Previous Article | Next Article 
Molecular and Cellular Biology, November 2001, p. 7320-7330, Vol. 21, No. 21
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.21.7320-7330.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Regulatory Mechanisms Controlling Human Hepatocyte
Nuclear Factor 4
Gene Expression
Pantelis
Hatzis and
Iannis
Talianidis*
Institute of Molecular Biology and
Biotechnology, Foundation for Research and Technology Hellas, 711 10 Herakleion, Crete, Greece
Received 21 March 2001/Returned for modification 2 May
2001/Accepted 3 August 2001
 |
ABSTRACT |
Hepatocyte nuclear factor 4
(HNF-4
) (nuclear receptor 2A1) is
an essential regulator of hepatocyte differentiation and function. Genetic and molecular evidence suggests that the tissue-restricted expression of HNF-4
is regulated mainly at the transcriptional level. As a step toward understanding the molecular mechanism involved
in the transcriptional regulation of the human HNF-4
gene, we cloned
and analyzed a 12.1-kb fragment of its upstream region. Major DNase
I-hypersensitive sites were found at the proximal promoter, the first
intron, and the more-upstream region comprising kb
6.5,
8.0, and
8.8. By the use of reporter constructs, we found that the
proximal-promoter region was sufficient to drive high levels of
hepatocyte-specific transcription in transient-transfection assays.
DNase I footprint analysis and electrophoretic mobility shift
experiments revealed binding sites for HNF-1
and -
, Sp-1, GATA-6, and HNF-6. High levels of HNF-4
promoter activity were dependent on the synergism between either HNF-1
and HNF-6 or HNF-1
and GATA-6, which implies that at least two alternative mechanisms may activate HNF-4
gene transcription. Chromatin
immunoprecipitation experiments with human hepatoma cells showed stable
association of HNF-1
, HNF-6, Sp-1, and COUP-TFII with the promoter.
The last factor acts as a repressor via binding to a newly identified
direct repeat 1 (DR-1) sequence of the human promoter, which is absent in the mouse homologue. We present evidence that this sequence is a
bona fide retinoic acid response element and that HNF-4
expression
is upregulated in vivo upon retinoic acid signaling.
 |
INTRODUCTION |
Hepatocyte nuclear factor
4
(HNF-4
) is a liver-enriched transcription factor which,
together with other factors, plays a key role in the tissue-specific
expression of a large number of genes (42). Besides
HNF-4
's crucial role in the adult liver, where it regulates genes
involved in various metabolic pathways (17), HNF-4
function has been implicated in early endodermal development
(14). Mouse embryos lacking HNF-4
die before completing gastrulation due to visceral endoderm dysfunction (7).
This early-lethal phenotype could be rescued by employing
complementation of HNF-4
-deficient embryos with a tetraploid
embryo-derived visceral endoderm (32). Analysis of gene
expression patterns of the rescued embryos revealed that HNF-4
was
dispensable for early developmental specification of the liver but was
essential for subsequent steps of hepatocyte differentiation
(32). In humans, heterozygous mutations in the HNF-4
gene are associated with an early-onset form of type II diabetes called
maturity onset diabetes of the young 1 (52). In addition
to the several mutations in the coding region, a 7-bp deletion
at the 5' regulatory region was recently found in association with
diabetes (39), suggesting that the expression and activity
of HNF-4
are important for pancreatic
-cell function.
The liver-enriched transcription factors are part of a complex
transcriptional network which seems to be responsible for both the
determination and the maintenance of the hepatic phenotype. This
network is established by a number of autoregulatory and cross-regulatory pathways securing balanced, high-level expression of
the main factors in hepatocytes (13, 18, 22, 24, 26, 48).
HNF-4
has been considered to be at the top of the hierarchy of the
transcription factor cascade that drives hepatocyte differentiation, since it is an essential regulator of the HNF-1
gene (26,
48). To fully understand how this regulatory network is
established, knowledge of the regulation of the HNF-4
gene itself is
required. Previous studies of the mouse HNF-4
promoter revealed a
potential reciprocal regulation of HNF-4
expression by HNF-1
(47, 54). This assumption was based on the identification
of a functional HNF-1 binding site in the proximal-promoter region
(54). However, during visceral endoderm differentiation
HNF-4
is activated at an earlier stage than HNF-1
, arguing
against the importance of HNF-1
in the initial activation of the
HNF-4
gene (5, 12, 14). In addition, HNF-1
-deficient
mice showed normal levels of HNF-4
in the liver (38).
More-recent studies on GATA-6- and HNF-1
-deficient mice revealed
that these two factors may directly or indirectly regulate the mouse
HNF-4
gene, as its expression was virtually abolished in both animal
models (2, 8, 35). The failure of
GATA-6
/
and
HNF-1
/
embryos to properly develop
visceral endoderms paralleled the lack of HNF-4
expression and
provided strong evidence that these two factors indeed lie upstream of
HNF-4
in the transcriptional cascade that regulates early endodermal
differentiation (2, 8, 35). Evidence for the potential
involvement of at least two additional factors in the regulation of the
HNF-4
gene has been recently reported. These are HNF-6 and CPF/FTF,
which can bind to and transactivate the mouse HNF-4
promoter
(30, 37).
To gain a comprehensive insight into the transcriptional regulation of
HNF-4
, we cloned and characterized the promoter region of the human
HNF-4
gene. We found that in cultured hepatoma cells the
proximal-promoter region was sufficient to drive high levels of
expression. Within this region we mapped binding sites for transcription factors HNF-1
and -
, Sp-1, HNF-6, and GATA-6. We
describe two alternative mechanisms of how these factors may regulate
HNF-4
expression. Moreover, we identified a functional hormone
response element (HRE) in the human promoter which is not conserved in
the mouse sequence. This element binds COUP-TFII (27),
which has a repressive effect on promoter activity; upon retinoic acid
signaling, binding of RXR
-RAR
heterodimers to the HRE leads to
hormone-dependent upregulation of the HNF-4
gene.
 |
MATERIALS AND METHODS |
Isolation of human HNF-4
genomic clones and plasmid
constructions.
A human
EMBL4 genomic DNA library was screened
with a 0.6-kb human HNF-4
cDNA fragment encoding the N-terminal part
of the protein. The resultant genomic clones were analyzed by
restriction enzyme mapping, and the SalI/SacII
fragment from one clone containing the upstream 12.1-kb region of the
HNF-4
gene was subcloned into the XhoI/BglII
sites of pGL3 basic vector (Promega). The resulting plasmid contains
the region from bp +67 to kb
12.1 of the human HNF-4
gene
in front of the firefly luciferase reporter cassette. 5' deletion
mutants were prepared either by restriction enzyme digestions or by
progressive unidirectional digestions with exonuclease III.
Site-directed mutagenesis of the footprinted regions was performed with
the GeneEditor kit (Promega) according to the manufacturer's instructions. The following oligonucleotides were used for
mutagenesis: HNF-1 site mutant,
104
GGGTCGATGGTGGATCCGTCCCCCGCCGGTGGATAGGCTG
143; HRE mutant,
298
GGTGAGTCGACGCACAAATGAGTGCCCG TGA
268; HNF-6 site mutant,
423
GCATTGAGGGTAGAATCTAGAGATTTGGGAAGTTATTG
386; GATA-6 site mutant,
419
AATGCTTTTGCAAAGCTTAGGCTGCCCCATGGCCC
453; Sp-1 site mutant,
160
ATCCCTGCAGCCATGGCCAGCCTATCCACCG
130. Mutated
nucleotides are underlined.
The 6xHRE-AdML-CAT plasmid was generated by ligating a double-stranded,
phosphorylated oligonucleotide corresponding to the region comprising
nucleotides (nt)
298 to
277 into the SalI site of
plasmid AdML-44-CAT (21). The construction of
pCMV-HNF-1
, pCMV-COUP-TFII, pCMV-RXR
, and pCMV-RAR
has been
described previously (24, 25). pRSV-HNF-1
(10), pCMV-hGATA-6 (15), pCMV-HNF-6 (31), and pCMV-HNF-3
(29) were kind gifts
from R. Cortese, T. Evans, F. Lemaigre, and R. Costa, respectively.
pCMV-PPAR
(49) and pCMV-VDR (20) were
obtained from A. Aranda. pSG-ER
(28) and pCMV-T3R
(4) and pCMV-LXR
(51) were from M. Parker
and D. Mangelsdorf, respectively. pCMV-CPF/FTF containing the human CPF
open reading frame (GenBank accession no. NM_003822) was cloned by PCR
from HepG2 cDNA. Proper expression by all the vectors in transfected
Cos-1 cells was tested.
Primer extension, reverse transcription (RT-PCR), and
DNase I-hypersensitive site analysis.
For primer extension, 10 µmol of a 32P-labeled oligonucleotide probe,
corresponding to nt +162 to +188 of the human HNF-4
gene, was
hybridized to 10 µg of poly(A) RNA prepared from HepG2 cells in a
buffer containing 40 mM PIPES, pH 6.4, 1 mM EDTA, 0.4 M NaCl, and 80%
formamide. The annealed products were precipitated and resuspended in a
buffer containing 50 mM Tris, pH 8.3, 40 mM KCl, 6 mM
MgCl2, 1 mM dithiothreitol, 0.5 mM
deoxynucleoside triphosphates, and 10 U of RNasin. After addition of 10 U of SuperScript reverse transcriptase (Gibco-BRL), the reaction was
allowed to proceed for 60 min at 37°C, followed by a 30-min digestion
with 5 µg of DNase-free RNase. The reaction products were extracted
with phenol-chloroform, precipitated with ethanol, and electrophoresed
in 6% denaturing polyacrylamide gels.
For RT-PCR analysis, total RNA from HepG2 cells was first treated with
10 U of DNase I (Gibco-BRL) for 30 min at room temperature,
followed by
extractions with phenol-chloroform and precipitation
with ethanol. cDNA
synthesis was performed with SuperScript reverse
transcriptase
(Gibco-BRL) using oligo(dT) and random hexamer primers.
The cDNAs were
directly used for PCR amplification (21 cycles)
in the presence of 10 µCi of [

