Previous Article | Next Article 
Molecular and Cellular Biology, October 2001, p. 7035-7046, Vol. 21, No. 20
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.20.7035-7046.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Induction of Distinct [URE3] Yeast
Prion Strains
Martin
Schlumpberger,1,2
Stanley B.
Prusiner,1,2,3,* and
Ira
Herskowitz3
Institute for Neurodegenerative
Diseases1 and Departments of
Neurology2 and Biochemistry and
Biophysics,3 University of California, San
Francisco, California 94143-0518
Received 7 May 2001/Returned for modification 4 June 2001/Accepted 18 July 2001
 |
ABSTRACT |
[URE3] is a non-Mendelian genetic element in
Saccharomyces cerevisiae, which is caused by a
prion-like, autocatalytic conversion of the Ure2 protein (Ure2p) into
an inactive form. The presence of [URE3] allows yeast
cells to take up ureidosuccinic acid in the presence of ammonia. This
phenotype can be used to select for the prion state. We have developed
a novel reporter, in which the ADE2 gene is controlled
by the DAL5 regulatory region, which allows monitoring
of Ure2p function by a colony color phenotype. Using this reporter, we
observed induction of different [URE3] prion variants
("strains") following overexpression of the N-terminal Ure2p
prion domain (UPD) or full-length Ure2p. Full-length Ure2p induced two
types of [URE3]: type A corresponds to conventional [URE3], whereas the novel type B variant is
characterized by relatively high residual Ure2p activity and efficient
curing by coexpression of low amounts of a UPD-green fluorescent
protein fusion protein. Overexpression of UPD induced type B
[URE3] but not type A. Both type A and B
[URE3] strains, as well as weak and strong isolates of
type A, were shown to stably maintain different prion strain characteristics. We suggest that these strain variants result from
different modes of aggregation of similar Ure2p monomers. We also
demonstrate a procedure to counterselect against the
[URE3] state.
 |
INTRODUCTION |
The [URE3]
state was first described in 1971 (29) as a new phenotype
inherited in a non-Mendelian manner, but the underlying genetic basis
for its unusual mode of inheritance remained enigmatic for more than 20 years. In 1994, Wickner suggested protein conformation-based inheritance of [URE3] by a prion-like conversion of Ure2
protein (Ure2p) into an inactive form (54). This
hypothesis was based on three observations. First, cells can be cured
of the [URE3] state by growth in the presence of
millimolar concentrations of guanidine, but after curing the phenotype
can reappear spontaneously, with a frequency similar to that of
untreated wild-type cells. Second, [URE3] appears at
higher frequencies when Ure2p is overexpressed. Third, the phenotype
caused by [URE3] is identical to that of a ure2
deletion mutant, and yet [URE3] appearance and maintenance depend on the expression of Ure2p. Wickner also proposed that a second
non-Mendelian state in Saccharomyces cerevisiae,
termed [PSI], was caused by a similar autocatalytic
inactivation of the Sup35 protein (Sup35p), which is involved in
translation termination in yeast.
Since then, numerous studies have provided further support for this
model. The prion isoforms of Ure2p and Sup35p acquire partial
resistance to proteinase K (33, 37, 39). Using fusion proteins with green fluorescent protein (GFP), it has been shown that
both proteins form aggregates in vivo in cells displaying the
respective prion phenotype but not in wild-type cells (19, 37). Both proteins also form amyloid-like aggregates in vitro (22, 27, 43, 47, 51), a process that can be seeded by preformed aggregates and by extracts from cells in the prion state (22, 38). All prion-like characteristics of Ure2p and
Sup35p depend upon the presence of an N-terminal prion domain that is dispensable for the normal function of either protein (33,
49). In both cases, the prion domain contains a high level of
polar uncharged amino acids, in particular, asparagine and glutamine. In vitro, the Ure2p prion domain (UPD) promotes not only its own aggregation but also the refolding of other sequences attached to it
(43). Similar polar uncharged domains of other yeast
proteins have been shown to support a prion state, either in their
native contexts or when they replace the prion domain of Sup35p
(52, 55), indicating that prion-like phenomena might be
more widespread in nature than previously assumed. Other features
characteristic of mammalian prion diseases have been reproduced in the
[URE3] and [PSI] systems, such as mutations
that can favor or disfavor prion formation and propagation (13,
18, 21, 30) and, in the case of [PSI], the
existence of a species barrier (6, 28, 42). Furthermore,
Hsp104p (7, 34) and a number of other chaperone proteins
in yeast (8, 35) have been shown to influence the
induction and maintenance of [PSI] and
[URE3]. A recent study demonstrated induction of
[PSI] by transfection with in vitro aggregated Sup35 prion
domain (45). These experiments provide direct evidence for
the central point of the protein-only hypothesis, that a purely
proteinaceous particle can show infectious behavior due to an
autocatalytically propagating abnormal configuration.
For mammalian prions, different strains have been described that cause
disease forms that differ in incubation time as well as in clinical
symptoms and brain pathology (17). The occurrence of such
strains, which requires invoking the existence of multiple stable
conformations of a protein, has long been used as an argument against
the protein-only hypothesis (4, 9). Considerable evidence
supports the argument that strain characteristics are enciphered in the
disease-causing isoform of the prion protein in mammals (2, 36,
40, 41, 44, 48). Strain variants of [PSI] which
differ in mitotic stability and the efficiency of nonsense suppression
have been demonstrated previously (16). However, the
molecular basis for this strain difference is not known. Demonstration
of clearly distinguishable and stably maintained variants of yeast
prion states would provide an opportunity to determine how prion strain
differences can be enciphered by protein conformation.
Ure2p in yeast is a negative regulator of the utilization of poor
nitrogen sources in the presence of preferred nutrients such as ammonia
or glutamine (12, 32). As a consequence of regulation by
Ure2p, cells are unable to import ureidosuccinic acid (USA) in the
presence of ammonia. In ure2 mutant cells, USA can
substitute for uracil to allow ura2 mutants to grow on
minimal medium in the presence of ammonia. This phenotype can therefore be used to select for the loss of Ure2p function in a ura2
mutant background. The target for Ure2p activity is the transcriptional activator Gln3p, a GATA-type zinc finger protein essential for the
expression of a wide range of genes involved in nitrogen uptake and
metabolism (32). Current data indicate that Ure2p acts by binding Gln3p in the cytoplasm, thereby sequestering it away from the
nucleus (1). Here, we demonstrate a new colony color
reporter for Ure2p function, which allows the observation of at least
two distinct types of [URE3] strains. Transient
overexpression of full-length Ure2p induced both types of
[URE3], whereas overexpression of UPD induced only one
type of [URE3]. These observations allow us to speculate
about how prion strains can be enciphered and how the initial
conversion of Ure2p to the prion state occurs in yeast cells.
 |
MATERIALS AND METHODS |
Reagents and media.
Enhanced chemiluminescence reagents and
horseradish peroxidase-conjugated donkey anti-rabbit antiserum were
obtained from Amersham Pharmacia Biotech (Piscataway, N.J.). The
antiserum to Ure2p was described previously (43). Other
reagents were purchased from Sigma-Aldrich (St. Louis, Mo.).
Standard yeast media, cultivation conditions, and methods were employed
(24). Yeast cells were grown at 30°C.
USA+ strains were maintained in minimal medium,
consisting of 0.67% yeast nitrogen base without amino acids (Difco),
2% glucose, the required amino acids, and 100 mg of USA/liter. The
color phenotype was assayed on standard yeast extract-peptone-dextrose
(YPD) plates made from 1% Bacto yeast extract, 2% Bacto peptone, 2%
glucose, and 2% Bacto agar. To induce [URE3] by
overexpression, strains carrying plasmids pMS46, pMS57, or pRW680 were
grown in glucose-free media containing 2% galactose for 24 to 48 h prior to plating on USA medium containing glucose. All
USA+ isolates were cured of the overexpressing
plasmids prior to detailed phenotypical characterization. Cytoduction
experiments were performed as described previously (24).
In each case, strain YRW3383 carrying the kar1-1
mutation was used as either the donor or acceptor strain. As acceptor
strains, [rho0] derivatives of YRW3383
and YMS23 were isolated after ethidium bromide treatment
(24). For maximum cytoduction efficiency, donor strains
were grown on USA medium prior to mating. Cytoductants were identified
as showing the acceptor genotype, showing the corresponding mating
type, and being restored to [RHO+].
Counterselection against the [URE3] state.
