Previous Article | Next Article 
Molecular and Cellular Biology, November 2001, p. 7307-7319, Vol. 21, No. 21
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.21.7307-7319.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Distinct RNP Complexes of Shuttling hnRNP Proteins with
Pre-mRNA and mRNA: Candidate Intermediates in Formation and Export
of mRNA
Stavroula
Mili,1
Hong Jun
Shu,2,
Yingming
Zhao,2,
and
Serafín
Piñol-Roma1,*
Department of Biochemistry and Molecular
Biology1 and Department of Human
Genetics,2 Mount Sinai School of Medicine,
New York, New York 10029-6574
Received 4 May 2001/Returned for modification 5 July 2001/Accepted 30 July 2001
 |
ABSTRACT |
Nascent pre-mRNAs associate with hnRNP proteins in hnRNP complexes,
the natural substrates for mRNA processing. Several lines of evidence
indicate that hnRNP complexes undergo substantial remodeling during
mRNA formation and export. Here we report the isolation of three
distinct types of pre-mRNP and mRNP complexes from HeLa
cells associated with hnRNP A1, a shuttling hnRNP protein. Based on
their RNA and protein compositions, these complexes are likely to
represent distinct stages in the nucleocytoplasmic shuttling pathway of
hnRNP A1 with its bound RNAs. In the cytoplasm, A1 is associated with
its nuclear import receptor (transportin), the cytoplasmic
poly(A)-binding protein, and mRNA. In the nucleus, A1 is found in
two distinct types of complexes that are differently associated with
nuclear structures. One class contains pre-mRNA and mRNA
and is identical to previously described hnRNP complexes. The other
class behaves as freely diffusible nuclear mRNPs (nmRNPs) at
late nuclear stages of maturation and possibly associated with nuclear
mRNA export. These nmRNPs differ from hnRNPs in that while they
contain shuttling hnRNP proteins, the mRNA export factor REF, and
mRNA, they do not contain nonshuttling hnRNP proteins or
pre-mRNA. Importantly, nmRNPs also contain proteins not
found in hnRNP complexes. These include the alternatively spliced
isoforms D01 and D02 of the hnRNP D proteins, the E0 isoform of the
hnRNP E proteins, and LRP130, a previously reported protein with
unknown function that appears to have a novel type of RNA-binding
domain. The characteristics of these complexes indicate that they
result from RNP remodeling associated with mRNA maturation and
delineate specific changes in RNP protein composition during formation
and transport of mRNA in vivo.
 |
INTRODUCTION |
Formation of mature
cytoplasmic mRNAs in eukaryotic cells involves extensive
processing of their corresponding pre-mRNAs in the nucleus,
resulting in mature mRNAs that are subsequently exported across the
nuclear envelope to the cytoplasm (for recent reviews on RNA
export, see references 27 and 51). The
natural substrates for nuclear events in mRNA maturation are
ribonucleoprotein (RNP) complexes formed by the persistent
association of pre-mRNAs and mRNAs with specific proteins.
Prominent among these is a group of pre-mRNA- and
mRNA-binding proteins collectively known as hnRNP proteins. The
association of hnRNP proteins with RNA begins as the nascent
pre-mRNA emerges from the RNA polymerase II transcription machinery and remains through processing and export of mRNA
(17).
In human cells, the hnRNP proteins comprise a family of ca. 24 different polypeptides, termed hnRNP A1 (ca. 35 kDa) through hnRNP U (ca. 120 kDa), which are among the most abundant
components of the cell nucleus (17, 59). hnRNP
proteins are recruited to different transcripts in different relative
amounts (43, 61, 76) and, rather than being passive
components of the substrate, several hnRNP proteins have been
shown to have specific roles in many different aspects of
mRNA formation (17, 33). Furthermore, the protein
composition of hnRNP complexes is not temporally fixed. There is
substantial evidence that maturation and nuclear export of mRNA are
accompanied by changes in the protein composition of hnRNP
complexes, as described below.
Under normal growth conditions, hnRNP proteins are concentrated in
the nucleus, where they are apparently excluded from the nucleolus
(57). A subset of the hnRNP proteins (e.g., hnRNPs A1 and K) shuttle constantly between the nucleus and the cytoplasm, whereas others (e.g., hnRNP C1/C2 and hnRNP U) do not shuttle and are retained in the nucleus (60). Nuclear export of
hnRNP A1 is mediated by a specific amino acid sequence termed M9,
which functions as a bona fide nuclear export signal (NES)
(46). M9 also functions as the hnRNP A1 nuclear
location signal by mediating binding of its nuclear import receptor,
transportin (62). hnRNP A1 retains its ability to bind
mRNA at least transiently in the cytoplasm and probably also during
its passage through the nuclear pore complex (NPC) (60).
In contrast to hnRNP A1, hnRNP C1 and hnRNP C2 are retained
in the nucleus, and this retention is mediated by a specific amino acid
sequence in the C proteins that functions as a nuclear retention
sequence (NRS). Importantly, this NRS can override NESs
(50), and therefore it is likely that removal of
NRS-containing hnRNP proteins from mRNA is a prerequisite for nuclear export of mRNA.
Based on the information described above, it was proposed that
shuttling hnRNP proteins accompany mRNAs during their
passage through NPCs, while nonshuttling hnRNP proteins are removed
prior to or concomitant with mRNA export (57, 60).
Support for this was provided by studies of the giant Balbiani ring
(BR) RNP complex in Chironomus tentans. BR
pre-mRNA- and mRNA-containing RNPs can be observed
directly by electron microscopy due to their large size and
abundance, and specific morphological changes can be monitored as their
RNA matures and is exported through NPCs (15). Early
electron microscopy observations provided evidence that mRNA is
indeed exported to the cytoplasm through NPCs as an mRNP complex
(69). Immunoelectron microscopy studies have shown that C-hrp36, which resembles vertebrate hnRNP A/B proteins, associates with nascent BR pre-mRNAs and remains in BR granules following their release into the nucleoplasm. Importantly, this association persists while BR granules are transported through NPCs and continues transiently in the cytoplasm (73). Proteins of the
cap-binding complex also remain associated with BR RNPs during their
nuclear export, while others, such as hrp45 and hrp23, do not appear to shuttle and dissociate at various stages prior to or upon association of transport RNPs with NPCs (15).
The specific factors and mechanisms involved in mRNP export through
NPCs are not well understood. Nuclear export of mRNA is a
facilitated process that requires energy (27, 51). The
present models for mRNA export are that the mRNP, rather than
the mRNA itself, is the actual recognition substrate and that
mRNP proteins mediate the interaction of the bound mRNA with a
nuclear protein export machinery (27, 51). A number
of candidate factors specific for mRNA export in metazoans
have emerged through similarities with mRNA export factors
identified in yeast and through studies of retroviral RNA export. One
of the best characterized is TAP, a homolog of the essential
Saccharomyces cerevisiae mRNA export factor Mex67p,
which also binds the constitutive transport element (CTE) of type D
retroviruses. TAP promotes export of unspliced CTE-containing
pre-mRNA, and an excess of CTE RNA inhibits cellular mRNA
export (22, 30, 55). The participation of TAP in export of
cellular mRNAs is probably effected through its interaction with an
hnRNP-like protein, termed REF or Aly, that is similar to another
essential S. cerevisiae mRNA export factor, Yra1p
(4, 70, 71). Recent studies have indeed shown that
REF can stimulate nuclear export of mRNA derived from
intron-containing as well as intronless RNAs (65, 77).
Association of REF with some RNAs appears to result from
pre-mRNA splicing, and the present thinking is that TAP
associates with cellular mRNPs at some stage after
recruitment of REF (65). Other mammalian proteins
similarly implicated in mRNA export include hGLE1, RAE1 (or
mrnp41) (a homolog of Gle2p), and Dbp5, a DEAD-box protein (32,
63, 67, 75).
Processing itself of pre-mRNA into mRNA plays a central
role in mRNA export. It has long been known that, for
intron-containing genes, the presence of an intron (and its subsequent
removal) is required for efficient gene expression (21,
23). Some naturally intronless transcripts (e.g., herpes
simplex virus thymidine kinase mRNA and histone mRNA) contain
specific sequences that can mediate intron-independent
expression when placed on otherwise intron-dependent RNAs
(25, 39). In the case of thymidine kinase mRNA, one
such sequence provides a high-affinity binding site for the hnRNP L protein (39). Introns themselves prevent RNA export,
and this is likely a result of retention by the spliceosome
(12, 36). In vitro splicing and oocyte microinjection
studies showed that for at least some mRNAs produced from
intron-containing pre-mRNAs, mRNPs assembled in vitro
through splicing are different from those assembled on fully spliced
mRNA and are exported from the nucleus more efficiently
(41). Several proteins are recruited to mRNPs as a
result of splicing, including DEK, SRm160p, RNPS1, Y14, and REF
(31, 37, 38, 45, 77). This results at least in part from
the deposition of a specific protein complex at or near splice junctions (37, 38). Among these, Y14 persists with the
mRNA in the cytoplasm (31).
It is apparent that nuclear processing and export of mRNA are
accompanied by multiple rearrangements in the RNP complexes with which
pre-mRNA and mRNA are associated. These rearrangements would include formation of an export-competent nuclear mRNP
(nmRNP) intermediate that contains mature mRNA with bound
shuttling hnRNP proteins, as well as specific proteins (such as
REF) recruited through pre-mRNA splicing and from which
nonshuttling hnRNP proteins have been removed (57,
60). Such an RNP assembled in vivo has not yet been isolated.
Besides splicing, it is likely that other cellular events in mRNA
formation also contribute to this remodeling. Shuttling hnRNP
proteins associated with mRNA may contribute to mRNA
export through their NESs (46, 47). Indeed, microinjection experiments with Xenopus laevis oocytes
have implicated hnRNP A1 in mRNA export
(28). Further remodeling of this mRNP would then
occur following nuclear export, as the nmRNP proteins are exchanged
for cytoplasmic mRNP components (16).
In the work presented here, we set out to identify and isolate RNP
complexes from human cells containing shuttling hnRNP proteins associated with pre-mRNA and mRNA at different stages of
maturation. At least three distinct complexes can be separated, one of
which exhibits characteristics of a nuclear mRNP (nmRNP)
intermediate. We have identified nmRNP-specific proteins that
include specific alternatively spliced isoforms of the hnRNP D and
E proteins, as well as a novel RNA-binding protein. This novel
nmRNP complex is likely to represent a late nuclear stage of
mRNA formation and as such is a candidate substrate for nuclear
export of mRNA.
 |
MATERIALS AND METHODS |
Cell culture and labeling.
