Previous Article | Next Article 
Molecular and Cellular Biology, November 2001, p. 7355-7365, Vol. 21, No. 21
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.21.7355-7365.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Restoration of Nucleotide Excision Repair in a Helicase-Deficient
XPD Mutant from Intragenic Suppression by a
Trichothiodystrophy Mutation
James W.
George,1,
Edmund P.
Salazar,1
Maaike P. G.
Vreeswijk,2
Jane E.
Lamerdin,1
Joyce T.
Reardon,3
Malgorzata Z.
Zdzienicka,2
Aziz
Sancar,3
Saloumeh
Kadkhodayan,1,
Robert S.
Tebbs,1
Leon H. F.
Mullenders,2 and
Larry H.
Thompson1,*
Biology and Biotechnology Research Program, Lawrence
Livermore National Laboratory, Livermore, California
94551-08081; MGC-Department of Radiation
Genetics and Chemical Mutagenesis, Leiden University Medical Center,
2333 AL Leiden, The Netherlands2; and
Department of Biochemistry and Biophysics, University of
North Carolina School of Medicine, Chapel Hill, North Carolina
27599-72603
Received 8 January 2001/Returned for modification 22 February
2001/Accepted 27 July 2001
 |
ABSTRACT |
The UV-sensitive V-H1 cell line has a T46I substitution mutation in
the Walker A box in both alleles of XPD and lacks DNA helicase activity. We characterized three partial revertants that curiously display intermediate UV cytotoxicity (2- to 2.5-fold) but
normal levels of UV-induced hprt mutations. In revertant
RH1-26, the efficient removal of pyrimidine (6-4) pyrimidone
photoproducts from both strands of hprt suggests that
global-genomic nucleotide excision repair is normal, but the pattern of
cyclobutane pyrimidine dimer removal suggests that
transcription-coupled repair (TCR) is impaired. To explain the
intermediate UV survival and lack of RNA synthesis recovery in RH1-26
after 10 J of UV/m2, we propose a defect in
repair-transcription coupling, i.e., the inability of the cells to
resume or reinitiate transcription after the first TCR event within a
transcript. All three revertants carry an R658H suppressor mutation, in
one allele of revertants RH1-26 and RH1-53 and in both alleles of
revertant RH1-3. Remarkably, the R658H mutation produces the clinical
phenotype of trichothiodystrophy (TTD) in several patients
who display intermediate UV sensitivity. The XPDR658H
TTD protein, like XPDT46I/R658H, is codominant
when overexpressed in V-H1 cells and partially complements their UV
sensitivity. Thus, the suppressing R658H substitution must
restore helicase activity to the inactive XPDT46I
protein. Based on current knowledge of helicase structure, the intragenic reversion mutation may partially compensate for the T46I
mutation by perturbing the XPD structure in a way that counteracts the
effect of this mutation. These findings have implications for
understanding the differences between xeroderma pigmentosum and TTD and
illustrate the value of suppressor genetics for studying helicase
structure-function relationships.
 |
INTRODUCTION |
The nucleotide excision
repair (NER) pathway in eukaryotic cells is required for the error-free
removal from DNA of lesions such as pyrimidine (6-4) pyrimidone
photoproducts (PPs), cyclobutane pyrimidine dimers (CPDs), and bulky
chemical adducts (1, 9, 37, 48). The molecular
mechanism of NER is a complex process requiring about 25 proteins in humans. NER can be subdivided into global-genomic
repair and transcription-coupled repair (TCR). These subpathways
differ with respect to damage recognition and the rate at which some
forms of DNA damage are repaired. For many lesions, including CPDs, the
global-genomic pathway operates in all parts of the genome but acts
relatively slowly. In this pathway, the XPA, RPA, and XPC-hHR23B
proteins participate in damage recognition (41, 61, 62).
Removal of CPDs and chemical adducts during TCR occurs more rapidly in
the transcribed strand of active genes (30). Repair is
initiated when an RNA polymerase II elongation complex is blocked by a
lesion and requires the CSA and CSB proteins but not XPC-hHR23B
(9). In both repair pathways, repair or transcription factor TFIIH is required to unwind the DNA duplex surrounding the lesion to facilitate incision by the XPG and XPF-ERCC1 single-strand or double-strand junction-specific endonucleases (10, 11, 34, 35, 38). This unwinding reaction
absolutely requires the 3' to 5' and 5' to 3' helicase activities of
the TFIIH subunits XPB/ERCC3 (28) and XPD/ERCC2 (42,
66), respectively.
Along with its role in NER, TFIIH (reviewed in reference
15) is necessary for promoter opening during basal
transcription initiation by RNA polymerase II. This nine-member protein
complex has several enzymatic activities, including a cyclin-dependent kinase activity comprising subunits Cdk7, cyclin H, and Mat1. The XPB
and XPD subunits of TFIIH possess single-stranded DNA-dependent helicase-associated ATPase activities. Interestingly, the
helicase activity of only XPB is required for transcription.
Although XPD is required for transcription, its role appears structural
rather than catalytic (7, 16, 32, 51). A K48R mutation in
the canonical GKS/T ATP binding motif of XPD or the Rad3 homolog
abolishes repair but does not compromise transcription (43,
66).
Mutations in the XPD/ERCC2 gene result in three distinct
diseases (reviewed in references 3, 5, and
48): cancer-prone xeroderma pigmentosum (XP), XP in
combination with Cockayne syndrome (CS; a developmental
disorder), and trichothiodystrophy (TTD), which involves neurological
and developmental abnormalities distinct from those of CS. Unlike the
situation with most other XP genes, XPD mutations exhibit
variable and complex clinical phenotypes due to the fact that XPD
functions in both transcription and repair. Mutations in XPD
resulting in simple XP appear to affect only the NER pathway and
probably result from defective helicase activity. XPD-CS mutations show
a more complex phenotype that includes defective TCR of oxidative
lesions from ionizing radiation and hydrogen peroxide and increased
mutations from an 8-oxo-7,8-dihydroguanine lesion in the
transcribed strand in a shuttle vector (26).
Mechanistically, TTD defects have been ascribed to an altered enzyme
structure that reduces stability and/or interaction with other TFIIH
members, thereby impairing transcription initiation (4, 7,
15). However, it is becoming apparent in the case of some
XPD mutants that the clinical phenotypes require a more
complex explanation than either lack of activity or lack of native XPD
conformation. For example, it was reported that the R683W XPD mutant
has a reduced interaction with the TFIIH p62 subunit, which normally
stimulates XPD helicase activity (7). It is clear that
understanding the structure-function relationships of wild-type (WT)
and mutant XPD proteins will increase insight into the molecular bases
of these diseases.
A step in this direction was taken with the isolation of the hamster
V-H1 mutant (68) and its partially UV-resistant revertants (69). The T46I substitution mutation in both alleles of
V-H1 resides in helicase motif I (21), which contains an
ATP binding motif found in all helicases (12). V-H1 cells
are about sixfold more UV sensitive to killing than parental cells
(69) and are defective in XPD helicase activity
(19). In this study, we characterize three phenotypic
revertants by demonstrating that these revertants have partially
restored the NER activity of XPD. In each revertant, the suppressing
mutation(s) was found to be R658H. Remarkably, this substitution is
identical to the mutation seen in three UV-sensitive TTD patients.
These results suggest that TTD mutations do in fact change the
structure of XPD and that suppressor genetics is a useful tool for
studying the gross structural features of the XPD helicase.
 |
MATERIALS AND METHODS |
Cell strains and culture conditions.
The UV-sensitive V-H1
mutant was derived from the V79 cell line (68). The
revertants RH1-3, RH1-26, and RH1-53 were isolated from a single
culture of V-H1 after UV mutagenesis with a dose of 3 J/m2 on each of three consecutive days
(69). Culture conditions were previously defined
(64). The doubling times (mean and standard error of the
mean) in hours of V-H1, RH1-26, and RH1-3 were 16.2 ± 0.72, 17.4 ± 1.4, and 18.3 ± 1.5, respectively.
UV survival curves and mutagenesis.
