDGMENTS |
This work was supported by grants from the National Cancer
Institute of Canada to B. Zanke. We thank T. W. Mak for assistance with homologous recombination experiments, Joseph Penninger for his
guidance in experiments evaluating T-cell proliferation and TCR-induced
ERK activation, Norman Iscove and Deborah Hyam for assistance with
experiments involving the hybridization of lineage blots and culture of
mouse bone marrow, Kaliannan Raju for assistance with T-helper 1 and 2 differentiation experiments, and Christine Quarrinton and her team at
the OCI Animal Resource Centre for assistance with animal care.
 |
FOOTNOTES |
*
Corresponding author. Present address: The Cross Cancer
Institute, 51160 University Avenue, Edmonton, Alberta T6G 1Z2, Canada. Phone: (780) 432-8771. Fax: (780) 432-8411. E-mail:
zanke{at}cancerboard.ab.ca.
 |
REFERENCES |
| 1.
|
Adachi, M.,
T. Torigoe,
M. Sekiya,
Y. Minami,
T. Taniguchi,
Y. Hinoda,
A. Yachi,
J. C. Reed, and K. Imai.
1995.
IL-2-induced gene expression of protein-tyrosine phosphatase LC-PTP requires acidic and serine-rich regions within IL-2 receptor beta chain.
FEBS Lett.
372:113-118[CrossRef][Medline].
|
| 2.
|
Ahn, N. G.,
R. Seger,
R. L. Bratlien, and E. G. Krebs.
1992.
Growth factor-stimulated phosphorylation cascades: activation of growth factor-stimulated MAPK.
CIBA Found. Symp.
164:113-126[Medline].
|
| 3.
|
Bergman, M.,
T. Mustelin,
C. Oetken,
T. Partanen,
N. A. Flint,
K. E. Amrein,
M. Autero,
P. Burn, and K. Alitalo.
1992.
The human p50csk tyrosine kinase phosphorylates p56lck at Tyr-505 and down regulates its catalytic activity.
EMBO J.
11:2919-2924[Medline].
|
| 4.
|
Bokemeyer, D.,
A. Sorokin,
M. Yan,
N. G. Ahn,
D. J. Templeton, and M. J. Dunn.
1996.
Induction of mitogen-activated protein kinase phosphatase 1 by the stress-activated protein kinase signaling pathway but not by extracellular signal-regulated kinase in fibroblasts.
J. Biol. Chem.
271:639-642[Abstract/Free Full Text].
|
| 5.
|
Borrego, F.,
J. Pena, and R. Solana.
1993.
Regulation of CD69 expression on human natural killer cells: differential involvement of protein kinase C and protein tyrosine kinases.
Eur. J. Immunol.
23:1039-1043[Medline].
|
| 6.
|
Camps, M.,
A. Nichols,
C. Gillieron,
B. Antonsson,
M. Muda,
C. Chabert,
U. Boschert, and S. Arkinstall.
1998.
Catalytic activation of the phosphatase MKP-3 by ERK2 mitogen-activated protein kinase.
Science
280:1262-1265[Abstract/Free Full Text].
|
| 7.
|
Chu, Y.,
P. A. Solski,
R. Khosravi-Far,
C. J. Der, and K. Kelly.
1996.
The mitogen-activated protein kinase phosphatases PAC1: MKP-1, and MKP-2 have unique substrate specificities and reduced activity in vivo toward the ERK2 sevenmaker mutation.
J. Biol. Chem.
271:6497-6501[Abstract/Free Full Text].
|
| 8.
|
Davis, R. J.
1993.
The mitogen-activated protein kinase signal transduction pathway.
J. Biol. Chem.
268:14553-14556[Free Full Text].
|
| 9.
|
Dorfman, K.,
D. Carrasco,
M. Gruda,
C. Ryan,
S. A. Lira, and R. Bravo.
1996.
Disruption of the ERP/MKP-1 gene does not affect mouse development: normal MAPK activity in ERP/MKP-1-deficient fibroblasts.
Oncogene
13:925-931[Medline].
|
| 10.
|
Franklin, C. C., and A. S. Kraft.
1997.
Conditional expression of the mitogen-activated protein kinase (MAPK) phosphatase MKP-1 preferentially inhibits p38 MAPK and stress-activated protein kinase in U937 cells.
J. Biol. Chem.
272:16917-16923[Abstract/Free Full Text].
|
| 11.
|
Galcheva-Gargova, Z.,
B. Derijard,
I. H. Wu, and R. J. Davis.
1994.