-
32P]dCTP with primer sets from
the human HNF-4

3' untranslated
region (UTR) (see below). For
normalization, the human acidic
ribosomal phosphoprotein was amplified
by primers 5' GGAAGGCTGTGGTGCTGATGG
3' and
5'AAGGAGAAGGGGGAGATGTTG 3' (
41).
Two probes, the
HindIII-
EcoRV fragment
corresponding to nt

3854 to

4134 and the
KpnI-
EcoRI fragment corresponding to nt

4660 to

5224 were used to map the DNase I-hypersensitive sites
in the
proximal- and distal-promoter regions, respectively. Nuclei
were
prepared from HepG2 cells as described previously (
22)
and
partially digested on ice for 10 min by 0 to 20 U of DNase
I
(Gibco-BRL) in a buffer containing 60 mM KCl, 15 mM NaCl, 15
mM Tris,
pH 7.5, 0.5 mM spermidine, 0.15 mM spermine, and 5 mM

-mercaptoethanol. The reactions were stopped by addition of EDTA
to
30 mM, followed by digestion with proteinase K at 56°C for
12 h.
DNA was extracted with phenol-chloroform, precipitated with
ethanol,
and digested with either
KpnI or
HindIII.
Digestion products
were analyzed by Southern
blotting.
In vitro DNA binding assays.
Nuclear extracts from HepG2 and
transfected Cos-1 cells were prepared as described previously
(22, 23). For DNase I footprint analysis three
5'-end-labeled probes encompassing nt
503 to +67, nt
450 to
45,
and nt
194 to
595 were prepared and incubated with HepG2 nuclear
extracts in a buffer containing 50 mM KCl, 20 mM HEPES, pH 7.9, 0.5 mM
dithiothreitol, 10% glycerol, 0.1 µM zinc acetate, 50 µg/ml bovine
serum albumin, 30 µg of poly(dI-dC)/ml, 0.25 µg of linearized
pUC-18 DNA/ml, and 2% polyvinyl alcohol. After incubation on ice for
45 min, MgCl2 and CaCl2
were added to 1 and 0.2 mM final concentrations, respectively, followed
by digestion with 30 µg of DNase I for 5 min. The reactions were stopped by the addition of an equal volume of 20 mM EDTA-1% sodium dodecyl sulfate (SDS)-50 µg of E. coli
tRNA/ml, followed by digestion with 2 µg of proteinase K. After
extraction with phenol-chloroform, the DNA fragments were precipitated
by ethanol and analyzed in 6% denaturing polyacrylamide gels.
Mobility shift assays with end-labeled double-stranded oligonucleotide
probes were performed as described previously (
22,
23).
The oligonucleotide sequences were as follows: FP-1, 5'
TCGACCGATTAACCATTAACCCCCACCCC nt

97; FP-2, 5'
TCGAGCAGCCCCGCCCAGCC
nt

139; FP-3, 5'
TCGAGGTGAGTCAAGGGTCAAATGAG nt

277; FP-4, 5'
TCGAGGGTAGAAGTCAATGATTTGGG nt

395; FP-5, 5'
TCGAGGCAGCCTTATCTCTGCAAAAGC
nt

422.
For supershift, Western blots, and immunoprecipitations the antibodies
used were from Santa Cruz Biotechnology (HNF-1

, Sp-1,
HNF-3

,
GATA-6, and HNF-6). Anti- HNF-1

(
5), anti-RXR

and
anti-RAR

(
16), and anti-COUP-TFII (
4) were
obtained from
S. Cereghini, P. Chambon, and M. Parker, respectively. A
polyclonal
antibody against HNF-4

was raised by immunization of New
Zealand
White rabbits by a keyhole limpet hemocyanin-linked peptide
corresponding
to the very C-terminal 12 amino acids of the human HNF-4
protein.
In Western blots a horseradish peroxidase-conjugated
anti-rabbit
immunoglobulin G (Jackson Laboratories) was used as the
secondary
antibody and ECL (APB) was used for chemiluminescence
detection.
Cell culture and transfections.
HepG2 and Cos-1 cells were
maintained in Dulbecco's modified Eagle medium (DMEM) supplemented
with 10% heat inactivated fetal calf serum. The cells were seeded
24 h before transfection at 50 to 60% confluence. In experiments
where 9-cis-retinoic acid induction was used, the cells were
plated in medium containing 10% dextran-charcoal-stripped fetal calf
serum. Various amounts of plasmids along with 1.5 µg of pCMV-
-gal
plasmid were introduced into the cells by the calcium phosphate-DNA
coprecipitation method as described previously (22, 23).
Thirty-six hours later the cells were harvested and lysed by three
consecutive freeze-thaw cycles. Chloramphenicol acetyltransferase and
-galactosidase assays were performed as described previously
(22, 23). Luciferase assays were performed using the
luciferase assay kit (Promega). All data were normalized to
-galactosidase internal-control values.
Chromatin immunoprecipitations.
The chromatin
immunoprecipitation assay was performed as described previously
(36), with several modifications. Briefly, cells were
treated with 1% formaldehyde for 10 min at room temperature. Cross-linking was stopped by the addition of glycine to a final concentration of 0.125 M. The cells were washed with cold
phosphate-buffered saline (PBS) and swelled on ice for 10 min in a
solution containing 25 mM HEPES, pH 7.8, 1.5 mM
MgCl2, 10 mM KCl, 0.1% NP-40, 1 mM dithiothreitol, and a protease inhibitor cocktail (Roche). Following Dounce homogenization (20 strokes; pestle A), the nuclei were collected
and resuspended in sonication buffer containing 50 mM HEPES, pH 7.9, 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate,
0.1% SDS, and protease inhibitors and sonicated on ice to an average
length of 200 to 1,000 bp. The samples were centrifuged at 20,000 × g and precleared with protein G-Sepharose in the
presence of 2 µg of sonicated
DNA and 1 mg of bovine serum
albumin/ml. Twenty-five A260 units of
the precleared chromatin was immunoprecipitated with 5 µl of
antibodies, and the immune complexes were collected by adsorption to
protein G-Sepharose. The beads were washed twice with sonication
buffer, twice with sonication buffer containing 500 mM NaCl, twice with
20 mM Tris (pH 8.0)-1 mM EDTA-250 mM LiCl-0.5% NP-40-0.5% sodium
deoxycholate, and twice with Tris-EDTA buffer. The
immunocomplexes were eluted with 50 mM Tris, pH 8.0-1 mM EDTA-1% SDS
at 65°C for 10 min, adjusted to 200 mM NaCl, and incubated at 65°C
for 5 h to reverse the cross-links. After successive treatments
with 10 µg of Rnase A and 20 µg of proteinase K/ml, the samples
were extracted with phenol-chloroform and precipitated with ethanol.
One tenth of the immunoprecipitated DNA and input DNA (from extracts
corresponding to 0.025 A260 units) was
analyzed by PCR using primers from sequences surrounding the human
HNF-4
proximal promoter (GGCAGCCTTATCTCTGCAAAAGC
422
and TCGAGGGGTGGGGTTAATGGTTAATC
119) or the 3' UTR of the
HNF-4
gene (sense oligonuceotide, 5'
GGAGATGACTTGAGGCCTTACT; antisense oligonucleotide, 5'
GGGGAATCGTTTCCAAGGCCTC). Amplifications (25 cycles) were
performed in the presence of 10 µCi of
[
-32P]dCTP, and the products were analyzed
in 4% polyacrylamide gels. To ensure that the amounts of PCR products
accurately reflected the amounts of template DNA, control PCRs (20, 25, and 30 cycles) were performed with decreasing amounts of
templates (not shown).
 |
RESULTS |
Cloning and functional mapping of the human HNF-4
upstream
regulatory region.
Screening a human genomic
EMBL-4 library
with an N-terminal fragment of the human HNF-4
cDNA, including the
5' UTR and the A/B domain, resulted in four positive clones.
Restriction enzyme mapping and Southern blot analysis revealed that one
clone contained part of the first exon and an approximately 12.1-kb
upstream region of the human HNF-4
gene. We performed extensive
restriction enzyme mapping and determined the nucleotide sequences of
several parts of this clone and compared the data with the human
chromosome 20 working draft sequence (GenBank accession no. NT_011382).
All the sequences determined as well as the restriction enzyme pattern were identical to the deposited sequence and pattern of the human HNF-4
gene, confirming that the isolated clone represents the unrearranged HNF-4
upstream region.
The transcriptional start site was determined by primer extension assay
using a 26-nt end-labeled primer, which hybridizes
73 bp downstream of
the first ATG codon. One major band of 188
bp was detected in HepG2
poly(A) RNA, which places the transcriptional
start site 89 bp upstream
of the first ATG codon (
11) (Fig.
1A). To map the regions interacting with
DNA-binding proteins,
we performed DNase I-hypersensitive-site
analysis. With probe
1 we could detect two major DNase I-hypersensitive
sites: one
at the proximal promoter region, about

