Previous Article | Next Article 
Molecular and Cellular Biology, November 2001, p. 7429-7441, Vol. 21, No. 21
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.21.7429-7441.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Downregulation of the Ras-Mitogen-Activated
Protein Kinase Pathway by the EphB2 Receptor Tyrosine Kinase Is
Required for Ephrin-Induced Neurite Retraction
Sabine
Elowe,1,2
Sacha J.
Holland,1,
Sarang
Kulkarni,1 and
Tony
Pawson1,2,*
Samuel Lunenfeld Research Institute, Mount
Sinai Hospital, Toronto, Ontario M5G 1X5,1 and
Department of Molecular and Medical Genetics, University of
Toronto, Toronto, Ontario M5G 1A8,2 Canada
Received 2 May 2001/Returned for modification 24 May 2001/Accepted 24 July 2001
 |
ABSTRACT |
Activation of the EphB2 receptor tyrosine kinase by clustered
ephrin-B1 induces growth cone collapse and neurite retraction in
differentiated NG108 neuronal cells. We have investigated the cytoplasmic signaling events associated with EphB2-induced cytoskeletal reorganization in these neuronal cells. We find that unlike other receptor tyrosine kinases, EphB2 induces a pronounced downregulation of
GTP-bound Ras and consequently of the extracellular signal-regulated kinase (ERK) mitogen-activated protein kinase (MAPK) pathway. A similar
inhibition of the Ras-MAPK pathway was observed on stimulation of
endogenous EphB2 in COS-1 cells. Inactivation of Ras, induced by ephrin
B1 stimulation of NG108 neuronal cells, requires EphB2 tyrosine kinase
activity and is blocked by a truncated form of p120-Ras
GTPase-activating protein (p120-RasGAP), suggesting that EphB2 signals
through the SH2 domain protein p120-RasGAP to inhibit the Ras-MAPK
pathway. Suppression of Ras activity appears functionally important,
since expression of a constitutively active variant of Ras impaired the
ability of EphB2 to induce neurite retraction. In addition, EphB2
attenuated the elevation in ERK activation induced by attachment of
NG108 cells to fibronectin, indicating that the EphB2 receptor can
modulate integrin signaling to the Ras GTPase. These results suggest
that a primary function of EphB2, a member of the most populous family
of receptor tyrosine kinases, is to inactivate the Ras-MAPK pathway in
a fashion that contributes to cytoskeletal reorganization and adhesion
responses in neuronal growth cones.
 |
INTRODUCTION |
External signals that control
cellular behavior in metazoan organisms are often transduced at the
cell surface by receptor tyrosine kinases (RTKs). Eph receptors
comprise the largest family of mammalian RTKs, with 14 members. The
family has apparently undergone a striking expansion during the
evolution of multicellular animals, since only a single Eph receptor
has been identified in Caenorhabditis elegans
(30) or Drosophila (65),
suggesting that these receptors might be involved in controlling
complex cellular interactions. The ligands for Eph receptors, termed
ephrins, are themselves anchored to the plasma membrane, either via a
glycosylphosphatidylinositol linkage (A class) or through a
transmembrane sequence (B class) (21, 28, 39).
Consequently, signaling generally requires direct contact between
ephrin- and Eph receptor-expressing cells. The Eph receptors are also
classified into A and B groups on the basis of sequence homology and
ephrin-binding ability (27). Although the binding of
receptors to ephrins is generally nonselective within a given class,
different combinations of receptors and ligands interact with distinct
affinities, while EphA4 can bind both classes of ephrins
(28).
In C. elegans, the VAB-1 Eph receptor and corresponding
ephrins regulate a series of morphogenetic cell movements important for
development (14, 30, 72). In mammals, Eph receptors and
ephrins are expressed in reciprocal compartments of the
developing embryo (28, 33) and are important for axon
guidance and topographic map formation in the central nervous system
(7, 19, 25, 34, 74), neural crest cell migration
(18), patterning of the hindbrain and paraxial mesoderm
(28), and vascular network assembly (1, 29, 31,
71). For both invertebrates and vertebrates, there are data to
suggest that Eph receptors have both kinase-dependent and
kinase-independent functions, with the latter potentially reflecting
either an ability of Eph-ephrin interactions to mediate cell adhesion
or an intrinsic ephrin-signaling activity (13, 22, 23,
37).
In the guidance of axons in the nervous system, and in cell migrations,
ephrin-Eph receptor signaling commonly has a repulsive effect on cell
movement (11, 53, 54, 57). In vitro, the activation of Eph
receptors in neuronal cells induces deadhesive responses and collapse
of neural growth cones (6), correlating with axon and
neural crest cell repulsion from ephrins displayed on cells or isolated
membranes (53, 54). Although ephrins and Eph receptors
clearly activate repellant responses in many cells, there is increasing
evidence that specific ligand-receptor pairs can also initiate an
attractive response in some cell types, for example by eliciting
endothelial cell sprouting (1), increased cellular
adhesion (8, 22, 23, 41), neural tube closure (40), and projection of vomeronasal axons
(47). This resembles the ability of several other guidance
molecules to induce either attraction or repulsion (56).
The intracellular signaling pathways that mediate the biological
effects of Eph receptors and ephrins are only starting to emerge.
Activated receptors become autophosphorylated at multiple sites,
including two absolutely conserved tyrosine residues in the
juxtamembrane region and a tyrosine within the activation segment of
the kinase domain (6, 44). Interestingly, prior to
phosphorylation, the juxtamembrane tyrosines (Y604 and Y610 in EphB2)
repress receptor kinase activity, but following phosphorylation they
are released to serve as docking sites for SH2 domain proteins (6). RTKs commonly signal through cytoplasmic proteins
with SH2 domains, which bind either directly to phosphotyrosine (pTyr) sites on the activated receptor or to phosphorylated docking proteins. Both mechanisms may be used by Eph receptors. A variety of SH2 proteins
have been identified as potential Eph receptor-binding partners,
including the Fyn and Src tyrosine kinases (15, 26, 35,
75), the p120-Ras GTPase-activating protein (p120-RasGAP) (see
interaction ID:123 at www.BIND.ca [35, 38]), the Nck and
Crk adaptors (35, 69), SHEP1 (24), the
Ras-binding protein AF6 (36), and the Src-like adaptor
protein SLAP (58). Which of these targets are relevant to
the biological functions of Eph receptors remain uncertain. In
addition, we and others have found that activated Eph receptors
preferentially phosphorylate the p62dok-1 docking protein in neuronal
and endothelial cells (4, 38). p62dok-1 has an N-terminal
pleckstrin homology (PH) domain followed by a
phosphotyrosine-binding (PTB) domain and multiple tyrosine
phosphorylation sites which engage the SH2 domains of p120-RasGAP and
Nck (73). In NG108 neuronal cells expressing EphB2 and
stimulated with clustered ephrin-B1, p62dok-1 is the most prominently
tyrosine-phosphorylated protein other than the receptor itself
(38).
The Ras-mitogen-activated protein kinase (MAPK) pathway is commonly
activated by RTKs, and indeed is viewed as a hallmark of RTK signaling
(16). Autophosphorylation of RTKs such as the epidermal
growth factor, platelet-derived growth factor (PDGF), or insulin
receptors leads to the recruitment (either directly or indirectly) of
the Grb2-Sos1 complex, which in turn induces the exchange of GDP for
GTP on Ras proteins, and the association of Ras with the Raf
serine/threonine protein kinase (59). Raf phosphorylates
the dual-specificity protein kinases MEK1 and MEK2, which
consequently activate the MAPKs extracellular signal-related kinases 1 and 2 (ERK1/2). This core biochemical pathway is regulated by many
different signals in numerous cell types, raising the issue of how such
a widespread signaling pathway generates distinct biological responses
in different cells or following stimulation by different ligands. In
metazoans, each cell is simultaneously exposed to multiple
extracellular signals and must integrate these inputs to initiate the
appropriate outcome. The combined nature of these external signals,
together with regulators expressed within the target cell, may
therefore determine the extent and duration of Ras-MAPK activation,
which in turn can determine how the cell responds (51).
Unlike other RTKs, Eph receptors appear inefficient at stimulating cell
proliferation in fibroblasts or epithelial cells (10, 12),
and the role of MAPK signaling downstream of activated Eph receptors
remains unclear. Here, we show that EphB2 tyrosine kinase activity down
regulates Ras and ERK1/2 MAPKs in a neuronal cell culture system. Our
data suggest that p120-RasGAP contributes to Ras inhibition by Eph
receptors and indicate that Ras activation interferes with neurite
retraction induced by ephrin-B1.
 |
MATERIALS AND METHODS |
EphB2 constructs, mutagenesis, and reagents.
Full-length
murine EphB2 cDNA was cloned into the mammalian expression vector
pcDNA3 (Invitrogen) as previously described (38).
Mutations and truncations in EphB2 were made using PCR-based site-directed mutagenesis. For juxtamembrane mutations, a
BglII fragment encompassing the tyrosine residues was
replaced with the identical fragment with tyrosines 604 (JX1) and 610 (JX2) mutated either singly to phenylalanine or together to
phenylalanine or glutamate. EphB2-
C was synthesized by mutation of
V952 in the SAM domain to a stop codon. The presence of the
mutations was confirmed by sequence analysis. The YFP-Actin cDNA
(Clontech) was cloned into the retroviral PMX-Puro vector
(60). For cloning, the entire coding region was amplified
by PCR with EcoRI sites flanking the start and stop codons.
The 5'-primer CCCGAATTCGCTAGCGCTACCGGTCGCCACCATG and the
3'-primer CCCGAATTCCTTAAGATACATTGATGAGTTTGGAC were used. Cloning of a truncated p120-RasGAP encoding the N-terminal hydrophobic region and including the SH2-SH3-SH2 domains (GAP-N) was previously described (52). pcDNA3-HA-RasV12 used in live
imaging of cells was a kind gift of A. Guha. PDGF-BB was purchased from
PeproTech Inc.
Cell culture and EphR stimulation.
Rat2 cells were
maintained in Dulbeco's modified Eagle's medium (DMEM) containing
10% fetal bovine serum (FBS) (Sigma). NG108-15 (NG108) cells were
routinely cultured in DMEM containing 10% FBS and 1x
hypoxanthine-aminopterin-thymidine (HAT) (Gibco). Stable cell lines in
NG108 cells were produced as previously described (38).