An osmosensing signal transduction pathway in mammalian cells.
Science
265:806-808[Abstract/Free Full Text].
|
| 12.
|
Greulich, H., and R. L. Erikson.
1998.
An analysis of Mek1 signaling in cell proliferation and transformation.
J. Biol. Chem.
273:13280-13288[Abstract/Free Full Text].
|
| 13.
|
Hanks, S. K.,
A. M. Quinn, and T. Hunter.
1988.
The protein kinase family: Conserved features and deduced phylogeny of the catalytic domains.
Science
241:42-52[Abstract/Free Full Text].
|
| 14.
|
Heiskanen, M. A.,
M. L. Bittner,
Y. Chen,
J. Khan,
K. E. Adler,
J. M. Trent, and P. S. Meltzer.
2000.
Detection of gene amplification by genomic hybridization to cDNA microarrays.
Cancer Res.
60:799-802[Abstract/Free Full Text].
|
| 15.
|
Hughes, T. R.,
C. J. Roberts,
H. Dai,
A. R. Jones,
M. R. Meyer,
D. Slade,
J. Burchard,
S. Dow,
T. R. Ward,
M. J. Kidd,
S. H. Friend, and M. J. Marton.
2000.
Widespread aneuploidy revealed by DNA microarray expression profiling.
Nat. Genet
25:333-337[CrossRef][Medline].
|
| 16.
|
Jiang, Y.,
Z. Li,
E. M. Schwarz,
A. Lin,
K. Guan,
R. J. Ulevitch, and J. Han.
1997.
Structure-function studies of p38 mitogen-activated protein kinase. Loop 12 influences substrate specificity and autophosphorylation, but not upstream kinase selection.
J. Biol. Chem.
272:11096-11102[Abstract/Free Full Text].
|
| 17.
|
Keyse, S. M.
1995.
An emerging family of dual specificity MAPK phosphatases.
Biochim. Biophys. Acta
1265:152-160[Medline].
|
| 18.
|
Kishihara, K.,
J. Penninger,
V. A. Wallace,
T. M. Kundig,
K. Kawai,
A. Wakeham,
E. Timms,
K. Pfeffer,
P. S. Ohashi,
M. L. Thomas,
C. Furlonger,
C. J. Paige, and T. W. Mak.
1993.
Normal B lymphocyte development but impaired T cell maturation in CD45-exon6 protein tyrosine phosphatase-deficient mice.
Cell
74:143-156[CrossRef][Medline].
|
| 19.
|
Kyriakis, J. M.,
P. Banerjee,
E. Nikolakaki,
T. Dai,
E. A. Rubie,
M. F. Ahmad,
J. Avruch, and J. R. Woodgett.
1994.
The stress-activated protein kinase subfamily of c-Jun kinases.
Nature
369:156-160[CrossRef][Medline].
|
| 20.
|
Lange-Carter, C. A.,
C. M. Pleiman,
A. M. Gardner,
K. J. Blumer, and G. L. Johnson.
1993.
A divergence in the MAPK regulatory network defined by MEK kinase and Raf.
Science
260:315-319[Abstract/Free Full Text].
|
| 21.
|
Millar, J. B. A.,
V. Buck, and M. G. Wilkinson.
1995.
Pyp1 and Pyp2 PTPases dephosphorylate an osmosensing MAPK controlling cell size at division in fission yeast.
Genes Dev.
9:2117-2130[Abstract/Free Full Text].
|
| 22.
|
Morgan, D. O.
1997.
Cyclin-dependent kinases: engines, clocks, and microprocessors.
Annu. Rev. Cell Dev. Biol.
13:261-291[CrossRef][Medline].
|
| 23.
|
Muda, M.,
R. Boschert,
R. Dickinson,
J. C. Martinou,
I. Martinou,
M. Camps,
W. Schlegel, and S. Arkinstall.
1996.
MKP-3: a novel cytosolic protein tyrosine phosphatase that exemplifies a new class of mitogen activated protein kinase phosphatase.
J. Biol. Chem.
271:4319-4326[Abstract/Free Full Text].
|
| 24.
|
Muda, M.,
U. Boschert,
A. Smith,
B. Antonsson,
C. Gillieron,
C. Chabert,
M. Camps,
I. Martinou,
A. Ashworth, and S. Arkinstall.
1997.
Molecular cloning and functional characterization of a novel mitogen-activated protein kinase phosphatase, MKP-4.