UV-C survival
curves were obtained as previously described (49). V79,
V-H1, RH1-3, RH1-26, RH1-53, and various transformed cell lines were
grown in mass cultures with continued neo selection for
transformants. Cells were then grown in normal
minimal essential medium for 1 to 3 days before use in the survival experiments. Cells
were plated on 10-cm dishes in triplicate at each UV dose. Dishes were
incubated at 37°C for 2 to 5 h and exposed to UV at various
doses (49).
In the mutation experiment, cells were thawed and grown in regular
medium for 2 days and then grown in
hypoxanthine-aminopterin-thymidine medium for 96 to 120 h to kill
preexisting hprt mutants. They then were placed in regular
medium for 48 to 72 h before being irradiated at 0, 2.5, and 5.0 J/m2. Aliquots were plated for survival, and then
0.8 × 107 to 1.0 × 107 cells were inoculated into an
850-cm2 plastic roller bottle (350 ml). The WT
was diluted on day 3 and revertant cultures were diluted on day 4 to
6 × 106 cells per bottle. The WT was plated
for mutations on day 6 of expression, RH1-26 was plated on day 8, and
RH1-3 was plated on day 9 because of differences in growth rates. In
each instance, cells were plated in triplicate for plating efficiency
(300 cells/dish) and for 6-thioguanine selection (5 µg/ml) on eight
dishes (unirradiated cells) or four dishes (irradiated cells) at
4.8 × 105 cells per 15-cm dish. Selection
dishes were incubated for 10 to 15 days.
Plasmid transfection and cDNA cloning.
Plasmid pXPD/R658H
was constructed by digesting pXPD/RH1-53 with SfiI and
XhoI to release a 1.66-kb fragment containing the suppressing mutation. After gel purification, this fragment was ligated
to the complementary 6.15-kb fragment isolated from
SfiI/XhoI-digested pXPD/WT.
The XPD cDNAs from revertants RH1-3, RH1-26, and RH1-53 were produced
from total RNAs isolated from 2 × 107 to
5 × 107 cells using a total RNA Maxi or
Midi kit from Qiagen. First-strand cDNA synthesis was accomplished
using an oligo(dT)12-18 primer and a Life
Technologies preamplification system for first-strand cDNA synthesis by
following the manufacturer's recommendations with the following
exceptions. After the addition of reverse transcriptase, reaction
mixtures were incubated for 70 to 90 min at 50°C; after the addition
of RNase H, reaction mixtures were incubated at 37°C for 20 to 30 min.
With the first-strand product, cDNA was produced by use of an
Opti-Prime PCR optimization kit (Stratagene). This reaction was
performed with a 100-µl mixture containing 10 mM Tris-HCl (pH 8.8),
3.5 mM MgCl2, 25 mM KCl, 0.2 mM each
deoxynucleoside triphosphate (dNTP), 100 µg of bovine serum albumin
(BSA)/ml, 10 mM NH4SO4,
7.5% dimethyl sulfoxide, 2.5 U of Pfu DNA polymerase, 1 U
of Perfect Match DNA polymerase enhancer, 10 µl of reverse transcriptase reaction mixture, and 0.2 mM each primers JK105 and JK109 (see below). Pfu DNA polymerase was added last to
initiate the reaction at 80°C. Reaction mixtures were heated to
94°C for 2.5 min followed by 31 to 36 cycles of PCR (1 cycle is 1 min
at 94°C, 1 min at 62°C, 2 min at either 68 or 72°C, and then a
6-min extension in the last cycle). To subclone the cDNAs into pcDNA3 (Invitrogen), vector DNA was digested with EcoRV and ligated
to gel-purified phosphorylated PCR product DNA.
Stable cDNA transformants were obtained by electroporation followed by
selection for Geneticin resistance (64, 65). Transformants were chosen for detailed study based on their level of UV sensitivity in pilot experiments and/or on their level of overexpressed XPD protein, as measured by Western blotting.
RNA synthesis.
Exponentially growing cells were prelabeled
for 20 h with 0.01 µCi of 14C-thymidine/ml
(56 mCi/mmol) (44). Cells (106) were
seeded in 6-cm dishes with fresh medium 1 day before UV irradiation. At
various times after irradiation (10 J/m2), the
medium was replaced with fresh medium containing 2 µCi of
3H-uridine/ml (39 Ci/mmol), after which cells
were incubated for 30 min at 37°C. Subsequently, cells were washed
with phosphate-buffered saline, and the incorporation of radioactivity
in trichloroacetic acetic acid-precipitated material was determined
(54). The ratio of 3H to
14C incorporation was taken as a measure of RNA synthesis.
Analysis of gene-specific repair.
The method used to analyze
gene-specific repair was essentially that described previously
(59). Exponentially growing cells were prelabeled for
20 h in the presence of 3H-thymidine (0.012 µCi/ml; 82 Ci/mmol) and 0.1 µM thymidine. Prior to irradiation, the
3H-thymidine-containing medium was removed and
the cells were rinsed with phosphate-buffered saline. Exponentially
growing cells were irradiated with UV-C at 10 or 30 J/m2 and either lysed immediately or incubated
for 2, 4, 8, or 24 h in the presence of 10 µM
5-bromodeoxyuridine and 1 µM 5-fluorodeoxyuridine. DNA was isolated
and purified by phenol-chloroform extraction and digested with
EcoRI. Restricted DNA was centrifuged to equilibrium in
neutral CsCl gradients to allow separation of replicated and parental
DNAs (59). The frequency of UV-induced CPDs per
restriction fragment was determined by incision with T4 endonuclease V. For analysis of 6-4 PP frequency, CPDs were removed by use of a
photolyase and visible light, and then the DNA was incubated with the
UvrABC excinuclease complex of Escherichia
coli. After electrophoresis of samples in alkaline agarose
gels, DNA was transferred to Hybond N+ membranes and hybridized with
gene-specific probes (59). Filters were scanned using
InstantImagerTM (Packard Instrument Co.). The number of CPDs or 6-4 PPs
per restriction fragment was calculated from the relative band
intensities of full-size restriction fragments in the lanes containing
mock-treated DNA or DNA treated with either T4 endonuclease V or UvrABC
excinuclease, assuming the Poisson distribution. Correction for
nonspecific activity of UvrABC was performed as described previously
(53).
DNA probes.
hprt cDNA fragments containing exons
3 to 5 or exons 6 to 9 were used to prepare specific probes.
Strand-specific single-stranded probes were radioactively labeled with
[32P]dATP by linear PCR using a single primer
recognizing one strand (36).
Excision repair assay.
Hamster cell extracts were prepared
from 1 × 109 to 3 × 109 cells as previously described
(29). The excision repair substrate is a 140-bp DNA duplex
containing a cholesterol adduct instead of a base in the middle of the
duplex. The 32P label was positioned five
nucleotides 5' from the cholesterol adduct, and the substrate was
prepared from six oligonucleotides as previously described
(17). Reactions were performed at 30°C for 60 min with
50 µg of cell extract in mixtures containing 3 fmol of substrate, 40 mM HEPES (pH 7.9), 80 mM KCl, 8 mM MgCl2, 2 mM
rATP, 20 µM each dNTP, 1 mM dithiothreitol, 7% glycerol (vol/vol), and 100 µg of BSA/ml. After the reactions were complete, the
substrate and product DNAs were processed, resolved by denaturing
polyacrylamide gel electrophoresis (PAGE), and quantitated as
previously described (33).
DNA sequencing.
The XPD cDNAs from RH1-3, RH1-26, and RH1-53
were sequenced from supercoiled plasmids using the dye termination
procedure (20). Primers for sequencing both strands were
as follows (written 5' to 3'): JK105
(TATTCAAGAGGCGGGCGAGCGG), JK72
(GCGGAAAAGCCCTCTGGTAG), JK107
(GCTCAAGAAAGAACCTGTGCATTC), JK74
(GTATCGAGCCAGGAAGTAGG), JK02
(CAGACCTGGTGTCCAAAGAG), JK76
(TGCTCGTCTGTCTCCTTGAT), JK77 (TGCCAGGCTCCATCCGCACT), JK85
(TAAGTGCTGACGAGAGTGGC), JK35
(GTCCCCACTGGACATCTACC), JK82
(TACTTCTCCAGGGCCACACT), JK78
(GGGGCAAAGTCTCAGAAGGG), JK80 (CAGATGGCTCAACCCTTCCA), JK37
(TTGCCCCTGATGGCACGACC), and JK109 (TTTCAGTACCTCCTGGTGCCACAGACGTCA).