300 bp from
the transcriptional
start site, while the second was located at the
intronic region
between exon 1b and exon 2, about 1.6 kb downstream of
the transcriptional
start site (Fig.
1B). With probe 2 we
detected three major DNase
I-hypersensitive sites at the
far-upstream region, about

6.6,

8.0, and

8.8 kb from the
transcriptional start site (Fig.
1B).

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 1.
Functional mapping of the human HNF-4 upstream
region. (A) Determination of the transcription start site by primer
extension analysis using HepG2 poly(A) RNA. Arrow, oligonucleotide used
for reverse transcription and the DNA sequencing reaction. The
underlined ATG codon corresponds to the upstream translation initiation
site proposed previously (11). (B) DNase
I-hypersensitive-site analysis. HepG2 nuclei were treated with 0, 5, 10, 15, 17, and 20 U of DNase I, and genomic DNA was prepared and
digested with HindIII (left) or KpnI
(right). Indirect end labeling was performed with the indicated probes.
The schematic shows the positions of the major hypersensitive sites
relative to the transcription start site (large arrows). Small arrows,
positions of minor DNase I-hypersensitive sites located at around
2.1, 2.7, and 5.6 kb from the transcriptional start site. (C)
Promoter activity of the human HNF-4 upstream region in HepG2 cells.
Bars, luciferase activities obtained with transfected constructs
containing the full-length human HNF-4 gene, the region from kb
12.1 to bp +67 of the HNF-4 gene, and derivatives of HNF-4 with
deletions of portions of the 5' region (indicated by the 5' nucleotide
position) and normalized to -galactosidase activities (internal
control). Standard errors were calculated from four independent
experiments.
|
|
To identify the minimal regulatory region of HNF-4

, we fused the
12.1-kb upstream sequence to a luciferase reporter and 5'
deletion
derivatives of this clone were used in transient transfection
assays
with the human hepatoma-derived HepG2 cell line. As shown
in Fig.
1C,
mutants with 5' deletions up to kb

0.56 had little
effect on promoter
activity. Since further deletions abolished
promoter activity and since
all constructs were inactive in the
nonhepatic HeLa cell line, we
concluded that the proximal promoter
region of the HNF-4

gene
contains all the important elements
required for high levels of hepatic
transcription in transient
transfection
assays.
Transcription factors binding to the proximal promoter region.
To identify transcription factor binding sites within this region, we
performed in vitro DNase I footprint analysis. Five major DNase
I-protected regions were detected with HepG2 nuclear extracts.
Footprint 1 extends from bp
97 to
119, footprint 2 extends from bp
135 to
164, footprint 3 extends from bp
256 to
304, and
footprints 4 and 5 extend from bp
377 to
442 (Fig. 2A to C). Careful inspection of the
nucleotide sequences corresponding to the protected regions revealed
that footprint 1, footprint 4, and footprint 5 contain canonical
binding sites for HNF-1
and -
, HNF-6, and GATA-6, respectively,
whose sequences are identical to the mouse promoter sequences (Fig.
2D). Interestingly, the region comprising nt
165 to
176, which
resembles an HNF-3 binding site, was not protected. Sequence comparison
of the mouse and human proximal-promoter region (nt
453 to +1;
GenBank accession no. S77762 and NT_011382) by the Clustal W-1.5
multiple sequence alignment program revealed an overall identity of
68% with six gaps, while the sequences within the footprinted regions
were 72% identical (data not shown). Sequence identity within the core binding motifs shown in Fig. 2D was 85%. Footprint 2, which contains a
canonical Sp-1 binding site, is not conserved in the corresponding mouse promoter sequence. Footprint 3 contains direct repeat 1 (DR-1),
which is a potential binding site for nuclear hormone receptors. This
sequence is also different in the corresponding region of the mouse
HNF-4
promoter (Fig. 2D). These differences point to potential
species-specific variations with respect to the involvement of
trans-acting factors in the regulation of the HNF-4
gene.
To confirm the identity of the transcription factors that bind to the
above footprinted regions, we performed antibody-mediated supershift assays. Antibodies against HNF-1, Sp-1, HNF-6,
and GATA-6 were able to partially supershift or eliminate the
complexes formed on FP-1-, FP-2-, FP-4-, and FP-5-derived
double-stranded oligonucleotides, respectively (Fig.
3A). Complexes formed on the FP-3 probe
were supershifted by COUP-TF, RXR
, and HNF-4
antibodies,
suggesting that this element is a potential HRE. To test the potential
association of other known nuclear hormone receptors with this
element, we performed electrophoretic mobility shift assays with
Cos-1 cellular extracts expressing RXR
-RAR
, PPAR
, VDR,
LXR
, T3R
, CPF/FTF, COUP-TFII, and HNF-4
. Strong binding only by COUP-TFII was observed. A weaker but significant binding by RXR
-RAR
and HNF-4
(Fig. 3B) was detected.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 2.
Identification of transcription factor binding sites in
the proximal-promoter region of the human HNF-4 gene. In vitro DNase
I footprint analysis was performed using 5'-end-labeled probes
containing the nt 45 to 450 (A), the nt 503 to +67 (B), and the
nt 194 to 595 (C) regions of the human HNF-4 promoter and the
indicated amounts of HepG2 nuclear extracts. Lanes G/A, Maxam-Gilbert
chemical sequencing ladders of the same probes. (D) Schematic
presentation of the footprinted areas and comparison of their sequence
motifs with the corresponding regions of the mouse HNF-4 promoter.
|
|

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 3.
Identification of the main transcription factors
associating with the proximal-promoter region of the human HNF-4
gene. (A) Electrophoretic mobility shift experiments were performed
using rat liver nuclear extracts and labeled double-stranded
oligonucleotides corresponding to the indicated footprinted regions.
Incubations with antibodies and the binding reactions were performed on
ice except for preincubations with anti-RXR and anti-HNF-4 , which
were done at room temperature. (B) Electrophoretic mobility shift
experiments were performed with extracts from mock-transfected Cos-1
cells ( ) and Cos-1 cells transfected with the indicated expression
vectors and a labeled FP-3 probe.
|
|
Functional analysis of the proximal promoter region.
To
ascertain the functional importance of the above cis
elements and trans-acting factors, we introduced mutations
into the individual footprinted regions that abolish the binding of the corresponding transcription factors. Transient transfection assays with
HepG2 cells revealed that mutations in the HNF-1 (footprint 1), Sp-1
(footprint 2), and HNF-6 (footprint 4) binding sites reduced
promoter activity to 17, 70, and 10%, respectively, of the wild-type
value (Fig. 4). In contrast, mutation of
the HRE region (footprint 3) led to approximately a twofold increase in promoter activity, while mutations at the GATA-6 (footprint 5) site had
only a marginal effect on it. Overexpression of HNF-1
, HNF-6, or
GATA-6 stimulated transcription from the wild-type promoter 2.9-fold,
2.6-fold, and 2.4-fold, respectively (Fig. 4). In contrast, overexpression of COUP-TFII inhibited the activity of the promoter to
about 38% of wild-type levels. None of the factors affected the
activity of the corresponding mutant constructs (Fig. 4). These
data suggest that HNF-1
, Sp-1, and HNF-6 may act as essential positive regulators for the high-level transcription of the human HNF-4
gene in HepG2 cells, while COUP-TFII, through binding to the
HRE, negatively regulates it. Although GATA-6 was able to transactivate
the promoter, its function, at least in HepG2 cells, seems to be
redundant, since disruption of its binding site did not change the
activity of the promoter. Since HepG2 cells contain, endogenously, high
levels of the above transcription factors, the relative degrees
of transactivation and the potential synergistic effects between pairs
of transcription factors are difficult to assess using this cell
line. To overcome this problem, we performed the cotransfection
experiments with HeLa cells, which do not express endogenous HNFs.
Strong transactivations were observed by overexpression of HNF-1
,
HNF-6, and GATA-6 (73-fold, 70-fold, and 62-fold, respectively) (Fig. 5A). HNF-1
-, HNF-3
-,
and HNF-4
-dependent transactivations were less pronounced
(4-fold, 6-fold, and 19-fold, respectively), while COUP-TFII
overexpression, as expected, did not activate the promoter (Fig. 5A).
As is evident up to this point, multiple factors have the potential to
activate the HNF-4
promoter. This raised the question whether, as in
most other complex regulatory regions, the simultaneous action of more
than one factor may be required for high-level transcription of the
HNF-4
gene. This was tested by analyzing the potential synergism of
the above factors on the promoter. As shown in Fig. 5B, coexpression of
HNF-1
and GATA-6 resulted in a transactivation far above the sum of
the activations obtained by the individual factors (390-fold versus 4-fold plus 62-fold). Coexpression of the other factors with HNF-1
did not lead to strong synergistic effects. Interestingly,
overexpression of HNF-4
resulted in reduction of the
HNF-1
-GATA-6 synergism, and, as expected, overexpression of
COUP-TFII abolished transcription (Fig. 5B). HNF-1
, however,
did not exhibit any synergism with GATA-6, but it did
so with HNF-6 or HNF-4
(475-fold versus 73-fold plus 70-fold and
417-fold versus 73-fold plus 19-fold, respectively) (Fig. 5C).
Overexpression of all three factors did not lead to further
enhancement, while overexpression of COUP-TFII inhibited transcription
(Fig. 5C). These results point to the possibility of alternative
transcription factor combinations in the formation of an active
transcription initiation complex on the human HNF-4
promoter.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 4.
Functional analysis of the cis elements
of the human HNF-4 promoter. HepG2 cells were transiently
transfected with the region comprising nt 560 to +67 and containing
the luciferase construct (wt) and its derivatives carrying internal
mutations at the indicated footprinted regions (mFP1, mFP3, mFP5, mFP4,
and mFP2). Where indicated, the cells were cotransfected with 500 ng of
the corresponding expression vectors. Bars, mean values and standard
errors of normalized luciferase activities from at least four
independent experiments expressed as multiples of the activity obtained
with the wild-type promoter.
|
|