Briefly, parental NG108 cells were transfected with 10 µg of cDNA
using Lipofectin reagent and OptiMEM medium (Gibco) as specified by the
manufacturer. Cells were then grown in the presence of 400 µg of G418
(Gibco) per ml to select stable transfectants. Transient transfections
into these cell lines were performed using Lipofectin or ExGEN 500 (MBI
Fermentas) reagents. Stimulation of EphB2 expressing cells was carried
out as previously described (38) with 2 µg of aggregated
Fc-ephrin-B1 per ml unless otherwise indicated. For ERK and MEK
activation experiments, NG-EphB2 cells were seeded into six-well plates
24 h prior to stimulation at 3 × 105 cells/well.
Immunoprecipitation and Western blotting.
Unless otherwise
indicated, cells were serum starved overnight in DMEM containing 1X
HAT. For ERK, MEK, and antiphosphotyrosine (anti-pTyr) Western blots,
cells were stimulated with Fc-ephrin-B1 as indicated and lysed directly
in 2× sodium dodecyl sulfate (SDS) loading buffer. For
immunoprecipitation experiments, cells were washed twice in
phosphate-buffered saline (PBS) and lysed as previously described (38). Protein levels were equalized using a
bicinchoninic acid protein assay kit (Pierce), and the proteins were
immunoprecipitated as indicated. They were separated by
SDS-polyacrylamide gel electrophoresis (SDS-PAGE), transferred to a
polyvinylidene difluoride membrane (Millipore), and blotted with the
appropriate antibodies. Antibodies against EphB2 have been previously
described (33). Phospho-ERK1/2 and phospho-MEK1 antibodies
were purchased from Cell Signaling Technologies, and Grb2 antibodies
were purchased from Transduction Laboratories. All other antibodies
were from Santa Cruz. Immunoblots were visualized using a linear
enhanced chemiluminescence (ECL) substrate (ECL Plus; Amersham) as
specified by the manufacturer. All blots were exposed to either X-Omat
imaging film (Kodak) or Fluor-S MultiImager and visualized using
QuantityOne software (Bio-Rad).
Assay for activated Ras.
The Ras-binding domain of c-Raf
(Raf-RBD) is thought to have a high affinity for GTP-bound Ras, and has
been used as a probe for activated Ras (61). After
treatment with clustered ephrin-B1 ligand, the cells were washed twice
with HEPES-buffered saline (HBS) (25 mM HEPES [pH 7.5], 150 mM NaCl),
and lysates were prepared in p21Ras lysis buffer (PLB) (25 mM HEPES
[pH 7.5], 150 mM NaCl, 1% NP-40, 1 mM EDTA, 10% glycerol, 25 mM
NaF, 10 mM MgCl2, 1 mM sodium vanadate, 10 µg of
leupeptin per ml, 10 µg of aprotinin per ml, 0.1 mM
phenylmethylsulfonyl fluoride). Total-cell lysates were equalized for
protein content and were incubated with 20 µg of purified glutathione
S-transferase (GST)-Raf-RBD on glutathione beads
(Pharmacia) for 60 minutes. Samples were resolved by SDS-PAGE and
immunoblotted with anti-Ras antibodies (Quality Biotech) as indicated above.
Neurite retraction assays.
NG-EphB2 cells were transfected
as indicated 56 h prior to the retraction assay. YFP-Actin-expressing
cells were plated onto DeltaT3 dishes (Bioptechs) and mounted on a
temperature-controlled stage adaptor. The temperature was maintained at
37°C, and the cells were imaged using an inverted Olympus IX-70
fluorescence microscope equipped with Deltavision deconvolution
software (Applied Precision). For neurite retraction assays, ligand was
added to the culture medium and the cells were immediately imaged every 30 s for 40 min.
 |
RESULTS |
Kinase activity of EphB2 downregulates ERK1/2 and MEK1
phosphorylation.
To investigate the role of Eph RTKs in regulating
the MAPK pathway in a neuronal cell type, we have used a derivative of
the NG108-15 (NG108) cell line stably expressing wild-type EphB2
(NG-EphB2) (6, 38). The parental NG108 cells do not
express detectable Eph receptors and do not respond to ephrin-B1
stimulation. In contrast, although neurite outgrowth is induced
normally in the NG-EphB2 cells by cyclic AMP, ephrin-B1 induces neurite
retraction of these cells in a fashion that depends on EphB2 kinase
activity (6). Ephrin-B1 stimulation of NG-EphB2 cells
leads to a rapid increase in the tyrosine phosphorylation of EphB2 and
a number of cellular proteins, most notably p62dok-1 (6,
38). Growing or serum-starved NG108 parental and NG-EphB2 cells
were stimulated with clustered Fc-ephrin-B1 ligand for different times
ranging from 2 to 60 min, and total-cell proteins were assayed for
activated ERK and MEK using antibodies directed against the
phosphorylated, activated forms of these kinases. Both growing (in 10%
FBS) and serum-starved NG-EphB2 cells exhibited a marked decrease in
activated, phospho-ERK1/2 (Fig. 1A, upper
panel), as well as activated, phospho-MEK1 (Fig. 1B, upper panel),
although the absolute levels of these proteins did not decrease
significantly (Fig. 1A and B, lower panels). In contrast, stimulation
of parental NG108 cells with ephrin-B1 showed no appreciable difference
in phospho-ERK1/2 or phospho-MEK1 levels compared to total protein
levels. Furthermore, the decrease in the phosphorylated forms of both
MEK and ERK was more pronounced and occurred for a longer duration
under serum-starved conditions (Fig. 1C). This is most probably due to
the presence of compensating mitogenic factors in serum, since we found
significantly elevated levels of tyrosine phosphorylated EphB2 up to 60 min after ephrin-B1 stimulation in the presence or absence of serum (Fig. 1D).


View larger version (67K):
[in this window]
[in a new window]
|
FIG. 1.
Ephrin-B1 stimulation of EphB2 leads to the down
regulation of the ERK1/2 MAPK signaling pathway. (A and B)
Serum-starved (right panels) or growing (10% FBS) (left panels)
parental NG108 or NG-EphB2 cells were stimulated with 2 µg of
clustered Fc-ephrin-B1 per ml for the indicated time points and lysed
directly in 2x SDS-PAGE sample buffer. The lysates were electrophoresed
and blotted (WB) with antibodies against phosphorylated ERK1/2 (A, top
panels), or phosphorylated MEK1 (B, top panels). The blots were
stripped and reprobed for total ERK1 or MEK1 (bottom panels, A and B,
respectively). (C) Graphical representation of phospho-ERK1/2 and
phospho -MEK1 from panels A and B relative to total levels. (D) Time
course of EphB2 tyrosine phosphorylation in NG108 cells. NG108 cells
were serum starved (lanes serum) or grown in the presence of serum
(lanes +serum) and stimulated with 2 µg of clustered Fc-ephrin-B1 per
ml as indicated. Immunoprecipitated (IP) EphB2 was then resolved by
SDS-PAGE and probed with anti-pTyr antibodies (upper panel). Blots were
subsequently stripped and reprobed with crude anti-EphB2 sera (lower
panel).
|
|
Unlike NG108 cells, COS-1 cells express endogenous EphB2, which becomes
phosphorylated on tyrosine residues subsequent to
stimulation with
clustered Fc-ephrin-B1 (Fig.
2A). In
agreement
with the observations made in NG-EphB2 cells, stimulation of
COS-1
cells with clustered ephrin-B1 led to a time-dependent decrease
in ERK phosphorylation in cells that had been serum starved (Fig.
2B,
left panels), as well as in cells grown in the presence of
10% FBS
(Fig.
2B, right panels). In contrast, treatment with clustered
Fc alone
did not significantly alter the ERK1/2 phosphorylation
status in COS 1 cells (Fig.
2B, lanes 1 to 4 and 9 to 12). These
results indicate that
activation of the EphB2 RTK in two distinct
cell types of neuronal and
epithelial origin induces downregulation
in ERK phosphorylation.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 2.
Ephrin-B1 stimulation of COS-1 cells leads to tyrosine
phosphorylation of endogenous EphB2 and down regulation of ERK1/2
phosphorylation. (A) COS-1 cells were serum starved for 14 h and
were either left untreated (lane C) or stimulated with 8 µg of
clustered human Fc (lanes Fc) or Fc-ephrin-B1 (lanes Ephrin-B1) per ml.
The cells were subsequently washed twice with PBS and lysed in PLC
buffer as indicated in Materials and Methods. Lysates equalized for
protein concentration were subjected to immunoprecipitation (IP) with
anti-EphB2 antibodies, and immunoprecipitates were subsequently
separated by SDS-PAGE and blotted with anti-pTyr antibodies (upper
panel). The membranes were then stripped and reprobed with anti-EphB2
antibodies (bottom panel). (B) Serum-starved (left panels) and growing
(right panels) COS-1 cells were challenged for the indicated time with
8 µg/ml clustered Fc or Fc-ephrin-B1 and subsequently lysed and
immunoblotted (WB) with anti-phospho-ERK1/2 antibodies as indicated in
Fig. 1. The membranes were then stripped and reprobed with anti-ERK1
antibodies (B, bottom panels).
|
|
To investigate the features of EphB2 that are important for the
downregulation of ERK signaling, we constructed stable NG108
cell lines
expressing EphB2 with truncations or mutations in specific
residues
(Fig.
3A). Several
protein interaction motifs are conserved
among Eph family receptors and
have been implicated in the downstream
signaling (
39). The
juxtamembrane tyrosines 604 and 610 (JX1
and JX2, respectively, in Fig.
3A) regulate kinase activity (
6)
and serve as docking
sites for SH2 domains once phosphorylated,
whereas the C-terminal SAM
domain is implicated in receptor oligomerization
(
67,
70)
but may also serve a docking function through phosphorylation
of
Y
929 (
69). The EphB2-

C construct ends at
V
951 in the SAM
domain, effectively eliminating this
domain, as well as the C-terminal
PDZ domain-binding site. Similar to
wild-type (WT) EphB2, stimulation
of NG108 cells expressing EphB2-

C
or EphB2-Y
929F caused a rapid
decrease in the levels of
phosphorylated ERK1/2 and MEK1, which
could be detected within 2 min
(Fig.
3B and C). These observations
suggest that neither a functional
SAM domain nor the C-terminal
PDZ domain-binding motif are required for
the decrease in EphB2
stimulated MAPK signaling, and, indeed, the
C-terminal region
of EphB2 is not required for neurite retraction (S. Holland and
T. Pawson, unpublished results). In contrast, replacement
of either
of the two conserved juxtamembrane tyrosines with
phenylalanine,
which impairs kinase activity and neurite retraction,
resulted
in a smaller decrease in ERK1/2 and MEK1 phosphorylation
following
ephrin-B1 challenge than that of WT EphB2. In particular, the
rate of EphB2-Y
JX2F-induced down regulation of ERK1/2
phosphorylation
was significantly lower in comparison to WT EphB2 (Fig.
