Previous Article | Next Article 
Molecular and Cellular Biology, November 2001, p. 7495-7508, Vol. 21, No. 21
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.21.7495-7508.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Mechanism of Poly(A) Signal Transduction to
RNA Polymerase II In Vitro
Dong P.
Tran,
Steven J.
Kim,
Noh Jin
Park,
Tiffany M.
Jew, and
Harold G.
Martinson*
Department of Chemistry and Biochemistry,
University of California at Los Angeles, Los Angeles, California
90095-1569
Received 29 March 2001/Returned for modification 25 May
2001/Accepted 26 July 2001
 |
ABSTRACT |
Termination of transcription by RNA polymerase II usually requires
the presence of a functional poly(A) site. How the poly(A) site signals
its presence to the polymerase is unknown. All models assume that the
signal is generated after the poly(A) site has been extruded from the
polymerase, but this has never been tested experimentally. It is also
widely accepted that a "pause" element in the DNA stops the
polymerase and that cleavage at the poly(A) site then signals
termination. These ideas also have never been tested. The lack of any
direct tests of the poly(A) signaling mechanism reflects a lack of
success in reproducing the poly(A) signaling phenomenon in vitro. Here
we describe a cell-free transcription elongation assay that faithfully
recapitulates poly(A) signaling in a crude nuclear extract. The assay
requires the use of citrate, an inhibitor of RNA polymerase II
carboxyl-terminal domain phosphorylation. Using this assay we show the
following. (i) Wild-type but not mutant poly(A) signals instruct the
polymerase to stop transcription on downstream DNA in a manner that
parallels true transcription termination in vivo. (ii) Transcription
stops without the need of downstream elements in the DNA. (iii)
cis-antisense inhibition blocks signal transduction,
indicating that the signal to stop transcription is generated following
extrusion of the poly(A) site from the polymerase. (iv) Signaling can
be uncoupled from processing, demonstrating that signaling does not
require cleavage at the poly(A) site.
| |
INTRODUCTION |
It has become clear in recent years
that RNA polymerase II (RNAPII) not only transcribes the mRNA but
shepherds it through the stages of processing as well (42,
67). An early indicator of this coupling between transcription
and processing was the finding that the poly(A) signal for cleavage and
polyadenylation of pre-mRNA directs not only 3'-end processing of the
transcript but also termination of transcription by the polymerase
(20, 32, 50, 61, 77, 79). A major challenge has been to
explain how the poly(A) signal communicates with the polymerase.
The core poly(A) signal in vertebrates consists of two recognition
elements flanking a cleavage-polyadenylation site (76, 82). Typically, an almost invariant AAUAAA hexamer
lies 20 to 50 nucleotides (nt) upstream of a more variable
element rich in U or GU residues. Cleavage of the nascent transcript
occurs between these two elements and is coupled to the addition of up
to 250 adenosines to the 5' cleavage product. The cleavage is mediated in vitro by a large, multicomponent protein complex that can be separated into five distinguishable factors. Two of these factors are
the cleavage and polyadenylation specificity factor (CPSF), which binds
the AAUAAA motif, and the cleavage stimulation factor (CstF), which binds the downstream U-rich element. In vitro studies suggest that CPSF (26) and probably CstF as well
(55, 71) are recruited to the polymerase at the promoter.
Presumably they then ride with the polymerase during transcription,
scanning the extruding transcript so as to snare the poly(A) site when
it emerges. The situation in yeast may be similar (8, 29).
Strictly speaking, the term "poly(A) site" refers only to the point
at which cleavage occurs and the poly(A) tail is appended, but we use
the term here to refer to the poly(A) signal as a whole when this helps
to distinguish between the poly(A) signal as an entity and poly(A)
signal transduction [or "poly(A) signaling"] as a process.
Models that attempt to explain transduction of the signal from the
poly(A) site to the polymerase can be divided into two categories
(50): (i) cleavage-dependent models, in which the poly(A) site is recognized by virtue of the processing that it carries
out, and (ii) cleavage-independent models, in which the poly(A) site is
recognized directly by a component of the transcription elongation
complex. Cleavage-independent models were initially favored
(50) and recently gained renewed support from the finding that CPSF and CstF may be components of the transcription elongation complex (55). As such, these factors would presumably be
positioned to recognize the poly(A) site as soon as it emerges so as to
transduce a termination signal to the polymerase. This is the mechanism used by the vaccinia virus RNA polymerase (27, 40), which closely resembles RNAPII in many aspects of structure and mechanism (see reference 28). Moreover, elongating polymerases not
only carry factors that can recognize signals in the extruding RNA (see
also reference 23), but they also have considerable
intrinsic potential to recognize sequence elements at both the DNA and
RNA levels prior to extrusion (4, 58). Thus,
cleavage-independent models readily offer plausible scenarios for
poly(A) signaling based on recognition of the signal either prior to,
during, or following extrusion.