Any drug whose uptake is regulated by the Ure2p-Gln3p system could be
used potentially for assaying Ure2p function. Substances that are
essential for growth, such as USA in ura2 mutants, allow positive selection for the prion state on plates containing ammonia as
the primary nitrogen source. Conversely, a toxic substance can be used
to select against [URE3], potentially allowing the identification of conditions or gene products that cure cells of the
prion state. High levels of
-aminoadipate (
-AA) are toxic for
yeast cells carrying wild-type alleles of both the LYS2 and LYS5 genes but only in the absence of ammonia (24,
56). Therefore, we tested whether uptake of
-AA is regulated
by Ure2p. Indeed, a strain carrying a chromosomal deletion of
URE2 was unable to grow on
-AA plates containing ammonia,
whereas a wild-type strain was unaffected by the drug. When a variety
of [URE3] strains was tested for growth on
-AA in the
presence of ammonia, in all cases, colonies still formed at an
efficiency up to 1,000-fold lower than that of the wild type.
When colonies from these plates were tested on USA, they were found to
be cured of the prion state. Therefore, colony formation by
[URE3] strains on
-AA is due to instability of the
prion phenotype. Although this spontaneous loss of the prion state
limits the usefulness of counterselection for screening purposes, it
was found to be a valuable tool for estimating the relative strength
and stability of [URE3] isolates (see Fig. 3). To select
for strains with functional Ure2p, minimal medium containing 2 g
of
-AA/liter and standard ammonia concentrations was used.
Plasmid construction.
To construct plasmids pMS40 and pMS41,
the UPD fragment of URE2 was amplified by PCR using primers
UPD1 (5'-GGATCCTCTAGACATGATGAATAACAACGGCAACC-3') and
UPD2 (5'-CAGTGCCAAGCTTTGGCTTTGGCTACCATTGCGGC-3'). The
product was cut with HindIII/XbaI and
inserted into plasmids YEp351 (26) and YEp351G
(pRW554) (54), respectively. The oligonucleotide Ssp-Stop
(5'-AGCTGATAATATTATC-3') was inserted into the
HindIII site of pMS40 and pMS41 to yield plasmids
pMS59 and pMS46, respectively. The PCR product of primers UPD1 and
URE2-T (5'-CTTTATTGAAAGCTTCAGATCTACAGTGACAACACCC-3') was cut
with NotI/HindIII and inserted into pMS41 to
obtain pMS57. The promoter and open reading frame of URE2
were amplified using the overlapping primer pairs P-URE+
(5'-TGGTCTGAGCTCGCGAAAAAGAAAAAGGGC-3') and
ATG-URE
(5'-GCCGTTGTTATTCATCATGTCTAGAACAACTTAATTTGCAGC-3') and
ATG-URE+ (5'-GCTGCAAATTAAGTTGTTCTAGACATGATGAATAACAACGGC-3') and
URE2-T2 (5'-TGAAAGCTGCAGATCTACAGTGACAACACCC-3'). These were recombined
in a second PCR step, cut with SacI/PstI, and
inserted into pFL36 (3) to yield plasmid pMS64. A 0.7-kb
SacI/XbaI fragment from pMS64 was inserted into
pMS59 to obtain pMS68, and a 2-kb SacI/BglII
fragment from pMS64 was inserted into YEp351 to produce pMS82. To
construct the PDAL5ADE2 reporter, a
segment comprising 561 bp upstream of the DAL5 gene and the
ADE2 open reading frame was amplified using the overlapping
primer pairs PDAL+ (5'-CTTTTACATCAGCACAATATCC-3') and
DAL-ADE
(5'-CCAACTGTTCTAGAATCCATCTGCAGTTTTTTTTTTTACACTATTTG-3') and DAL-ADE+
(5'-CAAATAGTGTAAAAAAAAAAACTGCAGATGGATTCTAGAACAGTTGG-3') and
T-ADE
(5'-CTGCATGTCGACGCCTTATATGAACTGTATCG-3'). These were recombined in a second PCR step, cut with
BamHI/SalI, and introduced into YEp351 to obtain
pMS86. A 2.6-kb BamHI/SalI fragment from pMS86
was then inserted into YIp5 and pRS313 to obtain plasmids pMS87 and
pMS90, respectively. All constructs were checked by sequencing.
Plasmids pRW680, pVTG12, and pH327 were generously provided by R. B. Wickner. The plasmids used in this study are listed in Table
1.
Strain construction.
The URA2 gene in
strain W303 was replaced by a
loxP- kanr-loxP
cassette generated by PCR using primers URA2
lox-1
(5'- TAAACCTTACCTAATAGAATATAACAATCATAATATGGCCGCAT AGGCCACTAGTGGATCTG-3')
and URA2
lox-2
(5'-TATAAATTTAAAA TACGGATAGGTCTCTTATCATTCACATCAGCTGAAGCTTCGTACGC- 3')
and pUG6 as templates (23), generating strain YMS11. After removal of the kanr marker by Cre
recombinase action using plasmid pSH47 (23) to produce
YMS12, the same system was used to replace the URE2 gene by
a loxP-kanr-loxP
cassette generated using primers URE2
lox-1
(5'-ATTGTTTTAAGCTGCA AATTAAGTTGTACACCAAATGATGGCATAGGCCACTAGTGGATCTG- 3')
and URE2
lox-2 (5'-CCTTCTTCTTTCTTTCTTGTTTTTAAAGCAGCCTTCATTCCAGCTGAAGCTTCGTACGC-3') to obtain strain YMS13. Correct replacement of the target sequence in
all three strains was confirmed by Southern blotting and PCR. Plasmid
YIp5 was linearized using StuI and integrated into YMS12 at
the URA3 locus to yield strain YMS15. Plasmid pMS87 was also linearized using StuI and integrated into YMS12 and YMS13 to
obtain strains YMS23 and YMS24, respectively. Transformants from this step were selected on minimal medium containing USA in the absence of
ammonia. Strains YRW3560 (33) and YRW3383
(54) were generously provided by R. B. Wickner.
Strain YCC34 (21) was generously provided by C. Cullin.
The strains used in this study are listed in Table
2.
Proteinase K digestion.
Crude extracts were prepared from
cells grown in USA medium (supplemented with uracil for wild-type
controls) to an optical density at 600 nm (OD600 of 1 to
1.5. Briefly, an amount of cells corresponding to 20 ml of culture at
an OD600 of 1 was washed, resuspended in 400 µl of TNT
buffer (25 mM Tris-HCl [pH 7.4], 100 mM NaCl, 0.2% Triton X-100),
and vortexed with 200 µl of acid-washed glass beads (425- to
600-µm-diameter; Sigma) for 20 min at 4°C. No protease
inhibitors were added. Extracts were cleared by spinning at 6,000 × g for 10 min at 4°C, and then they were immediately frozen on dry ice. Protein concentration was determined using the BCA
assay system (Pierce). For ultracentrifugation, 250 µg of total
protein in 100 µl of TNT buffer was spun at 100,000 × g for 1 h, the supernatant was transferred to a fresh
tube, and the pellet fraction was resuspended in 100 µl of TNT
buffer. Twenty-five microliters of 5× sample buffer was added, and
samples were boiled for 5 min. For proteinase K digestion, 150 µg of
total protein from the same extracts was diluted to 54 µl in TNT
buffer, mixed with 6 µl of appropriate serial dilutions of the
proteinase, and incubated at 37°C for 30 min. Digestion was stopped
by the addition of phenylmethylsulfonyl fluoride to a concentration of
1 mM, then 15 µl of 5× sample buffer was added, and the mixture was
boiled for 5 min. Urea was added to each sample to a final
concentration of at least 7 M. Prior to loading, the samples were again
boiled for 5 min. For electrophoresis, 25 µl (50 µg) of samples was
used per lane. Electrophoresis, Western blotting, and immunodetection were performed as previously described (43). All blots
were treated with 0.2 M NaOH for 30 min to ensure detection of all Ure2p fragments.
 |
RESULTS |
Reporter system for [URE3].
So far, the only
commonly used way to detect the [URE3] prion state has
been selection for growth on USA media. Because the assay is based on
selection, it does not allow easy visualization of spontaneous loss or
curing of the prion state. Cells without active Ure2p also secrete
uracil into the medium (29, 34), and consumption of the
available ammonia can diminish Ure2p activity. Both of these contribute
to considerable background growth on USA medium. In addition, the
selection assay cannot distinguish different levels of residual Ure2p
activity, since growth rates on USA might be negatively affected by the
accumulation of abnormally folded protein as well as by the rate of USA uptake.
To facilitate the study of [
URE3], an
ADE2-based reporter for Ure2p activity was designed (Fig.