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 5.
Analysis of the synergism between transcription factors
on the human HNF-4 promoter. (A) HeLa cells were cotransfected with
2 µg of DNA from the region comprising nt 560 to +67 and containing
the luciferase reporter and 250 ng of the indicated expression vectors.
(B and C) The cells were cotransfected with the indicated expression
vectors together with 250 ng of the HNF- or HNF-1 expression
vector (+), respectively. Bars, mean values and standard errors of
normalized luciferase activities from at least four independent rounds
of experiments performed in duplicate with all samples and expressed as
multiples of the activity obtained in transfections using the
promoter-reporter alone ( ). Note the different scale of the ordinate
in panel A.
|
|
Recruitment of transcription factors on the HNF-4
promoter in
HepG2 cells.
To verify the in vivo relevance of the data obtained
by transient-transfection assays in the context of chromatin in intact cells, we performed chromatin immunoprecipitation experiments using the human hepatoma HepG2 cell line, which expresses HNF-4
at
high levels. Antibodies raised against HNF-1
, HNF-6, COUP-TFII, and
Sp-1 could efficiently and specifically immunoprecipitate the HNF-4
promoter DNA, suggesting stable in vivo association of these
factors with the promoter (Fig. 6). On
the other hand, we failed to detect promoter occupancy by HNF-1
,
HNF-4
, HNF-3
, or GATA-6, in spite of the fact that, apart from
HNF-1
, these factors are abundantly expressed in HepG2 cells (data
not shown). Therefore, at least in HepG2 cells, HNF-4
transcription
seems to be regulated by the combined action of HNF-1
, HNF-6, and
Sp-1 and fine-tuned by the concomitant presence of COUP-TFII, which acts as a negative modulator.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 6.
Transcription factor recruitment to the human HNF-4
promoter in the context of chromatin in intact cells. Soluble chromatin
from formaldehyde-fixed HepG2 cells was prepared and immunoprecipitated
(IP) with antibodies to the indicated proteins. The DNAs in the
immunoprecipitates were amplified using primers encompassing the
proximal HNF-4 promoter (hHNF-4 promoter) or the 3' UTR of the human
HNF-4 gene. The autoradiographic image of the products separated on
a 5% polyacrylamide gel is shown.
|
|
The retinoic acid signaling pathway positively affects human
HNF-4
expression.
As shown above, the HRE sequence of footprint
3 can also associate with RXR
-RAR
heterodimers. To test the
functional relevance of this interaction, we asked whether
overexpression of RXR
-RAR
influences the activity of the human
HNF-4
promoter in HepG2 cells. As shown in Fig.
7A, RXR
-RAR
could induce the
activity of both the full-length and the proximal (beginning 12.1 kb
and 560 bp, respectively, upstream of the transcription start
site)-promoter-containing reporters in a ligand-dependent
manner. Similar induction was observed with a chimeric promoter
construct containing six copies of the HNF-4
HRE sequence in front
of the AdML minimal promoter. COUP-TFII antagonized this activation in
all cases (Fig. 7A). When the HRE site was mutated, no retinoic
acid-mediated activation was observed. The molecular basis for
the COUP-TFII-RXR
-RAR
antagonism could involve a
competition of these factors for the HNF-4
HRE. To test this, we
investigated the in vivo occupancy of the human HNF-4 promoter by these
factors in untreated and retinoic acid-treated HepG2 cells.
Differential occupancy of the promoter by COUP-TFII and RXR
or
RAR
in the majority of the cells was evident because the signal
detected in COUP-TFII chromatin immunoprecipitates decreased after
2 h of retinoic acid treatment, with a concomitant increase of the
signal in either RXR
or RAR
immunoprecipitates (Fig. 7B). The
above results suggested that the HNF-4
HRE is a bona fide
retinoic acid response element and that HNF-4
expression may
increase under certain physiological conditions. To verify this
possibility in vivo, we treated HepG2 cells with
9-cis-retinoic acid and monitored the expression levels of
HNF-4
by semiquantitative RT-PCR and Western blot analysis. A
2.5-fold increase in steady-state HNF-4
mRNA levels was observed; the level peaked around 2 h after treatment and then gradually decreased for the next 6 h (Fig. 7C and E). Interestingly,
cellular HNF-4
protein levels continued to increase for up to 8 h (Fig. 7D and E), suggesting that, in addition to its involvement in transcriptional potentiation, 9-cis-retinoic acid may also
act at a later step, possibly affecting HNF-4
protein stability.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 7.
Ligand-dependent activation of the human HNF-4 gene
by RXR -RAR in HepG2 cells.(A) HepG2 cells were grown in 10%
dextran-coated charcoal-stripped fetal calf serum containing DMEM and
transiently transfected with 2 µg of the indicated reporters and 500 ng of the indicated expression vectors. After transfection the cells
were treated with 1 µM 9-cis-retinoic acid or left
untreated for 36 h until harvest. Bars, mean values and standard
errors of normalized luciferase activities from at least four
independent experiments. (B) HepG2 cells, grown in stripped serum
containing DMEM, were left untreated or treated with 1 µM
9-cis-retinoic acid for 2 h. Soluble chromatin from
formaldehyde-fixed HepG2 cells was prepared and immunoprecipitated (IP)
with antibodies to the indicated proteins. The DNAs in the
immunoprecipitates were amplified using primers encompassing the
proximal HNF-4 promoter (hHNF-4 promoter). The autoradiographic
image of the products separated on a 5% polyacrylamide gel is shown.
(C and D) HepG2 cells, grown in stripped serum containing DMEM, were
treated with 1 µM 9-cis-retinoic acid for the
indicated time periods. Total RNAs and nuclear extracts were prepared,
and the expression of HNF-4 was analyzed by RT-PCR using human
acidic ribosomal phosphoprotein as the control (C) or by Western
blotting using a primary antibody against HNF-4 or an Sp-1 antibody
as an internal control (D). (E) Relative HNF-4 mRNA and protein
levels versus time after 9-cis-retinoic acid addition
were plotted.
|
|
 |
DISCUSSION |
HNF-4
is a key member of the complex regulatory network that
defines the hepatocyte phenotype (13, 18, 22, 24, 26, 48).
The activity of HNF-4
has been shown to be regulated in a number of
ways including posttranscriptional modifications, such as
phosphorylation (19, 23, 50) or acetylation
(44), as well as protein-protein interactions with other
factors (9, 43, 44, 53). Further complexity in the control
of HNF-4-dependent genes arises from the existence of several isoforms
of HNF-4
generated by alternative splicing (6, 11, 21).
HNF-4
expression is restricted to the liver, kidney, intestine, and
pancreatic
cells, a pattern that is highly conserved among
different species (12, 13). In addition to this restricted
expression pattern, the hierarchical cascade of activation of
hepatic transcription factors during early embryogenesis and the
cross-regulatory pathways functioning in the adult liver point to
the importance of HNF-4
regulation at the transcriptional level
(13, 17, 18, 22, 24, 26, 48).
In this work we cloned the human HNF-4
regulatory region and
analyzed it in a human hepatoma cell line. Several lines of evidence
suggest that in HepG2 cells the human HNF-4
gene is mainly regulated
by the synergistic action of two other liver-enriched transcription
factors, HNF-1