HeLa cells were grown at 37°C
in monolayer culture to subconfluent densities in Dulbecco modified
Eagle medium containing 10% fetal calf serum and supplemented
with penicillin and streptomycin. Where indicated, cells were labeled
with [35S]methionine at 20 µCi/ml for 20 h in Dulbecco modified Eagle medium containing 5% fetal calf serum and
1/10 the normal concentration of methionine.
Subcellular fractionation.
All fractionation steps were
carried out on ice. Cells grown in monolayer culture were rinsed three
times with phosphate-buffered saline and collected with a cell scraper
in RSB-100 (10 mM Tris-HCl [pH 7.4], 100 mM NaCl, 2.5 mM
MgCl2) (0.75 to 1.0 ml/plate) containing digitonin (Calbiochem) at a final concentration of 40 µg/ml. The cells were then incubated on ice for 5 min, and the soluble cytosolic fraction was separated from the nuclear and digitonin-insoluble fractions by centrifugation at 2,000 × g for 8 min.
The supernatant fraction was collected, and the remaining pellet was
resuspended in RSB-100 containing 0.5% (vol/vol) Triton X-100.
Following incubation on ice for 5 min, the Triton-extracted material
was separated by centrifugation at 2,000 × g for 8 min. The supernatant was collected, and the remaining pellet was
resuspended in the same buffer and disrupted by two 5-s exposures to
sonication on ice, using a microtip sonicator (model XL2015; Heat
Systems, Farmingdale, N.Y.) set at scale 2.5. The sonicated material
was then layered onto a 30% (wt/vol) sucrose cushion in RSB-100 and
centrifuged at 4,000 × g for 15 min, and the
supernatant was collected.
Immunopurification of RNP complexes.
RNP complexes were
immunopurified from the different subcellular fractions with the
indicated anti-hnRNP antibodies essentially as previously described
(13, 59), except that protease inhibitors were omitted.
Bound complexes were eluted from protein A-Sepharose beads with sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample
buffer or non-equilibrium pH gradient gel electrophoresis (NEPHGE) sample buffer for analysis by SDS-PAGE and
two-dimensional gel electrophoresis, respectively.
RNA analysis.
Total RNA was prepared from subcellular
fractions using the Trizol reagent (GIBCO-BRL) according to the
manufacturer's instructions. For analysis of RNP-associated RNA,
immunopurified complexes were heated to 65°C for 5 min in Tris-EDTA
containing 1% SDS. RNA was then extracted from the samples by
extraction with phenol and precipitated with ethanol according to
standard protocols. RNA samples were incubated with 4 U of RQ1 DNase
(Promega) for 40 min, and RNA was recovered by phenol extraction and
ethanol precipitation. RNP-associated RNAs or
1.5 µg of total RNA
was used in reverse transcription (RT) reactions (5 mM
MgCl2, 0.6 mM deoxynucleoside triphosphates, and
2.5 µM random hexamer primers) with murine leukemia virus reverse
transcriptase (Perkin-Elmer) for 15 min at 45°C, followed by 5 min at
95°C. PCRs (with 0.5 pmol of the indicated primers per µl, 1.5 mM
MgCl2, and 2.5 U of AmpliTaq polymerase
[Perkin-Elmer]) included 30 cycles of 1 min at 95°C, 1 min at
55°C, and 1 min at 72°C. PCR products were resolved by agarose gel
electrophoresis. The positions of the primers used in each reaction are
indicated in Fig. 3. Sequences of the
-actin-specific primers were
as follows: EF, 5'
GAAAATCTGGCACCACACCT; ER, 5'
GGCCGGACTCGTCATACTC; IF, 5'
CGCTACCTCTTCTGGTGGC; and IR, 5'
ACCATGTCACACTGGGGAAG. Sequences of the TAFII30-specific
primers were as follows: EF, 5'
AGGGGGCCATATCTAACGG; ER, 5'
AGTAGTGCGGCTTCTTCACATT; IF, 5'
GGGTGAGGGCAGAGGGTATAG; and IR, 5' TTTGTCAGCAGGCTAGGTGG.
Gel electrophoresis and immunoblot analysis.
SDS-PAGE and
immunoblot analyses were carried out essentially as previously
described (59). For SDS-PAGE, the separating gel had an
acrylamide concentration of 12.5%. Two-dimensional gel electrophoresis
was carried out as described by O'Farrell et al. (53).
Separation in the first dimension was by NEPHGE, using pH 3 to
10 ampholites (Bio-Rad, Richmond, Calif.). After electrophoresis of
[35S]methionine-labeled proteins, the gel was
stained with Coomassie blue and impregnated with 2,5-diphenyloxazole
for fluorography (35). The following antibodies were used
for immunoblot analysis: 4B10 (anti-hnRNP A1) (59),
4F4 (anti-hnRNP C1/C2) (14), 5B9 (anti-hnRNP
D) (26), 5H3 (anti-hnRNP E) (26), 12G4
(anti-hnRNP K/J) (44), anti-PABP1 (19),
antitransportin (Transduction Laboratories, Lexington, Ky.), and
anti-REF (kindly provided by E. Izaurralde, European Molecular Biology Laboratory).
UV light-induced cross-linking of proteins to RNA in living cells
and analysis of cross-linked RNP complexes.
Cross-linking of
proteins to RNA in vivo by UV light irradiation of cells, followed by
selection of cross-linked complexes by oligo(dT) chromatography, was
carried out essentially as previously described (16, 58),
except that following UV irradiation cells were fractionated as
described above. Proteins were released from the cross-linked complexes
by digestion with RNase A at 50 µg/ml for 1 h at 30°C,
resolved by SDS-PAGE, and visualized by autoradiography.
 |
RESULTS |
Differential subcellular fractionation of complexes containing
shuttling and nonshuttling hnRNP proteins.
In order to isolate
RNP complexes at different stages of maturation in association with the
shuttling hnRNP protein A1, a subcellular fractionation approach
was devised to allow their separation. To isolate complexes in
transit through the cytoplasm, the plasma membrane was first
permeabilized with low concentrations of digitonin that leave the
nuclear envelope intact (1), and nuclei and associated
structures were then removed through centrifugation. The
supernatant fraction from this step is expected to contain primarily
soluble cytoplasmic material, and we refer to it as cytosol. The second
fraction was obtained by extracting the nuclear pellet with 0.5%
Triton X-100, which partially solubilizes the nuclear envelope, and
again pelleting the extracted nuclei. The resulting supernatant
contains soluble nuclear components that are selectively released
from the nucleus (4, 20; F. Triolo and S. Piñol-Roma, unpublished data), as well as organellar material that is solubilized by Triton X-100. We refer to this as the
Triton-extracted fraction. The remaining nuclear pellet was disrupted
by sonication and clarified by centrifugation, yielding a soluble
fraction that is operationally defined as nucleoplasm and that was used
previously for isolation of hnRNP complexes (13, 56,
59).
Initial immunoblotting experiments revealed small amounts of hnRNP
A1 in the cytosol, consistent with its nucleocytoplasmic shuttling. In
addition, detectable amounts of A1 were selectively extracted with
Triton X-100 from the nuclear fraction, as compared to hnRNP C1/C2
(not shown, but see Fig. 4). To address whether A1 is in RNP complexes
in these fractions, we carried out immunopurifications using an
antibody against hnRNP A1 (4B10) under conditions that preserve
most protein-protein and protein-RNA interactions (13, 59). Immunopurifications from the nucleoplasmic fraction yielded a set of proteins similar to that of previously described hnRNP complexes (Fig. 1A). This was confirmed
by two-dimensional gel electrophoresis (see, e.g., Fig. 5A) and by the
fact that virtually identical complexes were immunopurified from this
fraction with an antibody against hnRNP C1/C2 (Fig. 1A). Notably,
immunopurifications from the other two fractions yielded distinct sets
of proteins associated with hnRNP A1. In the cytosol, the most
prominent proteins migrated at ca. 70 and ca. 90 kDa (Fig. 1A). In the
Triton-extracted fraction, A1 was associated with a prominent protein
of ca. 130 kDa as well as with other proteins of lower relative
abundance, many of which appear to be unique to this complex (Fig. 1A).
By contrast, no detectable complexes were recovered from the cytosol or
Triton-extracted fractions with an anti-hnRNP C antibody (Fig. 1).
The presence of proteins specific to each of the different hnRNPA1-associated complexes shows that these are indeed
distinct complexes. This also indicates that the differential
fractionation of these complexes reflects differences in their
subcellular localization and/or association with subcellular
structures, rather than cross-contamination of the fractions or
disruption of hnRNP complexes during fractionation.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 1.
Immunopurification of complexes containing hnRNP
proteins from different subcellular fractions. (A) HeLa cells were
labeled with [35S]methionine and fractionated as
described in the text. Immunopurifications were carried out from each
fraction with monoclonal antibodies to hnRNP A1 (4B10) or hnRNP
C1/C2 (4F4) or nonimmune parent myeloma immunoglobulins (SP2/0). The
positions of hnRNP A1 and hnRNP C1/C2 in the gel are indicated
on the right. The asterisk indicates the 130-kDa protein discussed in
the text. Cyto., cytosol; Triton, Triton-extracted fraction; Nup.,
nucleoplasmic fraction. (B) Immunopurifications carried out under
conditions identical to those shown in panel A, using
monoclonal antibodies to hnRNP K/J (12G4) and hnRNP U
(3G6). The positions of hnRNP K/J and hnRNP U in the gel are
indicated on the right. Positions of molecular mass standards (in
kilodaltons) are indicated on the left.
|
|
The presence of complexes associated with C proteins only in the
nucleoplasm, in contrast to the presence of hnRNP A1-associated
complexes also in the cytosol and Triton-extracted fractions,
suggested
that this differential fractionation reflects different
properties of
RNP complexes associated with shuttling compared
to nonshuttling
hnRNP proteins. Indeed, immunopurifications with
antibodies against
two other shuttling proteins, hnRNP K/J (Fig.
1B) and
hnRNP A2 (data not shown), yielded similar complexes from
the
Triton-extracted fraction, in which the 130-kDa protein was
again a
prominent component (Fig.
1B). By contrast, an antibody
against
hnRNP U (a nonshuttling protein) immunopurified the hnRNP
complex from nucleoplasm, as observed previously (
13), but
only
small detectable amounts of hnRNP U from the other two
fractions
(Fig.