Identification of genomic mutations.
Hamster genomic DNA was
prepared from 1.6 × 107 to 4 × 107 cells using a blood and cell culture DNA Maxi
kit (Qiagen). To determine the XPD genotype of the
revertants, a 954-bp DNA fragment was PCR amplified from genomic DNA by
two cycles of PCR using the following conditions and primers in a
50-µl reaction volume: 10 mM Tris-HCl (pH 9.2), 1.5 mM
MgCl2, 25 mM KCl, 0.2 mM each dNTP, 100 µg of
BSA/ml, 10 mM NH4SO4, 7.5%
dimethyl sulfoxide, 2.5 U of Pfu DNA polymerase, 1 U of
Perfect Match DNA polymerase enhancer, 300 to 400 ng of genomic DNA,
and primers JK78 (see above) and JK81
(5'-TAGACTGAGCAGTGACAGGC-3'). First-round PCR was performed as described above, except that annealing was done at 60°C and the
final extension reaction was carried out for 8 min. Second-round PCR
was performed with 2 µl of the first-round product under the conditions described above for cDNA synthesis. Second-step PCR products
were purified using a QIAquick PCR purification kit (Qiagen) and then
HhaI digested. Reaction products were resolved on a 15% polyacrylamide gel and visualized by staining with 0.5 µg of ethidium bromide/ml and illuminating on a standard UV-B light box.
Western blot analysis.
Cell extracts were prepared as
previously described (19). Fifty micrograms of protein
from each extract line was resolved by sodium dodecyl sulfate
(SDS)-PAGE. The resolved proteins were electroblotted onto a
nitrocellulose membrane (Amersham) and probed with a rabbit anti-XPD
polyclonal antibody (19) in blotting buffer containing 2%
dry milk, 2% BSA, 10 mM Tris (pH 7.5), 150 mM NaCl, and 0.20% Tween
20. Antibody binding was visualized by film autoradiography using a
goat anti-rabbit alkaline phosphatase-linked secondary antibody (Santa
Cruz Biotechnology, Inc.) and an ECL kit Western blotting detection
reagent (Amersham).
 |
RESULTS |
UV survival and mutagenesis responses of V-H1 revertants.
Partial revertants were previously isolated from UV-mutagenized
V-H1 cells (69). We chose revertants RH1-3, RH1-26, and RH1-53 for further characterization to determine the molecular basis of
their phenotypic reversion. UV survival experiments confirmed that all
three revertants were restored only partially compared to the WT level
of resistance (Fig. 1). Mutant V-H1
exhibited ~5.5-fold higher sensitivity (based on
D37 values) than the WT, whereas RH1-26 and
RH1-53 were ~2.5-fold more sensitive than the WT. RH1-3 was
consistently more resistant to UV than the other two revertants. The
sensitivity of RH1-3 and RH1-26 cells to UV-induced mutations at the
hprt locus was compared with that of WT cells using a
large-culture format to minimize variations caused by sampling
(see Materials and Methods). V-H1 cells were previously shown to have a sevenfold higher rate of UV-induced mutagenesis than WT cells (69). The data show two important findings
(Fig. 2). First, in contrast to their
differential cell survival responses, RH1-3 and RH1-26 gave virtually
identical mutation responses. Second, neither revertant differed
significantly from the WT. Since the mutation responses suggest that
repair is normal, the results prompt the question as to why survival is
impaired.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 1.
UV survival based on colony-forming ability of
revertants and parental cell lines. Cell lines tested were WT V79
( ), V-H1 ( ), and the phenotypic revertants RH1-3 ( ), RH1-26
( ), and RH1-53 ( ). Lines intersecting the abscissa indicate data
points below the axis. Each survival curve represents the average of
two experiments. Error bars represent SEMs.
|
|

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 2.
UV-induced hprt mutations based on
thioguanine-resistant cells for WT, mutant, and revertant cell lines.
(A) Mutations were induced by irradiation with 254-nm UV light in
parental V79 ( ), V-H1 ( ), RH1-3 ( ), and RH1-26 ( ) cell
lines. Data for V-H1 were taken from reference 69. The
spontaneous mutation frequencies that were subtracted were as follows:
WT, 0.4 × 10 5; V-H1, 1.8 × 10 5;
RH1-3, 1.6 × 10 5; and RH1-26, 1.0 × 10 5. (B) Survival curves measured immediately after UV
exposure for the cultures shown in panel A.
|
|
In vivo and in vitro repair in revertant RH1-26.
Previous
studies showed that RH1-26 cells removed 6-4 PPs from the genome with
normal kinetics overall, based on a radioimmunoassay, but showed very
little removal of CPDs in the hprt gene (70). To assess TCR, we first determined whether RH1-26 cells were able to recover from UV-inhibited RNA synthesis after a UV dose of 10 J/m2. No RNA synthesis recovery was observed in
RH1-26 cells after this dose, whereas WT cells recovered RNA synthesis
by 24 h postirradiation (Fig. 3).

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 3.
Rates of RNA synthesis after UV irradiation. Values are
expressed relative to those for untreated cells following irradiation
with 10 J/m2. V79 ( ) and RH1-26 ( ) cells were tested.
Error bars represent SEMs.
|
|
The removal of CPDs was analyzed with the 13- and 18-kb
EcoRI fragments of the hprt gene in WT and RH1-26
cells after irradiation with 10 J/m2 using T4
endonuclease V and quantitative Southern blot analysis (60). The initial CPD frequencies in the two cell lines
were similar. No removal of dimers from the nontranscribed strand of the 18-kb fragment of the hprt gene was observed after
24 h in the WT or RH1-26 (data not shown). Most CPDs (87%) were
removed from the transcribed strand in the hprt gene in WT
cells, whereas little or no removal occurred in the same fragment in
RH1-26 cells (Table 1). However, assay of
the transcribed strand in an upstream 13-kb EcoRI fragment
which contains hprt exons 3 to 5 indicated that the level of
repair of CPDs after 24 h was high compared to that in the
downstream 18-kb fragment, i.e., 56 and 9%, respectively. In WT cells,
the removal of CPDs from the transcribed strand of the hprt
gene was somewhat faster in the 13-kb fragment than in the 18-kb
fragment during the first 6 h after irradiation; in both
fragments, the transcribed strand was completely repaired after 24 h (60).
The removal of 6-4 PPs was measured with the same 18-kb
EcoRI hprt fragment using the UvrABC excinuclease
method, which avoids a potential limitation of the radioimmunoassay for
detecting nonremoved 6-4 PPs that have become refractory to antibody
binding. Since the level of induction of 6-4 PPs is ~3-fold lower
than that of CPDs (59), a UV dose of 30 J/m2 was used to obtain sufficient numbers of 6-4 PPs for accurate analysis. Prior to incubation with UvrABC, CPDs were
removed by treatment with photolyase and visible light. (When
photoreactivated DNA was incubated in the presence of T4 endonuclease
V, no incisions were observed in the fragments analyzed, indicating
complete removal of CPDs.) Photoreactivated DNA was incubated with
UvrABC and then analyzed by alkaline gel electrophoresis. 6-4 PPs were
removed from both strands of the hprt gene with the same
kinetics, and there was no detectable difference in repair kinetics
between the WT and RH1-26 (Fig. 4). Thus,
the normal removal of 6-4 PPs from hprt in RH1-26 agrees
with previous antibody data showing efficient removal of 6-4 PPs from
the genome overall (70) but contrasts sharply with the
lack of removal of CPDs in this particular hprt fragment
(see Discussion).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
Removal of 6-4 PPs from the hprt gene
after UV irradiation with 30 J/m2. (A) WT cells,
transcribed strand ( ) and nontranscribed strand ( ). (B) RH1-26,
transcribed strand ( ) and nontranscribed strand ( ). Error bars
represent SEMs.
|
|
To further examine cellular NER capacity, Manley
(29) whole-cell extracts were prepared, and NER activity
was measured using a 140-bp linear DNA duplex substrate containing a
cholesterol "adduct" in the middle of the substrate (see Materials
and Methods). To record NER activity, a
32P-labeled base was positioned five nucleotides
5'-ward of the cholesterol moiety. In this assay, activity is detected
when dual incisions occur on opposite sides of the lesion, thereby
producing excised oligonucleotides 24 to 32 bases long.