1). Strains deficient in
ADE2 are auxotrophic for adenine and accumulate a red pigment when
grown on
media where adenine is limiting (such as YPD complete
medium), whereas
wild-type strains are adenine prototrophic and
form white colonies. The
reporter consists of
ADE2 under the control
of the
Ure2p-regulated
DAL5 promoter. The
DAL5 promoter
was chosen
for two reasons. First, unlike other genes regulated by
nitrogen
sources,
DAL5 expression appears to be unaffected
by specific
substrates other than the presence or absence of good
nitrogen
sources (
11,
32). Second, the
DAL5
gene product is the transporter
responsible for uptake of USA
(
53) and whose regulation allows
selection for
[
URE3] strains. The color phenotype generated by
such a
PDAL5ADE2 reporter can therefore be
expected to report
the prion state with similar accuracy.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 1.
ADE2 reporter for Ure2p function. (A)
Structure of the reporter construct. Base numbering starts with the
start codon of the ADE2 opening reading frame as +1. The
561-bp segment amplified from the genomic region upstream of the
DAL5 start codon contains the binding sites for Gln3p.
Sequences between +1 and +1985 were amplified from the genomic
ADE2 sequence. The ADE2 open reading
frame ends at position 1716. (B) Regulation of the reporter. In the
presence of ammonia, Ure2p binds Gln3p and prevents transcription from
the DAL5 regulatory region. Colonies are red due to the
lack of Ade2p. (C) In the [URE3] state, Ure2p is
aggregated and inactive. Gln3p can now activate transcription of
ADE2, resulting in lighter colony color and adenine
prototrophy.
|
|
When an integrated version of the reporter pMS87, based on the yeast
plasmid YIp5, was introduced into the
ade2 yeast strain
YMS15, the resulting strain YMS23 formed red colonies. On medium
without adenine, the cells were able to form microcolonies (data
not
shown), indicating some leakiness of the repression by Ure2p.
In
contrast, YMS24, which contains pMS87 integrated into the
ure2 deletion mutant YMS13, was able to grow in the absence
of adenine
with an efficiency similar to that of the wild type (data
not
shown) and formed colonies on YPD medium that were almost
completely
white (Fig.
2). Strain YMS24
transformed with plasmid pMS64, which
expresses Ure2p from a
single-copy plasmid under the control of
its own promoter, formed red
colonies on YPD with occasional white
sectors, indicating a loss of the
URE2 plasmid. These results
demonstrate that the
chromosomally integrated version of the
ADE2 reporter is
efficiently regulated by Ure2p activity.

View larger version (132K):
[in this window]
[in a new window]
|
FIG. 2.
Cytoduction of [URE3] into reporter
strain YMS23. The [URE3] element was introduced into
strain YMS23 from strains YCC34 and YRW3560 by cytoduction.
Representative cytoductants displaying the [URE3]
phenotype were streaked on YPD. Sectors: wt, wild-type; 1 to 3, cytoductants from YCC34 (UFL); 4 to 6, cytoductants from YRW3560 (URW);
y24, ure2 deletion strain YMS24.
|
|
In contrast, when this
PDAL5ADE2
reporter was placed on a 2µm-based, multicopy plasmid (pMS86) and
transformed into the yeast
strain YMS15, the resulting strain became
Ade
+ and white, indicating that the construct is
not downregulated
efficiently by Ure2p. Even colonies of cells carrying
the reporter
construct on a
CEN-based, single-copy vector
(pMS90), were completely
white (data not
shown).
Previously described [URE3] isolates.
To test
the usefulness of the new reporter system in monitoring
[URE3], the prion elements from two strains, YRW3560
(33) and YCC34 (21) were transferred by
cytoduction into YMS23. Cytoduction allows cytoplasmic mixing of two
yeast strains without the exchange of chromosomal DNA.
[URE3] in YCC34 represents the isolate originally described by Lacroute (29). Cytoductant clones obtained
from this donor strain are hereafter referred to as UFL; those from YRW3560, an isolate originally described by Masison and Wickner (33) are hereafter referred to as URW. Cytoductants
carrying the prion element from both sources were able to grow on USA
and formed pink colonies on YPD medium. The obtained clones differed somewhat in color from each other, but both were at least slightly darker than the ure2 mutant strain, indicating that
inactivation of Ure2p was not complete (Fig. 2). Despite some variation
in colony color (Fig. 2, compare sectors 5 and 6), all UFL cytoductants were lighter in color than URW cytoductants, indicating that some difference between the two prion isolates is stably inherited, similar
to strain variants observed for the [PSI] yeast prion (16). UFL thus appears to confer a more severe reduction
of Ure2p function than does URW.
When [
URE3] cells were plated on nonselective YPD plates,
spontaneous loss of the prion state could easily be observed by
the
formation of red colonies or red sectors in pink colonies.
Cells from
such red sectors were tested on USA and found to be
unable to grow, as
was expected. Sectored colonies were particularly
abundant when cells
were plated directly from USA medium onto
YPD. Up to 50% of all
colonies showed sectoring, confirming that
the stability of
[
URE3] is considerably lower than that observed
for
[
PSI] using a similar colony color phenotype (see Fig. 3B
in reference
16 for comparison). In contrast, when
cells were
grown in YPD prior to plating on YPD, most of the colonies
were
either homogeneously pink or red, indicating that the change from
USA to YPD medium causes some loss of [
URE3]. Spontaneous
loss
of [
URE3] is also apparent in sectors 1 to 6 in Fig.
2, which
contain the cytoductant
clones.
Induction of new [URE3] by overexpression of Ure2p
or UPD.
Overexpression of either Ure2p or UPD in YMS23 resulted in
greatly elevated frequencies of [URE3] appearance, as
reported previously (33). Clones growing on USA were
isolated from strains carrying a multicopy plasmid expressing UPD or
Ure2p under control of the strong, inducible GAL1 promoter
(pMS46 and pMS57, respectively). When transferred to YPD plates,
USA+ clones isolated from the strain
overexpressing full-length Ure2p displayed various shades of pink, from
almost white to dark pink or red (Fig.
3). In striking contrast,
USA+ clones isolated from the UPD overexpressing
strain were all red and indistinguishable from the parental wild-type
strain. Apparently, in these red isolates, Ure2p activity is low enough
to allow uptake of USA but not low enough to produce a sufficient level
of Ade2p to prevent accumulation of the red pigment. The difference in the spectrum of induced USA+ phenotypes was
reproducible in several experiments using different overexpressing
plasmids. Specifically, plasmids pMS68 (expressing UPD under the
control of the URE2 promoter from a 2µm plasmid) and
pRW680 (equivalent to pMS46, which expresses a slightly shorter UPD
fragment) also produced red USA+ isolates, which
were indistinguishable by color from wild-type colonies.

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 3.
Color phenotypes of new [URE3] elements
induced by overexpression. Clones isolated following overexpression of
UPD are on the left, and clones isolated following overexpression of
full-length Ure2p are on the right. Wild-type (wt) YMS23 and
ure2 mutant (U11) cells are included as color controls.
U46, U47, U57, and U58 are the clones used for phenotypic
characterization (see text). Clones 1 to 8 and 9 to 16 were randomly
selected from a second, independent overexpression experiment using the
same plasmids. Colonies were picked from USA plates, purified, and
streaked on YPD.
|
|
Characterization of USA+ clones.
In order to
further elucidate the differences between these prion strain variants,
four representative clones were initially chosen for further
characterization: U46 and U47 were induced by UPD overexpression from
pMS46 and formed red colonies; and U57 and U58 were induced by Ure2p
expressed from pMS57 and formed light pink and pink colonies,
respectively (Fig. 3). The UFL and URW isolates obtained by cytoduction
into YMS23 (Fig. 2) were used as controls.
In addition to colony color, USA
+ clones were
characterized by the efficiency of curing by guanidine, aggregation
state of
Ure2p, resistance of Ure2p to proteinase K digestion,
fluorescence
pattern in strains expressing a UPD-GFP fusion protein,
and cytoduction
efficiency.
In order to assess guanidine curing, USA
+
isolates were grown in YPD medium with or without 5 mM guanidine
hydrochloride, and
serial dilutions were spotted on USA and

-AA
plates, respectively
(Fig.
4). The
ability to grow on USA was found to be directly
related to the color
phenotype. Pink clones, such as U57 and U58,
grew almost as efficiently
as
ure2 mutants, whereas the red variants
U46 and U47 grew
markedly slower. In contrast, U46 and U47 showed
considerable growth on

-AA, whereas the stronger isolates did
not (Fig.
4). With the
exception of U46 and the mutant strains,
all USA
+
clones were 90% or more cured of the prion state after about
10 generations in the presence of 5 mM guanidine hydrochloride.