However, the preferred model for poly(A) signaling has for many years
been a cleavage-dependent model in which the signal is generated by the
new, uncapped RNA 5' end resulting from poly(A) site cleavage
(20, 68, 81). According to this model the new 5' end
recruits a signal-transducing 5' exonuclease which chases the
polymerase by processively degrading the RNA, thereby to deliver the
signal. Consistent with this hypothesis, Edwalds-Gilbert et al.
(32) and Birse et al. (14) reported a close
correlation between processing efficiencies and termination
efficiencies for a variety of mutated poly(A) sites and processing
factors, suggesting that some aspect of the process leading to poly(A)
site cleavage is involved in generating the signal to terminate.
A different point of view has been expressed by Batt et al.
(10) and Osheim et al. (61), who favored a
cleavage-independent mechanism for transcription termination. However,
neither of these groups actually assayed termination itself. The data
in the work of Batt et al. (10) reflected variations in
processing efficiency rather than termination, while the polymerase
stacks in the electron micrographs of Osheim et al. (61)
may well have resulted from polymerase pausing or arrest. Osheim et al.
(61) pointed out that the stacked-up polymerases in their
micrographs carried mostly uncleaved, full-length transcripts although
the stacks extended across the poly(A) site. This is actually
consistent with current cleavage-dependent models in which cleavage
triggers termination as part of a single, concerted reaction (11,
30, 67, 80). This underscores the difficulty until now of
distinguishing experimentally between cleavage-dependent and
cleavage-independent models and has even led to the suggestion that
there is no mechanistic common denominator to poly(A) signaling,
termination being cleavage dependent, cleavage independent, or both
cleavage and 5'-exonuclease dependent according to circumstance
(81).
Transcriptional pause elements in the DNA downstream of the poly(A)
signal have long played a prominent role in models for poly(A)-dependent termination (2, 13, 41, 68, 81). Pausing
of the polymerase is thought to be necessary to allow the poly(A) site
time to act and, thereby, to signal the polymerase. Consistent with
this hypothesis pausing is indeed frequently observed to occur
downstream of poly(A) sites (7, 13, 16, 33, 41, 53, 74,
78). Also consistent with this hypothesis, some poly(A) sites
are known to be accompanied by downstream elements that enhance
cleavage and polyadenylation and/or termination or arrest (2, 6,
13, 21, 31, 33, 72). Although these elements are usually
referred to as pause elements because of a presumption about their
mechanism of action, it has not been confirmed that they actually cause
the pausing seen downstream of poly(A) sites in vivo. Moreover, pausing
per se does not enhance cleavage and polyadenylation in vitro
(80). Indeed, unlike confirmed pause elements (24,
45, 62, 65, 70), these downstream elements are not associated
with pausing in a consistent way
pausing being found variously
upstream, downstream, or coincident with the elements (2, 13, 33,
41). This has been attributed to DNA sequence artifacts related
to the nascent transcript analysis used to detect pausing and
termination (2). However, the widespread occurrence of
broad zones of apparent pausing downstream of poly(A) sites suggests
that the pausing itself is genuine and that it is the mechanistic
relationship of this pausing to the downstream elements that is
obscure. Thus, it is not known whether elements in downstream DNA
enhance processing and termination through pausing or by some other
mechanism such as by a direct effect on the poly(A) signal itself
(19, 52). Nor is it known whether the pausing commonly
seen downstream of poly(A) sites is due to additional elements in the
downstream DNA or to an effect of the poly(A) signal itself on events
that occur downstream.
Given the uncertainties concerning the number and nature of elements in
a typical poly(A)-dependent terminator together with the uncertainties
concerning the basis of poly(A) dependence itself, we have adopted a
parsimonious approach to the study of poly(A)-dependent termination.