In reactions lacking cell extracts, no detectable incision was
observed (Fig. 5, first lane).
Reactions containing WT extracts converted 5.2% ± 0.4%
(standard error of the mean) of the substrate to product (Fig. 5,
second lane). In contrast, no activity was detected in reactions
containing V-H1 extracts (Fig. 5, third lane), although the extracts
were shown to be active by complementation using XPG-deficient extracts
(data not shown). Reactions containing RH1-26 extracts incised 1.1% ± 0.7% of the substrate constituting, on average, 22% WT activity (Fig.
5, fourth lane). In another experiment, RH1-3 exhibited 29% WT
activity (data not shown; based on triplicate measurements of each cell
line). These results are qualitatively consistent with the differential
UV sensitivity of the two revertants, but the quantitative levels of
repair are clearly lower than one would expect from in vivo
survival and mutagenesis. The lack of activity in the V-H1
extracts is in agreement with the high UV sensitivity of this
mutant. The partial restoration of in vitro NER activity in
RH1-26 suggested that the suppressing mutation resided in XPD or
another NER protein.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 5.
Partial restoration of in vitro NER activity in
revertant RH1-26. Cell extracts were incubated with a 140-bp duplex DNA
containing a cholesterol moiety in the middle of the substrate. The
substrate was internally labeled with 32P 5 bp 5'-ward of
the adduct on the same strand of DNA. Reactions were performed at
30°C for 60 min. After protein removal, the substrate was separated
from the product by denaturing PAGE and visualized by film
autoradiography.
|
|
The unwinding activity of XPD is essential for NER (66),
and the XPDT46I protein of V-H1 lacks helicase
activity, as recently reported (19). Thus, it seemed
plausible that the suppressing mutation(s) in the revertants may have
occurred within XPD. Alternatively, the mutation may have occurred
in an XPD-interacting protein within TFIIH, such as p44
(8), to restore helicase activity by reestablishing an
essential protein-protein interaction that was disrupted by the T46I substitution.
XPD suppressor mutations in V-H1 revertants.
To test directly
whether a suppressing mutation was intragenic, the XPD cDNA
from RH1-53 was subcloned into expression vector pcDNA3, and several
plasmid clones were individually transfected into V-H1.
Individual G418-resistant transformants were then examined for
overexpression of XPD by Western analysis (Fig.
6A) and for increased UV resistance (Fig.
6B). Since V-H1 cells harbor two identical mutant xpd
alleles (21), initial experiments were directed at
identifying transformants that had increased UV resistance and
increased levels of XPD protein (data not shown). Overexpressing transformants showing increased UV resistance were presumed to have
integrated the cDNA of a revertant allele of RH1-53 (e.g., Fig. 6A,
lane 6, and Fig. 6B). These clones showed a level of UV resistance
identical to that of RH1-53 cells. Transformant cultures from some cDNA
clones of RH1-53 did not show any UV-resistant cells. This
overexpression-competition experiment suggested that the suppressing
mutation in RH1-53 resided in an xpd allele. As a positive
control for complementation, V-H1 transformants overexpressing wild-type XPD were complemented to the WT level of UV
resistance (Fig. 6A, lane 5, and Fig. 6B).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 6.
Evidence that a suppressing mutation resides in an
xpd allele. (A) Fifty micrograms of soluble protein from
each extract was resolved by SDS-PAGE, and XPD protein was identified
by Western blotting using an affinity-purified anti-XPD polyclonal
antibody. In some lanes, the XPD protein appears as a doublet, for
reasons not understood. (B) UV survival curves for cells of the WT
( ), V-H1 ( ), revertant RH1-53 ( ), V-H1 transfected with
XPDWT ( ), V-H1 transfected with
XPDRH1-53 ( ), and RH1-53 transfected with
XPDT46I ( ). Each survival curve
represents the average of two experiments. Error bars represent SEMs.
|
|
As a confirmatory approach to the transfection of V-H1 with
XPDRH1-53 cDNA, RH1-53 cells were
transfected with XPDV-H1 cDNA to determine
whether the overexpression of XPDT46I could
convert RH1-53 to a UV-sensitive phenotype. As shown in Fig. 6A,
lane 7, and Fig. 6B, an RH1-53 transformant expressing the
XPDT46I protein was at least as sensitive to UV
as V-H1. Taken together, these results demonstrated that the
suppressing mutation mapped to one of the xpd alleles in
RH1-53.
Nucleotide sequencing of UV resistance-producing XPD cDNA
clones from the revertants was performed to identify the secondary mutations. The same CGC-to-CAC substitution at nucleotide 1973 of the
coding sequence was found in all three revertants. This change
represents a R658H amino acid substitution in the XPD protein which is
quite distant from the original T46I mutation and resides just outside
of helicase motif VI (Fig. 7A). These
results suggest that these two regions of the protein normally interact
to form a functional domain. Especially remarkable and curious is the fact that R658H is the causative mutation in three TTD patients having
intermediate UV sensitivity (45, 46). An R658C
substitution was present in another TTD patient (45).

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 7.
Analysis of the XPD intragenic suppressor mutation(s) in
revertants. (A) The positions of the conserved helicase motifs in XPD,
as described by Koonin for the Rad3 helicase family (23),
are shown. The original mutation in the V-H1 cell line is a homozygous
substitution in the Walker A box of motif I (GT46GKT) of
the protein that results in a T46I change. The suppressing mutation in
all three revertant cell lines changed arginine at position 658 to
histidine. Arginine 658 is positioned on the immediate N-terminal side
of motif VI. (B) HhaI digestion of the genomic PCR
products from WT and V-H1 DNAs produces DNA fragments of 416, 241, 183, 74, and 40 bp. In the revertant DNA, the suppressing mutation
eliminates an HhaI site. (C) Genomic DNAs from V-H1 and
the revertants were isolated, and a portion of the XPD
gene corresponding to nucleotide positions 13113 to 14066 was PCR
amplified and purified. PCR products were digested with
HhaI and resolved by PAGE. The 40-bp bands are faint.
The image was black-white inverted for ease of viewing.
|
|
Since the suppressing mutation eliminates an HhaI cleavage
site, restriction enzyme analysis was used to determine the genotypes of the revertants with respect to each allele. A 954-bp genomic fragment surrounding the position of the suppressing mutation was
amplified by PCR from V-H1 and the revertants. The predicted restriction patterns for the alleles are diagrammed in Fig. 7B. The
loss of the HhaI site in a revertant allele changes the
restriction map in two ways: a unique 599-bp HhaI digestion
fragment is predicted along with the loss of the 416- and 183-bp
fragments seen with the WT and V-H1 alleles. The HhaI
restriction patterns are shown in Fig. 7C. The amplified and digested
V-H1 DNA contains the five predicted fragments. In contrast, the RH1-3
digest suggests that this revertant is homozygous for the
XPDT46I/R658H suppressing allele. In
comparison, both RH1-26 and RH1-53 are heterozygous for this allele.
Confirmatory analysis was done on cDNA of each revertant by performing
HhaI digestion of reverse transcriptase PCR-derived
products (data not shown). All the restriction digestion data were also
consistent with the idea that RH1-3 expresses two revertant alleles.
Table 2 summarizes these XPD
genotypes.
Since the R658H substitution partially restored the activity of the
XPDT46I mutant protein in V-H1, it was of
interest to determine how well the XPDR658H
allele itself would complement V-H1 cells. This information would help
us to assess how much effect the T46I substitution had on the
XPDR658H protein. Since TTD with the R658H
mutation shows mild UV sensitivity, we would not expect the
XPDR658H allele to fully complement V-H1.