1B). Release from the nuclear fraction with Triton
X-100
therefore appears to be a property of complexes associated with
shuttling hnRNP proteins that do not contain nonshuttling hnRNP
proteins. The specificity of the immunopurifications was confirmed
by
the absence of detectable proteins when nonimmune SP2/0 myeloma
immunoglobulins were used (Fig.
1). The specificity of the
anti-hnRNP
antibodies in immunopurification experiments has been
reported
previously (
13,
44,
59). Therefore, the
additional proteins
observed in the various complexes are
coimmunopurified due to
interactions (direct or indirect) with the
respective hnRNP
proteins.
The complexes of hnRNP A1 in different fractions are RNP
complexes.
Previous studies showed that copurification of the >20
hnRNP proteins in nucleoplasmic hnRNP complexes requires RNA
(13). To address whether RNA is also required for the
association of proteins with hnRNP A1 in the cytosol and
Triton-extracted fractions, the fractions were digested with RNase
prior to immunopurification. As shown in Fig.
2, RNase digestion disrupts the
complexes in both fractions. Specifically, association of the 130-kDa
protein and of most of the other proteins with A1 in the
Triton-extracted fraction is completely disrupted by RNase
treatment (Fig. 2). In the cytosol fraction, whereas the 70-kDa protein
does not copurify with A1 after RNase treatment, association of the
90-kDa protein is resistant to digestion of the RNA (Fig. 2). These
results indicate that, as is the case with nucleoplasmic hnRNPs,
the complexes isolated from cytosol and Triton-extracted fractions
contain RNA. Furthermore, the associations between most of these
proteins and hnRNP A1 are likely to be mediated primarily by their
binding to the same RNA molecules.

View larger version (76K):
[in this window]
[in a new window]
|
FIG. 2.
RNase sensitivity of hnRNP A1-associated
complexes. Complexes associated with hnRNP A1 were isolated
from the soluble cytosolic fraction (lanes C) or Triton-soluble nuclear
fraction (lanes T), as shown in Fig. 1, without (lanes ) or with
(lanes +) prior digestion of the fractions with RNase A. The
position of hnRNP A1 in the gel is indicated on the right.
Identical immunopurifications were carried out with nonimmune parent
myeloma immunoglobulins (SP2/0). Positions of molecular mass standards
(in kilodaltons) are indicated on the left.
|
|
The hnRNP A1-associated complexes contain RNAs at different
stages of maturation.
Previous work showed that immunopurified
hnRNP complexes contain a heterogeneous population of rapidly
labeled, RNA polymerase II-transcribed RNAs (13).
Furthermore, hnRNP A1 is bound transiently to
poly(A)+ RNA in the cytoplasm and probably also
during its nucleocytoplasmic transport (60). In
agreement with this, RNA polymerase II-transcribed RNA is
coimmunopurified with hnRNP A1 in all three fractions and can
be detected as a heterogeneous population of RNAs after labeling with
[3H]uridine (data not shown).
The fractionation properties of the RNPs in the different fractions
could be explained in at least two ways. First, each fraction
could
contain different subsets of transcripts with different
extraction
properties. Alternatively, the different fractionation
of the RNPs may
reflect sequential stages in maturation of their
associated
pre-mRNAs and mRNAs. In the absence of a unifying feature
of pre-mRNAs that would allow us to distinguish them
experimentally
as a family from mRNAs, we addressed these
possibilities by focusing
our attention on specific transcripts for
analysis by RT-PCR.
Two different constitutively expressed RNAs were
examined, corresponding
to

-actin (
49) and TAFII-30
(
66). These RNAs were selected
because they encode
proteins with very different properties: a
cytoplasmic abundant
cytoskeletal protein (

-actin) and a nuclear
protein of relatively
low abundance involved in transcription
(TAFII-30). Furthermore, both
RNAs encode intracellular proteins,
and therefore their translation
should not be carried out in association
with detergent-soluble
structures, such as the endoplasmic reticulum.
This property would
allow us to distinguish between selectively
extracted nuclear RNAs and
those that are preferentially associated
with the endoplasmic
reticulum. Primers specific for exon or intron
sequences were designed
so that pre-mRNA and spliced mRNA for
each transcript could
be distinguished based on the size of the
resulting PCR product (Fig.
3A). RT-PCR analysis of total RNA
from
each fraction showed that spliced mRNA for both transcripts
is
readily detected in all three fractions, and therefore it is
unlikely
that each fraction merely contains different subsets
of transcripts
(Fig.
3B). More importantly, intron-containing
precursors for both RNAs
were readily detected in the nucleoplasmic
fraction, whereas little (if
any) pre-mRNA was detected in the
cytosol and Triton-extracted
fractions. This is consistent with
the second scenario raised above,
namely, that the different fractions
contain RNAs at different stages
of maturation. The amplified
PCR products do not result from DNA
contamination of the RNA preparations,
since identical reactions where
reverse transcriptase was omitted
did not yield any detectable
amplified products (data not shown).

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 3.
Subcellular distribution and RNP association of specific
pre-mRNAs and mRNAs. (A) Diagram depicting the positions in
the actin and TAFII30 pre-mRNA and mRNA of the primers used
for RT-PCR analysis. Subscripts F and R refer to the forward and
reverse primers, respectively, used in the reactions. (B) Left panel,
RT-PCR analysis of the distribution of pre-mRNA and mRNA
for the transcripts shown in panel A, using total RNA from the various
subcellular fractions as a template. Right panel, analysis of hnRNP
A1-associated RNA in complexes isolated from the different subcellular
fractions. Lanes E, RT-PCR products when all primers correspond to exon
sequences. Lanes I, use of at least one intron-specific primer in the
RT-PCR. Abbreviations are as in Fig. 1 and 2.
|
|
In order to determine whether RNA associated with hnRNP A1 in the
different fractions showed a similar distribution of pre-mRNA
versus mRNA, RNP complexes were immunopurified with 4B10, and
RNAs
extracted from the complexes were used as templates in identical
RT-PCRs. Both pre-mRNA and mRNA were found associated with
hnRNP
A1 in the nucleoplasmic fraction, whereas only mature spliced
mRNA was associated with hnRNP A1 in the Triton-extracted and
cytosol fractions (Fig.
3B). Similar results were observed for
both
transcripts. The RNAs were specifically immunopurified because
of their
association with hnRNP A1, since no RNA was detected
in
immunopurifications with nonimmune SP2/0 myeloma immunoglobulins
(Fig.
3B). The fact that pre-mRNA associated with hnRNP A1 was
found only in the nucleoplasm indicates that hnRNP complexes
represent
an earlier stage of mRNA maturation than RNP complexes
isolated
from the Triton-extracted and cytosol
fractions.
Identification of common as well as specific proteins associated
with hnRNP A1 in different RNP complexes.
The apparent
molecular mass, isoelectric point (see Fig. 5A), and
RNase-resistant association in the cytosol with hnRNP A1 of the
90-kDa protein suggested that it might correspond to transportin, which
associates with A1 in the cytoplasm and mediates its nuclear import
(62). In agreement with this, immunoblot analysis (Fig. 4B) revealed that transportin is indeed
associated with hnRNP A1 preferentially in the cytosolic complexes.
This is consistent with the observation that coimmunopurification of
the major 90-kDa band with hnRNP A1 persists after RNase
digestion (Fig. 2), indicating that it associates with hnRNP A1 by
direct protein-protein interactions. The presence of transportin in
hnRNP A1-associated complexes in the cytoplasmic fraction is
consistent with the hypothesis that these complexes represent a bona
fide soluble cytoplasmic pool. This is further supported by the finding
that the cytoplasmic poly(A)-binding protein (PABP1) is also
specifically enriched in the cytosolic complexes (Fig. 4A) and likely
corresponds to the other major band, of ca. 70 kDa, that also
associates with A1 in this fraction, as suggested by its mobility on
two-dimensional gels (Fig. 5A). These
characteristics suggest that the hnRNP A1-associated complexes from
the cytoplasmic fraction correspond to soluble cytoplasmic
intermediates following nuclear export of hnRNP A1 with its bound
mRNA.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 4.
Immunoblot analysis of immunopurified RNPs. HeLa cells
were fractionated and RNP complexes were immunopurified from each
fraction with monoclonal antibodies to hnRNP A1 (4B10) or hnRNP
C1/C2 (4F4) or nonimmune antibodies (SP2/0). The proteins in the
complexes were resolved by SDS-PAGE, transferred to nitrocellulose, and
probed with monoclonal antibodies to PABP1 (A) or to transportin (B) or
with antibodies against hnRNP A1 (4B10), hnRNP C (4F4), and REF
(C). Lanes C, T, and N, cytosol, Triton-extracted, and nucleoplasmic
fractions, respectively. Asterisks denote the positions of the heavy or
light chains from antibodies used for immunopurification. Lanes ,
mock immunopurifications in which cellular material was omitted.
|
|

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 5.
Two-dimensional gel electrophoresis of hnRNP
A1-associated RNP complexes. (A) Proteins in complexes immunopurified
with 4B10 from each subcellular fraction of
[35S]methionine-labeled cells were resolved by
two-dimensional gel electrophoresis as described in the text and
visualized by autoradiography. The positions of proteins discussed in
the text are indicated. (B) Immunoblot analysis. Nucleoplasmic and
Triton-soluble nuclear RNPs resolved by two-dimensional gel
electrophoresis as for panel A were immunoblotted with the indicated
monoclonal antibodies. The positions of the hnRNP D, E, A1, and
C1/C2 proteins and corresponding alternatively spliced isoforms are
indicated. Ig h.c., position of the heavy chains from antibodies used
for immunopurification.
|
|
The fractionation properties of the other two hnRNP A1-associated
RNPs and the characteristics of their associated RNAs raised
the likely
possibility that these complexes represent distinct
nuclear stages in
the nucleocytoplasmic shuttling cycle of hnRNP
A1 with its
bound mRNAs. At least one protein directly implicated
in mRNA
export, REF, (
70,
71,
77), is associated with all
three
RNPs (Fig.
4). Notably, however, while the amounts of
REF
detected in the Triton-extracted RNPs are smaller than those in
hnRNPs, the amount of hnRNP A1 (and its associated complexes)
recovered from the Triton-extracted fraction is also always smaller
than that recovered from the nucleoplasm (Fig.
4C). We therefore
conclude that REF is associated with hnRNP A1 in at least similar
relative amounts in the complexes isolated from the nucleoplasm
and
from the Triton-extracted fraction. Consistent with its ability
to
shuttle between the nucleus and the cytoplasm (
77), a
relatively
smaller amount of REF is also present in the cytosolic
A1-associated
RNPs.