Curing was
evident from diminished growth on USA as well as improved
growth on

-AA.

View larger version (105K):
[in this window]
[in a new window]
|
FIG. 4.
Guanidine curing of USA+ isolates.
[URE3] cells were grown in nonselective YPD medium
with or without 5 mM guanidine for about 10 generations, and serial
dilutions were spotted onto USA and -AA plates to select for cells
with inactive or active Ure2p, respectively. Wild-type (YMS23) and
ure2 (YMS24) strains that are not affected by
guanidine were used as controls. Also shown are cytoductants carrying
the [URE3] isolate from strains YRW3560 (URW) and
YCC34 (UFL), USA+ isolates U46 and U47 (induced by
transient UPD overexpression), U57 and U58 (induced by Ure2p
overexpression), and U10 and U11 (two ure2 mutant
strains).
|
|
Similar to mammalian prion protein, Ure2p from [
URE3]
cells has been reported to be partially resistant to proteinase K
digestion
(
33). The four representative clones, U46, U47,
U57, and U58,
as well as URW and UFL were tested in the same way in
order to
determine whether the observed strain variability can be
associated
with a biochemical difference between Ure2p from those
isolates.
Ure2p was found mostly in the soluble fraction of extracts
from
the wild-type strain, whereas it was completely insoluble in all
USA
+ isolates except U46 after centrifugation at
100,000 ×
g (shown
for the wild type, UFL, U47, and
U58 in Fig.
5A). Ure2p was completely
digested after treatment with 0.6 µg of proteinase K/ml for 30
min in
both the wild-type and the U46 strains. In contrast, in
the five
remaining strains, full-length Ure2p could still be observed
following
digestion with up to 4 µg of proteinase K/ml. Furthermore,
a
characteristic pattern of partial degradation products was visible,
with three bands in the range of 25 to 30 kDa. A fourth band at

13
kDa was already present in the untreated extracts but not
in extracts
prepared using proteinase inhibitors. This band is
therefore most
likely due to partial degradation of Ure2p by lysosomal
proteinases
after disruption of the cells. The same band is also
the end product of
the proteinase K digestion, since it intensifies
with increasing
concentration of the proteinase used. A band with
similar
electrophoretic mobility and proteinase resistance is
observed when UPD
is expressed in yeast (data not shown) as well
as in the case of UPD
purified from
Escherichia coli (
43).
Accordingly,
it can be assumed that the fragment generated in extracts
from
the [
URE3] strains also corresponds to UPD.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 5.
Insolubility and proteinase K resistance of Ure2p in
USA+ isolates. Cells were grown in USA medium (supplemented
with uracil for wild-type controls) at 30°C. Extracts were prepared
in the absence of proteinase inhibitors and subjected to
ultracentrifugation or digestion with proteinase K. Western blots were
analyzed with anti-GST-Ure2 antiserum. (A) Wild-type and
[URE3] (isolates UFL, U47, and U58) strains without
any plasmid; (B) wild-type and USA+ (isolates U46, U47, and
U57) strains overexpressing Ure2p from pMS82. In each gel, lane P
represents the pellet and lane S represents the supernatant fraction
after centrifugation at 100,000 × g. For the
remaining lanes, samples of whole-cell lysates were treated with
increasing amounts of proteinase K (PK) as indicated. The asterisk
indicates the position of the gel-loading pocket on the blot
membrane.
|
|
The analysis was repeated in strains overexpressing Ure2p from the
multicopy plasmid pMS82 (Fig.
5B). Even under these conditions,
no
difference in Ure2p could be detected between wild-type and
U46 cells.
The overexpressing strains showed more clearly the
accumulation of a
fragment with an apparent molecular mass of
13 kDa, as well as two
slightly smaller fragments, as the final
product of the digestion
reaction. There was little degradation
of this species, even at
concentrations of proteinase K up to
40 µg/ml (Fig.
5B).
The experiments did not show any significant differences in the
digestion patterns of U47, U57, U58, URW, or UFL, indicating
that the
conformation of Ure2p is similar in all these isolates.
The molecular
basis for the strain variability is therefore unclear.
A closer look at
the data presented in Fig.
5, however, shows
a small amount of
aggregated Ure2p that did not migrate into the
sodium dodecyl sulfate
gel, but instead it was stuck in the gel-loading
pockets in the cases
of U57, U58, URW, and UFL but not U47. Although
this appears to be a
small difference, it was consistently observed
in several independent
experiments. Even in U47 cells expressing
high levels of Ure2p from
pMS82, no Ure2p signal was observed
in the gel pocket (Fig.
5B),
despite the overexpression. It seems
therefore plausible that the
strain variability is caused by a
difference in the aggregation pattern
of Ure2p rather than the
conformation of individual protein
monomers.
Recent studies (
5,
25) suggest that Ure2p is
phosphorylated in its active state and that dephosphorylation leads to
inactivation
of the protein. Phosphorylation leads to a slight shift in
electrophoretic
mobility of the protein and the appearance of a double
band. A
similar double band is visible in extracts of wild-type and U46
strains (Fig.
5), whereas all type A and B [
URE3] strains
show
only a single band. However, phosphatase treatment, as described
in reference
5, of the cell extracts used for the
experiments
whose results are shown in Fig.
5 did not change the Ure2p
banding
pattern in our study (data not
shown).
Studies by Edskes et al. (
19) show that, in cells
coexpressing UPD-GFP or Ure2-GFP fusion proteins, the aggregation state
of the fusion protein depends on the [
URE3] phenotype. In
wild-type
cells expressing either GFP fusion protein, the entire
cytoplasm
shows weak, homogeneous fluorescence. In contrast, in
[
URE3] strains,
the fluorescence coalesces into one or
several bright spots (foci)
in each cell. Clones U46, U47, U57, and U58
as well as UFL and
URW were transformed with pVTG12 and pH327, which
express UPD-GFP
and Ure2-GFP fusion proteins, respectively.
Transformants were
tested for growth on USA and the pattern of
intracellular fluorescence.
In clones U57, U58, UFL, and URW, most
cells showed one or two
fluorescent foci per cell (Fig.
6B to E). Occasionally, elongated
structures were observed, reminiscent of fibers formed by purified
UPD
and Ure2p in vitro (Fig.
6H and I). Sometimes these structures
spanned
the entire length of the cell. In contrast, U46, like
wild-type cells,
showed homogeneous staining (Fig.
6A). Surprisingly,
U47 transformed
with either construct was efficiently cured of
the prion state, even
though the GFP fusion protein was expressed
at relatively low levels.
After loss of the GFP fusion plasmid,
the cells did not regain the
ability to grow on USA, indicating
that the [
URE3] state
had not been suppressed but was actually
cured. Curing by expression of
GFP fusion proteins or UPD alone
has been demonstrated previously
(
19), but in those cases GFP-UPD
expression levels had to
be in the order of 20 to 50 times higher
than those produced by pVTG12.
No curing was observed with either
pVTG12 or pH327 for any of the
other five USA
+ isolates tested in this
experiment. While curing of U47 by pH327
was always complete, in some
transformants with pVTG12 a small
percentage of cells in the original
colony retained the USA
+ phenotype. Under the
microscope, such cells exhibited numerous
fluorescent foci (Fig.
6F and
G).

View larger version (121K):
[in this window]
[in a new window]
|
FIG. 6.
Autofluorescence of USA+ strains expressing
a UPD-GFP fusion protein. USA+ isolates of strain YMS23
(Fig. 2 and 3) were transformed with pVTG12 (expressing Ure2N-GFP) and
grown in USA medium without leucine prior to microscopic observation.
(A) Clone U46, showing homogeneous distribution of UPD-GFP, identical
to wild-type cells (data not shown); (B and C) clone URW; (D and E)
clone U57; (F and G) cells of clone U47 that remained USA+
after transformation with pVTG12; (H and I) cells of clone UFL, showing
fiber-like aggregates of UPD-GFP. Panels A, C, E, G, and I show
autofluorescence; in panels B, D, F, and H, autofluorescence was
overlaid on the corresponding bright light image to visualize cell
shapes. Exposure time for the image in panel A was approximately two to
three times longer than for the other autofluorescence
images.
|
|
Classification of additional USA+ isolates.
Following this initial characterization, a larger number of
USA+ clones was examined using the same methods.
All clones induced by transient UPD overexpression showed the
characteristics of either U46 or U47, whereas virtually all clones
obtained by Ure2p overexpression behaved like either U57 or U47.