First, we have concentrated exclusively on the core of the poly(A)
signal in order to determine its unique contribution to termination. To
do this we have capitalized on our previous finding that the core of
the simian virus 40 (SV40) early poly(A) signal is capable of inducing
efficient termination in vivo without the assistance of any downstream
elements in the DNA (79). Thus, we eliminate ambiguities
related to the role of such elements in termination.
Second, we have limited our attention to the signaling step of
poly(A)-dependent terminationi.e., how the poly(A) site makes its
presence known to the polymerase. The immediate consequence of
signaling need not be transcript release as is generally assumed. It
could be pausing, consistent with the apparent collection of paused
transcription complexes seen in the striking electron micrographs of
Osheim et al. (61) and as suggested by the broad pausing profiles commonly seen downstream of poly(A) sites following nascent transcript run-on analysis (7, 13, 16, 33, 41, 53, 74,
78). We have therefore designed an assay that measures the
collective effects of the poly(A) signal on the efficiency of
transcription elongation. Thus, we detect the first effect of the
poly(A) site on transcription [i.e., poly(A) signaling], whether that
effect is complete termination, halting of the polymerase, or merely
slowing down transcription.
Finally, wishing to address questions of mechanism in a direct way, we
have devised an in vitro system for studying poly(A) signaling. There
have been prior reports suggesting successful coupling in vitro of
polyadenylation to termination. However, one such report
(57) actually described measurements not of termination
but of poly(A) site cleavage, while another (81) failed to
show that the termination under study was dependent on the presence of
a poly(A) signal. In contrast, we now describe an in vitro system that
faithfully reproduces signaling from the poly(A) site to the
polymerase, and we validate this in vitro assay by reference to an in
vivo assay that is free of the potential artifacts associated with
conventional hybridization-based nascent transcript analysis
(79). We show below that signaling in vitro does not
require pause elements in the DNA and does not require cleavage of the
transcript but does require extrusion of the poly(A) site from the
polymerase. This is the first successful demonstration of poly(A)
signaling in vitro.
| |
MATERIALS AND METHODS |
Plasmids.
In our nomenclature, subscripts (as in
APw and APm) refer to
plasmids with wild-type and mutant poly(A) signal hexamers,
respectively. Often the subscripts are omitted when the context is
clear or when mutant and wild-type versions of the plasmid are being
referred to collectively or generically. Brackets (as in 
cat
)
refer to G-less cassettes of 120 and 261 bp flanking the indicated
sequence unless otherwise specified, as in 117cat.
Plasmids not described elsewhere were constructed as follows. For
pAPw117cat, a BamHI site was
introduced into the 377-bp precassette of pAPcat
(79) by site-directed mutagenesis, and the resulting
323-bp BamHI fragment was removed, leaving a 117-bp
precassette. pAPm117cat was
constructed as described above except that the poly(A) signal was first
inactivated by mutating the hexamer (AATAAA
AgTAct
[lowercase letters indicate mutations]) using site-directed
mutagenesis. For pAPcat, SmaI and
HindIII sites were added at the 3' end of the upstream
cassette (simultaneously lengthening it to 120 bp) in the
pAP117cat plasmids by use of site-directed mutagenesis
(gcttggcgagattcccgggcaagctt). For
pAP377, the pAPcat plasmids were cut with
HindIII and EcoRV and the
BamHI-RsaI fragment containing the 377-bp G-less cassette from pAPcat was inserted. The construction of
pAPC9 was like that for pAP377, but
the insert, C9, was a 1,012-bp piece of DNA
consisting primarily of nine copies of an arbitrarily selected
102-bp sequence from the middle of the C2 region
of 
-globin 3'-flanking DNA (79), containing no
known functional elements. For
p377A174PC9, the 377-bp G-less
cassette (above) and a 174-bp cassette were inserted into
pAPC9 at the StuI and
HpaI sites, respectively. The 174-bp cassette was obtained
by cutting pAPcat with BglII and HinfI
after site-directed mutagenesis (atatttaGatCt) of the 261-bp cassette. For pAPC9377, the
1,012-bp C9 fragment was inserted into
SmaI-cut pAP377.
Poly(A) signaling assay.
HeLa nuclear extract was prepared
exactly as described by Flaherty et al. (34) except that
the final centrifugation was at 13,000 × gav for 30 min. The extract was
dialyzed against buffer D until the conductances of the extract and the
buffer were equal (5 to 7 h). The extract was then aliquoted and
stored in liquid nitrogen. Different extracts vary somewhat in their properties.