A comparison of the pattern of proteins in the nucleoplasmic and
Triton-extracted complexes resolved by two-dimensional gel
electrophoresis revealed that in addition to REF, other shuttling
hnRNP proteins (e.g., hnRNP K and hnRNP A2/B1/B2) are also
present
in both complexes (Fig.
5A). On the other hand, apart from the
different association of the nonshuttling hnRNP C1/C2 proteins,
which, as observed previously (Fig.
4C), were not detected by
immunoblot analysis in the Triton-extracted complexes, the nonshuttling
hnRNP U protein (
60) was also not present in any
detectable
amounts in the Triton-extracted complexes (Fig.
5A).
Therefore,
a unique characteristic of these mRNA-containing
complexes from
the Triton fraction that distinguishes them from the
pre-mRNA-
and mRNA-containing hnRNP complex is the
absence of nonshuttling
hnRNP
proteins.
A second unique feature of the Triton-extracted complexes was the
presence of proteins that are not found in hnRNP complexes.
Among
them, the most prominent migrates at ca. 130 kDa (Fig.
5A).
Differences
in protein composition were also apparent in the region
of the gel
between 35 and 60 kDa (Fig.
5A, compare panels Nucleoplasmic
and
Triton). Some of these proteins were identified using antibodies
against known hnRNP proteins. An antibody against hnRNP D (5B9)
reacts with four alternatively spliced isoforms of this protein
(D1,
D2, D01, and D02) (
26). Immunoblotting experiments
revealed
that whereas only D1 and D2 are present in the nucleoplasmic
hnRNP
complex, all four isoforms are associated with A1 in the
Triton-extracted
complexes (Fig.
5B). Similarly, an anti-hnRNP
E antibody (5H3)
recognizes one of the hnRNP E proteins, E1, as
well as an immunologically
related protein, E0 (
26). Only
the E1 protein is detected in
the hnRNP complex, whereas both E1
and E0 are present in the Triton
complex (Fig.
5B). Therefore, the
mRNA-containing RNP complexes
from the Triton-extracted fraction
contain a subset of hnRNP proteins
(namely, shuttling hnRNP
proteins), as well as additional proteins
that include alternatively
spliced isoforms of hnRNP
proteins.
Identification of the 130-kDa protein as LRP130, a novel
RNA-binding protein.
Since the 130-kDa protein was the most
prominent one associated with shuttling hnRNP proteins in the
Triton-extracted fraction and because its association appeared to be
specific to these mRNA-containing complexes, it was chosen for
further characterization. For this purpose, immunopurification from the
Triton-extracted fraction with the 4B10 antibody was scaled up to
enable analysis of the 130-kDa protein by mass spectrometry (MS).
Tandem MS (MS-MS) (5) was used to derive sequence
information (64) from tryptic peptides of the 130-kDa
protein. The resulting peptide masses and corresponding daughter
fragments were used to identify proteins by searching the NCBI
nonredundant protein sequence database and EST sequence database
with the program PepFrag (18). This analysis yielded unambiguous identification of a peptide sequence, ADAVWNKIQEENVIPR, unique to a previously reported 130-kDa leucine-rich protein (LRP130) (24). The same identification was obtained by MS-MS
analysis of a different tryptic fragment (not shown). Matrix-assisted
laser desorption ionization-time of flight MS analysis of the 130-kDa band confirmed its identity with LRP130. The function of this protein
was previously unknown, although it was found to be overexpressed in
hepatoblastoma cells (24). Extensive computer searches of databases (2) showed no regions in LRP130 with significant or obvious similarity to any known RNA-binding domains
(8). The only recognizable amino acid sequence motif in
LRP130 is the recently described PPR motif, a TPR-related motif that
has been suggested to mediate protein-protein or protein-RNA
interactions (68). LRP130 contains 11 such PPR motifs,
which are clustered in the N terminus and in the middle region of the
protein (68).
Association of LRP130 with A1 is readily disrupted by RNase
treatment (Fig.
2), indicating that the interaction between these
two
proteins is mediated by their association with the same RNA
molecules.
The absence of known RNA-binding motifs in LRP130 raised
the question
of whether it is bound directly to RNA or whether
this association is
indirect (for example, through interaction
with an RNA-bound protein).
To address this directly, RNA-protein
cross-links were induced in vivo
by exposure of living cells to
UV irradiation. Under the conditions
used here, only proteins
that are in direct contact with the RNA in
vivo can be covalently
cross-linked to it. RNA with its cross-linked
proteins can then
be isolated under protein-denaturing conditions in
order to eliminate
adventitious association of proteins with RNA during
fractionation
(see, e.g., references
16 and
72). HeLa cells were exposed
to UV light, and
polyadenylated RNA with its cross-linked proteins
was selected from
cytosol, Triton-extracted, and nucleoplasmic
fractions by oligo(dT)
chromatography under denaturing conditions
that allow coisolation of
only those proteins covalently cross-linked
to the RNA. Proteins in the
cross-linked complexes were then released
by digestion with RNase
and resolved by SDS-PAGE (Fig.
6). As
previously observed (see, e.g., references
16 and
72), even
at this level of resolution one can observe
differences in the
sets of proteins cross-linked to RNA in
nucleoplasmic and cytoplasmic
fractions. Importantly, the most
prominent cross-linked protein
in the Triton-extracted fraction
migrates at ca. 130 kDa (lane
T). The specificity of this cross-linking
is underscored by the
absence of detectable proteins in samples
prepared from cells
that were not exposed to UV light (Fig.
6, lane

UV). Matrix-assisted
laser desorption ionization-time of flight MS
and MS-MS analyses
of the 130-kDa cross-linked band in the
Triton-extracted fraction
identified it also as LRP130 (not shown),
which demonstrates that
LRP130 is indeed bound to poly(A)-containing
mRNA in living cells.

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 6.
Selection of proteins bound to poly(A)+ RNA
in vivo in the different subcellular fractions. HeLa cells were exposed
to UV light to induce covalent protein-RNA cross-links, and the cells
were fractionated into cytoplasmic (lane C), Triton-extracted (lane T),
and nucleoplasmic (lane N) fractions. The cross-linked complexes were
selected from each fraction by oligo(dT) chromatography under
protein-denaturing conditions. Bound proteins were released from the
cross-linked complexes by digestion with RNase, resolved by
SDS-PAGE, and visualized by autoradiography. The position of
LRP130 is indicated with an asterisk. A shorter exposure of the lane
corresponding to cytoplasmic cross-linked proteins is shown here for
clarity.
|
|
 |
DISCUSSION |
We have dissected the nucleocytoplasmic shuttling pathway of
hnRNP A1 into at least three distinct classes of RNPs with
characteristics of sequential stages in mRNA formation. Among
these, we identified a likely intermediate nuclear mRNP (nmRNP)
complex (or set of complexes) that contains mRNA with associated
shuttling hnRNP proteins but no pre-mRNA or nonshuttling
hnRNP proteins. The strategy for the isolation of these complexes
is based on the different nucleocytoplasmic traffic characteristics of
hnRNP proteins and exploits differences in subcellular associations
of RNP complexes at different stages of maturation in combination with
specific immunopurification of RNPs. The immunopurification approach
taken here has been used successfully in the past to isolate hnRNP
complexes under conditions that minimize disruption and rearrangements
of the complex (13, 59). Therefore, the complexes
described in this study are likely to represent endogenous RNPs that
were assembled in vivo.
The three classes of RNP complexes described here can be distinguished
from each other by their RNA and protein compositions and by their
association with different subcellular fractions. One class corresponds
to the previously described nucleoplasmic hnRNP complexes
(13, 59), which contain shuttling and nonshuttling hnRNP proteins and which we show here contain both pre-mRNA
and mRNA. This is distinct from a second class of RNPs, also
associated with nuclei, which display characteristics of mature
nuclear mRNPs (nmRNPs). Specifically, they contain mRNA but
no detectable pre-mRNA. They also contain shuttling hnRNP
proteins as well as the nuclear mRNA export factor REF, as is the
case with hnRNP complexes, but no nucleus-retained hnRNPs such
as C1/C2 and U. In addition, there are several proteins specifically
associated with nmRNPs that are not found in hnRNP complexes.
RNP complexes associated with hnRNP A1 are also found in the
cytosol, where A1 is associated with mRNA as well as with the major
cytoplasmic mRNP protein PABP1 (19) and with
transportin, the nuclear transport receptor for hnRNP A1
(62). Importantly, all three types of complexes
contain proteins in common, as well specific proteins that are
not found in the other complexes.
The existence of distinct RNP complexes of hnRNP proteins was
suggested by a number of previous studies, which indicated that nuclear
formation of mRNAs from pre-mRNAs, as well as
nucleocytoplasmic transport of mRNAs, is accompanied by substantial
changes in the proteins associated with these RNAs (see the
introduction). In addition, the major proteins bound to mRNA in the
cytoplasm at steady-state levels are different from those associated
with pre-mRNA in the nucleus (16, 72), indicating
a wholesale exchange of mRNP for hnRNP proteins as the mRNA
is exported from the nucleus to the cytoplasm. Taking these previous
observations together with our findings, the distinct RNP complexes
that we have isolated can best be fit into a temporal sequence of
events in which the hnRNP complexes represent the initial
pre-mRNPs as well as early postsplicing mRNPs in which RNA
polymerase II-transcribed transcripts are found (17). In
agreement with this, pre-mRNA and mRNA for both
-actin
and TAFII30 are detected in these complexes (Fig. 3). In addition, the
mRNA export factor REF is also present in hnRNP complexes. The
presence of spliced mRNA in hnRNP complexes indicates that many
of the subsequent changes in RNP protein composition represented by the
additional mRNPs described here occur after processing of
pre-mRNA to mRNA.
In contrast to hnRNPs, the fractionation properties of the
cytosolic complexes and their association with transportin and PABP1 (a
primarily cytosolic mRNP protein [19]) indicate that they represent the last stage(s) in the nucleocytoplasmic shuttling of
hnRNP A1 during its transit in the cytoplasm. These results also indicate that PABP1 can bind mRNA prior to complete release of
hnRNP A1 from the same mRNA. By contrast, no significant
amounts of PABP1 copurify with hnRNP K in the cytosolic
fraction (Fig. 1B). This suggests that hnRNP K dissociates from
mRNA prior to binding of PABP1 and therefore prior to release of
hnRNP A1. Indeed, electron microscopy studies of BR mRNP export
in C. tentans have also shown different proteins
dissociating from the mRNP in the cytoplasm at different stages
following its nuclear export (for a review, see reference
15). We cannot determine from these results whether
both transportin and PABP1 coexist simultaneously in the same complexes
with hnRNP A1 or whether they interact with hnRNP A1 in
distinct complexes. The specificity of the interaction of hnRNP A1
with transportin is underscored by the absence of transportin in
association with hnRNP K/J (Fig. 1B), in agreement with previous
findings that hnRNP K does not require transportin for its nuclear
import (47). It is noteworthy that the number of proteins
that can be cross-linked to mRNA in the cytoplasm is substantially
larger than the number of proteins associated with hnRNP A1
(16) (Fig. 6). This would be consistent with a transient
nature of the cytosolic hnRNP A1-containing mRNPs (supported by
immunofluorescence microscopy data [60]), indicating
that additional proteins associate with cytoplasmic mRNA once
hnRNP A1 is released from the complex (and therefore such proteins
would not be coimmunoprecipitated with hnRNP A1).