Specifically, of 16 red clones that were cured by guanidine and
isolated after either UPD or Ure2p overexpression, 15 were also cured
by expression of UPD-GFP (Table 3). Based
on these observations, three types of USA+
isolates can be distinguished following transient overexpression of UPD
or Ure2p (Table 3). Clones similar to U57, classified as type A
isolates, and clones similar to U47, classified as type B isolates,
were cured by guanidine. However, type A clones were generally pink and
showed aggregation of UPD-GFP into fluorescent foci under the
microscope, whereas type B clones were red and lost the prion phenotype
after transformation with the UPD-GFP-expressing plasmid. Type B clones
also tended to grow more readily on
-AA. Cytoductants containing
[URE3-RW] from YRW3560 or
[URE3-FL] from YCC34 had all the
characteristics of type A.
The third type of USA
+ isolate, designated type
III clones (similar to U46), often showed very weak growth on USA,
tended to
grow better on

-AA, and was not affected by
guanidine. While
type A and B isolates showed all of the
characteristics of [
URE3],
no sign of abnormal Ure2p could
be found in type III isolates,
meaning they do not appear to be
[
URE3]. Although we cannot exclude
the possibility that a
mutation causes this phenotype, we consider
this possibility unlikely
because of the following observations.
Type III
USA
+ isolates are clearly induced by UPD
overexpression. These clones
are also only partially complemented by
expression of Ure2p from
the single-copy plasmid pMS64 or the multicopy
plasmid pMS82,
and they lose the USA
+ phenotype
upon continued propagation on nonselective media. The
molecular basis
of the defect in these isolates is therefore unclear
at
present.
Stable inheritance of [URE3] yeast prion
strains.
To determine whether the observed variants of
[URE3] are faithfully inherited, cytoduction experiments
were performed. The prion state in U47, U57, and U58 was first
transferred from YMS23 to YRW3383 and subsequently from YRW3383 back
into YMS23. In each case, at least three clones obtained from the first
round of cytoduction were used as donors for the second round. After
these two transfers, clones containing [URE3] from U47
still showed all type B characteristics, including curing by low
expression levels of UPD-GFP, while clones carrying [URE3]
from either U57 or U58 were still type A. Moreover, U57-derived
isolates all maintained a lighter colony color than those derived from
U58, indicating that even the presumably more subtle differences within
type A isolates are stably inherited (Fig.
7). The cytoduction efficiencies of
[URE3] for all three isolates were above 95%, provided
that the donor cells were grown on USA medium prior to mating. We were
unable, however, to obtain any cytoductants that retained the
USA+ phenotype from the U46 isolate, although a
substantial portion of the occasional diploids that were formed in
these experiments were still weakly USA+.

View larger version (106K):
[in this window]
[in a new window]
|
FIG. 7.
Stable inheritance of different [URE3]
strain variants. [URE3] clones U47, U57, and U58 (Fig.
3) were cytoduced from YMS23 into strain YRW3383 and then back
into YMS23. Each plate shows a wild-type (wt) and ure2
mutant (U11) control, the original [URE3] clone
(donor), and five representative cytoductants (1 to 5)
streaked on YPD plates.
|
|
Spontaneous USA+ isolates.
Colonies with the
ability to grow on USA appeared with a low frequency (about 2 × 10
6 to 5 × 10
6)
in wild-type strains without overexpression of Ure2p or UPD. When such
clones were isolated from YMS23, about 40% were completely white with
no apparent sectoring, indicating considerably lower Ure2p activity and
greater mitotic stability than in any [URE3] clone
isolated following transient overexpression of Ure2p. Most of the
remaining clones were red; some were pink. In four white clones, the
URE2 gene was sequenced. Two of these clones contained nonsense mutations (U9, S210Stop; U11, Q32Stop), leading to the expression of truncated, inactive versions of Ure2p. In the other two
clones, missense mutations were identified (U10, G182R; U13, D310H)
which could also explain the USA+ phenotype.
Thirty clones (13 white, 1 pink, 16 red) were tested for guanidine
curing of the USA+ phenotype, and all were found
to be fully resistant, indicating that they either contained a
ure2 mutation or exhibited the type III
USA+ phenotype. In all white and pink clones
tested, the USA+ phenotype was complemented by
the plasmid pMS64, indicating a mutation in URE2. In
contrast, several of the red clones retained the ability to grow on USA
medium after transformation, as observed for type III isolates.
Apparently, in the absence of overexpression, [URE3] is
generated spontaneously only at very low frequencies in the W303 strain
background used for our studies.
 |
DISCUSSION |
Novel reporter system for [URE3].
Previously,
Ure2p function has been monitored almost exclusively by the growth of
Ure2p-deficient ura2 URA3 strains on media containing USA
instead of uracil in the presence of ammonia. Studies of the
[URE3] state have been hampered by background growth due to secretion of uracil by cells deficient in Ure2p function
(29); by the frequent isolation of weak, unstable, or
atypical USA+ isolates; and by the lack of an
additional, nonselective phenotype. By putting an ADE2
reporter gene under the control of the DAL5 promoter,
adenine biosynthesis and colony color become regulated by the
Ure2p-Gln3 system, which allows facile quantitative observation of this
regulation by colony color intensity. We have used this reporter system
to visualize the stability of the [URE3] prion state and
to identify different strain variants of the [URE3] prion state.
Different strains of [URE3].
For many years,
the existence of strains of mammalian prions, which are responsible for
different disease phenotypes, was used as an argument against prions
consisting only of protein (4, 9). Considerable evidence
argues that the biological properties of mammalian prion strains are
enciphered in the secondary and tertiary structures of
PrPSc (2, 36, 40, 41, 44, 48). The
question remains, however, how a single protein can exist in multiple
self-propagating conformations.
Our studies demonstrate that different strains of [
URE3]
can be generated reproducibly in fully isogenic cells, excluding
the
potential involvement of
URE2 sequence variation in the
formation
or maintenance of the [
URE3] strains.
Posttranslational modifications
of Ure2p, which is a cytosolic protein,
appear to be limited to
a phosphorylation event that has been
implicated in the regulation
of Ure2p function (
5,
25).
Therefore, any strain information
has to be enciphered in the Ure2
protein structure
itself.
Based on colony color and the response to expression of a GFP-UPD
fusion protein, we defined two types of [
URE3] isolates,
A
and B. Since proteinase digestion experiments did not detect
significant differences in the conformation of Ure2p from these
different isolates, we presume that they do not exhibit major
variations in secondary or tertiary structure. Alternatively,
[
URE3] prion strain variations could be due to differences
in
the aggregation state or aggregation pattern (for example
differences
in the monomer surfaces that mediate aggregation) of Ure2p.
Our
observation that some of the Ure2p in extracts from type A but
not
from type B [
URE3] strains is more likely to become stuck
in the loading pocket of a sodium dodecyl sulfate-polyacrylamide
gel,
despite the harsh denaturation conditions used in the experiment,
is
consistent with different aggregation patterns: similarly folded
monomers could form different oligomers and higher polymers, depending
on the kind of seed that initiated the conversion to
[
URE3].
Response to GFP fusion proteins.
We observed that a UPD-GFP
fusion protein is surprisingly potent in curing type B
[URE3] isolates even at low expression levels. In a
previous report, efficient curing by the same fusion protein or UPD
alone required massive overexpression, whereas Ure2-GFP was more
effective (19). In our experiments, all 15 red
USA+ isolates that were curable by guanidine
(i.e., type B) were also cured by small amounts of UPD-GFP, while 8 of
the 9 pink isolates (type A) were not affected by the presence of the
fusion protein. Thus, curing by UPD-GFP offers a definitive way to
distinguish the two types of [URE3], at least in our
strain background.
We propose that the GFP fusion protein binds to Ure2p in type B
[
URE3] in a manner that does not allow further propagation
of the prion isoform. The observation that expression of the GFP
fusion
protein cures type B but not type A [
URE3] indicates that
the interaction surface between the normal and the prion forms
of the
protein, where binding and conversion are assumed to occur,
are
different in these [
URE3] strain variants. A small number
of cells in type B isolates remains stably USA
+
even with the expression of UPD-GFP. These cells still form red
colonies. Under the microscope, they display slightly different
fluorescent foci, which appear larger and more numerous than those
found in type A [
URE3] (Fig.
6F and G). Remarkably, when
such
cells were cured of the plasmid expressing the GFP fusion protein,
all of them were USA

(unpublished
observations), indicating that in these cells, the
UPD-GFP fusion
protein was required to maintain the prion
state.
A recent study by Speransky et al. (
46) showed that Ure2p
forms globular structures consisting of filamentous aggregates
in
[
URE3] but not in wild-type yeast cells that
overexpress Ure2p.