V-H1 cells transfected with a plasmid containing the
XPDR658H cDNA were selected for
resistance to G418 and then screened for XPDR658H
overexpression by Western blot analysis. As shown in Fig.
8A, four transformants showed various
levels of XPD overexpression. UV survival curves for these
transformants are compared to those for V-H1, RH1-53, and the WT in
Fig. 8B. Transformant clone 30, which appeared to express the smallest
amount of XPDR658H protein, minimally
complemented V-H1. Transformant clones 22 and 23, showing about the
same level of expression, complemented V-H1 to UV resistance slightly
higher than that of RH1-53. Finally, transformant 28 (arguably
producing the highest level of XPDR658H)
repeatedly showed the highest level of resistance, which was appreciably above that of RH1-53 and approximately equivalent to that
of RH1-3 (compare Fig. 1 with Fig. 8B). There are two possible
explanations for this partial restoration of UV resistance. First,
the XPDR658H protein may be moderately helicase
deficient and adequately competitive with the
XPDT46I protein at these expression levels.
Alternatively, the XPDR658H protein may be fully
active enzymatically but not highly competitive with
XPDT46I, even at a very high expression level,
because of defective interactions with partner proteins.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 8.
UV survival of V-H1 clones overexpressing
XPDR658H cDNA. (A) Fifty micrograms of
soluble protein extract from each cell line resolved by SDS-PAGE and
probed for XPD using anti-XPD antibody from a rabbit as described in
Materials and Methods. (B) UV survival curves for V-H1 (dotted line),
RH1-53 (dashed line, no symbols), WT (solid line, no symbols), and
VH-1/R658H transformant clone 30 ( ), clone 22 ( ), clone
23 ( ) and clone 28 ( ). The curves for V-H1, RH1-53, and WT are
taken from Fig. 6.
|
|
 |
DISCUSSION |
Partial restoration of in vitro NER capacity in
revertants.
Like that of other XPD mutants (18), the
phenotype of V-H1 cells has been paradoxical because of their high
sensitivity to UV killing and UV-induced hprt
mutation but their retention of both high unscheduled DNA
synthesis (69) and, ostensibly, intermediate levels
of 6-4 PP removal (31). However, recent studies examining
in vitro incision and XPD helicase activity lead to the conclusion that
V-H1 is completely defective in NER and that the apparent repair is an
artifact arising from unproductive incision and associated "repair"
synthesis (19). The helicase-motif I synthetic
XPDK48R mutation shows similar properties, such
as aberrant repair synthesis (66). Our in vitro data show
that the suppressor mutations in RH1-3 and RH1-26 partially restore
incision activity (Fig. 5 and unpublished results),
inferentially by producing a mutant protein that has partially regained
helicase activity, which is essential for repair (42, 66).
Both revertants show less in vitro repair activity than expected from
the in vivo repair and survival data. One possible explanation for this
discrepancy is that the XPDT46I/R658H protein is
relatively inefficient or labile in vitro, like, for example,
temperature-sensitive mutants that lack detectable in vitro activity.
Nature of the revertant phenotype.
The phenotype of RH1-26
(and the other revertants), like that of its parent mutant, also
presented a paradox because sensitivity to UV killing was intermediate,
whereas UV-induced hprt mutation was reported to be below
normal (70). Our data show an essentially WT level of
mutagenesis under mutation expression conditions that compensated for
the reduced rate of growth of revertant cells compared with WT cells
(Fig. 2). Examination of the kinetics of removal of CPDs and 6-4 PPs in
the hprt gene was intended to provide insight into the
previous finding that the efficiency and spectrum of UV-induced
mutations were normal in RH1-26 (70). Almost all mutations
produced at 2 J/m2 were due to photolesions in
the nontranscribed strand. Our data (Fig. 4) suggest that 6-4 PP
removal is normal in both strands of hprt, even at the high
dose of 30 J/m2. The possibility of abortive
incision (as discussed above for V-H1) does not seem to apply to RH1-26
because we did not observe any break induction that would be indicative
of this occurring (unpublished results). However, normal UV mutagenesis
may seem at first to be inconsistent with inhibition of recovery of
transcription, as measured by RNA synthesis after 10 J/m2 (Fig. 3). This inhibition is likely to be
the cause of the substantial UV cytotoxicity of RH1-26 (increased
~2.5-fold).
The lack of recovery of RNA synthesis implies that (i) TCR per se is
defective or that (ii) transcription fails to resume or reinitiate
after the removal of the first CPD in an active gene (average of about
two CPDs in the 18-kb fragment at 10 J/m2). Since
TCR normally removes DNA photolesions in a sequential way
(53), CPDs in the 5' region of the hprt gene
(i.e., the 13-kb fragment) will be removed first. After the first
TCR event has occurred in the gene, either transcription
elongation can resume (if the polymerase is still bound) or
transcription can reinitiate (if the polymerase is released). RH1-26
appears to be defective in whichever of these steps normally occurs,
causing failure of RNA synthesis to recover at 10 J/m2 (Fig. 3). However, after low doses, such as
2 J/m2 (the dose used to determine the mutation
spectrum), less than one CPD, on average, is present in
hprt; CPDs will be removed by ongoing transcription or after
initiation of transcription, thus leading to a normal mutation
frequency and spectrum.
Therefore, to explain the intermediate UV sensitivity and lack of
recovery of RNA synthesis in RH1-26, we favor a model in which only
cells in the population that are able to restore RNA synthesis can
survive. These surviving cells have approximately WT levels of
hprt mutations (Fig. 2) because of efficient 6-4 PP removal
and intermediate CPD repair. In the remainder of the cells, suppression
of transcription may lead to cell cycle arrest and/or apoptosis
(2, 27). It is well established that sensitivity to
killing varies during the cell cycle, with early S phase being the most
sensitive. In contrast, mutagenesis shows a flat age response
(67). In asynchronous RH1-26 populations, survival of
hprt+ cells after irradiation could be
preferentially limited to a portion of the cell cycle
(67).
Moreover, it is instructive to compare the phenotype of RH1-26 with
that of the CHO CSB/ERCC6 mutant UV61, which shows efficient repair of 6-4 PPs, little repair of CPDs in the transcribed strand, no
recovery of transcription, and enhanced mutagenesis (58). UV61 is also somewhat more UV sensitive than RH1-26 (50).
Whereas RH1-26 appears to be partially defective in CPD removal and
reinitiation of transcription after gene repair, UV61 is defective in
TCR per se, resulting in an elevated level of UV mutagenesis. The
phenotype of RH1-26 also differs from that of highly UV-sensitive human XPD-CS mutants, which show defective RNA synthesis recovery but also
greatly reduced 6-4 PP repair (52).
Mechanism of phenotypic suppression of XPD helicase mutation.
The fact that RH1-3 is homozygous for the suppressing mutation agrees
with its UV resistance being significantly higher than that of RH1-26
and RH1-53 (Fig. 1 and 2). These data, along with the
XPDT46I/R658H overexpression data shown in
Fig. 6, indicate that this revertant allele is codominant. The
homozygosity of the revertant allele in RH1-3 cells is surprising, just
as is the homozygosity of the XPDT46I
allele in parental V-H1 cells. In both instances, homozygosity presumably arose through a process of gene conversion or chromosome nondisjunction. The chromosomes of V79 cells show multiple
rearrangements (47). It is possible that one of the
chromosomes carrying XPD is particularly prone to such
events. If the initial reversion event had improved the growth rate,
there might have been selection in favor of a second event producing
homozygosity in RH1-3. However, this scenario is unlikely because RH1-3
grows more slowly than RH1-26 and RH1-26 grows more slowly than V-H1
(see Materials and Methods). These slower doubling times for revertant
cells than for V-H1 and parental V-79 cells are consistent with the
idea that the R658H mutation results in less efficient transcription.