The third class of RNP complexes, which are associated with hnRNP
A1 in the Triton-extracted fraction, is of particular interest because
their properties are consistent with those hypothesized for nuclear
mRNPs at late stages of mRNA formation and possibly as
substrates for nuclear export of mRNA. This conclusion is supported both by their protein and RNA compositions, as described above, and by
their subcellular fractionation properties. Specifically, these
nmRNPs are associated with the nuclear fraction and are not
solubilized with digitonin under conditions that retain the integrity
of the nuclear envelope (1). Therefore, they are unlikely
to represent soluble cytoplasmic complexes. On the other hand, they are
readily released by Triton X-100 treatment of the digitonin-insoluble
fraction, which contains nuclei as well as insoluble cytoplasmic
structures. Treatment of nuclei with nonionic detergents is known to
result in selective release of some nuclear contents, including RNA
export factors, and we have observed this to also be the case for the
nucleoplasmic pool of another abundant nuclear protein, nucleolin, with
its associated rRNA (4, 20; Triolo and Piñol-Roma,
unpublished data). It is unlikely that the complexes released by
treatment with Triton X-100 originate from an otherwise insoluble
cytoplasmic pool of mRNPs associated with the cytoskeleton. It has
been reported that translated mRNA associates with the
cytoskeleton, and there are conflicting reports as to the sensitivity
of cytoskeleton-associated mRNA to treatment with detergents
(6, 11, 54). While we have not completely ruled out a
cytoplasmic origin of these complexes, we consider this unlikely since
they are not released into the soluble cytosolic fraction by treatment
of cells with a variety of cytoskeleton-disrupting conditions (S. Mili
and S. Piñol-Roma, unpublished observations). The properties of
these RNPs, therefore, indicate that they are precursors to the
cytosolic mRNPs described here and that they correspond to a later
stage in mRNA formation than (and are a product of) the
pre-mRNA-containing hnRNP complexes. This suggests strongly
that these nmRNP complexes are a novel intermediate in the pathway
of mRNA formation.
An important finding presented here is that several of the proteins in
the nmRNPs are specific to these complexes and are not found in
hnRNP complexes. The most prominent among them is LRP130, to which
no specific function had been attributed (24) and which
our results indicate binds specifically to mRNA. Importantly, a
protein with electrophoretic mobility similar to that of LRP130 is
associated with all shuttling hnRNP proteins that we have examined thus far, including hnRNP A1 and hnRNP K/J (this work) and
hnRNP A2/B1/B2 (Mili and Piñol-Roma, unpublished
observations). Analysis of the LRP130 amino acid sequence revealed no
readily apparent RNA-binding motifs. However, we show here that it
binds poly(A)+ RNA in vivo, as it is readily
cross-linked to mRNA by UV irradiation of living cells (Fig. 6).
The only recognizable amino acid sequence motif in LRP130 is the
recently described PPR motif (68). Other proteins with PPR
motifs have also been shown to bind RNA and/or participate in mRNA
metabolism, raising the possibility that the PPR motif itself is an
RNA-binding motif (68). Therefore, LRP130 is an
RNA-binding protein with none of the known RNA-binding motifs, suggesting that it contains a novel type of RNA-binding domain. A
recent study with Drosophila melanogaster has shown that
BSF, a protein highly similar to LRP130, has RNA-binding activity and is involved in regulating the stability of bicoid mRNA
(42).
Other proteins associated with this intermediate and not present in
nucleoplasmic hnRNP complexes are the D0 and E0 proteins. There are
four alternatively spliced isoforms of hnRNP D: D2 (p45), D1 (p42),
D02 (p40), and D01 (p37) (74). Of these, D2 and D1 isoforms are preferentially associated with hnRNP complexes (Fig. 5B). D1 and D2 contain a specific amino acid sequence that is encoded
by an alternatively spliced exon that is absent from the D01 and D02
isoforms. By contrast to D1 and D2, D01 and D02 are specifically
associated with nmRNPs. While all D protein isoforms are
predominantly nuclear at steady-state levels, they differ in their
ability to shuttle between the nucleus and the cytoplasm. Interestingly, the amino acid sequence specific to the D1/D2 isoforms has been proposed to be responsible for retaining them in the nucleus
by mediating their interaction with the nuclear matrix-associated factor SAF-B. D01 and D02, which lack this sequence, do not associate with SAF-B and are able to shuttle (3). These properties
are consistent with our observation that D1- and D2-containing
hnRNP complexes are resistant to extraction with nonionic
detergent, whereas D01- and D02-containing nmRNP complexes seem to
be relatively freely diffusible in the nucleoplasm, since they are
readily extracted by mild detergent treatment. This distribution of
hnRNP D protein isoforms is reminiscent of the
Drosophila RNA-binding protein How, which exists in two
isoforms with different subcellular distributions. It was proposed that
the shorter isoform can compete directly with the longer nuclear
isoform for binding to target RNAs, thereby releasing inhibition of
nuclear export in a developmentally regulated manner (48).
We speculate that a similar mechanism could operate in the case of the
hnRNP D proteins, with the D01 and D02 isoforms possibly displacing
the nucleus-retained D1 and D2 isoforms at a specific stage prior to
nuclear RNA export. The specific relationship between E1 and E0 is not
known, but their immunological relatedness, together with precedent
from other hnRNP proteins (9), suggests that they may
also be produced by alternative splicing from the same
pre-mRNAs.
It is noteworthy that recruitment of a number of RNA-binding proteins
onto mRNA in the nucleus has been shown or hypothesized to be
required for subsequent function of these proteins in the cytoplasm,
e.g., in RNA localization, stability, and regulation of translation
(see, e.g., references 7, 34, and 40). For example, the D. melanogaster hrp40 protein, which is similar
to hnRNP D, mediates cytoplasmic localization of a number of
pair-rule transcripts, and this function requires recruitment of Hrp40
to the mRNA in the nucleus (34). Furthermore,
contributions of hrp40 to regulation of Gurken localization during
oogenesis vary among specific hrp40 isoforms (52). In
vertebrate cells, recruitment of specific hnRNP D protein isoforms
(also known as AUF1) to mRNA in the nucleus has been proposed to
determine the subsequent function of these proteins in cytoplasmic
regulation of mRNA stability (40). These observations,
therefore, are in agreement with our finding that specific isoforms of
hnRNP proteins initiate their association with the mRNA in
nuclear mRNP complexes. RNP complexes containing
-actin and
TAFII30 pre-mRNA and mRNA exhibit similar fractionation
properties, suggesting that the overall characteristics of the observed
complexes are a general feature of most transcripts in the cell.
However, it is likely that the actual relative amounts of different
proteins in the RNPs vary among specific transcripts (43, 61,
76), depending on the sequence characteristics and ultimate fate
of the mRNA.
Based on these findings, we propose the model shown in Fig.
7 for remodeling of pre-mRNP and
mRNP complexes during nuclear maturation and export of mRNA. As
previously shown, most hnRNP proteins associate with nascent
transcripts produced by RNA polymerase II, in
pre-mRNA-containing hnRNP complexes. In addition to
hnRNP proteins, other components of the pre-mRNA processing
machinery (including snRNPs) associate transiently with hnRNP
complexes as the reactions leading to formation of mature mRNA take
place. For transcripts derived from intron-containing genes, the RNAs are retained in the nucleus as long as spliceosomes can be formed on
these RNAs (12, 36). In addition, RNA-bound proteins with NRSs such as hnRNP C1/C2 and D1/D2 may also mediate nuclear
retention of the bound RNAs (50). Completion of splicing
leads to recruitment of a subset of mRNP-specific proteins,
such as Y14, DEK, SRm160, and the mRNA export factor REF.
Subsequent removal of NRS-containing proteins would release this
mRNP from a "nuclear anchor," possibly rendering the mRNP
freely diffusible in the nucleoplasm. The mechanism for removal of
NRS-containing proteins is not known. By analogy to the D. melanogaster RNA-binding protein How (48), this
dissociation could result from displacement by alternatively spliced
isoforms (as could be the case for hnRNP D and E) or by a
different mechanism (e.g., through the action of helicases
[29, 67]). This complex would also acquire additional
mRNA-specific proteins such as LRP130 and hnRNP D01/D02,
leading to formation of an nmRNP intermediate that is subsequently
exported to the cytoplasm. Following export from the nucleus, shuttling
hnRNP proteins remain associated in a transient cytosolic mRNP
(cmRNP*). An exchange of cytoplasmic mRNP proteins for
nmRNP proteins takes place, ultimately resulting in a distinct
cytoplasmic mRNP (cmRNP) that serves as a substrate for
cytoplasmic mRNA metabolism. Shuttling hnRNP proteins
dissociate from the mRNA at different stages and are reimported
into the nucleus. Therefore, RNP remodeling during mRNA maturation
and export would involve stage-specific release of bound proteins, as
well as stage-specific recruitment of additional RNA-binding proteins.
Any of the stages depicted in this model are potential targets for
regulation.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 7.