Our observation of fibrous, fluorescent aggregates
in a small
percentage of [
URE3] cells expressing low
amounts of GFP-UPD (Fig.
6H and I) complements this work, and provides
further evidence
for the hypothesis that amyloid fiber formation might
be the underlying
mechanism of [
URE3] formation and
inheritance.
Comparison to [PSI] yeast prion strains.
Different strains of yeast prions have also been observed for
[PSI], using an ADE1 reporter to distinguish
between stronger and weaker isolates of [PSI] by colony
color (16). Weak [PSI] isolates are less
efficient in nonsense suppression and are spontaneously lost at a much
higher rate than are strong isolates. Each prion strain was shown to
breed true in that it does not convert from weak to strong or vice
versa. One study demonstrated that overexpression of Sup35p can
destabilize some weak [PSI] isolates but not others (15). Weak and strong isolates of [PSI] seem
to correspond most closely to weak and strong isolates of type A
[URE3]. The characteristics of type B [URE3]
distinguish it further from type A because of its specific induction by
UPD overexpression and by the strikingly different effects of the GFP
fusion proteins.
A recent study by Chien and Weissman (
10) provides another
example of [
PSI] prion strains. A strain background was
used
which expressed Sup35p with a part of the prion domain replaced
by
a corresponding fragment from
Candida albicans Sup35p.
Overexpression
of GFP fusion proteins with the Sup35 prion domain from
either
S. cerevisiae or
C. albicans induced [
PSI] in this chimeric
background,
indicating the absence of a species barrier. However, the
two
fragments used to induce [
PSI] generated different
prion strain
variants. Furthermore, fibers of this chimeric prion
domain generated
in vitro also showed distinct patterns of
proteinase-resistant
fragments, depending on the protein with which
they were seeded.
This observation provides direct evidence for
differences in the
secondary or tertiary structure of the protein that
could determine
prion strain
characteristics.
Initiation of new [URE3] elements.
It has
been speculated previously (31) that [URE3]
elements are initiated by N-terminal fragments of Ure2p generated by intracellular proteolytic cleavage. Since no such cleavage products are
detected in standard Western blots, they cannot be very abundant. However, like UPD overexpressed from plasmids, N-terminal fragments should have a much higher propensity than full-length Ure2p to induce
[URE3], which could compensate for low abundance.
Fragments corresponding to the prion domain in size and proteinase K
resistance do appear in cell extracts that have been prepared without
the use of proteinase inhibitors (Fig. 5), indicating that yeast
contains proteinases that could generate this kind of fragment. Since
we demonstrate that induction by full-length Ure2p overexpression leads
to a prion phenotype that is distinct from that induced by UPD, this
hypothesis can be tested. UPD seeds do not induce the pink (type A)
variant of [URE3] in our strain background. Therefore,
such type A strains are most likely initiated by full-length Ure2p
itself. Conversely, type B [URE3] can be induced by UPD overexpression and is also found following Ure2p overexpression. It is
possible, therefore, that type B [URE3] is seeded by
N-terminal proteolytic fragments in the case of Ure2p overexpression as well.
Spontaneous appearance of the prion state.
Surprisingly, in
contrast to earlier studies in which [URE3] isolates were
obtained spontaneously at a frequency of approximately 10
5 (54), we were unable to
isolate any [URE3] strains without overexpressing Ure2p or
UPD. It is noteworthy that the original work describing
[URE3] was based on a single isolate and also mentioned
difficulties in obtaining additional clones (29). The
difference is likely due to variations in the strain background used in
these studies. The [PIN] factor is another prion-like state in yeast, which plays a role in the induction of
[PSI] (14). It is possible that
[PIN] or another prion-like state is also necessary for
the spontaneous appearance of [URE3]. Since chaperone proteins have been shown to influence prion formation and maintenance in yeast, another explanation for the failure to generate spontaneous [URE3] could be differences in the expression of such
proteins in different strain backgrounds. Finally, the Mks1 protein has been reported to inhibit Ure2p function and to be necessary for initial
conversion of wild-type yeast cells to [URE3]
(20), indicating that regulation of Ure2p function could
also influence the generation of new [URE3] elements. The
question of how [URE3] is generated spontaneously
therefore cannot be answered at this point. Most likely, one would
expect a distribution similar to that observed when full-length Ure2p
is overexpressed, although lower protein levels might affect seed
formation by the full-length protein more strongly than by UPD.
[URE3-FL], the only spontaneous [URE3] clone
used in this study, clearly falls into the type A prion strain classification.
 |
ACKNOWLEDGMENTS |
We are grateful to R. B. Wickner for generously providing
strains and plasmids. We thank C. Cullin for providing strain YCC34 and
J. H. Hegemann for providing the plasmids used for strain construction.
This work was supported by a research fellowship from the Deutsche
Forschungsgemeinschaft to M.S. and grants from the National Institute
of Aging and the National Institute of Neurological Diseases and Stroke
of the National Institutes of Health (grant numbers AG02132, AG10770,
and NS14069) and from the National Institute of General Medical
Sciences (grant number GM59466 to I.H.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute for
Neurodegenerative Diseases, Box 0518, University of California, San
Francisco, CA 94143-0518. Phone: (415) 476-4482. Fax: (415) 476-8386. E-mail: stanley{at}itsa.ucsf.edu.
 |
REFERENCES |
| 1.
|
Beck, T., and M. N. Hall.
1999.
The TOR signalling pathway controls nuclear localization of nutrient-regulated transcription factors.
Nature
402:689-692[CrossRef][Medline].
|
| 2.
|
Bessen, R. A., and R. F. Marsh.
1994.
Distinct PrP properties suggest the molecular basis of strain variation in transmissible mink encephalopathy.
J. Virol.
68:7859-7868[Abstract/Free Full Text].
|
| 3.
|
Bonneaud, N.,
O. Ozier-Kalogeropoulos,
G. Y. Li,
M. Labouesse,
L. Minvielle-Sebastia, and F. Lacroute.
1991.
A family of low and high copy replicative, integrative and single-stranded S. cerevisiae/E. coli shuttle vectors.
Yeast
7:609-615[CrossRef][Medline].
|
| 4.
|
Bruce, M. E., and A. G. Dickinson.
1987.
Biological evidence that the scrapie agent has an independent genome.
J. Gen. Virol.
68:79-89[Abstract/Free Full Text].
|
| 5.
|
Cardenas, M. E.,
N. S. Cutler,
M. C. Lorenz,
C. J. Di Como, and J. Heitman.
1999.
The TOR signaling cascade regulates gene expression in response to nutrients.
Genes Dev.
13:3271-3279[Abstract/Free Full Text].
|
| 6.
|
Chernoff, Y. O.,
A. P. Galkin,
E. Lewitin,
T. A. Chernova,
G. P. Newnam, and S. M. Belenkiy.
2000.
Evolutionary conservation of prion-forming abilities of the yeast Sup35 protein.
Mol. Microbiol.
35:865-876[CrossRef][Medline].
|
| 7.
|
Chernoff, Y. O.,
S. L. Lindquist,
B. Ono,
S. G. Inge-Vechtomov, and S. W. Liebman.
1995.
Role of the chaperone protein Hsp104 in propagation of the yeast prion-like factor [psi+].
Science
268:880-884[Abstract/Free Full Text].
|
| 8.
|
Chernoff, Y. O.,
G. P. Newnam,
J. Kumar,
K. Allen, and A. D. Zink.
1999.
Evidence for a protein mutator in yeast: role of the Hsp70-related chaperone Ssb in formation, stability, and toxicity of the [PSI] prion.
Mol. Cell. Biol.
19:8103-8112[Abstract/Free Full Text].
|
| 9.
|
Chesebro, B.
1998.
Prion diseases. BSE and prions: uncertainties about the agent.
Science
279:42-43[Free Full Text].
|
| 10.
|
Chien, P., and J. S. Weissman.
2001.
Conformational diversity in a yeast prion dictates its seeding specificity.
Nature
410:223-227[CrossRef][Medline].
|
| 11.
|
Coffman, J. A.,
H. M. el Berry, and T. G. Cooper.
1994.
The URE2 protein regulates nitrogen catabolic gene expression through the GATAA-containing UASNTR element in Saccharomyces cerevisiae.
J. Bacteriol.
176:7476-7483[Abstract/Free Full Text].
|
| 12.
|
Coschigano, P. W., and B. Magasanik.
1991.
The URE2 gene product of Saccharomyces cerevisiae plays an important role in the cellular response to the nitrogen source and has homology to glutathione S-transferases.