3B, upper
panel, compare lanes 5 and 6 with lanes 14 and 15). The
double
substitution of EphB2-Y
JX1,2F effectively eliminated
the decrease
in phosphorylated ERK1/2 (Fig.
3B, upper panel,
compare lanes
8 and 9 with lanes 5 and 6) after stimulation with
ephrin-B1 ligand,
consistent with the observation that this double
substitution
abrogates ephrin-B1-induced kinase activity and NG108
neurite
retraction (
6). Similarly, ephrin-B1 treatment of
cells expressing
a mutant EphB2 rendered kinase inactive through a
mutation in
the catalytic domain (EphB2-KD, substitution at Lys 611 to
Met)
induced no appreciable decline in phospho-ERK levels (Fig.
3D).
Together, these results indicate that activation of EphB2 in the
NG108
cells attenuates the phosphorylation and thus the activation
of the
MEK1 and ERK1/2 kinases and show that this inhibition of
the MAPK
signaling pathway requires EphB2 kinase activity.


View larger version (70K):
[in this window]
[in a new window]
|
FIG. 3.
Kinase activity of EphB2 is required for down regulation
of ERK1/2 signaling. (A) Schematic representation of the EphB2 mutant
structures, indicating juxtamembrane tyrosines JX1 (Y604),
JX2 (Y610) and the conserved SAM domain tyrosine
(Y929). (B and C) EphB2- C, a C-terminal truncation, ends
at V951 in the SAM domain. NG108 or NG-EphB2 clones
expressing WT or mutant receptors were stimulated with 2 µg of
clustered Fc-ephrin-B1 per ml for the indicated time points. The cells
were harvested directly in 2× SDS sample buffer, and lysates were
electrophoresed and immunoblotted (WB) with antibodies against
phosphorylated ERK1/2 (B, top panel) or phosphorylated MEK1 (C, top
panel). Immunoblots were stripped and reprobed with anti-ERK1 (B,
bottom panel) or anti-MEK1 (C, bottom panel). (D) NG108 cells
expressing WT EphB2 and kinase-inactive EphB2 (KD) were stimulated with
clustered Fc-ephrin-B1 and treated as indicated for panels B and C. Lysates were then probed with anti-phospho-ERK1/2 (upper panel), and
anti-ERK1 (lower panel).
|
|
Activation of EphB2 in NG108 cells leads to a decrease in the
levels of GTP-bound Ras.
The small GTPase Ras is an important
upstream regulator of the MAPK cascade and a common downstream effector
of RTK signaling (59). To study the effect of EphB2 on Ras
activation, parental NG108 and stable EphB2 cell lines were stimulated
with clustered ephrin-B1 and cell lysates were incubated with the
Ras-binding domain of c-Raf expressed as a GST fusion protein
(GST-Raf-RBD) and immobilized on glutathione-Sepharose beads. The
Raf-RBD has a higher affinity for the GTP-bound form of Ras than for
the GDP bound form and can thus be used as a probe for activated Ras
(61). Stimulation of NG-EphB2 cells in the presence of
serum with clustered Fc-ephrin-B1 ligand led to a transient decrease in
the levels of Ras-GTP that was restored to the basal level by 30 mins
after stimulation (Fig. 4, left panels).
In the absence of serum, the decrease in the Ras-GTP level was more
dramatic (Fig. 4, right panels). In contrast, parental NG108 cells
showed no changes in the levels of GTP-bound Ras. These observations
are in good agreement with the decrease in ERK1/2 and MEK1
phosphorylation shown in Fig. 1. Collectively, these results imply that
activation of EphB2 in NG108 cells leads to a decrease in the levels of
activated Ras and subsequently a more prolonged decrease in ERK
activation, even in the presence of serum.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 4.
EphB2 activation by ephrin-B1 causes a transient
decrease in the levels of activated p21Ras. (A) Parental NG108 or
NG-EphB2 cells in the presence of serum (left panels) or serum starved
(right panels) were stimulated for the indicated times with
Fc-ephrin-B1 clusters (2 µg/ml), and lysates were mixed with GST-Raf
RBD immobilized on glutathione beads in a pull-down (PD) assay.
Samples were electrophoresed and immunoblotted (WB) for Ras (upper
panel). To demonstrate equivalent protein levels at different time
points, equal volumes of whole-cell lysate were electrophoresed and
immunoblotted for Ras (lower panel).
|
|
p120-RasGAP participates in EphB2-induced downregulation of the
Ras-MAP kinase pathway.
Replacement of Y604 and Y610 in the EphB2
juxtamembrane region by phenylalanine locks the receptor in an
autoinhibited state, but their replacement by glutamate allows for
receptor activation while impairing the subsequent binding of SH2
domain proteins to the juxtamembrane sequence (6, 76). To
test the consequences of mutating the EphB2 juxtamembrane tyrosines to
glutamate on the inhibition of Ras-MAPK activation, lines of NG108
cells stably expressing a Tyr604/610Glu mutant (EphB2-EE) were
isolated. Ephrin-B1 stimulation of NG-EphB2 and NG-EphB2-EE cells
resulted in a similar profile of tyrosine phosphorylation, notably of
the p120-RasGAP-associated protein p62dok-1, although phosphorylation
was induced with slower kinetics in the EphB2-EE cells (Fig.
5A). Ephrin B1 stimulation of NG-EphB2-EE
cells caused a significant decrease in ERK1/2 phosphorylation; however,
this down regulation was attenuated compared with that for cells
expressing WT EphB2 (Fig. 5B). Ephrin-B1 stimulation of cells
expressing EphB2 or EphB2-EE induced the association of both WT and
mutant receptors with p120-RasGAP, although this interaction was
markedly reduced for EphB2-EE (Fig. 5C). Thus, the EphB2-EE mutant can
still down regulate ERK activation, but this activity is less potent
than that of WT EphB2, corresponding to a decreased ability of the
mutant to access p120-RasGAP, either directly or through p62dok-1
phosphorylation.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 5.
Role for p120-RasGAP in signaling from EphB2 in NG108
cells. (A) NG-EphB2 and NG-EphB2-EE clones were stimulated with
aggregated Fc-ephrinB1 ligand for the indicated times, and whole-cell
lysates were separated by SDS-PAGE and immunoblotted (WB) for
anti-pTyr. Tyrosine-phosphorylated EphB2 and p62dok-1 are indicated by
arrows. (B) Cell lysates from (panel A) were immunoblotted for
phosphorylated ERK1/2 (upper panel) and reprobed for ERK1 (lower
panel). (C) Serum-starved NG-EphB2 and NG-EphB2-EE cells were incubated
in the presence or absence of 2 µg of aggregated ephrin-B1 per ml for
20 min and lysed as indicated in Materials and Methods. EphB2
immunoprecipitates were blotted for p120-RasGAP (upper panel) and
reprobed with anti-pTyr antibodies (second panel) and anti-EphB2 (third
panel). For control, equivalent amounts of whole-cell lysate (WCL) were
immunoblotted for p120-RasGAP to indicate equal input (bottom panel).
|
|
To pursue the possible role of p120-RasGAP in EphB2-mediated Ras-MAPK
downregulation, we have used a truncated form of p120-RasGAP
lacking
the C-terminal GTPase-activating domain but retaining
the N-terminal
SH2 and SH3 protein binding motifs (GAP-N) (
52).
In
fibroblasts stably transfected with this truncated p120-RasGAP,
the
levels of activated Ras are upregulated, indicating that GAP-N
acts as
a dominant negative (Fig.
6A). NG-EphB2
cells were transfected
with either vector control or the GAP-N
construct and were challenged
with clustered Fc-ephrin-B1 48 h after
transfection. Immunoblotting
of whole-cell lysates with p120-RasGAP
antibodies raised against
the N-terminal region (
52)
revealed a 49-kDa band in the GAP-N-transfected
cells that was not
present in the control cells and corresponds
to the expected molecular
weight of GAP-N (Fig.
6B, upper panel).
In the control NG-EphB2 cells,
stimulation of EphB2 led to a time-dependent
decrease in phospho-ERK1/2
levels whereas there was no apparent
decrease in these levels in the
GAP-N-transfected cells (Fig.
6B, middle panel). In contrast, NG-EphB2
cells overexpressing
the Grb2 adaptor protein showed no apparent
difference in the
kinetics of ephrin-induced ERK downregulation
compared to cells
transfected with the vector control (Fig.
6C). These
results argue
that Grb2 does not play a significant role in signaling
downstream
of EphB2 in NG108 cells and indicate that the dominant
inhibitory
effect of GAP-N is specific and not simply due to
overexpression
of an SH2/SH3 domain polypeptide. These results show
that overexpression
of GAP-N ablates the EphB2-induced downregulation
of ERK signaling
in NG108 cells, suggesting that the GTPase domain of
p120-RasGAP
may play an important role in this process. Interestingly,
and
in agreement with the results presented above, we were unable
to
detect association of tyrosine-phosphorylated proteins with
Grb2 in
ephrin-B1-stimulated NG-EphB2 or NG-EphB2-EE lysates,
whereas ephrin-B1
stimulation led to the recruitment of tyrosine-phosphorylated
p62dok-1
to p120-RasGAP in both of these cell lines (
38) (Fig.
6D).
Collectively, these data suggest that the primary role of
EphB2 in
NG108 cells in relation to the Ras-MAPK pathway is the
transmission of
negative signals through p120-RasGAP rather than
of positive signals
through the Grb2/Sos1 complex.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 6.
p120-RasGAP but not Grb2 participates in signaling from
EphB2 in NG-108 cells. (A) Lyates from WT Rat2 cells or Rat2 cells
stably expressing GAP-N (top panel) were mixed with GST-Raf RBD
immobilized on glutathione beads. Samples were electrophoresed and
immunoblotted (WB) for Ras (bottom panel). Equivalent aliquots of
whole-cell lysate were probed for Ras to demonstrate equal input
(middle panel). (B and C) NG-EphB2 cells were transfected with empty vector
or GAP-N, as indicated (B), or in parallel empty vector and HA-Grb2
(C). At 48 h after transfection, the cells were challenged with 2 µg of clustered Fc-ephrin-B1 per ml and assayed for expression of
p120-RasGAP and GAP-N (B, upper panel), HA-Grb2 (C, upper panel), and
phospho-ERK1/2 (B and C, middle panel), then reprobed for total
ERK1 (B and C, bottom panel). (D) Parental NG108, NG-EphB2 and
NG-EphB2-EE cells were incubated in the absence ( ) or presence (+) of
clustered Fc-ephrin-B1 for 20 mins. For the Grb2 immunoprecipitation
(IP) control, Rat2 cells were incubated in the absence ( ) or presence
(+) of PDGF for 20 min. Lysates were subsequently immunoprecipitated
with either p120-RasGAP (left panel) or Grb2 (middle and right panels)
antibodies, and immunoblots were probed with anti-pTyr antibodies.