J. Biol. Chem.
272:5141-5151[Abstract/Free Full Text].
|
| 25.
|
Muda, M.,
A. Theodosiou,
N. Rodrigues,
U. Boschert,
M. Camps,
C. Gillieron,
K. Davies,
A. Ashworth, and S. Arkinstall.
1996.
The dual specificity phosphatases M3/6 and MKP-3 are highly selective for inactivation of distinct mitogen-activated protein kinases.
J. Biol. Chem.
271:27205-27208[Abstract/Free Full Text].
|
| 26.
|
Mustelin, T.,
K. M. Coggeshall, and A. Altman.
1989.
Rapid activation of the T-cell tyrosine protein kinase pp56lck by the CD45 phosphotyrosine phosphatase.
Proc. Natl. Acad. Sci. USA
86:6302-6306[Abstract/Free Full Text].
|
| 27.
|
Payne, D. M.,
A. J. Rossomando,
P. Martino,
A. K. Erickson,
J. H. Her,
J. Shabanowitz,
D. F. Hunt,
M. J. Weber, and T. W. Sturgill.
1991.
Identification of the regulatory phosphorylation sites in pp42/mitogen-activated protein kinase (MAPK).
EMBO J.
10:885-892[Medline].
|
| 28.
|
Posada, J., and J. A. Cooper.
1992.
Requirements for phosphorylation of MAPK during meiosis in Xenopus oocytes.
Science
255:212-215[Abstract/Free Full Text].
|
| 29.
|
Pulido, R.,
A. Zuniga, and A. Ullrich.
1998.
PTP-SL and STEP protein tyrosine phosphatases regulate the activation of the extracellular signal-regulated kinases ERK1 and ERK2 by association through a kinase interaction motif.
EMBO J.
17:7337-7350[CrossRef][Medline].
|
| 30.
|
Roberts, C. J.,
B. Nelson,
M. J. Marton,
R. Stoughton,
M. R. Meyer,
H. A. Bennett,
Y. D. He,
H. Dai,
W. L. Walker,
T. R. Hughes,
M. Tyers,
C. Boone, and S. H. Friend.
2000.
Signaling and circuitry of multiple MAPK pathways revealed by a matrix of global gene expression profiles.
Science
287:873-880[Abstract/Free Full Text].
|
| 31.
|
Sanchez, I.,
R. T. Hughes,
B. J. Mayer,
K. Yee,
J. R. Woodgett,
J. Avruch,
J. M. Kyriakis, and L. I. Zon.
1994.
Role of SAPK/ERK kinase-1 in the stress-activated pathway regulating transcription factor c-Jun.
Nature
372:794-798[Medline].
|
| 32.
|
Saxena, M.,
S. Williams,
J. Gilman, and T. Mustelin.
1998.
Negative regulation of T cell antigen receptor signal transduction by hematopoietic tyrosine phosphatase (HePTP).
J. Biol. Chem.
273:15340-15344[Abstract/Free Full Text].
|
| 33.
|
Seger, R., and E. G. Krebs.
1995.
The MAPK signaling cascade.
FASEB J.
9:726-735[Abstract].
|
| 34.
|
Sun, H.,
C. H. Charles,
L. F. Lau, and N. K. Tonks.
1993.
MKP-1 (3CH134), an immediate early gene product, is a dual specificity phosphatase that dephosphorylates MAPK in vivo.
Cell
75:487-493[CrossRef][Medline].
|
| 35.
|
Sun, H.,
N. K. Tonks, and D. Bar-Sagi.
1994.
Inhibition of Ras-induced DNA synthesis by expression of the phosphatase MKP-1.
Science
266:285-288[Abstract/Free Full Text].
|
| 36.
|
Sutherland, C. L.,
A. W. Heath,
S. L. Pelech,
P. R. Young, and M. R. Gold.
1996.
Differential activation of the ERK, JNK, and p38 mitogen-activated protein kinases by CD40 and the B cell antigen receptor.
J. Immunol.
157:3381-3390[Abstract].
|
| 37.
|
Terada, K.,
Y. Kaziro, and T. Satoh.
1997.
Ras-dependent activation of c-Jun N-terminal kinase/stress-activated protein kinase in response to interleukin-3 stimulation in hematopoietic BaF3 cells.
J. Biol. Chem.
272:4544-4548[Abstract/Free Full Text].
|
| 38.
|
Thomas, K. R., and M. R. Capecchi.
1987.
Site-directed mutagenesis by gene targeting in mouse embryo-derived stem cells.
Cell
51:503-512[CrossRef][Medline].
|
| 39.
|
Trevisan, M., and N. N. Iscove.
1995.