Mol. Cell. Biol.
11:822-832[Abstract/Free Full Text].
|
| 13.
|
DePace, A. H.,
A. Santoso,
P. Hillner, and J. S. Weissman.
1998.
A critical role for amino-terminal glutamine/asparagine repeats in the formation and propagation of a yeast prion.
Cell
93:1241-1252[CrossRef][Medline].
|
| 14.
|
Derkatch, I. L.,
M. E. Bradley,
P. Zhou,
Y. O. Chernoff, and S. W. Liebman.
1997.
Genetic and environmental factors affecting the de novo appearance of the [PSI+] prion in Saccharomyces cerevisiae.
Genetics
147:507-519[Abstract].
|
| 15.
|
Derkatch, I. L.,
M. E. Bradley,
P. Zhou, and S. W. Liebman.
1999.
The PNM2 mutation in the prion protein domain of SUP35 has distinct effects on different variants of the [PSI+] prion in yeast.
Curr. Genet.
35:59-67[CrossRef][Medline].
|
| 16.
|
Derkatch, I. L.,
Y. O. Chernoff,
V. V. Kushnirov,
S. G. Inge-Vechtomov, and S. W. Liebman.
1996.
Genesis and variability of [PSI] prion factors in Saccharomyces cerevisiae.
Genetics
144:1375-1386[Abstract].
|
| 17.
|
Dickinson, A. G.
1976.
Scrapie in sheep and goats, p. 209-241.
In
R. H. Kimberlin (ed.), Slow virus diseases of animals and man. North-Holland Publishing Co., Amsterdam, The Netherlands.
|
| 18.
|
Doel, S. M.,
S. J. McCready,
C. R. Nierras, and B. S. Cox.
1994.
The dominant PNM2 mutation which eliminates the factor of Saccharomyces cerevisiae is the result of a missense mutation in the SUP35 gene.
Genetics
137:659-670[Abstract].
|
| 19.
|
Edskes, H. K.,
V. T. Gray, and R. B. Wickner.
1999.
The [URE3] prion is an aggregated form of Ure2p that can be cured by overexpression of Ure2p fragments.
Proc. Natl. Acad. Sci. USA
96:1498-1503[Abstract/Free Full Text].
|
| 20.
|
Edskes, H. K., and R. B. Wickner.
2000.
A protein required for prion generation: [URE3] induction requires the Ras-regulated Mks1 protein.
Proc. Natl. Acad. Sci. USA
97:6625-6629[Abstract/Free Full Text].
|
| 21.
|
Fernandez-Bellot, E.,
E. Guillemet, and C. Cullin.
2000.
The yeast prion [URE3] can be greatly induced by a functional mutated URE2 allele.
EMBO J.
19:3215-3222[CrossRef][Medline].
|
| 22.
|
Glover, J. R.,
A. S. Kowal,
E. C. Schirmer,
M. M. Patino,
J.-J. Liu, and S. Lindquist.
1997.
Self-seeded fibers formed by Sup35, the protein determinant of [PSI+], a heritable prion-like factor of S. cerevisiae.
Cell
89:811-819[CrossRef][Medline].
|
| 23.
|
Güldener, U.,
S. Heck,
T. Fiedler,
J. Beinhauer, and J. H. Hegemann.
1996.
A new efficient gene disruption cassette for repeated use in budding yeast.
Nucleic Acids Res.
24:2519-2524[Abstract/Free Full Text].
|
| 24.
|
Guthrie, C., and G. R. Fink (ed.).
1991.
Methods in enzymology, vol. 194. Guide to yeast genetics and molecular biology.
Academic Press, Inc., New York, N.Y.
|
| 25.
|
Hardwick, J. S.,
F. G. Kuruvilla,
J. K. Tong,
A. F. Shamji, and S. L. Schreiber.
1999.
Rapamycin-modulated transcription defines the subset of nutrient-sensitive signaling pathways directly controlled by the Tor proteins.
Proc. Natl. Acad. Sci. USA
96:14866-14870[Abstract/Free Full Text].
|
| 26.
|
Hill, J. E.,
A. M. Myers,
T. J. Koerner, and A. Tzagoloff.
1986.
Yeast/E. coli shuttle vectors with multiple unique restriction sites.
Yeast
2:163-167[CrossRef][Medline].
|
| 27.
|
King, C.-Y.,
P. Tittman,
H. Gross,
R. Gebert,
M. Aebi, and K. Wüthrich.
1997.
Prion-inducing domain 2-114 of yeast Sup35 protein transforms in vitro into amyloid-like filaments.
Proc. Natl. Acad. Sci. USA
94:6618-6622[Abstract/Free Full Text].
|
| 28.
|
Kushnirov, V. V.,
N. V. Kochneva-Pervukhova,
M. B. Chechenova,
N. S. Frolova, and M. D. Ter-Avanesyan.
2000.
Prion properties of the Sup35 protein of yeast Pichia methanolica.
EMBO J.
19:324-331[CrossRef][Medline].
|
| 29.
|
Lacroute, F.
1971.
Non-Mendelian mutation allowing ureidosuccinic acid uptake in yeast.
J. Bacteriol.
106:519-522[Abstract/Free Full Text].
|
| 30.
|
Liu, J. J., and S. Lindquist.
1999.
Oligopeptide-repeat expansions modulate `protein-only' inheritance in yeast.
Nature
400:573-576[CrossRef][Medline].
|
| 31.
|
Maddelein, M. L., and R. B. Wickner.
1999.
Two prion-inducing regions of Ure2p are nonoverlapping.
Mol. Cell. Biol.
19:4516-4524[Abstract/Free Full Text].
|
| 32.
|
Magasanik, B.
1992.
Regulation of nitrogen utilization, p. 283-317.
In
J. N. Strathern, E. W. Jones, and J. R. Broach (ed.), The molecular and cellular biology of the yeast Saccharomyces: gene expression, vol. II. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 33.
|
Masison, D. C., and R. B. Wickner.
1995.
Prion-inducing domain of yeast Ure2p and protease resistance of Ure2p in prion-containing cells.
Science
270:93-95[Abstract/Free Full Text].
|
| 34.
|
Moriyama, H.,
H. K. Edskes, and R. B. Wickner.
2000.
[URE3] prion propagation in Saccharomyces cerevisiae: requirement for chaperone Hsp104 and curing by overexpressed chaperone Ydj1p.
Mol. Cell. Biol.
20:8916-8922[Abstract/Free Full Text].
|
| 35.
|
Newnam, G. P.,
R. D. Wegrzyn,
S. L. Lindquist, and Y. O. Chernoff.
1999.
Antagonistic interactions between yeast chaperones Hsp104 and Hsp70 in prion curing.
Mol. Cell. Biol.
19:1325-1333[Abstract/Free Full Text].
|
| 36.
|
Nishida, N.,
D. A. Harris,
D. Vilette,
H. Laude,
Y. Frobert,
J. Grassi,
D. Casanova,
O. Milhavet, and S. Lehmann.
2000.
Successful transmission of three mouse-adapted scrapie strains to murine neuroblastoma cell lines overexpressing wild-type mouse prion protein.
J. Virol.
74:320-325[Abstract/Free Full Text].
|
| 37.
|
Patino, M. M.,
J.-J. Liu,
J. R. Glover, and S. Lindquist.
1996.
Support for the prion hypothesis for inheritance of a phenotypic trait in yeast.
Science
273:622-626[Abstract].
|
| 38.
|
Paushkin, S. V.,
V. V. Kushnirov,
V. N. Smirnov, and M. D. Ter-Avanesyan.
1997.
In vitro propagation of the prion-like state of yeast Sup35 protein.
Science
277:381-383[Abstract/Free Full Text].
|
| 39.
|
Paushkin, S. V.,
V. V. Kushnirov,
V. N. Smirnov, and M. D. Ter-Avanesyan.
1996.
Propagation of the yeast prion-like [psi+] determinant is mediated by oligomerization of the SUP35-encoded polypeptide chain release factor.
EMBO J.
15:3127-3134[Medline].
|
| 40.
|
Peretz, D.,
M. Scott,
D. Groth,
A. Williamson,
D. Burton,
F. E. Cohen, and S. B. Prusiner.
2001.
Strain-specified relative conformational stability of the scrapie prion protein.
Protein Sci.
10:854-863[CrossRef][Medline].
|
| 41.
|
Safar, J.,
H. Wille,
V. Itri,
D. Groth,
H. Serban,
M. Torchia,
F. E. Cohen, and S. B. Prusiner.
1998.
Eight prion strains have PrPSc molecules with different conformations.
Nat. Med.