and HNF-6. First, mutagenesis of either the HNF-1
or the HNF-6 binding site on the human HNF-4
promoter highly reduced
its activity. Second, cotransfection of HNF-1
and HNF-6 resulted in
high levels of synergistic activation. Third, immunoprecipitation of
cross-linked HepG2 chromatin revealed that in vivo both factors are
stably associated with the HNF-4
proximal promoter. Since HNF-4
is known to be an essential regulator of the HNF-1
gene, the effect
of HNF-1
on the HNF-4
promoter is particularly interesting
and points to a positive autoregulatory loop between these two factors.
Previous studies of the mouse HNF-4
promoter have indicated a
similar reciprocal relationship, and these studies have been further
strengthened by studies of hepatoma cell variants (1, 3, 45,
46). Although HNF-1
seems to be essential for HNF-4
expression, it should not participate in the initial activation of the
HNF-4
gene during early embryonic development, since HNF-4
expression precedes that of HNF-1
(5, 12, 14). What
could then be the mechanism that turns on HNF-4
expression? Previous
studies on HNF-1
null mice have indicated that HNF-1
, whose
expression precedes that of HNF-4
, is essential for visceral
endoderm differentiation (2, 8).
HNF-1
/
mice fail to express HNF-4
and
HNF-1
, suggesting that it may be directly or indirectly involved in
the initial activation of the HNF-4
gene (2, 8). We
found that HNF-1
, which binds the same sequence motif as HNF-1
,
poorly activated the human HNF-4
promoter in transfection assays.
However, together with GATA-6, it produced a dramatic induction
of transcription. Since disruption of the GATA-6 gene in mice results
in a phenotype similar to that of the
HNF-1
/
mice (35), it seems
possible that the initial activation of HNF-4
requires the combined
action of GATA-6 and HNF-1
. Our promoter analysis demonstrates that
both factors could be directly involved in HNF-4
activation, driving
high levels of transcription by a synergistic mechanism.
Taken together, the results imply multiple pathways for
the regulation of the HNF-4
gene. The synergistic action
of HNF-1
and GATA-6 may be responsible for its initial activation,
while at later stages of hepatocyte differentiation, when HNF-1
levels reach a critical threshold and HNF-1
expression gradually
decreases, the promoter activity depends on the synergism between
HNF-1
and HNF-6. In this respect HepG2 cells resemble differentiated hepatocytes, since they express HNF-1
at high levels but very little
HNF-1
. According to this model, the actual balance of HNF-1
and
HNF-1
levels in a given cell may play a determinative role in the
composition of the transcription initiation complex formed on the
HNF-4
promoter. This may explain why in adult HNF-1 null mice
HNF-4
expression is not seriously affected, since these animals
express elevated levels of HNF-1
, which may compensate for the loss
of HNF-1
in certain promoters (38).
The existence of a reciprocal cross-regulation between HNF-1
and
HNF-4
in hepatic cells raises some important concerns with respect
to the control of the levels of these transcription factors in the
cell. Once such a loop is established, it could be self-perpetuating, which may eventually lead to abnormally high intracellular quantities of the two factors. However, other regulatory events in the same circuit, schematically presented in Fig.
8, may prevent this. As shown in this
study, a major member of this loop, COUP-TFII, negatively regulates
HNF-4
expression. On the other hand COUP-TFII may increase HNF-1
transcription by potentiating HNF-4
activity via protein-protein
interaction with its ligand-binding domain (25). Increased
levels of HNF-1
inhibit its own transcription, again via
protein-protein interaction with HNF-4
(24), which would prevent further activation of HNF-4
. Furthermore, efficient transactivation of the HNF-4
promoter by HNF-1 requires HNF-6, which
may provide an additional control step. Thus, according to this model,
the expression of HNF-1 and HNF-4
is strictly controlled by multiple
interdependent regulatory pathways, securing balanced levels of HNF-1
and HNF-4
in the cell.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 8.
Schematic representation of the positive (pointed
arrows) and negative (flat-headed arrows) effects in the proposed
regulatory network. Dashed and solid arrows indicate alternative
activation mechanisms.
|
|
Although, as discussed so far, one could assign biological significance
to the HNF-1
-HNF-6 and HNF-1
-GATA-6 synergism, the available
data are insufficient to explain the potential biological role of the
observed direct positive effect of HNF-4
itself on its own promoter.
HNF-4
could synergize with HNF-1
but not with HNF-1
, while it
inhibited HNF-1
-GATA-6-dependent activation. It is tempting to
speculate that the last effect may relate to a signal that switches the
HNF-1
-GATA-6 complex to the HNF-1
-HNF-6 complex on the HNF-4
promoter once HNF-4
expression and consequently HNF-1
expression
reached a critical level. The possibility that HNF-4
can directly
autoregulate its own expression in HNF-1
-expressing cells, however,
remains to be demonstrated. At least in HepG2 cells, which express both
factors at high levels, no such direct autoregulation is evident.
HNF-4
was not found to be associated with the promoter in vivo, and
mutagenesis of its binding site increased, rather than decreased,
promoter activity. Perhaps such a mechanism might function only in cell
types expressing low levels of HNF-6.
A recent study indicated the potential involvement of a novel orphan
nuclear receptor (CPF/FTF) in the regulation of the HNF-4
promoter
(37). This factor was shown to be able to bind to and weakly transactivate the mouse HNF-4
proximal-promoter region (37). However, both of the two potential binding sites,
positioned at nt
250 and
321, are located outside of the
footprinted regions in the human promoter and only one of them (that at
nt
250) is partially conserved. In addition, we could not observe
CPF/FTF-mediated transactivation of the human promoter in HepG2 or HeLa
cells (data not shown). Although we cannot entirely exclude a possible
role for this factor in the activation of the human HNF-4
gene, it seems likely that, if it is involved, it may act as a "competence factor" rather than a major activator, in analogy to its function on
the CYP7A1 promoter (33).
Comparison of the human and mouse HNF-4
proximal-promoter sequences
revealed some fundamental differences. Although the core binding sites
for HNF-1
and -
, HNF-6, and GATA-6 were identical, the human
promoter contained two additional cis elements of functional importance. The first is a binding site for Sp-1, which is occupied in
vivo by this factor, and the second is DR-1, a common binding motif for
nuclear hormone receptors. This element can bind HNF-4
, COUP-TFII,
and the retinoic acid receptors RXR
-RAR
. Our results suggest that
this region represents a negative regulatory element in HepG2 cells.
COUP-TFII binding is responsible for this negative effect. On the other
hand, binding of RXR
-RAR
to this region leads to
ligand-dependent activation of the promoter. As demonstrated in this
study, the molecular basis for this antagonistic effect involves a
retinoic acid-mediated exchange of occupancy of the HNF-4
HRE
by these two factors. The physiological relevance of this finding is
highlighted by the increase of HNF-4
expression in HepG2 cells upon
short-term retinoic acid treatment. Interestingly, the kinetics of the