Suppression of the XPDT46I mutant phenotype
by the R658H substitution is especially intriguing in light of
the fact that this mutation causes TTD (45, 46). The
transcription hypothesis proposes that TTD patients have a defect in
basal transcription due to impaired transcription initiation (7,
15, 57). There is now considerable evidence that mutations
underlying TTD alter the structure of XPD and destabilize TFIIH. The
xpd R658C mutation present in several TTD patients
confers a temperature-sensitive phenotype for repair, transcription,
and cell growth (56) and explains the hair loss occurring
in patients after fevers. Moreover, this mutation destabilizes TFIIH,
since the level of the p62 subunit is also temperature sensitive. The
XPDR722W protein, the result of a recurring TTD
mutation, is unable to interact with the p44 TFIIH subunit in cell
extracts, unlike WT XPD (8). Also, the TTD mutation in
the TTD-A complementation group causes a reduction in the TFIIH
level to ~25% the normal level by an unknown mechanism
(55). We propose that the R658H substitution in V-H1
revertants causes a subtle structural change that compensates for a
structural perturbation arising from the T46I substitution in the ATP
binding site.
The two heterozygous revertants showed similar, intermediate levels of
UV resistance, indicating that the XPDT46I/R658H
revertant protein competes effectively with the
XPDT46I protein for incorporation into TFIIH. To
begin to understand the mechanism underlying the suppressing R658H
substitution, the XPDR658H protein was
overexpressed at different levels in V-H1 cells and was also found to
compete effectively and produce more UV resistance at higher
levels of expression (Fig. 8). The intermediate UV sensitivity associated with the human R658H mutation (46) is
consistent with the intermediate sensitivity of the V-H1 transformants
overexpressing XPDR658H. We assume that this
mutation acts identically in hamster and human proteins because the
amino acid sequences are 99% identical.
Helicase domains and intragenic suppression.
Based on
sequence homology, five RNA/DNA helicase superfamilies were defined
(12, 13). Superfamily II contains the Rad3 family, to
which XPD belongs (23). Despite the overall weak similarity among the various families, conserved motifs have been defined (13, 14). The limited homology that does exist
across superfamilies is restricted to motifs I and II, which are
involved in nucleotide triphosphate binding (14).
However, these motifs are shared with other enzymes that hydrolyze
nucleotide triphosphates (referred to as Walker A and B motifs)
(63).
X-ray crystal structures for several helicases, including the PcrA and
Rep DNA helicases and the hepatitis C virus NS3 RNA helicase, are known
(22, 24, 40). Although the PcrA and Rep proteins belong to
superfamily I and the NS3 protein belongs to superfamily II, they are
structurally similar, implying the conservation of folds and
relationships among helicase motifs across these superfamilies
(14, 25). The tertiary structures of all three proteins
place the helicase motifs within two domains forming a cleft that
contains motifs I and II on one side and motif VI on the other. In each
structure, the GxGKT/S residues of motif I are responsible for
binding the
-phosphate of ATP, while the aspartic acid residue of
motif II binds Mg2+. These bonds help orient the
ATP-Mg2+ complex for hydrolysis. Upon binding
ATP, the gap between the cleft closes, positioning the arginine
residues of motif VI such that they interact with the phosphate groups
of ATP. Upon hydrolysis, protein translocation and DNA unwinding occur,
ADP is released, and the cleft opens, thus completing a reaction cycle
(39).
An intimate spatial relationship between residues
T46 and R658 in XPD is
suggested based on our reversion data and the general picture of
helicase structure gained from the crystal structures mentioned above.
We speculate that because residue T46 is
positioned between invariant residues of motif I
(GT46GKT), the T46I change may distort ATP
binding in such a way that the arginine residues of motif VI are unable
to interact properly with the phosphate groups of ATP to facilitate
hydrolysis. The normal R658 residue may influence
the position of the arginine residues of motif VI, since
R658 is positioned seven residues away from the
highly conserved Gly and Arg residues in this motif
(R658HAAQCVGRAIR). In suppressing the effect of
the T46I substitution, the R658H substitution may position the arginine
residues of motif VI in a conformation that improves the efficiency of
hydrolysis, albeit not to the normal rate.
To our knowledge, this study provides the first instance in which
intragenic suppressor mutations have been identified in a DNA helicase.
Reversion mutations in the yeast Prp28 RNA helicase identified several
putative motif interactions, including a remarkably analogous
suppression of T223I in motif I by a substitution in motif IV
(6). Thus, suppressor genetics may help determine helicase
structure and function by identifying interacting regions or motifs. It
is of particular interest to understand exactly how TTD mutations
such as R658H alter the structure of XPD to confer various degrees of
UV sensitivity.
 |
ACKNOWLEDGMENTS |
We thank Anita Avery for technical assistance.
This research was supported by NIH grant CA52679 and was performed
under the auspices of the U.S. Department of Energy at the University
of California, Lawrence Livermore National Laboratory, under
contract no. W-7405-Eng-48. Other support was provided by grants
GM32833 (to A.S.), EU-FIGH-CT1999-00010 (to M.Z.Z.), and Dutch Cancer
Society grant IKW 92-32 (to L.H.F.M.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: BBR Program,
L441, Lawrence Livermore National Laboratory, P.O. Box 808, Livermore, CA 94551-0808. Phone: (925) 422-5658. Fax: (925) 422-2099. E-mail: thompson14{at}llnl.gov.
Present address: Nonproliferation, Arms Control and International
Security Program, Lawrence Livermore National Laboratory, Livermore, CA 94551.
Present address: Genentech, Inc., South San Francisco, CA 94080.
 |
REFERENCES |
| 1.
|
Araujo, S. J., and R. D. Wood.
1999.
Protein complexes in nucleotide excision repair.
Mutat. Res.
435:23-33[Medline].
|
| 2.
|
Balajee, A. S.,
L. P. DeSantis,
R. M. Brosh Jr,
R. Selzer, and V. A. Bohr.
2000.
Role of the ATPase domain of the Cockayne syndrome group B protein in UV induced apoptosis.
Oncogene
19:477-489[CrossRef][Medline].
|
| 3.
|
Berneburg, M., and A. R. Lehmann.
2001.
Xeroderma pigmentosum and related disorders: defects in DNA repair and transcription.
Adv. Genet.
43:71-102[Medline].
|
| 4.
|
Bootsma, D., and J. H. Hoeijmakers.
1994.
The molecular basis of nucleotide excision repair syndromes.
Mutat. Res.
307:15-23[Medline].
|
| 5.
|
Bootsma, D.,
K. H. Kraemer,
J. E. Cleaver, and J. H. J. Hoeijmakers.
1998.
Nucleotide excision repair syndromes: xeroderma pigmentosum, Cockayne syndrome, and trichothiodystrophy, p. 245-274.
In
B. Vogelstein, and K. Kinzler (ed.), The genetic basis of human cancer. McGraw-Hill Book Co., New York, N.Y.
|
| 6.
|
Chang, T. H.,
L. J. Latus,
Z. Liu, and J. M. Abbott.
1997.
Genetic interactions of conserved regions in the DEAD-box protein Prp28p.
Nucleic Acids Res.
25:5033-5040[Abstract/Free Full Text].
|
| 7.
|
Coin, F.,
E. Bergmann,
A. Tremeau-Bravard, and J. M. Egly.
1999.
Mutations in XPB and XPD helicases found in xeroderma pigmentosum patients impair the transcription function of TFIIH.
EMBO J.
18:1357-1366[CrossRef][Medline].
|
| 8.
|
Coin, F.,
J. C. Marinoni,
C. Rodolfo,
S. Fribourg,
A. M. Pedrini, and J. M. Egly.
1998.
Mutations in the XPD helicase gene result in XP and TTD phenotypes, preventing interaction between XPD and the p44 subunit of TFIIH.
Nat. Genet.
20:184-188[CrossRef][Medline].
|
| 9.
|
de Laat, W. L.,
N. G. Jaspers, and J. H. Hoeijmakers.
1999.
Molecular mechanism of nucleotide excision repair.
Genes Dev.
13:768-785[Free Full Text].
|
| 10.
|
Evans, E.,
J. Fellows,
A. Coffer, and R. D. Wood.
1997.
Open complex formation around a lesion during nucleotide excision repair provides a structure for cleavage by human XPG protein.