4:1157-1165[CrossRef][Medline].
|
| 42.
|
Santoso, A.,
P. Chien,
L. Z. Osherovich, and J. S. Weissman.
2000.
Molecular basis of a yeast prion species barrier.
Cell
100:277-288[CrossRef][Medline].
|
| 43.
|
Schlumpberger, M.,
H. Wille,
M. A. Baldwin,
D. A. Butler,
I. Herskowitz, and S. B. Prusiner.
2000.
The prion domain of yeast Ure2p induces autocatalytic formation of amyloid fibers by a recombinant fusion protein.
Protein Sci.
9:440-451[Medline].
|
| 44.
|
Scott, M. R.,
D. Groth,
J. Tatzelt,
M. Torchia,
P. Tremblay,
S. J. DeArmond, and S. B. Prusiner.
1997.
Propagation of prion strains through specific conformers of the prion protein.
J. Virol.
71:9032-9044[Abstract].
|
| 45.
|
Sparrer, H. E.,
A. Santoso,
F. C. Szoka, Jr., and J. S. Weissman.
2000.
Evidence for the prion hypothesis: induction of the yeast [PSI+] factor by in vitro-converted Sup35 protein.
Science
289:595-599[Abstract/Free Full Text].
|
| 46.
|
Speransky, V. V.,
K. L. Taylor,
H. K. Edskes,
R. B. Wickner, and A. C. Steven.
2001.
Prion filament networks in [URE3] cells of Saccharomyces cerevisiae.
J. Cell Biol.
153:1327-1336[Abstract/Free Full Text].
|
| 47.
|
Taylor, K. L.,
N. Cheng,
R. W. Williams,
A. C. Steven, and R. B. Wickner.
1999.
Prion domain initiation of amyloid formation in vitro from native Ure2p.
Science
283:1339-1343[Abstract/Free Full Text].
|
| 48.
|
Telling, G. C.,
P. Parchi,
S. J. DeArmond,
P. Cortelli,
P. Montagna,
R. Gabizon,
J. Mastrianni,
E. Lugaresi,
P. Gambetti, and S. B. Prusiner.
1996.
Evidence for the conformation of the pathologic isoform of the prion protein enciphering and propagating prion diversity.
Science
274:2079-2082[Abstract/Free Full Text].
|
| 49.
|
Ter-Avanesyan, M. D.,
A. R. Dagkesamanskaya,
V. V. Kushnirov, and V. N. Smirnov.
1994.
The SUP35 omnipotent suppressor gene is involved in the maintenance of the non-Mendelian determinant [psi+] in the yeast Saccharomyces cerevisiae.
Genetics
137:671-676[Abstract].
|
| 50.
|
Thomas, B. J., and R. Rothstein.
1989.
Elevated recombination rates in transcriptionally active DNA.
Cell
4:619-630.
|
| 51.
|
Thual, G.,
A. A. Komar,
L. Bousset,
E. Fernandez-Bellot,
C. Cullin, and R. Melki.
1999.
Structural characterization of Saccharomyces cerevisiae prion-like protein Ure2.
J. Biol. Chem.
274:13666-13674[Abstract/Free Full Text].
|
| 52.
|
Tuite, M. F.
2000.
Yeast prions and their prion-forming domain.
Cell
100:289-292[CrossRef][Medline].
|
| 53.
|
Turoscy, V., and T. G. Cooper.
1987.
Ureidosuccinate is transported by the allantoate transport system in Saccharomyces cerevisiae.
J. Bacteriol.
169:2598-2600[Abstract/Free Full Text].
|
| 54.
|
Wickner, R. B.
1994.
[URE3] as an altered URE2 protein: evidence for a prion analog in Saccharomyces cerevisiae.
Science
264:566-569[Abstract/Free Full Text].
|
| 55.
|
Wickner, R. B.,
K. L. Taylor,
H. K. Edskes, and M. L. Maddelein.
2000.
Prions: portable prion domains.
Curr. Biol.
10:R335-R337[CrossRef][Medline].
|
| 56.
|
Zaret, K. S., and F. Sherman.
1985.
-Aminoadipate as a primary nitrogen source for Saccharomyces cerevisiae mutants.
J. Bacteriol.
162:579-583[Abstract/Free Full Text].
|
Molecular and Cellular Biology, October 2001, p. 7035-7046, Vol. 21, No. 20
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.20.7035-7046.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Choe, Y.-J., Ryu, Y., Kim, H.-J., Seok, Y.-J.
(2009). Increased [PSI+] Appearance by Fusion of Rnq1 with the Prion Domain of Sup35 in Saccharomyces cerevisiae. Eukaryot Cell
8: 968-976
[Abstract]
[Full Text]
-
Edskes, H. K., McCann, L. M., Hebert, A. M., Wickner, R. B.
(2009). Prion Variants and Species Barriers Among Saccharomyces Ure2 Proteins. Genetics
181: 1159-1167
[Abstract]
[Full Text]
-
Sharma, D., Stanley, R. F., Masison, D. C.
(2009). Curing of Yeast [URE3] Prion by the Hsp40 Cochaperone Ydj1p Is Mediated by Hsp70. Genetics
181: 129-137
[Abstract]
[Full Text]
-
Higurashi, T., Hines, J. K., Sahi, C., Aron, R., Craig, E. A.
(2008). Specificity of the J-protein Sis1 in the propagation of 3 yeast prions. Proc. Natl. Acad. Sci. USA
105: 16596-16601
[Abstract]
[Full Text]
-
Sharma, D., Masison, D. C.
(2008). Functionally Redundant Isoforms of a Yeast Hsp70 Chaperone Subfamily Have Different Antiprion Effects. Genetics
179: 1301-1311
[Abstract]
[Full Text]
-
Alexandrov, I. M., Vishnevskaya, A. B., Ter-Avanesyan, M. D., Kushnirov, V. V.
(2008). Appearance and Propagation of Polyglutamine-based Amyloids in Yeast: TYROSINE RESIDUES ENABLE POLYMER FRAGMENTATION. J. Biol. Chem.
283: 15185-15192
[Abstract]
[Full Text]
-
Fan, Q., Park, K.-W., Du, Z., Morano, K. A., Li, L.
(2007). The Role of Sse1 in the de Novo Formation and Variant Determination of the [PSI+] Prion. Genetics
177: 1583-1593
[Abstract]
[Full Text]
-
Sen, A., Baxa, U., Simon, M. N., Wall, J. S., Sabate, R., Saupe, S. J., Steven, A. C.
(2007). Mass Analysis by Scanning Transmission Electron Microscopy and Electron Diffraction Validate Predictions of Stacked beta-Solenoid Model of HET-s Prion Fibrils. J. Biol. Chem.
282: 5545-5550
[Abstract]
[Full Text]
-
Park, K.-W., Hahn, J.-S., Fan, Q., Thiele, D. J., Li, L.
(2006). De Novo Appearance and "Strain" Formation of Yeast Prion [PSI+] Are Regulated by the Heat-Shock Transcription Factor. Genetics
173: 35-47
[Abstract]
[Full Text]
-
Talarek, N., Maillet, L., Cullin, C., Aigle, M.
(2005). The [URE3] Prion Is Not Conserved Among Saccharomyces Species. Genetics
171: 23-34
[Abstract]
[Full Text]
-
Ripaud, L., Maillet, L., Immel-Torterotot, F., Durand, F., Cullin, C.
(2004). The [URE3] Yeast Prion Results from Protein Aggregates That Differ from Amyloid Filaments Formed in Vitro. J. Biol. Chem.
279: 50962-50968
[Abstract]
[Full Text]
-
Wickner, R. B., Edskes, H. K., Roberts, B. T., Baxa, U., Pierce, M. M., Ross, E. D., Brachmann, A.
(2004). Prions: proteins as genes and infectious entities. Genes Dev.
18: 470-485
[Full Text]
-
Liebman, S. W.
(2002). Progress toward an ultimate proof of the prion hypothesis. Proc. Natl. Acad. Sci. USA
99: 9098-9100
[Full Text]
-
Baxa, U., Speransky, V., Steven, A. C., Wickner, R. B.
(2002). Inaugural Article: Mechanism of inactivation on prion conversion of the Saccharomyces cerevisiae Ure2 protein. Proc. Natl. Acad. Sci. USA
99: 5253-5260
[Abstract]
[Full Text]
-
Gueldener, U., Heinisch, J., Koehler, G. J., Voss, D., Hegemann, J. H.
(2002). A second set of loxP marker cassettes for Cre-mediated multiple gene knockouts in budding yeast. Nucleic Acids Res
30: e23-e23
[Abstract]
[Full Text]