Asterisks indicate tyrosine-phosphorylated proteins in the Grb2
immunoprecipitation control. Lower panels indicate total protein
levels.
|
|
Constitutive Ras activation impairs EphB2-mediated neurite
retraction in NG108 cells.
Ephrin-B1 stimulation of
differentiated, neurite-bearing NG-EphB2 cells leads to the collapse of
polymerized actin structures and to neurite retraction, as visualized
by using rhodamine-phalloidin staining (6). Using a
conjugated yellow fluorescence protein-actin construct (YFP-actin [see
Materials and Methods]), we have identified a similar series of events
using time lapse imaging of living cells. Parental NG108 or NG-EphB2
cells were transfected with YFP-actin, and neurite outgrowth was
induced 24 h after transfection. In both NG108 and NG-EphB2 cells,
YFP-actin protein was localized throughout the cell body and was
particularly rich in the protruding filopodial projections and growth
cones (Fig. 7A and data not shown), in
good agreement with the distribution patterns of endogenous F-actin in
NG108 cells (38). Imaging of untreated parental and NG-EphB2 cells revealed basal levels of cytoskeletal movement, including dynamic but small projections and retractions in actin microspikes (data not shown). After stimulation with 2 µg of
clustered ephrin-B1 per ml, NG-EphB2 cells exhibited a rapid
reorganization of polymerized actin structures, as visualized by
disassembly of the filopodial projections and retraction of neurite
extensions (compare arrows in Fig. 7A to F) (time-lapse videography of
the neurite retraction can be seen on our website at
www.mshri.on.ca/pawson/home.html). The collapse of organized actin
structures was accompanied by shrinkage and compaction of the cell
bodies. In contrast, ephrin-B1 stimulation of YFP-actin transfected
parental NG108 cells induced no significant collapse of neurite or
microspike extensions and the cells retained their differentiated
morphology at the end of the 40-min time course (data not shown).

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 7.
EphB2 down regulation of Ras signaling is required for
neurite retraction in NG108 cells. Stable cell lines expressing EphB2
were transfected with either a YFP-actin (yellow fluorescence protein
conjugated actin) construct alone (A to F) or YFP-actin and HAp21RasV12
(A' to F') and stimulated with 2 µg of clustered ephrin-B1 per ml.
Live imaging of cells was performed using an inverted Olympus IX-70
fluorescence microscope for 25 min (A to F) or 40 min (A' to F'), with
frames taken at 30-s intervals. Time points in the stimulation are
indicated in minutes:seconds.
|
|
To investigate the possible significance of EphB2-induced down
regulation of the Ras-MAPK pathway for cytoskeletal remodeling,
we
analyzed the behavior of NG-EphB2 cells coexpressing YFP-actin
and the
RasV
12 variant, which is constitutively active due to
its
insensitivity to the GTPase activating function of p120-RasGAP.
If down
regulation of GTP-bound Ras is important for EphB2-mediated
cytoskeletal reorganization, we reasoned that constitutively active
RasV
12 might antagonize this response. NG-EphB2 cells were
cotransfected
with YFP-actin and RasV
12 and were
differentiated to form neurites
24 h after transfection. The
resulting cells showed an accumulation
of actin at the tip of
microspike projections, much like NG-EphB2
cells (Fig. 7A'). However,
in contrast to parental NG-EphB2 cells,
stimulation of the cells
expressing RasV
12 with clustered Fc-ephrin-B1
resulted in
the collapse of only a few neurites, while most microspikes
remained
extended and structured (Fig. 7A' to F'). Together, these
observations
raise the possibility that down regulation of Ras
activity may be
required for EphB2-induced changes in cell morphology
in NG108
cells.
EphB2 stimulation causes down regulation of fibronectin-induced
ERK1/2 activation.
Several recent studies have implicated Eph
receptors and ephrins in modulating integrin activity (55,
77). Integrin engagement of matrix ligands such as fibronectin
causes transient activation of the ERK pathway in a Ras-dependent
manner (64). To investigate the effect of EphB2 signaling
on integrin-mediated ERK1/2 activation, NG-EphB2 cells were serum
starved overnight and then held in suspension in the absence of serum
to diminish ERK1/2 phosphorylation. Cells were subsequently seeded onto
fibronectin-coated plates for various times to activate ERK1/2
signaling and then challenged with clustered ephrin-B1 ligand. As
anticipated, plating of NG-EphB2 cells on fibronectin led to an
increase in phospho-ERK1/2 levels in a time-dependent fashion, up to 80 min after plating (Fig. 8, left-hand five
lanes). EphB2 stimulation with ligand for 2, 20, or 40 min caused a
notable decrease in the integrin-stimulated phospho-ERK1/2 levels at
all time points of integrin engagement tested, compared to untreated controls (Fig. 8, compare lanes 11 and 9 to lane 4 and compare lane 7 to lane 2). These data suggest that EphB2 can negatively regulate
signaling from integrin receptors, leading to down regulation of ERK1/2
activation.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 8.
Integrin-induced stimulation of ERK1/2 phosphorylation
is down regulated in response to EphB2 signaling. NG-EphB2 cells were
serum starved overnight and subsequently detached and held in
suspension for approximately 1 h in the absence of serum. The
cells were subsequently plated onto fibronectin-coated six-well plates
for the specified times. After incubation of the cells in the absence
(lanes 1 to 6) or presence (lanes 7 to 12) of 2 µg of Fc-ephrin-B1
per ml as indicated, the cells were lysed directly in 2× SDS-PAGE
sample buffer, separated by electrophoresis, and immunoblotted (WB)
with anti-phospho-ERK1/2 antibodies (upper panel) or anti-ERK1
antibodies (lower panel).
|
|
 |
DISCUSSION |
Activated RTKs generally engage the Grb2/Sos1 complex, leading to
activation of the Ras-MAPK pathway. However, in addition to recruiting
SH2 domain proteins that enhance signaling events, receptors can bind
SH2 proteins that attenuate cytoplasmic signaling pathways, such as
p120-RasGAP. Since all RTKs studied to date stimulate the Ras-MAPK
pathway, negative regulators have generally been viewed as playing a
secondary role in receptor signaling by down regulating previously
activated pathways and thereby controlling the duration of the cellular
response to growth factors. However, in immune cells a number of
receptors (such as Fc
RIIB) which are substrates for cytoplasmic
tyrosine kinases are dedicated to the inhibition of phosphotyrosine
signaling pathways, which they achieve through the recruitment of
SH2-containing inositol and tyrosine phosphatases (i.e. SHIP1
and Shp1) to ITIM motifs (17). Here, we show that in some
cell types a primary effect of the EphB2 receptor, a member of the
largest family of vertebrate RTKs, is to inactivate Ras and thereby
inhibit the MAPK pathway. In particular, we show that activation of the
EphB2 RTK in the neuronal cell line NG108 leads to inhibition of Ras
and ERK1/2 in a p120-RasGAP-dependent manner and demonstrate that down
regulation of activated Ras is required for EphB2 stimulated neurite
retraction in NG108 cells.
To investigate the role of EphB2 in the activation of the ERK pathway
in a neuronal context, we have used NG108 cells in which we have
ectopically expressed WT or mutant EphB2 (38). These cells
can be differentiated to extend elaborate neurite and filopodial structures reminiscent of motor neurons, a cell type in which endogenous Eph receptors are expressed during embryogenesis
(33), and they can therefore be considered a
physiologically relevant cell culture system. Using phosphospecific
antibodies that detect the activated forms of MEK1 and ERK1/2, we have
found that activation of EphB2 by clustered ephrin-B1 causes a
dose-dependent (data not shown), and time-dependent (Fig. 1 A and B)
decrease in the level of activated ERK1/2 and MEK1 in NG-EphB2 cells.
This down regulation of MEK and ERK activation induced by ephrin-B1 is
more pronounced and of longer duration in the absence of serum,
suggesting that EphB2 inhibitory signaling can be partially
counteracted by serum growth factors. Active EphB2 also down regulated
the Ras-MAPK pathway in COS 1 cells (Fig. 2), suggesting that
inhibitory Ras signaling by EphB2 operates in multiple cell types.
However, we have not observed any Ras inhibition following ephrin-B1
stimulation of mouse embryo fibroblasts ectopically expressing EphB2
(data not shown). These results suggest that negative signaling from EphB2 to Ras is cell type dependent. This may explain the observation that overexpression of chicken EphB2 in 293 cells stimulates ERK2 activity (76).
Following the observation that ephrin-B1 inhibits ERK activation, we
have analyzed the regulation of upstream elements of the MAPK pathways.
In contrast to the Ras activation seen after stimulation of most RTKs,
ephrin-B1 causes a decrease in the levels of active, GTP-bound Ras that
mimics the time course of EphB2 activation, as well as the decrease in
MEK1 and ERK1/2 phosphorylation (Fig. 1A and B). These data indicate
that stimulation of EphB2 in NG108 cells leads to a decrease in the
levels of GTP-Ras and thus to the attenuation of MAPK signaling. This
inhibition of the MAPK cascade requires phosphorylation at the
conserved juxtamembrane tyrosine residues of EphB2, since their
replacement by phenylalanine (either singly or together) resulted in
progressive loss of MAPK inhibitory signaling (Fig. 3B and C). We have
previously shown that these juxtamembrane tyrosines in their
unphosphorylated state repress kinase activity and that the double
phenylalanine mutant is locked in an autoinhibited state and therefore
unable to induce neurite retraction (6). In agreement with
these results, we also demonstrate that a kinase-inactive mutant of
EphB2 is unable to attenuate ERK phosphorylation after ephrin
stimulation (Fig. 3D). These results indicate that EphB2
autophosphorylation and consequent kinase activation are required to
downregulate Ras.
A direct mechanism by which activated EphB2 could down regulate Ras is
through p120-RasGAP. Indeed, p120-RasGAP can bind directly through its
SH2 domains to the autophosphorylated EphB2 juxtamembrane region and
also to p62dok-1, the principal substrate for EphB2 in NG-EphB2 cells
(38) (Fig. 6D). Previous work has shown that p62dok-1 is
involved in negative signaling from cell surface receptors to inhibit
the MAPK pathway (43, 50, 73). We have found that
overexpression of a truncated form of p120-RasGAP lacking the GTPase
domain inhibited the decrease in ERK1/2 phosphorylation induced by
ephrin-B1 in NG-EphB2 cells (Fig. 6B).