Model for the sequential changes in protein composition
of complexes associated with pre-mRNA and mRNA during maturation and
nuclear export of mRNA. See text for details.
|
|
At least two of the proteins in this nmRNP, namely, hnRNP A1
and hnRNP K, contain sequences that can mediate nuclear protein export (46, 47), and thus multiple NESs are found on
individual mRNAs. Our results show that at least one of the
mRNA export factors identified thus far in vertebrate cells, REF
(71, 77), is also associated with the nmRNP. We have
been unable to determine unambiguously whether TAP is also associated
with the nmRNP. It is possible that the interaction of TAP with the
nmRNP is too unstable or weak to survive the RNP isolation
procedure, as suggested also by results from other laboratories (see,
e.g., reference 77). Experiments are now in progress to
determine which (if any) additional known RNA export factors and/or NPC
components, as well as other proteins recruited to mRNA through
splicing (see the introduction), are present in or interact with this
nmRNP. Additional nmRNP components may include members of the
SR family of splicing factors, some of which also shuttle between the
nucleus and the cytoplasm (10). Experiments are also in
progress to determine whether mRNAs derived from intronless genes
also associate in similar complexes and with similar proteins.
 |
ACKNOWLEDGMENTS |
We thank Audrey Marcu and Rosalie Perez for excellent technical
assistance, Soojin Kim for assistance with the initial RT-PCR experiments, and Fabio Triolo for sharing his initial observations on
selective solubility of mature nuclear RNPs and for helpful discussions
and suggestions throughout the course of this work. We also thank Elisa
Izaurralde, Maria Carmo-Fonseca, and Angelo Calado for antibodies and
Kathy Borden, Avrom Caplan, Jeanne Hirsch, Fabio Triolo, and Paul
Wassarman for critical reading of the manuscript.
This work was supported by a grant (GM-53468) from the NIH to S.P.-R.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry and Molecular Biology, Mount Sinai School of Medicine, One Gustave L. Levy Place, Box 1007, New York, NY 10029-6574. Phone: (212) 241-8578. Fax: (212) 860-1174. E-mail:
serafin.pinol-roma{at}mssm.edu.
Present address: Department of Biochemistry, UT Southwestern
Medical Center, Dallas, TX 75390-9038.
 |
REFERENCES |
| 1.
|
Adam, S. A.,
R. Sterne-Marr, and L. Gerace.
1990.
Nuclear protein import in permeabilized mammalian cells requires soluble cytoplasmic factors.
J. Cell Biol.
111:807-816[Abstract/Free Full Text].
|
| 2.
|
Altschul, S. F.,
T. L. Madden,
A. A. Schaffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402[Abstract/Free Full Text].
|
| 3.
|
Arao, Y.,
R. Kuriyama,
F. Kayama, and S. Kato.
2000.
A nuclear matrix-associated factor, SAF-B, interacts with specific isoforms of AUF/hnRNP D.
Arch. Biochem. Biophys.
380:228-236[CrossRef][Medline].
|
| 4.
|
Bachi, A.,
I. C. Braun,
J. P. Rodrigues,
N. Panté,
K. Ribbeck,
C. von Kobbe,
U. Kutay,
M. Wilm,
D. Görlich,
M. Carmo-Fonseca, and E. Izaurralde.
2000.
The C-terminal domain of TAP interacts with the nuclear pore complex and promotes export of specific CTE-bearing RNA substrates.
RNA
6:136-158[Abstract].
|
| 5.
|
Biemann, K.
1992.
Mass spectrometry of peptides and proteins.
Annu. Rev. Biochem.
61:977-1010[CrossRef][Medline].
|
| 6.
|
Bird, R. C., and B. H. Sells.
1986.
Cytoskeleton involvement in the distribution of mRNP complexes and small cytoplasmic RNAs.
Biochim. Biophys. Acta
868:215-225[Medline].
|
| 7.
|
Bouvet, P., and A. P. Wolffe.
1994.
A role for transcription and FRGY2 in masking maternal mRNA within Xenopus oocytes.
Cell
77:931-941[CrossRef][Medline].
|
| 8.
|
Burd, C. G., and G. Dreyfuss.
1994.
Conserved structures and diversity of functions of RNA-binding proteins.
Science
265:615-621[Abstract/Free Full Text].
|
| 9.
|
Burd, C. G.,
M. S. Swanson,
M. Görlach, and G. Dreyfuss.
1989.
Primary structures of the heterogeneous nuclear ribonucleoprotein A2, B1, and C2 proteins: a diversity of RNA-binding proteins is generated by small peptide inserts.
Proc. Natl. Acad. Sci. USA
86:9788-9792[Abstract/Free Full Text].
|
| 10.
|
Caceres, J. F.,
G. R. Screaton, and A. R. Krainer.
1998.
A specific subset of SR proteins shuttles between the nucleus and the cytoplasm.
Genes Dev.
12:55-66[Abstract/Free Full Text].
|
| 11.
|
Cervera, M.,
G. Dreyfuss, and S. Penman.
1981.
Messenger RNA is translated when associated with the cytoskeletal framework in normal and VSV-infected HeLa cells.
Cell
23:113-120[CrossRef][Medline].
|
| 12.
|
Chang, D. D., and P. A. Sharp.
1989.
Regulation of HIV depends upon recognition of splice sites.
Cell
59:789-795[CrossRef][Medline].
|
| 13.
|
Choi, Y. D., and G. Dreyfuss.
1984.
Isolation of the heterogeneous nuclear ribonucleoprotein complex (hnRNP): a unique supramolecular assembly.
Proc. Natl. Acad. Sci. USA
81:7471-7475[Abstract/Free Full Text].
|
| 14.
|
Choi, Y. D., and G. Dreyfuss.
1984.
Monoclonal antibody characterization of the C proteins of heterogeneous nuclear ribonucleoprotein complexes in vertebrate cells.
J. Cell Biol.
99:1997-2004[Abstract/Free Full Text].
|
| 15.
|
Daneholt, B.
1997.
A look at messenger RNP moving through the nuclear pore.
Cell
88:585-588[CrossRef][Medline].
|
| 16.
|
Dreyfuss, G.,
Y. D. Choi, and S. A. Adam.
1984.
Characterization of heterogeneous nuclear RNA-protein complexes in vivo with monoclonal antibodies.
Mol. Cell. Biol.
4:1104-1114[Abstract/Free Full Text].
|
| 17.
|
Dreyfuss, G.,
M. J. Matunis,
S. Piñol-Roma, and C. G. Burd.
1993.
HnRNP proteins and the biogenesis of mRNA.
Annu. Rev. Biochem.
62:289-321[CrossRef][Medline].
|
| 18.
|
Fenyo, D.,
W. Zhang,
B. T. Chait, and R. C. Beavis.
1996.
Internet-based analytical chemistry resource: a model project.
Anal. Chem.
68:721A-726A.
|
| 19.
|
Görlach, M.,
C. G. Burd, and G. Dreyfuss.
1994.
The mRNA poly(A)-binding protein: localization, abundance, and RNA-binding specificity.
Exp. Cell Res.
211:400-407[CrossRef][Medline].
|
| 20.
|
Gotzmann, J.,
A. Eger,
M. Meissner,
R. Grimm,
C. Gerner,
G. Sauermann, and R. Foisner.
1997.
Two-dimensional electrophoresis reveals a nuclear matrix-associated nucleolin complex of basic isoelectric point.
Electrophoresis
18:2645-2653[CrossRef][Medline].
|
| 21.
|
Gruss, P.,
C. J. Lai,
R. Dhar, and G. Khoury.
1979.
Splicing as a requirement for biogenesis of functional 16S mRNA of simian virus 40.
Proc. Natl. Acad. Sci. USA
76:4317-4321[Abstract/Free Full Text].
|
| 22.
|
Grüter, P.,
C. Tabernero,
C. von Kobbe,
C. Schmitt,
C. Saavedra,
A. Bachi,
M. Wilm,
B. K. Felber, and E. Izaurralde.
1998.
TAP, the human homolog of Mex67p, mediates CTE-dependent RNA export from the nucleus.
Mol. Cell
1:649-659[CrossRef][Medline].
|
| 23.
|
Hamer, D. H., and P. Leder.
1979.
Splicing and the formation of stable RNA.
Cell
18:1299-1302[CrossRef][Medline].
|
| 24.
|
Hou, J.,
F. Wang, and W. L. McKeehan.
1994.
Molecular cloning and expression of the gene for a major leucine-rich protein from human hepatoblastoma cells (HEPG2).
In Vitro Cell Dev. Biol.
30A:111-114.
|
| 25.
|
Huang, Y., and G. G. Carmichael.
1997.
The mouse histone H2a gene contains a small element that facilitates cytoplasmic accumulation of intronless gene transcripts and of unspliced HIV-1-related mRNAs.
Proc. Natl. Acad. Sci. USA
94:10104-10109[Abstract/Free Full Text].
|
| 26.
|
Ishikawa, F.,
M. J. Matunis,
G. Dreyfuss, and T. R. Cech.
1993.
Nuclear proteins that bind the pre-mRNA 3' splice site sequence r(UUAG/G) and the human telomeric DNA sequence d(TTAGGG)n.
Mol. Cell. Biol.
13:4301-4310[Abstract/Free Full Text].
|
| 27.
|
Izaurralde, E., and S. Adam.
1998.
Transport of macromolecules between the nucleus and the cytoplasm.
RNA
4:351-364[Abstract].
|
| 28.
|
Izaurralde, E.,
A. Jarmolowski,
C. Beisel,
I. W. Mattaj,
G. Dreyfuss, and U. Fischer.
1997.
A role for the M9 transport signal of hnRNP A1 in mRNA nuclear export.
J. Cell Biol.
137:27-35[Abstract/Free Full Text].
|
| 29.
|
Jankowsky, E.,
C. H. Gross,
S. Shuman, and A. M. Pyle.
2001.
Active disruption of an RNA-protein interaction by a DExH/D RNA helicase.
Science
291:121-125[Abstract/Free Full Text].
|
| 30.
|
Kang, Y., and B. R. Cullen.
1999.
The human Tap protein is a nuclear mRNA export factor that contains novel RNA-binding and nucleocytoplasmic transport sequences.
Genes Dev.
13:1126-1139[Abstract/Free Full Text].
|
| 31.
|
Kataoka, N.,
J. Yong,
V. N. Kim,
F. Velazquez,
R. A. Perkinson,
F. Wang, and G. Dreyfuss.
2000.
Pre-mRNA splicing imprints mRNA in the nucleus with a novel RNA-binding protein that persists in the cytoplasm.
Mol. Cell
6:673-682[CrossRef][Medline].
|
| 32.
|
Kraemer, D., and G. Blobel.
1997.
mRNA binding protein mrnp 41 localizes to both nucleus and cytoplasm.
Proc. Natl. Acad. Sci. USA
94:9119-9124[Abstract/Free Full Text].
|
| 33.
|
Krecic, A. M., and M. S. Swanson.
1999.
hnRNP complexes: composition, structure and function.
Curr. Opin. Cell Biol.
11:363-371[CrossRef][Medline].
|
| 34.
|
Lall, S.,
H. Francis-Land,
A. Flament,
A. Norvell,
T. Schüpbach, and D. Ish-Horowicz.
1999.
Squid hnRNP protein promotes apical cytoplasmic transport and localization of Drosophila pair-rule transcripts.