retinoic acid-induced increases in HNF-4
mRNA and protein levels
were distinct. Steady-state HNF-4
mRNA levels were initially
increased up to 2 h after treatment; this was followed by a
decrease to close to the initial levels. In contrast, HNF-4
protein
levels steadily increased up to 8 h. This suggests that, in
addition to affecting direct transcriptional activation, the
retinoic acid signaling pathway may affect HNF-4 protein stability. The
mechanism for such stabilization is unknown. A direct ligand effect can
be excluded, since retinoids are not ligands for HNF-4
. We speculate
that the involvement of retinoic acid-induced protein kinase cascades
in this phenomenon is a more likely mechanism, since HNF-4
is a
phosphoprotein (19, 23, 50). Supporting our results on the
role of retinoic acid signaling in HNF-4
expression is the recent
finding that long-term (72-h) retinoic acid treatment of Hep3B cells,
which leads to downregulation of RXR
, decreased HNF-4
mRNA
(34, 40). The positive influence of a well-characterized
signaling pathway on human HNF-4
expression may provide the
molecular basis for the design of novel therapeutic-intervention protocols to combat diseases caused by low HNF-4
expression levels. Such a disease is maturity onset diabetes of the young 1, a diabetic syndrome, which, according to the current view, is causally related to
HNF-4
haploinsufficiency due to heterozygous mutations of the
HNF-4
gene (52).
In summary, our results demonstrate that in cultured hepatoma cells the
regulation of human HNF-4
depends on the interplay of positive and
negative transcription factors. Transcriptional activation is achieved
by the synergistic action of alternative sets of factors
(HNF-1
-GATA-6 or HNF-1
-HNF-6), which may act sequentially
during early hepatocyte specification and subsequent differentiation.
In HepG2 cells, the concomitant action of positive regulators (HNF-1
and HNF-6) and COUP-TFII, which acts as a repressor, determines the
actual rate of transcription from this gene. The repressive effect of
COUP-TFII may be alleviated by liganded RXR
-RAR
acting via
competition for the same binding site and increasing HNF-4
expression.
 |
ACKNOWLEDGMENTS |
We are indebted to A. Aranda, S. Cereghini, P. Chambon, R. Cortese, R. Costa, T. Evans, F. Lemaigre, D. Mangelsdorf, and M. Parker
for providing the indicated reagents. We are grateful to N. Katrakili
for expert technical assistance, C. Mamalaki for advice with HS
analysis, E. Soutoglou and K. Boulias for helpful discussions, G. Keszler for critical reading of the manuscript, and an anonymous
reviewer for helpful comments.
This work was supported by funds from the Greek General Secretariat for
Science and Technology, by HFSP RGP-0024, and by EU HPRN-CT-2000-00087 programs.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute of
Molecular Biology and Biotechnology, Foundation for Research and
Technology Hellas, P.O. Box 1527, 711 10 Herakleion, Crete, Greece.
Phone: 30-81-391163. Fax: 30-81-391101.E-mail:
talianid{at}imbb.forth.gr.
 |
REFERENCES |
| 1.
|
Bailly, A.,
G. Spath,
V. Bender, and M. C. Weiss.
1998.
Phenotypic effects of the forced expression of HNF4 and HNF1alpha are conditioned by properties of the recipient cell.
J. Cell Sci.
111:2411-2421[Abstract].
|
| 2.
|
Barbacci, E.,
M. Reber,
M. O. Ott,
C. Breillat,
F. Huetz, and S. Cereghini.
1999.
Variant hepatocyte nuclear factor 1 is required for visceral endoderm specification.
Development
126:4795-4805[Abstract].
|
| 3.
|
Bulla, G. A.
1997.
Hepatocyte nuclear factor-4 prevents silencing of hepatocyte nuclear factor-1 expression in hepatoma x fibroblast cell hybrids.
Nucleic Acids Res.
25:2501-2508[Abstract/Free Full Text].
|
| 4.
|
Butler, A. J., and M. G. Parker.
1995.
COUP-TF II homodimers are formed in preference to heterodimers with RXR alpha or TR beta in intact cells.
Nucleic Acids Res.
23:4143-4150[Abstract/Free Full Text].
|
| 5.
|
Cereghini, S.,
M. O. Ott,
S. Power, and M. Maury.
1992.
Expression patterns of vHNF1 and HNF1 homeoproteins in early postimplantation embryos suggest distinct and sequential developmental roles.
Development
116:783-797[Abstract].
|
| 6.
|
Chartier, F. L.,
J. P. Bossu,
V. Laudet,
J. C. Fruchart, and B. Laine.
1994.
Cloning and sequencing of cDNAs encoding the human hepatocyte nuclear factor 4 indicate the presence of two isoforms in human liver.
Gene
147:269-272[CrossRef][Medline].
|
| 7.
|
Chen, W. S.,
K. Manova,
D. C. Weinstein,
S. A. Duncan,
A. S. Plump,
V. R. Prezioso,
R. F. Bachvarova, and J. E. Darnell.
1994.
Disruption of the HNF-4 gene, expressed in visceral endoderm, leads to cell death in embryonic ectoderm and impaired gastrulation of mouse embryos.
Genes Dev.
8:2466-2477[Abstract/Free Full Text].
|
| 8.
|
Coffinier, C.,
D. Thepot,
C. Babinet,
M. Yaniv, and J. Barra.
1999.
Essential role for the homeoprotein vHNF1/HNF1beta in visceral endoderm differentiation.
Development
126:4785-4794[Abstract].
|
| 9.
|
Dell, H., and M. Hadzopoulou-Cladaras.
1999.
CREB-binding protein is a transcriptional coactivator for hepatocyte nuclear factor-4 and enhances apolipoprotein gene expression.
J. Biol. Chem.
274:9013-9021[Abstract/Free Full Text].
|
| 10.
|
De Simone, V.,
L. De Magistris,
D. Lazzaro,
J. Gerstner,
P. Monaci,
A. Nicosia, and R. Cortese.
1991.
LFB3, a heterodimer-forming homeoprotein of the LFB1 family, is expressed in specialized epithelia.
EMBO J.
10:1435-1443[Medline].
|
| 11.
|
Drewes, T.,
S. Senkel,
B. Holewa, and G. U. Ryffel.
1996.
Human hepatocyte nuclear factor 4 isoforms are encoded by distinct and differentially expressed genes.
Mol. Cell. Biol.
16:925-931[Abstract].
|
| 12.
|
Duncan, S. A.,
K. Manova,
W. S. Chen,
P. Hoodless,
D. C. Weinstein,
R. F. Bachvarova, and J. E. Darnell.
1994.
Expression of transcription factor HNF-4 in the extraembryonic endoderm, gut, and nephrogenic tissue of the developing mouse embryo: HNF-4 is a marker for primary endoderm in the implanting blastocyst.
Proc. Natl. Acad. Sci. USA
91:7598-7602[Abstract/Free Full Text].
|
| 13.
|
Duncan, S. A.,
M. A. Navas,
D. Dufort,
J. Rossant, and M. Stoffel.
1998.
Regulation of a transcription factor network required for differentiation and metabolism.
Science
281:692-695[Abstract/Free Full Text].
|
| 14.
|
Duncan, S. A.
2000.
Transcriptional regulation of liver development.
Dev. Dyn.
219:131-142[CrossRef][Medline].
|
| 15.
|
Gao, X.,
T. Sedgwick,
Y. B. Shi, and T. Evans.
1998.
Distinct functions are implicated for the GATA-4, -5, and -6 transcription factors in the regulation of intestine epithelial cell differentiation.
Mol. Cell. Biol.
18:2901-2911[Abstract/Free Full Text].
|
| 16.
|
Gaub, M. P.,
C. Rochette-Egly,
Y. Lutz,
S. Ali,
H. Matthes,
I. Scheuer, and P. Chambon.
1992.
Immunodetection of multiple species of retinoic acid receptor alpha: evidence for phosphorylation.
Exp. Cell Res.
201:335-346[CrossRef][Medline].
|
| 17.
|
Hayhurst, G. P.,
Y. H. Lee,
G. Lambert,
J. M. Ward, and F. J. Gonzalez.
2001.
Hepatocyte nuclear factor 4 (nuclear receptor 2A1) is essential for maintenance of hepatic gene expression and lipid homeostasis.
Mol. Cell. Biol.
21:1393-1403[Abstract/Free Full Text].
|
| 18.
|
Holewa, B.,
E. P. Strandmann,
D. Zapp,
P. Lorenz, and G. U. Ryffel.
1996.
Transcriptional hierarchy in Xenopus embryogenesis: HNF4 a maternal factor involved in the developmental activation of the gene encoding the tissue specific transcription factor HNF1 alpha (LFB1).
Mech. Dev.
54:45-57[CrossRef][Medline].