EMBO J.
16:625-638[CrossRef][Medline].
|
| 11.
|
Evans, E.,
J. G. Moggs,
J. R. Hwang,
J. M. Egly, and R. D. Wood.
1997.
Mechanism of open complex and dual incision formation by human nucleotide excision repair factors.
EMBO J.
16:6559-6573[CrossRef][Medline].
|
| 12.
|
Gorbalenya, A. E., and E. V. Koonin.
1993.
Helicases: amino acid sequence comparisons and structure-function relationships.
Curr. Opin. Struct. Biol.
3:419-429.
|
| 13.
|
Gorbalenya, A. E.,
E. V. Koonin,
A. P. Donchenko, and V. M. Blinov.
1989.
Two related superfamilies of putative helicases involved in replication, recombination, repair and expression of DNA and RNA genomes.
Nucleic Acids Res.
17:4713-4730[Abstract/Free Full Text].
|
| 14.
|
Hall, M. C., and S. W. Matson.
1999.
Helicase motifs: the engine that powers DNA unwinding.
Mol. Microbiol.
34:867-877[CrossRef][Medline].
|
| 15.
|
Hoeijmakers, J. H. J.,
J. M. Egly, and W. Vermeulen.
1996.
TFIIH: a key component in multiple DNA transactions.
Curr. Opin. Genet. Dev.
6:26-33[CrossRef][Medline].
|
| 16.
|
Holstege, F. C. P.,
P. C. van der Vliet, and H. T. M. Timmers.
1996.
Opening of an RNA polymerase II promoter occurs in two distinct steps and requires the basal transcription factors IIE and IIH.
EMBO J.
15:1666-1677[Medline].
|
| 17.
|
Huang, J. C.,
D. S. Hsu,
A. Kazantsev, and A. Sancar.
1994.
Substrate spectrum of human excinuclease: repair of abasic sites, methylated bases, mismatches, and bulky adducts.
Proc. Natl. Acad. Sci. USA
91:12213-12217[Abstract/Free Full Text].
|
| 18.
|
Johnson, R. T., and S. Squires.
1992.
The XPD complementation group. Insights into xeroderma pigmentosum, Cockayne's syndrome and trichothiodystrophy.
Mutat. Res.
273:97-118[CrossRef][Medline].
|
| 19.
|
Kadkhodayan, S.,
F. Coin,
E. Salazar,
J. George,
J. Egly, and L. Thompson.
2001.
Codominance associated with overexpression of certain XPD mutations.
Mutat. Res.
485:153-168[Medline].
|
| 20.
|
Kadkhodayan, S.,
E. P. Salazar,
J. E. Lamerdin, and C. A. Weber.
1996.
Construction of a functional cDNA clone of the hamster ERCC2 DNA repair and transcription gene.
Somat. Cell Mol. Genet.
22:453-460[CrossRef][Medline].
|
| 21.
|
Kadkhodayan, S.,
E. P. Salazar,
M. J. Ramsey,
K. Takayama,
J. D. Tucker,
M. Z. Zdzienicka, and C. A. Weber.
1997.
Molecular analysis of ERCC2 mutations in the repair deficient hamster mutant UVL-1 and V-H1.
Mutat. Res.
385:47-57[Medline].
|
| 22.
|
Kim, J. L.,
K. A. Morgenstern,
J. P. Griffith,
M. D. Dwyer,
J. A. Thomson,
M. A. Murcko,
C. Lin, and P. R. Caron.
1998.
Hepatitis C virus NS3 RNA helicase domain with a bound oligonucleotide: the crystal structure provides insights into the mode of unwinding.
Structure
6:89-100[Medline].
|
| 23.
|
Koonin, E. V.
1993.
Escherichia coli dinG gene encodes a putative DNA helicase related to a group of eukaryotic helicases including Rad3 protein.
Nucleic Acids Res.
21:1497[Free Full Text].
|
| 24.
|
Korolev, S.,
J. Hsieh,
G. H. Gauss,
T. M. Lohman, and G. Waksman.
1997.
Major domain swiveling revealed by the crystal structures of complexes of E. coli Rep helicase bound to single-stranded DNA and ADP.
Cell
90:635-647[CrossRef][Medline].
|
| 25.
|
Korolev, S.,
N. Yao,
T. M. Lohman,
P. C. Weber, and G. Waksman.
1998.
Comparisons between the structures of HCV and Rep helicases reveal structural similarities between SF1 and SF2 super-families of helicases.
Protein Sci.
7:605-610[Abstract].
|
| 26.
|
Le Page, F.,
E. E. Kwoh,
A. Avrutskaya,
A. Gentil,
S. A. Leadon,
A. Sarasin, and P. K. Cooper.
2000.
Transcription-coupled repair of 8-oxoguanine: requirement for XPG, TFIIH, and CSB and implications for Cockayne syndrome.
Cell
101:159-171[CrossRef][Medline].
|
| 27.
|
Ljungman, M., and F. Zhang.
1996.
Blockage of RNA polymerase as a possible trigger for u.v. light-induced apoptosis.
Oncogene
13:823-831[Medline].
|
| 28.
|
Ma, L.,
E. D. Siemssen,
H. M. Noteborn, and A. J. van der Eb.
1994.
The xeroderma pigmentosum group B protein ERCC3 produced in the baculovirus system exhibits DNA helicase activity.
Nucleic Acids Res.
22:4095-4102[Abstract/Free Full Text].
|
| 29.
|
Manley, J. L.,
A. Fire,
A. Cano,
P. A. Sharp, and M. L. Gefter.
1980.
DNA-dependent transcription of adenovirus genes in a soluble whole-cell extract.
Proc. Natl. Acad. Sci. USA
77:3855-3859[Abstract/Free Full Text].
|
| 30.
|
Mellon, I.,
G. Spivak, and P. C. Hanawalt.
1987.
Selective removal of transcription-blocking DNA damage from the transcribed strand of the mammalian DHFR gene.
Cell
51:241-249[CrossRef][Medline].
|
| 31.
|
Mitchell, D. L.,
M. Z. Zdzienicka,
D. van Zeeland, and R. S. Nairn.
1989.
Intermediate (6-4) photoproduct repair in Chinese hamster V79 mutant V-H1 correlates with intermediate levels of DNA incision and repair replication.
Mutat. Res.
226:43-47[CrossRef][Medline].
|
| 32.
|
Moreland, R. J.,
F. Tirode,
Q. Yan,
J. W. Conaway,
J. M. Egly, and R. C. Conaway.
1999.
A role for the TFIIH XPB DNA helicase in promoter escape by RNA polymerase II.
J. Biol. Chem.
274:22127-22130[Abstract/Free Full Text].
|
| 33.
|
Mu, D.,
C. H. Park,
T. Matsunaga,
D. S. Hsu,
J. T. Reardon, and A. Sancar.
1995.
Reconstitution of human DNA repair excision nuclease in a highly defined system.
J. Biol. Chem.
270:2415-2418[Abstract/Free Full Text].
|
| 34.
|
Mu, D.,
M. Wakasugi,
D. S. Hsu, and A. Sancar.
1997.
Characterization of reaction intermediates of human excision repair nuclease.
J. Biol. Chem.
272:28971-28979[Abstract/Free Full Text].
|
| 35.
|
O'Donovan, A.,
A. A. Davies,
J. G. Moggs,
S. C. West, and R. D. Wood.
1994.
XPG endonuclease makes the 3' incision in human DNA nucleotide excision repair.
Nature
371:432-435[CrossRef][Medline].
|
| 36.
|
Ruven, H. J.,
C. M. Seelen,
P. H. Lohman,
H. van Kranen,
A. A. van Zeeland, and L. H. Mullenders.
1994.
Strand-specific removal of cyclobutane pyrimidine dimers from the p53 gene in the epidermis of UVB-irradiated hairless mice.
Oncogene
9:3427-3432[Medline].
|
| 37.
|
Sancar, A.
1996.
DNA excision repair.
Annu. Rev. Biochem.