A role for Ras in remodeling neuronal growth cones has been previously
proposed (3, 9, 63). When microinjected into PC12 cells or
primary embryonic neurons, Ras stimulates morphological differentiation, including neurite outgrowth (3). Our data suggest that decreased levels of activated Ras are necessary for neurite retraction in ephrin-B1-stimulated NG-EphB2 cells, since forced
expression of the activated variant RasV12 significantly blocked cytoskeletal changes in response to ligand stimulation (Fig.
7). How down regulation of Ras activity contributes to neurite retraction in these cells remains to be established. Several Ras effectors and Rho family members have been implicated in growth cone
development and guidance. Inhibition of phosphatidylinositol (PI)
3-kinase signaling by wortmanin or a dominant negative form of p85 can
block nerve growth factor-induced neurite outgrowth (42,
45), and activated PI 3-kinase leads to the formation of
neurite-like structures in PC12 cells (46, 48).
Furthermore, in N1E-115 neuroblastoma cells, PI-3 kinase appears to be
an integral mediator of Ras-induced neurite outgrowth, in a Cdc42- and
Rac1-dependent manner, while RhoA competes with Ras to inhibit neurite
extension (49, 63). Interestingly, recent work suggests
mutual cross talk between the Ras and Rho signaling pathways in
transformed cells, with Ras acting to specifically inhibit the effects
of Rho-GTP on the actin cytoskeleton by blocking activation of the Rho
kinase ROCK (62). Since Rho can also potentially be
activated during Eph receptor signaling through guanine nucleotide
exchange factors such as Ephexin (66), down regulation of
Ras may be important for Rho to exert an effect on the actin
cytoskeleton during neurite retraction.
In addition to mediating the signaling functions of ephrins, Eph
receptors are increasingly implicated as modulators of other cell
surface receptors. For example, EphB2 physically associates with the
N-methyl-D-aspartate receptor in synapses
(20) and with the Ryk receptor (32). It is
therefore possible that one role of EphB2 inhibitory signaling is to
attenuate the ability of other receptors to activate the Ras-MAPK
pathway. As a case in point, a number of recent reports have implicated
Eph RTKs in modulating integrin signaling. Activation of EphA2 in PC-3 cells inhibits integrin-mediated adhesion and causes the
dephosphorylation of focal adhesion kinase in a ligand-dependent manner
(55). Zou et al. suggest that in NIH 3T3 cells, EphB2
inhibits cell adhesion through phosphorylation of R-Ras (another member
of the Ras family of small GTPases), which suppresses the ability of R-Ras to support integrin activity (77). Here, we show
that phosphorylation of ERK1/2 induced by integrin engagement in
NG-EphB2 cells is suppressed in the presence of clustered ephrin-B1,
potentially through p120-RasGAP-induced downregulation of GTP-Ras.
These data argue that ephrin-Eph receptor signaling may modify the
cellular response to other receptors.
While the role of Eph receptors in axon guidance and growth cone
migration is well established, it is not completely understood. The
neuronal growth cone is a specialized structure responsible for
pathfinding in the developing nervous system (2, 5). It
guides the extending neurite toward its target by constantly protruding
and retracting filopodia and lamellipodia. We have demonstrated that
activation of EphB2 in the neuronal cell line NG108 leads to retraction
of filopodial extensions and collapse of neurite structures. Moreover,
we show here that activation of EphB2 leads to attenuation of Ras-MAPK
signaling and that the decrease in levels of activated Ras is required
for the observed changes in the actin cytoskeleton. Our results raise
an interesting issue concerning the specificity of RTK signaling.
Although RTKs as a general rule signal through the Grb2 SH2/SH3 adaptor
to activate the Ras-MAPK pathway, Eph receptors can preferentially
signal through p120-RasGAP to inhibit Ras signaling in some cell types. Since both Grb2 and p120-RasGAP are controlled through recruitment of
their SH2 domains to pTyr-containing motifs, it appears that distinct
RTKs can transmit opposing signals to the Ras pathway through their
ability to engage distinct targets.
 |
ACKNOWLEDGMENTS |
We thank Kathleen Binns for critical reading of the manuscript
and members of the Pawson laboratory for many helpful discussions. We
also thank Suzanne Del Rizzo for purification of Fc-ephrin-B1.
This work was supported by a grant from the Canadian Institute of
Health Research (CIHR) and a Howard Hughes Medical Institute International Research Scholar award to T.P. S.E. was supported by
an Ontario Graduate Scholarship. T.P. is a Distinguished Scientist of
the CIHR.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Samuel Lunenfeld
Research Institute, Mount Sinai Hospital, 600 University Ave., Toronto, Ontario, Canada M5G 1X5. Phone: (416) 586-8262. Fax: (416) 586-8869. E-mail: pawson{at}mshri.on.ca.
Present address: Rigel Inc., South San Francisco, CA 94080.
 |
REFERENCES |
| 1.
|
Adams, R. H.,
G. A. Wilkinson,
C. Weiss,
F. Diella,
N. W. Gale,
U. Deutsch,
W. Risau, and R. Klein.
1999.
Roles of ephrinB ligands and EphB receptors in cardiovascular development: demarcation of arterial/venous domains, vascular morphogenesis, and sprouting angiogenesis.
Genes Dev.
13:295-306[Abstract/Free Full Text].
|
| 2.
|
Aletta, J. M., and L. A. Greene.
1988.
Growth cone configuration and advance: a time-lapse study using video-enhanced differential interference contrast microscopy.
J. Neurosci.
8:1425-1435[Abstract].
|
| 3.
|
Bar-Sagi, D., and J. R. Feramisco.
1985.
Microinjection of the ras oncogene protein into PC12 cells induces morphological differentiation.
Cell.
42:841-848[CrossRef][Medline].
|
| 4.
|
Becker, E.,
U. Huynh-Do,
S. Holland,
T. Pawson,
T. O. Daniel, and E. Y. Skolnik.
2000.
Nck-interacting Ste20 kinase couples Eph receptors to c-Jun N-terminal kinase and integrin activation.
Mol. Cell. Biol.
20:1537-1545[Abstract/Free Full Text].
|
| 5.
|
Bentley, D., and T. P. O'Connor.
1994.
Cytoskeletal events in growth cone steering.
Curr. Opin. Neurobiol.
4:43-48[CrossRef][Medline].
|
| 6.
|
Binns, K. L.,
P. P. Taylor,
F. Sicheri,
T. Pawson, and S. J. Holland.
2000.
Phosphorylation of tyrosine residues in the kinase domain and juxtamembrane region regulates the biological and catalytic activities of Eph receptors.
Mol. Cell. Biol.
20:4791-4805[Abstract/Free Full Text].
|
| 7.
|
Birgbauer, E.,
C. A. Cowan,
D. W. Sretavan, and M. Henkemeyer.
2000.
Kinase independent function of EphB receptors in retinal axon pathfinding to the optic disc from dorsal but not ventral retina.
Development
127:1231-1241[Abstract].
|
| 8.
|
Bohme, B.,
T. VandenBos,
D. P. Cerretti,
L. S. Park,
U. Holtrich,
H. Rubsamen-Waigmann, and K. Strebhardt.
1996.
Cell-cell adhesion mediated by binding of membrane-anchored ligand LERK-2 to the EPH-related receptor human embryonal kinase 2 promotes tyrosine kinase activity.
J. Biol. Chem.
271:24747-24752[Abstract/Free Full Text].
|
| 9.
|
Borasio, G. D.,
J. John,
A. Wittinghofer,
Y. A. Barde,
M. Sendtner, and R. Heumann.
1989.
Ras p21 protein promotes survival and fiber outgrowth of cultured embryonic neurons.
Neuron
2:1087-1096[CrossRef][Medline].
|
| 10.
|
Brambilla, R.,
A. Schnapp,
F. Casagranda,
J. P. Labrador,
A. D. Bergemann,
J. G. Flanagan,
E. B. Pasquale, and R. Klein.
1995.
Membrane-bound LERK2 ligand can signal through three different Eph-related receptor tyrosine kinases.
EMBO J.
14:3116-3126[Medline].
|
| 11.
|
Brennan, C.,
B. Monschau,
R. Lindberg,
B. Guthrie,
U. Drescher,
F. Bonhoeffer, and N. Holder.
1997.
Two Eph receptor tyrosine kinase ligands control axon growth and may be involved in the creation of the retinotectal map in the zebrafish.
Development.
124:655-664[Abstract].
|
| 12.
|
Bruce, V.,
G. Olivieri,
O. Eickelberg, and G. C. Miescher.
1999.
Functional activation of EphA5 receptor does not promote cell proliferation in the aberrant EphA5 expressing human glioblastoma U-118 MG cell line.
Brain Res.
821:169-176[CrossRef][Medline].
|
| 13.
|
Bruckner, K.,
E. B. Pasquale, and R. Klein.
1997.
Tyrosine phosphorylation of transmembrane ligands for Eph receptors.
Science
275:1640-1643[Abstract/Free Full Text].
|
| 14.
|
Chin-Sang, I. D.,
S. E. George,
M. Ding,
S. L. Moseley,
A. S. Lynch, and A. D. Chisholm.
1999.
The ephrin VAB-2/EFN-1 functions in neuronal signaling to regulate epidermal morphogenesis in C. elegans.
Cell
99:781-790[CrossRef][Medline].
|
| 15.
|
Choi, S., and S. Park.
1999.
Phosphorylation at Tyr-838 in the kinase domain of EphA8 modulates Fyn binding to the Tyr-615 site by enhancing tyrosine kinase activity.
Oncogene
18:5413-5422[CrossRef][Medline].
|
| 16.
|
Cobb, M. H.
1999.
MAP kinase pathways.
Prog. Biophys. Mol. Biol.
71:479-500[CrossRef][Medline].
|
| 17.
|
Coggeshall, K. M.
1998.
Inhibitory signaling by B cell Fc gamma RIIb.
Curr. Opin. Immunol.
10:306-312[CrossRef][Medline].
|
| 18.
|
Conover, J. C.,
F. Doetsch,
J. M. Garcia-Verdugo,
N. W. Gale,
G. D. Yancopoulos,
G. D., and A. Alvarez-Buylla.
2000.
Disruption of Eph/ephrin signaling affects migration and proliferation in the adult subventricular zone.
Nat. Neurosci.
3:1091-1097[CrossRef][Medline].
|
| 19.
|
Cowan, C. A.,
N. Yokoyama,
L. M. Bianchi,
M. Henkemeyer, and B. Fritzsch.
2000.