|
| 19.
|
Jiang, G.,
L. Nepomuceno,
Q. Yang, and F. M. Sladek.
1997.
Serine/threonine phosphorylation of orphan receptor hepatocyte nuclear factor 4.
Arch. Biochem. Biophys.
340:1-9[CrossRef][Medline].
|
| 20.
|
Jimenez-Lara, A. M., and A. Aranda.
1999.
Lysine 246 of the vitamin D receptor is crucial for ligand-dependent interaction with coactivators and transcriptional activity.
J. Biol. Chem.
274:13503-13510[Abstract/Free Full Text].
|
| 21.
|
Kritis, A. A.,
A. Argyrokastritis,
N. K. Moschonas,
S. Power,
N. Katrakili,
V. I. Zannis,
S. Cereghini, and I. Talianidis.
1996.
Isolation and characterization of a third isoform of human hepatocyte nuclear factor 4.
Gene
173:275-280[CrossRef][Medline].
|
| 22.
|
Kritis, A. A.,
E. Ktistaki,
D. Barda,
V. I. Zannis, and I. Talianidis.
1993.
An indirect negative autoregulatory mechanism involved in hepatocyte nuclear factor-1 gene expression.
Nucleic Acids Res.
21:5882-5889[Abstract/Free Full Text].
|
| 23.
|
Ktistaki, E.,
N. T. Ktistakis,
E. Papadogeorgaki, and I. Talianidis.
1995.
Recruitment of hepatocyte nuclear factor 4 into specific intranuclear compartments depends on tyrosine phosphorylation that affects its DNA-binding and transactivation potential.
Proc. Natl. Acad. Sci. USA
92:9876-9880[Abstract/Free Full Text].
|
| 24.
|
Ktistaki, E., and I. Talianidis.
1997.
Modulation of hepatic gene expression by hepatocyte nuclear factor 1.
Science
277:109-112[Abstract/Free Full Text].
|
| 25.
|
Ktistaki, E., and I. Talianidis.
1997.
Chicken ovalbumin upstream promoter transcription factors act as auxiliary cofactors for hepatocyte nuclear factor 4 and enhance hepatic gene expression.
Mol. Cell. Biol.
17:2790-2797[Abstract].
|
| 26.
|
Kuo, C. J.,
P. B. Conley,
L. Chen,
F. M. Sladek,
J. E. Darnell, Jr., and G. R. Crabtree.
1992.
A transcriptional hierarchy involved in mammalian cell-type specification.
Nature
355:457-461[CrossRef][Medline].
|
| 27.
|
Ladias, J. A., and S. K. Karathanasis.
1991.
Regulation of the apolipoprotein AI gene by ARP-1, a novel member of the steroid receptor superfamily.
Science
251:561-565[Abstract/Free Full Text].
|
| 28.
|
Lahooti, H.,
R. White,
P. S. Danielian, and M. G. Parker.
1994.
Characterization of ligand-dependent phosphorylation of the estrogen receptor.
Mol. Endocrinol.
8:182-188[Abstract/Free Full Text].
|
| 29.
|
Lai, E.,
V. R. Prezioso,
E. Smith,
O. Litvin,
R. H. Costa, and J. E. Darnell.
1990.
HNF-3A, a hepatocyte-enriched transcription factor of novel structure is regulated transcriptionally.
Genes Dev.
4:1427-1436[Abstract/Free Full Text].
|
| 30.
|
Landry, C.,
F. Clotman,
T. Hioki,
H. Oda,
J. J. Picard,
F. P. Lemaigre, and G. G. Rousseau.
1997.
HNF-6 is expressed in endoderm derivatives and nervous system of the mouse embryo and participates to the cross-regulatory network of liver-enriched transcription factors.
Dev. Biol.
192:247-257[CrossRef][Medline].
|
| 31.
|
Lemaigre, F. P.,
S. M. Durviaux,
O. Truong,
V. J. Lannoy,
J. J. Hsuan, and G. G. Rousseau.
1996.
Hepatocyte nuclear factor 6, a transcription factor that contains a novel type of homeodomain and a single cut domain.
Proc. Natl. Acad. Sci. USA
93:9460-9664[Abstract/Free Full Text].
|
| 32.
|
Li, J.,
G. Ning, and S. A. Duncan.
2000.
Mammalian hepatocyte differentiation requires the transcription factor HNF-4alpha.
Genes Dev.
14:464-474[Abstract/Free Full Text].
|
| 33.
|
Lu, T. T.,
M. Makishima,
J. J. Repa,
K. Schoonjans,
T. A. Kerr,
J. Auwerx, and D. J. Mangelsdorf.
2000.
Molecular basis for feedback regulation of bile acid synthesis by nuclear receptors.
Mol. Cell
6:507-515[CrossRef][Medline].
|
| 34.
|
Magee, T. R.,
Y. Cai,
M. E. El-Houseini,
J. Locker, and Y. J. Wan.
1998.
Retinoic acid mediates down-regulation of the alpha-fetoprotein gene through decreased expression of hepatocyte nuclear factors.
J. Biol. Chem.
273:30024-30032[Abstract/Free Full Text].
|
| 35.
|
Morrisey, E. E.,
Z. Tang,
K. Sigrist,
M. M. Lu,
F. Jiang,
H. S. Ip, and M. S. Parmacek.
1998.
GATA6 regulates HNF4 and is required for differentiation of visceral endoderm in the mouse embryo.
Genes Dev.
12:3579-3590[Abstract/Free Full Text].
|
| 36.
|
Orlando, V.,
H. Strutt, and R. Paro.
1997.
Analysis of chromatin structure by in vivo formaldehyde cross-linking.
Methods
11:205-214[CrossRef][Medline].
|
| 37.
|
Pare, J. F.,
S. Roy,
L. Galarneau, and L. Belanger.
2001.
The mouse fetoprotein transcription factor (ftf) gene promoter is regulated by three gata elements with tandem e box and nkx motifs, and ftf in turn activates the hnf3beta, hnf4alpha, and hnf1alpha gene promoters.
J. Biol. Chem.
276:13136-13144[Abstract/Free Full Text].
|
| 38.
|
Pontoglio, M.,
J. Barra,
M. Hadchouel,
A. Doyen,
C. Kress,
J. P. Bach,
C. Babinet, and M. Yaniv.
1996.
Hepatocyte nuclear factor 1 inactivation results in hepatic dysfunction, phenylketonuria, and renal Fanconi syndrome.
Cell
84:575-585[CrossRef][Medline].
|
| 39.
|
Price, J. A.,
S. C. Fossey,
M. M. Sale,
C. S. Brewer,
B. I. Freedman,
J. P. Wuerth, and D. W. Bowden.
2000.
Analysis of the HNF4 alpha gene in Caucasian type II diabetic nephropathic patients.
Diabetologia
43:364-372[CrossRef][Medline].
|
| 40.
|
Qian, A.,
Y. Cai,
T. R. Magee, and Y. J. Wan.
2000.
Identification of retinoic acid-responsive elements on the HNF1alpha and HNF4alpha genes.
Biochem. Biophys. Res. Commun.
276:837-842[CrossRef][Medline].
|
| 41.
|
Rich, B. E., and J. A. Steitz.
1987.
Human acidic ribosomal phosphoproteins P0, P1, and P2: analysis of cDNA clones, in vitro synthesis, and assembly.
Mol. Cell. Biol.
7:4065-4074[Abstract/Free Full Text].
|
| 42.
|
Sladek, F. M.,
W. M. Zhong,
E. Lai, and J. E. Darnell.
1990.
Liver-enriched transcription factor HNF-4 is a novel member of the steroid hormone receptor superfamily.
Genes Dev.
4:2353-2365[Abstract/Free Full Text].
|
| 43.
|
Sladek, F. M.,
M. D. Ruse,
L. Nepomuceno,
S. M. Huang, and M. R. Stallcup.
1999.
Modulation of transcriptional activation and coactivator interaction by a splicing variation in the F domain of nuclear receptor hepatocyte nuclear factor 4 1.
Mol. Cell. Biol.
19:6509-6522[Abstract/Free Full Text].
|
| 44.
|
Soutoglou, E.,
N. Katrakili, and I. Talianidis.
2000.
Acetylation regulates transcription factor activity at multiple levels.
Mol. Cell
5:745-751[CrossRef][Medline].
|
| 45.
|
Spath, G. F., and M. C. Weiss.
1997.
Hepatocyte nuclear factor 4 expression overcomes repression of the hepatic phenotype in dedifferentiated hepatoma cells.
Mol. Cell. Biol.
17:1913-1922[Abstract].
|
| 46.
|
Spath, G. F., and M. C. Weiss.
1998.
Hepatocyte nuclear factor 4 provokes expression of epithelial marker genes, acting as a morphogen in dedifferentiated hepatoma cells.
J. Cell Biol.
140:935-946[Abstract/Free Full Text].
|
| 47.
|
Taraviras, S.,
A. P. Monaghan,
G. Schutz, and G. Kelsey.
1994.
Characterization of the mouse HNF-4 gene and its expression during mouse embryogenesis.
Mech. Dev.
48:67-79[CrossRef][Medline].
|
| 48.
|
Tian, J. M., and U. Schibler.
1991.
Tissue-specific expression of the gene encoding hepatocyte nuclear factor 1 may involve hepatocyte nuclear factor 4.
Genes Dev.
5:2225-2234[Abstract/Free Full Text].
|
| 49.
|
Tolon, R. M.,
A. I. Castillo, and A. Aranda.
1998.
Activation of the prolactin gene by peroxisome proliferator-activated receptor-alpha appears to be DNA binding-independent.
J. Biol. Chem.
273:26652-26661[Abstract/Free Full Text].
|
| 50.
|
Viollet, B.,
A. Kahn, and M. Raymondjean.
1997.
Protein kinase A-dependent phosphorylation modulates DNA-binding activity of hepatocyte nuclear factor 4.