65:43-81[CrossRef][Medline].
|
| 38.
|
Sijbers, A. M.,
W. L. de Laat,
R. R. Ariza,
M. Biggerstaff,
Y. F. Wei,
J. G. Moggs,
K. C. Carter,
B. K. Shell,
E. Evans,
M. C. de Jong,
S. Rademakers,
J. de Rooij,
N. G. J. Jaspers,
J. H. J. Hoeijmakers, and R. D. Wood.
1996.
Xeroderma pigmentosum group F caused by a defect in a structure-specific DNA repair endonuclease.
Cell
86:811-822[CrossRef][Medline].
|
| 39.
|
Soultanas, P., and D. B. Wigley.
2000.
DNA helicases: `inching forward'.
Curr. Opin. Struct. Biol.
10:124-128[CrossRef][Medline].
|
| 40.
|
Subramanya, H. S.,
L. E. Bird,
J. A. Brannigan, and D. B. Wigley.
1996.
Crystal structure of a DExx box DNA helicase.
Nature
384:379-383[CrossRef][Medline].
|
| 41.
|
Sugasawa, K.,
J. M. Ng,
C. Masutani,
S. P. Iwai,
J. van der Spek,
A. P. Eker,
F. Hanaoka,
D. Bootsma, and J. H. Hoeijmakers.
1998.
Xeroderma pigmentosum group C protein complex is the initiator of global genome nucleotide excision repair.
Mol. Cell
2:223-232[CrossRef][Medline].
|
| 42.
|
Sung, P.,
S. N. Guzder,
L. Prakash, and S. Prakash.
1996.
Reconstitution of TFIIH and requirement of its DNA helicase subunits, Rad3 and Rad25, in the incision step of nucleotide excision repair.
J. Biol. Chem.
271:10821-10826[Abstract/Free Full Text].
|
| 43.
|
Sung, P.,
D. Higgins,
L. Prakash, and S. Prakash.
1988.
Mutation of lysine-48 to arginine in the yeast RAD3 protein abolishes its ATPase and DNA helicase activities but not the ability to bind ATP.
EMBO J.
7:3263-3269[Medline].
|
| 44.
|
Tagder, K., and W. Scheuermann.
1970.
Estimation of absorbed doses in the cell nucleus after incorporation of 3H- or 14C-labeled thymidine.
Radiat. Res.
41:202-216[Medline].
|
| 45.
|
Takayama, K.,
E. P. Salazar,
B. C. Broughton,
A. R. Lehmann,
A. Sarasin,
L. H. Thompson, and C. A. Weber.
1996.
Defects in the DNA repair and transcription gene ERCC2 (XPD) in trichothiodistrophy.
Am. J. Hum. Genet.
58:263-270[Medline].
|
| 46.
|
Taylor, E. M.,
B. C. Broughton,
E. Botta,
M. Stefanini,
A. Sarasin,
N. G. J. Jaspers,
H. Fawcett,
S. A. Harcourt,
C. F. Arlett, and A. R. Lehmann.
1997.
Xeroderma pigmentosum and trichothiodystrophy are associated with different mutations in the XPD (ERCC2) repair/transcription gene.
Proc. Natl. Acad. Sci. USA
94:8658-8663[Abstract/Free Full Text].
|
| 47.
|
Thacker, J.
1981.
The chromosomes of a V79 Chinese hamster line and a mutant subline lacking HPRT activity.
Cytogenet. Cell Genet.
29:16-25[Medline].
|
| 48.
|
Thompson, L. H.
1998.
Nucleotide excision repair: its relation to human disease, p. 335-393.
In
J. Nickoloff, and M. Hoekstra (ed.), DNA damage and repair, vol. 2. DNA repair in higher eukaryotes. Humana Press, Totowa, N.J.
|
| 49.
|
Thompson, L. H.,
S. Fong, and K. Brookman.
1980.
Validation of conditions for efficient detection of HPRT and APRT mutations in suspension-cultured Chinese hamster cells.
Mutat. Res.
74:21-36[CrossRef][Medline].
|
| 50.
|
Thompson, L. H.,
D. L. Mitchell,
J. D. Regan,
S. D. Bouffler,
S. A. Stewart,
W. L. Carrier,
R. S. Nairn, and R. T. Johnson.
1989.
CHO mutant UV61 removes (6-4) photoproducts but not cyclobutane dimers.
Mutagenesis
4:140-146[Abstract/Free Full Text].
|
| 51.
|
Tirode, F.,
D. Busso,
F. Coin, and J. M. Egly.
1999.
Reconstitution of the transcription factor TFIIH: assignment of functions for the three enzymatic subunits, XPB, XPD, and cdk7.
Mol. Cell
3:87-95[CrossRef][Medline].
|
| 52.
|
van Hoffen, A.,
W. H. Kalle,
A. de Jong-Versteeg,
A. R. Lehmann,
A. A. van Zeeland, and L. H. Mullenders.
1999.
Cells from XP-D and XP-D-CS patients exhibit equally inefficient repair of UV-induced damage in transcribed genes but different capacity to recover UV-inhibited transcription.
Nucleic Acids Res.
27:2898-2904[Abstract/Free Full Text].
|
| 53.
|
van Hoffen, A.,
J. Venema,
R. Meschini,
A. A. van Zeeland, and L. H. Mullenders.
1995.
Transcription-coupled repair removes both cyclobutane pyrimidine dimers and 6-4 photoproducts with equal efficiency and in a sequential way from transcribed DNA in xeroderma pigmentosum group C fibroblasts.
EMBO J.
14:360-367[Medline].
|
| 54.
|
van Oosterwijk, M. F.,
A. Versteeg,
R. Filon,
A. A. van Zeeland, and L. H. Mullenders.
1996.
The sensitivity of Cockayne's syndrome cells to DNA-damaging agents is not due to defective transcription-coupled repair of active genes.
Mol. Cell. Biol.
16:4436-4444[Abstract].
|
| 55.
|
Vermeulen, W.,
E. Bergmann,
J. Auriol,
S. Rademakers,
P. Frit,
E. Appeldoorn,
J. H. Hoeijmakers, and J. M. Egly.
2000.
Sublimiting concentration of TFIIH transcription/DNA repair factor causes TTD-A trichothiodystrophy disorder.
Nat. Genet.
26:307-313[CrossRef][Medline].
|
| 56.
|
Vermeulen, W.,
S. Rademakers,
N. G. Jaspers,
E. Appeldoorn,
A. Raams,
B. Klein,
W. J. Kleijer,
L. K. Hansen, and J. H. Hoeijmakers.
2001.
A temperature-sensitive disorder in basal transcription and DNA repair in humans.
Nat. Genet.
27:299-303[CrossRef][Medline].
|
| 57.
|
Vermeulen, W.,
A. J. van Vuuren,
M. Chipoulet,
L. Schaeffer,
E. Appeldoorn,
G. Weeda,
N. G. J. Jaspers,
A. Priestley,
C. F. Arlett,
A. R. Lehmann,
M. Stefanini,
M. Mezzina,
A. Sarasin,
D. Bootsma,
J.-M. Egly, and J. H. J. Hoeijmakers.
1994.
Three unusual repair deficiencies associated with transcription factor BTF2(TFIIH). Evidence for the existence of a transcription syndrome.
Cold Spring Harbor Symp. Quant. Biol.
59:317-329[Medline].
|
| 58.
|
Vreeswijk, M. P.,
M. W. Overkamp,
B. E. Westland,
S. van Hees-Stuivenberg,
H. Vrieling,
M. Z. Zdzienicka,
A. A. van Zeeland, and L. H. Mullenders.
1998.
Enhanced UV-induced mutagenesis in the UV61 cell line, the Chinese hamster homologue of Cockayne's syndrome B, is associated with defective transcription coupled repair of cyclobutane pyrimidine dimers.
Mutat. Res.
409:49-56[Medline].
|
| 59.
|
Vreeswijk, M. P.,
A. van Hoffen,
B. E. Westland,
H. Vrieling,
A. A. van Zeeland, and L. H. Mullenders.
1994.
Analysis of repair of cyclobutane pyrimidine dimers and pyrimidine 6-4 pyrimidone photoproducts in transcr |