EphB2 guides axons at the midline and is necessary for normal vestibular function.
Neuron
26:417-430[CrossRef][Medline].
|
| 20.
|
Dalva, M. B.,
M. A. Takasu,
M. Z. Lin,
S. M. Shamah,
L. Hu,
N. W. Gale, and M. E. Greenberg.
2000.
EphB receptors interact with NMDA receptors and regulate excitatory synapse formation.
Cell
103:945-956[CrossRef][Medline].
|
| 21.
|
Davis, S.,
N. W. Gale,
T. H. Aldrich,
P. C. Maisonpierre,
V. Lhotak,
T. Pawson,
M. Goldfarb, and G. D. Yancopoulos.
1994.
Ligands for EPH-related receptor tyrosine kinases that require membrane attachment or clustering for activity.
Science
266:816-819[Abstract/Free Full Text].
|
| 22.
|
Davy, A.,
N. W. Gale,
E. W. Murray,
R. A. Klinghoffer,
P. Soriano,
C. Feuerstein, and S. M. Robbins.
1999.
Compartmentalized signaling by GPI-anchored ephrin-A5 requires the Fyn tyrosine kinase to regulate cellular adhesion.
Genes Dev.
13:3125-3135[Abstract/Free Full Text].
|
| 23.
|
Davy, A., and S. M. Robbins.
2000.
Ephrin-A5 modulates cell adhesion and morphology in an integrin-dependent manner.
EMBO J.
19:5396-5405[CrossRef][Medline].
|
| 24.
|
Dodelet, V. C.,
C. Pazzagli,
A. H. Zisch,
C. A. Hauser, and E. B. Pasquale.
1999.
A novel signaling intermediate, SHEP1, directly couples Eph receptors to R-Ras and Rap1A.
J. Biol. Chem.
274:31941-31946[Abstract/Free Full Text].
|
| 25.
|
Drescher, U.,
C. Kremoser,
C. Handwerker,
J. Loschinger,
M. Noda, and F. Bonhoeffer.
1995.
In vitro guidance of retinal ganglion cell axons by RAGS, a 25 kDa tectal protein related to ligands for Eph receptor tyrosine kinases.
Cell
82:359-370[CrossRef][Medline].
|
| 26.
|
Ellis, C.,
F. Kasmi,
P. Ganju,
E. Walls,
G. Panayotou, and A. D. Reith.
1996.
A juxtamembrane autophosphorylation site in the Eph family receptor tyrosine kinase. Sek, mediates high affinity interaction with p59fyn.
Oncogene
12:1727-1736[Medline].
|
| 27.
|
Eph Nomenclature Committee.
1997.
Unified nomenclature for Eph family receptors and their ligands, the ephrins.
Cell
90:403-404[CrossRef][Medline].
|
| 28.
|
Gale, N. W.,
S. J. Holland,
D. M. Valenzuela,
A. Flenniken,
L. Pan,
T. E. Ryan,
M. Henkemeyer,
K. Strebhardt,
H. Hirai,
D. G. Wilkinson,
T. Pawson,
S. Davis, and G. D. Yancopoulos.
1996.
Eph receptors and ligands comprise two major specificity subclasses and are reciprocally compartmentalized during embryogenesis.
Neuron
17:9-19[CrossRef][Medline].
|
| 29.
|
Gale, N. W.,
P. Baluk,
L. Pan,
M. Kwan,
J. Holash,
T. DeChiara,
D. McDonald, and G. Yancopoulos.
2001.
Ephrin-B2 selectively marks arterial vessels and neovascularization sites in the adult, with expression in both endothelial and smooth-muscle cells.
Dev. Biol.
230:151-160[CrossRef][Medline].
|
| 30.
|
George, S. E.,
K. Simokat,
J. Hardin, and A. D. Chisholm.
1998.
The VAB-1 Eph receptor tyrosine kinase functions in neural and epithelial morphogenesis in C. elegans.
Cell
92:633-643[CrossRef][Medline].
|
| 31.
|
Gerety, S. S.,
H. U. Wang,
Z. F. Chen, and D. J. Anderson.
1999.
Symmetrical mutant phenotypes of the receptor EphB4 and its specific transmembrane ligand ephrin-B2 in cardiovascular development.
Mol. Cell
4:403-414[CrossRef][Medline].
|
| 32.
|
Halford, M. M.,
J. Armes,
M. Buchert,
V. Meskenaite,
D. Grail,
M. L. Hibbs,
A. F. Wilks,
P. G. Farlie,
D. F. Newgreen,
C. M. Hovens, and S. A. Stacker.
2000.
Ryk-deficient mice exhibit craniofacial defects associated with perturbed Eph receptor crosstalk.
Nat. Genet.
25:414-418[CrossRef][Medline].
|
| 33.
|
Henkemeyer, M.,
L. E. Marengere,
J. McGlade,
J. P. Olivier,
R. A. Conlon,
D. P. Holmyard,
K. Letwin, and T. Pawson.
1994.
Immunolocalization of the Nuk receptor tyrosine kinase suggests roles in segmental patterning of the brain and axonogenesis.
Oncogene
9:1001-1014[Medline].
|
| 34.
|
Henkemeyer, M.,
D. Orioli,
J. T. Henderson,
T. M. Saxton,
J. Roder,
T. Pawson, and R. Klein.
1996.
Nuk controls pathfinding of commissural axons in the mammalian central nervous system.
Cell
86:35-46[CrossRef][Medline].
|
| 35.
|
Hock, B.,
B. Bohme,
T. Karn,
S. Feller,
H. Rubsamen-Waigmann, and K. Strebhardt.
1998.
Tyrosine-614, the major autophosphorylation site of the receptor tyrosine kinase HEK2, functions as multi-docking site for SH2-domain mediated interactions.
Oncogene
17:255-260[CrossRef][Medline].
|
| 36.
|
Hock, B.,
B. Bohme,
T. Karn,
T. Yamamoto,
K. Kaibuchi,
U. Holtrich,
S. Holland,
T. Pawson,
H. Rubsamen-Waigmann, and K. Strebhardt.
1998.
PDZ-domain-mediated interaction of the Eph-related receptor tyrosine kinase EphB3 and the ras-binding protein AF6 depends on the kinase activity of the receptor.
Proc. Natl. Acad. Sci. USA
95:9779-84[Abstract/Free Full Text].
|
| 37.
|
Holland, S. J.,
N. W. Gale,
G. Mbamalu,
G. D. Yancopoulos,
M. Henkemeyer, and T. Pawson.
1996.
Bidirectional signalling through the EPH-family receptor Nuk and its transmembrane ligands:
Nature
383:722-725[CrossRef][Medline].
|
| 38.
|
Holland, S. J.,
N. W. Gale,
G. D. Gish,
R. A. Roth,
Z. Songyang,
L. C. Cantley,
M. Henkemeyer,
G. D. Yancopoulos, and T. Pawson.
1997.
Juxtamembrane tyrosine residues couple the Eph family receptor EphB2/Nuk to specific SH2 domain proteins in neuronal cells.
EMBO J.
16:3877-3888[CrossRef][Medline].
|
| 39.
|
Holland, S. J.,
E. Peles,
T. Pawson, and J. Schlessinger.
1998.
Cell-contact-dependent signalling in axon growth and guidance: Eph receptor tyrosine kinases and receptor protein tyrosine phosphatase beta.
Curr. Opin. Neurobiol.
8:117-127[CrossRef][Medline].
|
| 40.
|
Holmberg, J.,
D. L. Clarke, and J. Frisén.
2000.
Regulation of repulsion versus adhesion by different splice forms of an Eph receptor.
Nature
408:203-206[CrossRef][Medline].
|
| 41.
|
Huai, J., and U. Drescher.
2001.
An ephrin-A-dependent signaling pathway controls integrin function and is linked to the tyrosine phosphorylation of a 120-kDa protein.
J Biol. Chem.
276:6689-6694[Abstract/Free Full Text].
|
| 42.
|
Jackson, T. R.,
I. J. Blader,
L. P. Hammonds-Odie,
C. R. Burga,
F. Cooke,
P. T. Hawkins,
A. G. Wolf,
K. A. Heldman, and A. B. Theibert.
1996.
Initiation and maintenance of NGF-stimulated neurite outgrowth requires activation of a phosphoinositide 3-kinase.
J. Cell Sci.
109:289-300[Abstract].
|
| 43.
|
Jones, N., and D. Dumont.
1999.
Recruitment of Dok-R to the EGF receptor through its PTB domain is required for attenuation of Erk MAP kinase activation.
Curr. Biol.
9:1057-1060[CrossRef][Medline].
|
| 44.
|
Kalo, M. S., and E. B. Pasquale.
1999.
Multiple in vivo tyrosine phosphorylation sites in EphB receptors.
Biochemistry
38:14396-14408[CrossRef][Medline].
|
| 45.
|
Kimura, K.,
S. Hattori,
Y. Kabuyama,
Y. Shizawa,
J. Takayanagi,
S. Nakamura,
S. Toki,
Y. Matsuda,
K. Onodera, and Y. Fukui.
1994.
Neurite outgrowth of PC12 cells is suppressed by wortmannin, a specific inhibitor of phosphatidylinositol 3-kinase.
J. Biol. Chem.
269:18961-18967[Abstract/Free Full Text].
|
| 46.
|
Kita, Y.,
K. D. Kimura,
M. Kobayashi,
S. Ihara,
K. Kaibuchi,
S. Kuroda,
M. Ui,
H. Iba,
H. Konishi,
U. Kikkawa,
S. Nagata, and Y. Fukui.
1998.
Microinjection of activated phosphatidylinositol-3 kinase induces process outgrowth in rat PC12 cells through the Rac-JNK signal transduction pathway.
J. Cell Sci.
111:907-915[Abstract].
|
| 47.
|
Knoll, B.,
K. Zarbalis,
W. Wurst, and U. Drescher.
2001.
A role for the EphA family in the topographic targeting of vomeronasal axons.
Development
128:895-906[Abstract].
|
| 48.
|
Kobayashi, M.,
S. Nagata,
Y. Kita,
N. Nakatsu,
S. Ihara,
K. Kaibuchi,
S. Kuroda,
M. Ui,
H. Iba,
H. Konishi,
U. Kikkawa,
I. Saitoh, and Y. Fukui.
1997.
Expression of a constitutively active phosphatidylinositol 3-kinase induces process formation in rat PC12 cells. Use of Cre/loxP recombination system.