Mol. Cell. Biol.
17:4208-4219[Abstract].
|
| 51.
|
Willy, P. J.,
K. Umesono,
E. S. Ong,
R. M. Evans,
R. A. Heyman, and D. J. Mangelsdorf.
1995.
LXR, a nuclear receptor that defines a distinct retinoid response pathway.
Genes Dev.
9:1033-1045[Abstract/Free Full Text].
|
| 52.
|
Yamagata, K.,
H. Furuta,
N. Oda,
P. J. Kaisaki,
S. Menzel,
N. J. Cox,
S. S. Fajans,
S. Signorini,
M. Stoffel, and G. I. Bell.
1996.
Mutations in the hepatocyte nuclear factor-4alpha gene in maturity-onset diabetes of the young (MODY1).
Nature
384:458-460[CrossRef][Medline].
|
| 53.
|
Yoshida, E.,
S. Aratani,
H. Itou,
M. Miyagishi,
M. Takiguchi,
T. Osumu,
K. Murakami, and A. Fukamizu.
1997.
Functional association between CBP and HNF4 in trans-activation.
Biochem. Biophys. Res. Commun.
241:664-669[CrossRef][Medline].
|
| 54.
|
Zhong, W.,
J. Mirkovitch, and J. E. Darnell.
1994.
Tissue-specific regulation of mouse hepatocyte nuclear factor 4 expression.
Mol. Cell. Biol.
14:7276-7284[Abstract/Free Full Text].
|
Molecular and Cellular Biology, November 2001, p. 7320-7330, Vol. 21, No. 21
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.21.7320-7330.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Xie, X., Liao, H., Dang, H., Pang, W., Guan, Y., Wang, X., Shyy, J. Y.-J., Zhu, Y., Sladek, F. M.
(2009). Down-Regulation of Hepatic HNF4{alpha} Gene Expression during Hyperinsulinemia via SREBPs. Mol. Endocrinol.
23: 434-443
[Abstract]
[Full Text]
-
Xie, P., Sun, L., Nayak, B., Haruna, Y., Liu, F.-y., Kashihara, N., Kanwar, Y. S.
(2009). C/EBP-{beta} Modulates Transcription of Tubulointerstitial Nephritis Antigen in Obstructive Uropathy. J. Am. Soc. Nephrol.
20: 807-819
[Abstract]
[Full Text]
-
Ungaro, P., Teperino, R., Mirra, P., Cassese, A., Fiory, F., Perruolo, G., Miele, C., Laakso, M., Formisano, P., Beguinot, F.
(2008). Molecular Cloning and Characterization of the Human PED/PEA-15 Gene Promoter Reveal Antagonistic Regulation by Hepatocyte Nuclear Factor 4{alpha} and Chicken Ovalbumin Upstream Promoter Transcription Factor II. J. Biol. Chem.
283: 30970-30979
[Abstract]
[Full Text]
-
Wederell, E. D., Bilenky, M., Cullum, R., Thiessen, N., Dagpinar, M., Delaney, A., Varhol, R., Zhao, Y., Zeng, T., Bernier, B., Ingham, M., Hirst, M., Robertson, G., Marra, M. A., Jones, S., Hoodless, P. A.
(2008). Global analysis of in vivo Foxa2-binding sites in mouse adult liver using massively parallel sequencing. Nucleic Acids Res
36: 4549-4564
[Abstract]
[Full Text]
-
Shadley, J. D., Divakaran, K., Munson, K., Hines, R. N., Douglas, K., McCarver, D. G.
(2007). Identification and Functional Analysis of a Novel Human CYP2E1 Far Upstream Enhancer. Mol. Pharmacol.
71: 1630-1639
[Abstract]
[Full Text]
-
Hatzis, P., Kyrmizi, I., Talianidis, I.
(2006). Mitogen-Activated Protein Kinase-Mediated Disruption of Enhancer-Promoter Communication Inhibits Hepatocyte Nuclear Factor 4{alpha} Expression.. Mol. Cell. Biol.
26: 7017-7029
[Abstract]
[Full Text]
-
Kyrmizi, I., Hatzis, P., Katrakili, N., Tronche, F., Gonzalez, F. J., Talianidis, I.
(2006). Plasticity and expanding complexity of the hepatic transcription factor network during liver development.. Genes Dev.
20: 2293-2305
[Abstract]
[Full Text]
-
Beaudry, J.-B., Pierreux, C. E., Hayhurst, G. P., Plumb-Rudewiez, N., Weiss, M. C., Rousseau, G. G., Lemaigre, F. P.
(2006). Threshold Levels of Hepatocyte Nuclear Factor 6 (HNF-6) Acting in Synergy with HNF-4 and PGC-1{alpha} Are Required for Time-Specific Gene Expression during Liver Development.. Mol. Cell. Biol.
26: 6037-6046
[Abstract]
[Full Text]
-
Qadri, I., Iwahashi, M., Kullak-Ublick, G. A., Simon, F. R.
(2006). Hepatocyte Nuclear Factor (HNF) 1 and HNF4 Mediate Hepatic Multidrug Resistance Protein 2 Up-Regulation during Hepatitis C Virus Gene Expression. Mol. Pharmacol.
70: 627-636
[Abstract]
[Full Text]
-
Rufibach, L. E., Duncan, S. A., Battle, M., Deeb, S. S.
(2006). Transcriptional regulation of the human hepatic lipase (LIPC) gene promoter. J. Lipid Res.
47: 1463-1477
[Abstract]
[Full Text]
-
Bosse, T., van Wering, H. M., Gielen, M., Dowling, L. N., Fialkovich, J. J., Piaseckyj, C. M., Gonzalez, F. J., Akiyama, T. E., Montgomery, R. K., Grand, R. J., Krasinski, S. D.
(2006). Hepatocyte nuclear factor-1{alpha} is required for expression but dispensable for histone acetylation of the lactase-phlorizin hydrolase gene in vivo. Am. J. Physiol. Gastrointest. Liver Physiol.
290: G1016-G1024
[Abstract]
[Full Text]
-
Rowley, C. W., Staloch, L. J., Divine, J. K., McCaul, S. P., Simon, T. C.
(2006). Mechanisms of mutual functional interactions between HNF-4{alpha} and HNF-1{alpha} revealed by mutations that cause maturity onset diabetes of the young. Am. J. Physiol. Gastrointest. Liver Physiol.
290: G466-G475
[Abstract]
[Full Text]
-
Pramfalk, C., Davis, M. A., Eriksson, M., Rudel, L. L., Parini, P.
(2005). Control of ACAT2 liver expression by HNF1. J. Lipid Res.
46: 1868-1876
[Abstract]
[Full Text]
-
Popowski, K., Eloranta, J. J., Saborowski, M., Fried, M., Meier, P. J., Kullak-Ublick, G. A.
(2005). The Human Organic Anion Transporter 2 Gene Is Transactivated by Hepatocyte Nuclear Factor-4{alpha} and Suppressed by Bile Acids. Mol. Pharmacol.
67: 1629-1638
[Abstract]
[Full Text]
-
Zhao, R., Watt, A. J., Li, J., Luebke-Wheeler, J., Morrisey, E. E., Duncan, S. A.
(2005). GATA6 Is Essential for Embryonic Development of the Liver but Dispensable for Early Heart Formation. Mol. Cell. Biol.
25: 2622-2631
[Abstract]
[Full Text]
-
Boulias, K., Talianidis, I.
(2004). Functional role of G9a-induced histone methylation in small heterodimer partner-mediated transcriptional repression. Nucleic Acids Res
32: 6096-6103
[Abstract]
[Full Text]
-
Hirokane, H., Nakahara, M., Tachibana, S., Shimizu, M., Sato, R.
(2004). Bile Acid Reduces the Secretion of Very Low Density Lipoprotein by Repressing Microsomal Triglyceride Transfer Protein Gene Expression Mediated by Hepatocyte Nuclear Factor-4. J. Biol. Chem.
279: 45685-45692
[Abstract]
[Full Text]
-
Briancon, N., Bailly, A., Clotman, F., Jacquemin, P., Lemaigre, F. P., Weiss, M. C.
(2004). Expression of the {alpha}7 Isoform of Hepatocyte Nuclear Factor (HNF) 4 Is Activated by HNF6/OC-2 and HNF1 and Repressed by HNF4{alpha}1 in the Liver. J. Biol. Chem.
279: 33398-33408
[Abstract]
[Full Text]
-
Tanaka, T., Tomaru, Y., Nomura, Y., Miura, H., Suzuki, M., Hayashizaki, Y.
(2004). Comprehensive search for HNF-1{beta}-regulated genes in mouse hepatoma cells perturbed by transcription regulatory factor-targeted RNAi. Nucleic Acids Res
32: 2740-2750
[Abstract]
[Full Text]
-
Liu, A., Hoffman, P. W., Lu, W., Bai, G.
(2004). NF-{kappa}B Site Interacts with Sp Factors and Up-regulates the NR1 Promoter during Neuronal Differentiation. J. Biol. Chem.
279: 17449-17458
[Abstract]
[Full Text]
-
Haumaitre, C., Reber, M., Cereghini, S.
(2003). Functions of HNF1 Family Members in Differentiation of the Visceral Endoderm Cell Lineage. J. Biol. Chem.
278: 40933-40942
[Abstract]
[Full Text]
-
Divine, J. K., McCaul, S. P., Simon, T. C.
(2003). HNF-1{alpha} and endodermal transcription factors cooperatively activate Fabpl: MODY3 mutations abrogate cooperativity. Am. J. Physiol. Gastrointest. Liver Physiol.
285: G62-G72
[Abstract]
[Full Text]
-
Rausa, F. M., Tan, Y., Costa, R. H.
(2003). Association between Hepatocyte Nuclear Factor 6 (HNF-6) and FoxA2 DNA Binding Domains Stimulates FoxA2 Transcriptional Activity but Inhibits HNF-6 DNA Binding. Mol. Cell. Biol.
23: 437-449
[Abstract]
[Full Text]