Cell
98:171-180[CrossRef][Medline].
|
| 35.
|
Laskey, R. A., and A. D. Mills.
1975.
Quantitative film detection of 3H and 14C in polyacrylamide gels by fluorography.
Eur. J. Biochem.
56:335-341[Medline].
|
| 36.
|
Legrain, P., and M. Rosbash.
1989.
Some cis- and trans-acting mutants for splicing target pre-mRNA to the cytoplasm.
Cell
57:573-583[CrossRef][Medline].
|
| 37.
|
Le Hir, H.,
E. Izaurralde,
L. E. Maquat, and M. J. Moore.
2000.
The spliceosome deposits multiple proteins 20-24 nucleotides upstream of mRNA exon-exon junctions.
EMBO J.
19:6860-6869[CrossRef][Medline].
|
| 38.
|
Le Hir, H.,
M. J. Moore, and L. E. Maquat.
2000.
Pre-mRNA splicing alters mRNP composition: evidence for stable association of proteins at exon-exon junctions.
Genes Dev.
14:1098-1108[Abstract/Free Full Text].
|
| 39.
|
Liu, X., and J. E. Mertz.
1995.
HnRNP L binds a cis-acting RNA sequence element that enables intron-independent gene expression.
Genes Dev.
9:1766-1780[Abstract/Free Full Text].
|
| 40.
|
Loflin, P.,
C. Y. Chen, and A.-B. Shyu.
1999.
Unraveling a cytoplasmic role for hnRNP D in the in vivo mRNA destabilization directed by the AU-rich element.
Genes Dev.
15:1884-1897.
|
| 41.
|
Luo, M.-J., and R. Reed.
1999.
Splicing is required for rapid and efficient mRNA export in metazoans.
Proc. Natl. Acad. Sci. USA
96:14937-14942[Abstract/Free Full Text].
|
| 42.
|
Mancebo, R.,
X. Zhou,
W. Shillinglaw,
W. Henzel, and P. M. Macdonald.
2001.
BSF binds specifically to the bicoid mRNA 3' untranslated region and contributes to stabilization of bicoid mRNA.
Mol. Cell. Biol.
21:3462-3471[Abstract/Free Full Text].
|
| 43.
|
Matunis, E. L.,
M. J. Matunis, and G. Dreyfuss.
1993.
Association of individual hnRNP proteins and snRNPs with nascent transcripts.
J. Cell Biol.
121:219-228[Abstract/Free Full Text].
|
| 44.
|
Matunis, M. J.,
W. M. Michael, and G. Dreyfuss.
1992.
Characterization and primary structure of the poly(C)-binding heterogeneous nuclear ribonucleoprotein complex K protein.
Mol. Cell. Biol.
12:164-171[Abstract/Free Full Text].
|
| 45.
|
McGarvey, T.,
E. Rosonina,
S. McCracken,
Q. Li,
R. Arnaout,
E. Mientjes,
J. A. Nickerson,
D. Awrey,
J. Greenblatt,
G. Grosveld, and B. J. Blencowe.
2000.
The acute myeloid leukemia-associated protein, DEK, forms a splicing-dependent interaction with exon-product complexes.
J. Cell Biol.
150:309-320[Abstract/Free Full Text].
|
| 46.
|
Michael, W. M.,
M. Choi, and G. Dreyfuss.
1995.
A nuclear export signal in hnRNP A1: a signal-mediated, temperature-dependent nuclear protein export pathway.
Cell
83:415-422[CrossRef][Medline].
|
| 47.
|
Michael, W. M.,
P. S. Eder, and G. Dreyfuss.
1997.
The K nuclear shuttling domain: a novel signal for nuclear import and nuclear export in the hnRNP K protein.
EMBO J.
16:3587-3598[CrossRef][Medline].
|
| 48.
|
Nabel-Rosen, H.,
N. Dorevitch,
A. Reuveny, and T. Volk.
1999.
The balance between two isoforms of the Drosophila RNA-binding protein How controls tendon differentiation.
Mol. Cell
4:573-584[CrossRef][Medline].
|
| 49.
|
Nakajima-Ijima, S.,
H. Hamada,
P. Reddy, and T. Kakunaga.
1985.
Molecular structure of the human cytoplasmic beta-actin gene: interspecies homology of sequences in the introns.
Proc. Natl. Acad. Sci. USA
82:6133-6137[Abstract/Free Full Text].
|
| 50.
|
Nakielny, S., and G. Dreyfuss.
1996.
The hnRNP C proteins contain a nuclear retention sequence that can override nuclear export signals.
J. Cell Biol.
134:1365-1373[Abstract/Free Full Text].
|
| 51.
|
Nakielny, S., and G. Dreyfuss.
1999.
Transport of proteins and RNAs in and out of the nucleus.
Cell
99:677-690[CrossRef][Medline].
|
| 52.
|
Norvell, A.,
R. L. Kelley,
K. Wehr, and T. Schüpbach.
1999.
Specific isoforms of Squid, a Drosophila hnRNP, perform distinct roles in Gurken localization during oogenesis.
Genes Dev.
13:864-876[Abstract/Free Full Text].
|
| 53.
|
O'Farrell, P. Z.,
H. M. Goodman, and P. H. O'Farrell.
1977.
High resolution two-dimensional gel electrophoresis of basic as well as acidic proteins.
Cell
12:1133-1142[CrossRef][Medline].
|
| 54.
|
Ornelles, D. A.,
E. G. Fey, and S. Penman.
1986.
Cytochalasin releases mRNA from the cytoskeletal framework and inhibits protein synthesis.
Mol. Cell. Biol.
6:1650-1662[Abstract/Free Full Text].
|
| 55.
|
Pasquinelli, A. E.,
R. K. Ernst,
E. Lund,
C. Grimm,
M. L. Zapp,
D. Rekosh,
M.-L. Hammarskjöld, and J. E. Dahlberg.
1997.
The constitutive transport element (CTE) of Mason-Pfizer monkey virus (MPMV) accesses a cellular mRNA export pathway.
EMBO J.
16:7500-7510[CrossRef][Medline].
|
| 56.
|
Pederson, T.
1974.
Proteins associated with heterogeneous nuclear RNA in eukaryotic cells.
J. Mol. Biol.
83:163-183[CrossRef][Medline].
|
| 57.
|
Piñol-Roma, S.
1997.
HnRNP proteins and the nuclear export of mRNA.
Semin. Cell Dev. Biol.
8:57-63[CrossRef][Medline].
|
| 58.
|
Piñol-Roma, S.,
S. A. Adam,
Y. D. Choi, and G. Dreyfuss.
1989.
Ultraviolet-induced crosslinking of RNA to proteins in vivo.
Methods Enzymol.
28:410-418.
|
| 59.
|
Piñol-Roma, S.,
Y. D. Choi,
M. J. Matunis, and G. Dreyfuss.
1988.
Immunopurification of heterogeneous nuclear ribonucleoprotein particles reveals and assortment of RNA-binding proteins.
Genes Dev.
2:215-227[Abstract/Free Full Text].
|
| 60.
|
Piñol-Roma, S., and G. Dreyfuss.
1992.
Shuttling of pre-mRNA binding proteins between nucleus and cytoplasm.
Nature
355:730-732[CrossRef][Medline].
|
| 61.
|
Piñol-Roma, S.,
M. S. Swanson,
J. G. Gall, and G. Dreyfuss.
1989.
A novel heterogeneous nuclear RNP protein with a unique distribution on nascent transcripts.
J. Cell Biol.
109:2575-2587[Abstract/Free Full Text].
|
| 62.
|
Pollard, V. W.,
W. M. Michael,
S. Nakielny,
M. C. Siomi,
F. Wang, and G. Dreyfuss.
1996.
A novel receptor-mediated nuclear protein import pathway.
Cell
86:985-994[CrossRef][Medline].
|
| 63.
|
Pritchard, C. E. J.,
M. Fornerod,
L. H. Kasper, and J. M. A. van Deursen.
1999.
RAE1 is a shuttling mRNA export factor that binds to a GLEBS-like NUP98 motif at the nuclear pore complex through multiple domains.
J. Cell Biol.
145:237-253[Abstract/Free Full Text].
|
| 64.
|
Qin, J.,
C. J. Herring, and X. Zhang.
1998.
De novo peptide sequencing in an ion trap mass spectrometer with 18O labeling.
Rapid Commun. Mass Spectrom.
12:209-216[CrossRef][Medline].
|
| 65.
|
Rodrigues, J. P.,
M. Rode,
D. Gatfield,
B. J. Blencowe,
M. Carmo-Fonseca, and E. Izaurralde.
2001.
REF proteins mediate the export of spliced and unspliced mRNAs from the nucleus.
Proc. Natl. Acad. Sci. USA
98:1030-1035[Abstract/Free Full Text].
|
| 66.
|
Scheer, E.,
M.-G. Mattei,
X. Jacq,
P. Chambon, and L. Tora.
1995.
Organization and chromosomal localization of the gene (TAF2H) encoding the human TBP-associated factor II 30 (TAFII30).
Genomics
29:269-272[CrossRef][Medline].
|
| 67.
|
Schmitt, C.,
C. von Kobbe,
A. Bachi,
N. Pante,
J. P. Rodrigues,
C. Boscheron,
G. Rigaut,
M. Wilm,
B. Séraphin,
M. Carmo-Fonseca, and E. Izaurralde.
1999.
Dbp5, a DEAD-box protein required for mRNA export, is recruited to the cytoplasmic fibrils of nuclear pore complex via a conserved interaction with CAN/Nup159p.
EMBO J.
18:4332-4347[CrossRef][Medline].
|
| 68.
|
Small, I. D., and N. Peters.
2000.
The PPR motif a TPR-related motif prevalent in plant organellar proteins.
Trends Biochem. Sci.
25:46-47[Medline].
|
| 69.
|
Stevens, B. J., and H. Swift.
1966.
RNA transport from nucleus to cytoplasm in Chironomus salivary glands.
J. Cell Biol.
31:55-77[Abstract/Free Full Text].
|
| 70.
|
Strasser, K., and E. Hurt.
2000.
Yra1p, a conserved nuclear RNA-binding protein, interacts directly with Mex67p and is required for mRNA export.
EMBO J.
19:410-420[CrossRef][Medline].
|
| 71.
|
Stutz, F.,
A. Bachi,
T. Doerks,
I. C. Braun,
B. Séraphin,
M. Wilm,
P. Bork, and E. Izaurralde.
2000.
REF, an evolutionarily conserved family of hnRNP-like proteins, interacts with TAP/Mex67p and participates in mRNA nuclear export.