J. Biol. Chem.
272:16089-16092[Abstract/Free Full Text].
|
| 49.
|
Kozma, R.,
S. Sarner,
S. Ahmed, and L. Lim.
1997.
Rho family GTPases and neuronal growth cone remodelling: relationship between increased complexity induced by Cdc42Hs, Rac1, and acetylcholine and collapse induced by RhoA and lysophosphatidic acid.
Mol. Cell. Biol.
17:1201-1211[Abstract].
|
| 50.
|
Lemay, S.,
D. Davidson,
S. Latour, and A. Veillette.
2000.
Dok-3, a novel adapter molecule involved in the negative regulation of immunoreceptor signaling.
Mol. Cell. Biol.
20:2743-2754[Abstract/Free Full Text].
|
| 51.
|
Marshall, C. J.
1995.
Specificity of receptor tyrosine kinase signaling: transient versus sustained extracellular signal-regulated kinase activation.
Cell
80:179-185[CrossRef][Medline].
|
| 52.
|
McGlade, J.,
B. Brunkhorst,
D. Anderson,
G. Mhamalu,
J. Settleman,
S. Dedhar,
M. Rozakis-Adcock,
L. B. Chen, and T. Pawson.
1993.
The N-terminal region of GAP regulates cytoskeletal structure and cell adhesion.
EMBO J.
12:3073-3081[Medline].
|
| 53.
|
Meima, L.,
I. J. Kljavin,
P. Moran,
A. Shih,
J. W. Winslow, and I. W. Caras.
1997.
AL-1-induced growth cone collapse of rat cortical neurons is correlated with REK7 expression and rearrangement of the actin cytoskeleton.
Eur. J. Neurosci.
9:177-188[CrossRef][Medline].
|
| 54.
|
Meima, L.,
P. Moran,
W. Matthews, and I. W. Caras.
1997.
Lerk2 (ephrin-B1) is a collapsing factor for a subset of cortical growth cones and acts by a mechanism different from AL-1 (ephrin-A5).
Mol. Cell. Neurosci.
9:314-328[CrossRef][Medline].
|
| 55.
|
Miao, H.,
E. Burnett,
M. Kinch,
E. Simon, and B. Wang.
2000.
Activation of EphA2 kinase suppresses integrin function and causes focal-adhesion-kinase dephosphorylation.
Nat. Cell Biol.
2:62-69[CrossRef][Medline].
|
| 56.
|
Mueller, B. K.
1999.
Growth cone guidance: first steps towards a deeper understanding.
Annu. Rev. Neurosci.
22:351-388[CrossRef][Medline].
|
| 57.
|
Nakamoto, M.,
H. J. Cheng,
G. C. Friedman,
T. McLaughlin,
M. J. Hansen,
C. H. Yoon,
D. D. O'Leary, and J. G. Flanagan.
1996.
Topographically specific effects of ELF-1 on retinal axon guidance in vitro and retinal axon mapping in vivo.
Cell
86:755-766[CrossRef][Medline].
|
| 58.
|
Pandey, A.,
H. Shao,
R. M. Marks,
P. J. Polverini, and V. M. Dixit.
1995.
Role of B61, the ligand for the Eck receptor tyrosine kinase, in TNF-alpha-induced angiogenesis.
Science
268:567-569[Abstract/Free Full Text].
|
| 59.
|
Pawson, T., and T. M. Saxton.
1999.
Signaling networks do all roads lead to the same genes?
Cell
97:675-678[CrossRef][Medline].
|
| 60.
|
Pear, W. S.,
G. P. Nolan,
M. L. Scott, and D. Baltimore.
1993.
Production of high titer helper-free retroviruses by transient transfection.
Proc. Natl. Acad. Sci. USA
90:8392-8396[Abstract/Free Full Text].
|
| 61.
|
de Rooij, J., and J. L. Bos.
1997.
Minimal Ras-binding domain of Raf1 can be used as an activation-specific probe for Ras.
Oncogene
14:623-625[CrossRef][Medline].
|
| 62.
|
Sahai, E.,
M. F. Olson, and C. J. Marshall.
2001.
Cross-talk between Ras and Rho signalling pathways in transformation favours proliferation and increased motility.
EMBO J.
20:755-766[CrossRef][Medline].
|
| 63.
|
Sarner, S.,
R. Kozma,
S. Ahmed, and L. Lim.
2000.
Phosphatidylinositol 3-kinase, Cdc42, and Rac1 act downstream of Ras in integrin-dependent neurite outgrowth in N1E-115 neuroblastoma cells.
Mol. Cell. Biol.
20:158-172[Abstract/Free Full Text].
|
| 64.
|
Schlaepfer, D. D., and T. Hunter.
1998.
Integrin signalling and tyrosine phosphorylation: just the FAKs?
Trends Cell. Biol.
8:151-157[CrossRef][Medline].
|
| 65.
|
Scully, A. L.,
M. McKeown, and J. B. Thomas.
1999.
Isolation and characterization of Dek, a Drosophila eph receptor protein tyrosine kinase.
Mol. Cell. Neurosci.
13:337-347[CrossRef][Medline].
|
| 66.
|
Shamah, S. M.,
M. Z. Lin,
J. L. Goldberg,
S. Estrach,
M. Sahin,
L. Hu,
M. Bazalakova,
R. L. Neve,
G. Corfas,
A. Debant, and M. E. Greenberg.
2001.
EphA receptors regulate growth cone dynamics through the novel guanine nucleotide exchange factor ephexin.
Cell
105:233-244[CrossRef][Medline].
|
| 67.
|
Stapleton, D.,
I. Balan,
T. Pawson, and F. Sicheri.
1999.
The crystal structure of an Eph receptor SAM domain reveals a mechanism for modular dimerization.
Nat. Struct. Biol.
6:44-49[CrossRef][Medline].
|
| 68.
|
Stein, E.,
D. P. Cerretti, and T. O. Daniel.
1996.
Ligand activation of ELK receptor tyrosine kinase promotes its association with Grb10 and Grb2 in vascular endothelial cells.
J. Biol. Chem.
271:23588-23593[Abstract/Free Full Text].
|
| 69.
|
Stein, E.,
U. Hyunh-Do,
A. A. Lane,
D. P. Cerretti, and T. O. Daniel.
1998.
Nck recruitment to Eph Receptor, EphB1/Elk, couples ligand activation to c-Jun kinase.
J. Biol. Chem.
273:1303-1308[Abstract/Free Full Text].
|
| 70.
|
Thanos, C. D.,
S. Faham,
K. E. Goodwill,
D. Cascio,
M. Phillips, and J. U. Bowie.
1999.
Monomeric structure of the human EphB2 sterile alpha motif domain.
J. Biol. Chem.
274:37301-37306[Abstract/Free Full Text].
|
| 71.
|
Wang, H. U.,
Z. F. Chen, and D. J. Anderson.
1998.
Molecular distinction and angiogenic interaction between embryonic arteries and veins revealed by ephrin-B2 and its receptor Eph-B4.
Cell
93:741-753[CrossRef][Medline].
|
| 72.
|
Wang, X.,
P. J. Roy,
S. J. Holland,
L. W. Zhang,
J. G. Culotti, and T. Pawson.
1999.
Multiple ephrins control cell organization in C. elegans using kinase-dependent and -independent functions of the VAB-1 Eph receptor.
Mol. Cell
4:903-913[CrossRef][Medline].
|
| 73.
|
Yamanashi, Y.,
T. Tamura,
T. Kanamori,
H. Yamane,
H. Nariuchi,
T. Yamamoto, and D. Baltimore.
2000.
Role of the rasGAP-associated docking protein p62(dok) in negative regulation of B cell receptor-mediated signaling.
Genes Dev.
14:11-16[Abstract/Free Full Text].
|
| 74.
|
Yokoyama, N.,
M. I. Romero,
C. A. Cowan,
P. Galvan,
F. Helmbacher,
P. Charnay,
L. F. Parada, and M. Henkemeyer.
2001.
Forward signaling mediated by ephrin-B3 prevents contralateral corticospinal axons from recrossing the spinal cord midline.
Neuron
29:85-97[CrossRef][Medline].
|
| 75.
|
Zisch, A. H.,
M. S. Kalo,
L. D. Chong, and E. B. Pasquale.
1998.
Complex formation between EphB2 and Src requires phosphorylation of tyrosine 611 in the EphB2 juxtamembrane region.
Oncogene
16:2657-2670[CrossRef][Medline].
|
| 76.
|
Zisch, A. H.,
C. Pazzagli,
A. Freeman,
M. Schneller,
M. Hadman,
J. W. Smith,
E. Ruoshlahti, and E. B. Pasquale.
2000.
Replacing two conserved tyrosines of the EphB2 receptor with glutamic acid prevents binding of SH2 domains without abrogating kinase activity and biological responses.
Oncogene
19:177-187[CrossRef][Medline].
|
| 77.
|
Zou, J. X.,
B. Wang,
M. S. Kalo,
A. Zisch,
E. B. Pasquale, and E. Ruoshlahti.
1999.
An Eph receptor regulates integrin activity through R-Ras.
Proc. Natl. Acad. Sci. USA
96:13813-13818[Abstract/Free Full Text].
|
Molecular and Cellular Biology, November 2001, p. 7429-7441, Vol. 21, No. 21
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.21.7429-7441.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Endo, M., Yamashita, T.
(2009). Inactivation of Ras by p120GAP via Focal Adhesion Kinase Dephosphorylation Mediates RGMa-Induced Growth Cone Collapse. J. Neurosci.
29: 6649-6662
[Abstract]
[Full Text]
-
Petros, T. J., Shrestha, B. R., Mason, C.
(2009). Specificity and Sufficiency of EphB1 in Driving the Ipsilateral Retinal Projection. J. Neurosci.
29: 3463-3474
[Abstract]
[Full Text]
-
Ting, M.-C., Wu, N. L., Roybal, P. G., Sun, J., Liu, L., Yen, Y., Maxson, R. E. Jr
(2009). EphA4 as an effector of Twist1 in the guidance of osteogenic precursor cells during calvarial bone growth and in craniosynostosis. Development
136: 855-864
[Abstract]
[Full Text]
-
Poliakov, A., Cotrina, M. L., Pasini, A., Wilkinson, D. G.
(2008). Regulation of EphB2 activation and cell repulsion by feedback control of the MAPK pathway. JCB
183: 933-947
[Abstract]
[Full Text]
-
Fukai, J., Yokote, H., Yamanaka, R., Arao, T., Nishio, K., Itakura, T.
(2008). EphA4 promotes cell proliferation and migration through a novel EphA4-FGFR1 signaling pathway in the human glioma U251 cell line. Molecular Cancer Therapeutics
7: 2768-2778
[Abstract]
[Full Text]
-
Lackmann, M., Boyd, A. W.