Phenotypic analysis of murine long-term hemopoietic reconstituting cells quantitated competitively in vivo and comparison with more advanced colony-forming progeny.
J. Exp. Med.
181:93-103[Abstract/Free Full Text].
|
| 40.
|
Ward, Y.,
S. Gupta,
P. Jensen,
M. Wartmann,
R. J. Davis, and K. Kelly.
1994.
Control of MAPK activation by the mitogen-induced threonine/ tyrosine phosphatase PAC1.
Nature
367:651-654[CrossRef][Medline].
|
| 41.
|
Wurgler-Murphy, S. M.,
T. Maeda,
E. A. Witten, and H. Saito.
1997.
Regulation of the Saccharomyces cerevisiae HOG1 mitogen-activated protein kinase by the PTP2 and PTP3 protein tyrosine phosphatases.
Mol. Cell. Biol.
17:1289-1297[Abstract].
|
| 42.
|
Yan, M.,
T. Dai,
J. C. Deak,
J. M. Kyriakis,
L. I. Zon,
J. R. Woodgett, and D. J. Templeton.
1994.
Activation of stress-activated protein kinase by MEKK1 phosphorylation of its activator SEK1.
Nature
372:798-800[Medline].
|
| 43.
|
Zanke, B. W.,
E. A. Rubie,
K. Boudreau,
M. McGinnis,
M. Yan,
D. J. Templeton, and J. R. Woodgett.
1996.
Insulation of mammalian MAPK pathways through formation of specific kinase:activator complexes.
J. Biol. Chem.
271:29876-29881[Abstract/Free Full Text].
|
| 44.
|
Zanke, B. W.,
H. Suzuki,
K. Kishihara,
L. Mizzen,
M. Minden,
A. Pawson, and T. W. Mak.
1992.
Cloning and expression of an inducible lymphoid-specific, protein tyrosine phosphatase (HePTPase).
Eur. J. Immunol.
22:235-239[Medline].
|
Molecular and Cellular Biology, October 2001, p. 6851-6858, Vol. 21, No. 20
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.20.6851-6858.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
McAlees, J. W., Sanders, V. M.
(2009). Hematopoietic Protein Tyrosine Phosphatase Mediates {beta}2-Adrenergic Receptor-Induced Regulation of p38 Mitogen-Activated Protein Kinase in B Lymphocytes. Mol. Cell. Biol.
29: 675-686
[Abstract]
[Full Text]
-
Zhang, Y.-Y., Mei, Z.-Q., Wu, J.-W., Wang, Z.-X.
(2008). Enzymatic Activity and Substrate Specificity of Mitogen-activated Protein Kinase p38{alpha} in Different Phosphorylation States. J. Biol. Chem.
283: 26591-26601
[Abstract]
[Full Text]
-
Nika, K., Charvet, C., Williams, S., Tautz, L., Bruckner, S., Rahmouni, S., Bottini, N., Schoenberger, S. P., Baier, G., Altman, A., Mustelin, T.
(2006). Lipid Raft Targeting of Hematopoietic Protein Tyrosine Phosphatase by Protein Kinase C {theta}-Mediated Phosphorylation.. Mol. Cell. Biol.
26: 1806-1816
[Abstract]
[Full Text]
-
Kovanen, P. E., Young, L., Al-Shami, A., Rovella, V., Pise-Masison, C. A., Radonovich, M. F., Powell, J., Fu, J., Brady, J. N., Munson, P. J., Leonard, W. J.
(2005). Global analysis of IL-2 target genes: identification of chromosomal clusters of expressed genes. Int Immunol
17: 1009-1021
[Abstract]
[Full Text]
-
Schade, A. E., Levine, A. D.
(2004). Cutting Edge: Extracellular Signal-Regulated Kinases 1/2 Function as Integrators of TCR Signal Strength. J. Immunol.
172: 5828-5832
[Abstract]
[Full Text]
-
Rintelen, F., Hafen, E., Nairz, K.
(2003). The Drosophila dual-specificity ERK phosphatase DMKP3 cooperates with the ERK tyrosine phosphatase PTP-ER. Development
130: 3479-3490
[Abstract]
[Full Text]
-
Shen, R., Ouyang, Y.-B., Qu, C.-K., Alonso, A., Sperzel, L., Mustelin, T., Kaplan, M. H., Feng, G.-S.
(2002). Grap Negatively Regulates T-Cell Receptor-Elicited Lymphocyte Proliferation and Interleukin-2 Induction. Mol. Cell. Biol.
22: 3230-3236
[Abstract]
[Full Text]