RNA
6:638-650[Abstract].
|
| 72.
|
vanEekelen, C. A.,
T. Riemen, and W. vanVenrooij.
1981.
Specificity in the interaction of hnRNP and mRNA with proteins as revealed by in vivo cross linking.
FEBS Lett.
130:223-226[CrossRef][Medline].
|
| 73.
|
Visa, N.,
A. T. Alzhanova-Ericsson,
X. Sun,
E. Kiseleva,
B. Björkroth,
T. Wurtz, and B. Daneholt.
1996.
A pre-mRNA-binding protein accompanies the RNA from the gene through the nuclear pores and into polysomes.
Cell
84:253-264[CrossRef][Medline].
|
| 74.
|
Wagner, B. J.,
C. T. DeMaria,
Y. Sun,
G. M. Wilson, and G. Brewer.
1998.
Structure and genomic organization of the human AUF1 gene: alternative pre-mRNA splicing generates four protein isoforms.
Genomics
48:195-202[CrossRef][Medline].
|
| 75.
|
Watkins, J. L.,
R. Murphy,
J. L. T. Emtage, and S. R. Wente.
1998.
The human homologue of Saccharomyces cerevisiae Gle1p is required for poly(A)+ RNA export.
Proc. Natl. Acad. Sci. USA
95:6779-6784[Abstract/Free Full Text].
|
| 76.
|
Wurtz, T.,
E. Kiseleva,
A. Nacheva,
A. Alzhanova-Ericsson,
A. Rosen, and B. Daneholt.
1996.
Identification of two RNA-binding proteins in Balbiani ring premessenger ribonucleoprotein granules and presence of these proteins in specific subsets of heterogeneous nuclear ribonucleoprotein particles.
Mol. Cell. Biol.
16:1425-1435[Abstract/Free Full Text].
|
| 77.
|
Zhou, Z.,
M.-J. Luo,
K. Straesser,
J. Katahira,
E. Hurt, and R. Reed.
2000.
The protein Aly links pre-messenger-RNA splicing to nuclear export in metazoans.
Nature
407:401-405[CrossRef][Medline].
|
Molecular and Cellular Biology, November 2001, p. 7307-7319, Vol. 21, No. 21
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.21.7307-7319.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zolotukhin, A. S., Uranishi, H., Lindtner, S., Bear, J., Pavlakis, G. N., Felber, B. K.
(2009). Nuclear export factor RBM15 facilitates the access of DBP5 to mRNA. Nucleic Acids Res
37: 7151-7162
[Abstract]
[Full Text]
-
Pettit Kneller, E. L., Connor, J. H., Lyles, D. S.
(2009). hnRNPs Relocalize to the Cytoplasm following Infection with Vesicular Stomatitis Virus. J. Virol.
83: 770-780
[Abstract]
[Full Text]
-
Pawlicki, J. M., Steitz, J. A.
(2008). Primary microRNA transcript retention at sites of transcription leads to enhanced microRNA production. JCB
182: 61-76
[Abstract]
[Full Text]
-
Hsu, L. C.-L., Chen, H.-Y., Lin, Y.-W., Chu, W.-C., Lin, M.-J., Yan, Y.-T., Yen, P. H.
(2008). DAZAP1, an hnRNP protein, is required for normal growth and spermatogenesis in mice. RNA
14: 1814-1822
[Abstract]
[Full Text]
-
Ogawa, S., Satake, M., Ikuta, K.
(2008). Physical and Functional Interactions between STAT5 and Runx Transcription Factors. J Biochem
143: 695-709
[Abstract]
[Full Text]
-
Pfeifer, I., Elsby, R., Fernandez, M., Faria, P. A., Nussenzveig, D. R., Lossos, I. S., Fontoura, B. M. A., Martin, W. D., Barber, G. N.
(2008). NFAR-1 and -2 modulate translation and are required for efficient host defense. Proc. Natl. Acad. Sci. USA
105: 4173-4178
[Abstract]
[Full Text]
-
Cammas, A., Pileur, F., Bonnal, S., Lewis, S. M., Leveque, N., Holcik, M., Vagner, S.
(2007). Cytoplasmic Relocalization of Heterogeneous Nuclear Ribonucleoprotein A1 Controls Translation Initiation of Specific mRNAs. Mol. Biol. Cell
18: 5048-5059
[Abstract]
[Full Text]
-
Barrandon, C., Bonnet, F., Nguyen, V. T., Labas, V., Bensaude, O.
(2007). The Transcription-Dependent Dissociation of P-TEFb-HEXIM1-7SK RNA Relies upon Formation of hnRNP-7SK RNA Complexes. Mol. Cell. Biol.
27: 6996-7006
[Abstract]
[Full Text]
-
Lykke-Andersen, S., Pinol-Roma, S., Kjems, J.
(2007). Alternative splicing of the ADAR1 transcript in a region that functions either as a 5'-UTR or an ORF. RNA
13: 1732-1744
[Abstract]
[Full Text]
-
Ji, X., Kong, J., Carstens, R. P., Liebhaber, S. A.
(2007). The 3' Untranslated Region Complex Involved in Stabilization of Human {alpha}-globin mRNA Assembles in the Nucleus and Serves an Independent Role as a Splice Enhancer. Mol. Cell. Biol.
27: 3290-3302
[Abstract]
[Full Text]
-
Stasyk, T., Schiefermeier, N., Skvortsov, S., Zwierzina, H., Peranen, J., Bonn, G. K., Huber, L. A.
(2007). Identification of Endosomal Epidermal Growth Factor Receptor Signaling Targets by Functional Organelle Proteomics. Mol. Cell. Proteomics
6: 908-922
[Abstract]
[Full Text]
-
Gallois-Montbrun, S., Kramer, B., Swanson, C. M., Byers, H., Lynham, S., Ward, M., Malim, M. H.
(2007). Antiviral Protein APOBEC3G Localizes to Ribonucleoprotein Complexes Found in P Bodies and Stress Granules. J. Virol.
81: 2165-2178
[Abstract]
[Full Text]
-
CZAPLINSKI, K., MATTAJ, I. W.
(2006). 40LoVe interacts with Vg1RBP/Vera and hnRNP I in binding the Vg1-Localization Element. RNA
12: 213-222
[Abstract]
[Full Text]
-
Bonnal, S., Pileur, F., Orsini, C., Parker, F., Pujol, F., Prats, A.-C., Vagner, S.
(2005). Heterogeneous Nuclear Ribonucleoprotein A1 Is a Novel Internal Ribosome Entry Site trans-Acting Factor That Modulates Alternative Initiation of Translation of the Fibroblast Growth Factor 2 mRNA. J. Biol. Chem.
280: 4144-4153
[Abstract]
[Full Text]
-
Ostrowski, J., Klimek-Tomczak, K., Wyrwicz, L. S., Mikula, M., Schullery, D. S., Bomsztyk, K.
(2004). Heterogeneous Nuclear Ribonucleoprotein K Enhances Insulin-induced Expression of Mitochondrial UCP2 Protein. J. Biol. Chem.
279: 54599-54609
[Abstract]
[Full Text]
-
Suntharalingam, M., Alcazar-Roman, A. R., Wente, S. R.
(2004). Nuclear Export of the Yeast mRNA-binding Protein Nab2 Is Linked to a Direct Interaction with Gfd1 and to Gle1 Function. J. Biol. Chem.
279: 35384-35391
[Abstract]
[Full Text]
-
King, F. W., Shtivelman, E.
(2004). Inhibition of Nuclear Import by the Proapoptotic Protein CC3. Mol. Cell. Biol.
24: 7091-7101
[Abstract]
[Full Text]
-
Lai, M.-C., Tarn, W.-Y.
(2004). Hypophosphorylated ASF/SF2 Binds TAP and Is Present in Messenger Ribonucleoproteins. J. Biol. Chem.
279: 31745-31749
[Abstract]
[Full Text]
-
Labialle, S., Dayan, G., Gayet, L., Rigal, D., Gambrelle, J., Baggetto, L. G.
(2004). New invMED1 element cis-activates human multidrug-related MDR1 and MVP genes, involving the LRP130 protein. Nucleic Acids Res
32: 3864-3876
[Abstract]
[Full Text]
-
Huang, Y., Yario, T. A., Steitz, J. A.
(2004). A molecular link between SR protein dephosphorylation and mRNA export. Proc. Natl. Acad. Sci. USA
101: 9666-9670
[Abstract]
[Full Text]
-
Ng, C. K.-Y., Kinoshita, T., Pandey, S., Shimazaki, K.-i., Assmann, S. M.
(2004). Abscisic Acid Induces Rapid Subnuclear Reorganization in Guard Cells. Plant Physiol.
134: 1327-1331
[Full Text]
-
Zolotukhin, A. S., Michalowski, D., Bear, J., Smulevitch, S. V., Traish, A. M., Peng, R., Patton, J., Shatsky, I. N., Felber, B. K.
(2003). PSF Acts through the Human Immunodeficiency Virus Type 1 mRNA Instability Elements To Regulate Virus Expression. Mol. Cell. Biol.
23: 6618-6630
[Abstract]
[Full Text]
-
Mili, S., Pinol-Roma, S.
(2003). LRP130, a Pentatricopeptide Motif Protein with a Noncanonical RNA-Binding Domain, Is Bound In Vivo to Mitochondrial and Nuclear RNAs. Mol. Cell. Biol.
23: 4972-4982
[Abstract]
[Full Text]
-
Ostrowski, J., Kawata, Y., Schullery, D. S., Denisenko, O. N., Bomsztyk, K.
(2003). Transient recruitment of the hnRNP K protein to inducibly transcribed gene loci. Nucleic Acids Res
31: 3954-3962
[Abstract]
[Full Text]
-
Sarkar, B., Lu, J.-Y., Schneider, R. J.
(2003). Nuclear Import and Export Functions in the Different Isoforms of the AUF1/Heterogeneous Nuclear Ribonucleoprotein Protein Family. J. Biol. Chem.
278: 20700-20707
[Abstract]
[Full Text]
-
Mootha, V. K., Lepage, P., Miller, K., Bunkenborg, J., Reich, M., Hjerrild, M., Delmonte, T., Villeneuve, A., Sladek, R., Xu, F., Mitchell, G. A., Morin, C., Mann, M., Hudson, T. J., Robinson, B., Rioux, J. D., Lander, E. S.
(2003). From the Cover: Identification of a gene causing human cytochrome c oxidase deficiency by integrative genomics. Proc. Natl. Acad. Sci. USA
100: 605-610
[Abstract]
[Full Text]