(2008). Eph, a Protein Family Coming of Age: More Confusion, Insight, or Complexity?. Sci Signal
1: re2-re2
[Abstract]
[Full Text]
-
Shi, W., Levine, M.
(2008). Ephrin signaling establishes asymmetric cell fates in an endomesoderm lineage of the Ciona embryo. Development
135: 931-940
[Abstract]
[Full Text]
-
Shin, J., Gu, C., Park, E., Park, S.
(2007). Identification of Phosphotyrosine Binding Domain-Containing Proteins as Novel Downstream Targets of the EphA8 Signaling Function. Mol. Cell. Biol.
27: 8113-8126
[Abstract]
[Full Text]
-
Picco, V., Hudson, C., Yasuo, H.
(2007). Ephrin-Eph signalling drives the asymmetric division of notochord/neural precursors in Ciona embryos. Development
134: 1491-1497
[Abstract]
[Full Text]
-
Stokowski, A., Shi, S., Sun, T., Bartold, P. M., Koblar, S. A., Gronthos, S.
(2007). EphB/Ephrin-B Interaction Mediates Adult Stem Cell Attachment, Spreading, and Migration: Implications for Dental Tissue Repair. Stem Cells
25: 156-164
[Abstract]
[Full Text]
-
Guo, H., Miao, H., Gerber, L., Singh, J., Denning, M. F., Gilliam, A. C., Wang, B.
(2006). Disruption of EphA2 Receptor Tyrosine Kinase Leads to Increased Susceptibility to Carcinogenesis in Mouse Skin.. Cancer Res.
66: 7050-7058
[Abstract]
[Full Text]
-
Freywald, A., Sharfe, N., Miller, C. DE., Rashotte, C., Roifman, C. M.
(2006). EphA Receptors Inhibit Anti-CD3-Induced Apoptosis in Thymocytes. J. Immunol.
176: 4066-4074
[Abstract]
[Full Text]
-
Dail, M., Richter, M., Godement, P., Pasquale, E. B.
(2006). Eph receptors inactivate R-Ras through different mechanisms to achieve cell repulsion. J. Cell Sci.
119: 1244-1254
[Abstract]
[Full Text]
-
Guo, D. L., Zhang, J., Yuen, S. T., Tsui, W. Y., Chan, A. S.Y., Ho, C., Ji, J., Leung, S. Y., Chen, X.
(2006). Reduced expression of EphB2 that parallels invasion and metastasis in colorectal tumours. Carcinogenesis
27: 454-464
[Abstract]
[Full Text]
-
Parri, M., Buricchi, F., Taddei, M. L., Giannoni, E., Raugei, G., Ramponi, G., Chiarugi, P.
(2005). EphrinA1 Repulsive Response Is Regulated by an EphA2 Tyrosine Phosphatase. J. Biol. Chem.
280: 34008-34018
[Abstract]
[Full Text]
-
Lugli, A., Spichtin, H., Maurer, R., Mirlacher, M., Kiefer, J., Huusko, P., Azorsa, D., Terracciano, L., Sauter, G., Kallioniemi, O.-P, Mousses, S., Tornillo, L.
(2005). EphB2 Expression across 138 Human Tumor Types in a Tissue Microarray: High Levels of Expression in Gastrointestinal Cancers. Clin. Cancer Res.
11: 6450-6458
[Abstract]
[Full Text]
-
Nakada, M., Niska, J. A., Tran, N. L., McDonough, W. S., Berens, M. E.
(2005). EphB2/R-Ras Signaling Regulates Glioma Cell Adhesion, Growth, and Invasion. Am. J. Pathol.
167: 565-576
[Abstract]
[Full Text]
-
Lemons, M. L., Barua, S., Abanto, M. L., Halfter, W., Condic, M. L.
(2005). Adaptation of Sensory Neurons to Hyalectin and Decorin Proteoglycans. J. Neurosci.
25: 4964-4973
[Abstract]
[Full Text]
-
Matsuyama, M., Mizusaki, H., Shimono, A., Mukai, T., Okumura, K., Abe, K., Shimada, K., Morohashi, K.-i.
(2005). A novel isoform of Vinexin, Vinexin {gamma}, regulates Sox9 gene expression through activation of MAPK cascade in mouse fetal gonad. GENES CELLS
10: 421-434
[Abstract]
[Full Text]
-
Yu, G., Luo, H., Wu, Y., Wu, J.
(2004). EphrinB1 Is Essential in T-cell-T-cell Co-operation during T-cell Activation. J. Biol. Chem.
279: 55531-55539
[Abstract]
[Full Text]
-
Dail, M., Kalo, M. S., Seddon, J. A., Cote, J.-F., Vuori, K., Pasquale, E. B.
(2004). SHEP1 Function in Cell Migration Is Impaired by a Single Amino Acid Mutation That Disrupts Association with the Scaffolding Protein Cas but Not with Ras GTPases. J. Biol. Chem.
279: 41892-41902
[Abstract]
[Full Text]
-
Nakada, M., Niska, J. A., Miyamori, H., McDonough, W. S., Wu, J., Sato, H., Berens, M. E.
(2004). The Phosphorylation of EphB2 Receptor Regulates Migration and Invasion of Human Glioma Cells. Cancer Res.
64: 3179-3185
[Abstract]
[Full Text]
-
Lai, K.-O., Chen, Y., Po, H.-M., Lok, K.-C., Gong, K., Ip, N. Y.
(2004). Identification of the Jak/Stat Proteins as Novel Downstream Targets of EphA4 Signaling in Muscle: IMPLICATIONS IN THE REGULATION OF ACETYLCHOLINESTERASE EXPRESSION. J. Biol. Chem.
279: 13383-13392
[Abstract]
[Full Text]
-
Mao, W., Luis, E., Ross, S., Silva, J., Tan, C., Crowley, C., Chui, C., Franz, G., Senter, P., Koeppen, H., Polakis, P.
(2004). EphB2 as a Therapeutic Antibody Drug Target for the Treatment of Colorectal Cancer. Cancer Res.
64: 781-788
[Abstract]
[Full Text]
-
Zhang, J.-z., Sinha, M., Luxon, B. A., Yu, X.-j.
(2004). Survival Strategy of Obligately Intracellular Ehrlichia chaffeensis: Novel Modulation of Immune Response and Host Cell Cycles. Infect. Immun.
72: 498-507
[Abstract]
[Full Text]
-
Pratt, R. L., Kinch, M. S.
(2003). Ligand Binding Up-Regulates EphA2 Messenger RNA Through the Mitogen-Activated Protein/Extracellular Signal-Regulated Kinase Pathway. Mol Cancer Res
1: 1070-1076
[Abstract]
[Full Text]
-
Yu, G., Luo, H., Wu, Y., Wu, J.
(2003). Mouse EphrinB3 Augments T-cell Signaling and Responses to T-cell Receptor Ligation. J. Biol. Chem.
278: 47209-47216
[Abstract]
[Full Text]
-
Corson, L. B., Yamanaka, Y., Lai, K.-M. V., Rossant, J.
(2003). Spatial and temporal patterns of ERK signaling during mouse embryogenesis. Development
130: 4527-4537
[Abstract]
[Full Text]
-
Atwal, J. K., Singh, K. K., Tessier-Lavigne, M., Miller, F. D., Kaplan, D. R.
(2003). Semaphorin 3F Antagonizes Neurotrophin-Induced Phosphatidylinositol 3-Kinase and Mitogen-Activated Protein Kinase Kinase Signaling: A Mechanism for Growth Cone Collapse. J. Neurosci.
23: 7602-7609
[Abstract]
[Full Text]
-
Vindis, C., Cerretti, D. P., Daniel, T. O., Huynh-Do, U.
(2003). EphB1 recruits c-Src and p52Shc to activate MAPK/ERK and promote chemotaxis. JCB
162: 661-671
[Abstract]
[Full Text]
-
Murai, K. K., Pasquale, E. B.
(2003). `Eph'ective signaling: forward, reverse and crosstalk. J. Cell Sci.
116: 2823-2832
[Abstract]
[Full Text]
-
Yu, G., Luo, H., Wu, Y., Wu, J.
(2003). Ephrin B2 Induces T Cell Costimulation. J. Immunol.
171: 106-114
[Abstract]
[Full Text]
-
Xu, Z., Lai, K.-O., Zhou, H.-M., Lin, S.-C., Ip, N. Y.
(2003). Ephrin-B1 Reverse Signaling Activates JNK through a Novel Mechanism That Is Independent of Tyrosine Phosphorylation. J. Biol. Chem.
278: 24767-24775
[Abstract]
[Full Text]
-
Sharfe, N., Freywald, A., Toro, A., Roifman, C. M.
(2003). Ephrin-A1 Induces c-Cbl Phosphorylation and EphA Receptor Down-Regulation in T Cells. J. Immunol.
170: 6024-6032
[Abstract]
[Full Text]
-
Freywald, A., Sharfe, N., Rashotte, C., Grunberger, T., Roifman, C. M.
(2003). The EphB6 Receptor Inhibits JNK Activation in T Lymphocytes and Modulates T Cell Receptor-mediated Responses. J. Biol. Chem.
278: 10150-10156
[Abstract]
[Full Text]
-
Delehanty, L. L., Mogass, M., Gonias, S. L., Racke, F. K., Johnstone, B., Goldfarb, A. N.
(2003). Stromal inhibition of megakaryocytic differentiation is associated with blockade of sustained Rap1 activation. Blood
101: 1744-1751
[Abstract]
[Full Text]
-
Tong, J., Elowe, S., Nash, P., Pawson, T.
(2003). Manipulation of EphB2 Regulatory Motifs and SH2 Binding Sites Switches MAPK Signaling and Biological Activity. J. Biol. Chem.
278: 6111-6119
[Abstract]
[Full Text]
-
Miller, M. A., Ruest, P. J., Kosinski, M., Hanks, S. K., Greenstein, D.
(2003). An Eph receptor sperm-sensing control mechanism for oocyte meiotic maturation in Caenorhabditis elegans. Genes Dev.
17: 187-200
[Abstract]
[Full Text]
-
Nagashima, K.-I., Endo, A., Ogita, H., Kawana, A., Yamagishi, A., Kitabatake, A., Matsuda, M., Mochizuki, N.
(2002). Adaptor Protein Crk Is Required for Ephrin-B1-induced Membrane Ruffling and Focal Complex Assembly of Human Aortic Endothelial Cells. Mol. Biol. Cell
13: 4231-4242
[Abstract]
[Full Text]