A typical signaling assay began with 6 to 12.5 µl of nuclear
extract, which was brought to a total volume of 12.5 µl with buffer
D. This was then mixed with sodium citrate, dithiothreitol, creatine
phosphate, MgCl2, anti-RNase (Ambion), DNA, and
water up to a volume of 22 µl. The mixture was preincubated at 30°C for 30 min, and then 3 µl of nucleoside triphosphate mix containing 20 µCi of [
-32P]CTP (800 Ci/mmol) was
added and transcription was allowed to continue for 15 min. Final
concentrations in a typical transcription mixture were as follows: 10 mM HEPES (pH 7.9); 10% glycerol; 50 mM KCl; 0.1 mM EDTA; 2 mM
dithiothreitol; 8 mM sodium citrate (pH 6.7); 20 mM creatine phosphate;
5 mM MgCl2; 15 to 30 U of anti-RNase; 0.6 µg of
DNA; a 200 µM concentration (each) of ATP, GTP, and UTP; and 5 µM
unlabeled CTP. Any variations from this standard procedure are noted in
the figure legends. Because of some variations between experiments,
including the use of several different extract preparations,
comparisons of absolute signaling efficiency should be made only
within, not between, figures.
For most of the experiments reported in this work, transcription
was stopped by addition of 1 µl each of
-amanitin (1 mg/ml;
Sigma)
and DNase I (2 U/µl; Ambion). After 10 min at room temperature,
1 µl each of 50 mM EDTA and RNase T
1 (200 to 250 U/µl; Ambion)
was added for 15 min at 30°C. Then 1 µl of
proteinase K (20 mg/ml)
was added and, after 10 min at room
temperature, the reaction
was extracted with 350 µl of TRIzol (Gibco
BRL) and 70 µl of chloroform.
However, a simpler procedure is often
adequate, in which transcription
is stopped using 2 µl of 250 mM EDTA
containing 200 U of RNase
T
1, followed, after 15 min, by TRIzol extraction. The RNA was
precipitated with 1.5 to 2 µl
of
Saccharomyces cerevisiae tRNA
(10 mg/ml; Sigma)
and 350 µl of isopropanol (10 min, room temperature),
spun in a
microcentrifuge (10 min, 4°C), washed with 150 µl of
75%
ethanol, resuspended in 15 µl of 7 M urea-loading dye, heated
at
90°C for 5 min, chilled immediately on ice for 1 min, and loaded
onto
an 8% polyacrylamide gel to separate the G-less transcription
products. For analyzing transcripts containing antisense sequences,
one
or two additional digestions with T
1 under
denaturing conditions
were carried out, as follows. Instead of
resuspending in urea
after the first precipitation, the RNA was
resuspended in 32 µl
of 50% formamide-0.5 mM Tris-0.5 mM EDTA (pH
8) and then heated
to 90°C for 5 min. After cooling to 37°C, 7 µl
of RNase T
1 (1,000
U/µl) was added and the
samples were placed in an oven at 63°C
for 1 h. Extraction with
TRIzol and subsequent steps were then
carried out as described
earlier.
Following electrophoresis, results were recorded and analyzed
using a PhosphorImager with ImageQuant software (Molecular Dynamics).
Unless otherwise indicated, results are reported as the average
of two
separate experiments carried out on different days. Error
bars indicate
the range of values obtained in the two individual
experiments. For
most individual experiments, reactions were carried
out in duplicate
and the averages of the duplicates were taken
as the outcome of the
experiment.
Nascent transcript G-less cassette analysis of poly(A)-dependent
termination in vivo (79).
COS cells were grown in
35-mm-diameter wells and transfected with plasmid DNA using Fugene 6 (Roche). After 48 h cells were rinsed twice with cold
phosphate-buffered saline and lysed with a solution containing 0.5%
IGEPAL (Sigma), 10 mM Tris (pH 7.4), 3 mM
MgCl2, and 10 mM NaCl. Nuclei were pelleted and
then resuspended in 15 µl of 50 mM Tris (pH 8.3)-0.1 mM EDTA-40%
glycerol-5 mM MgCl2. Run-on transcription was
carried out for 45 min at 30°C following addition of 16 µl of a
solution containing 10 mM Tris (pH 8), 5 mM
MgCl2, 600 mM
(NH4)2SO4,
1 mM ATP, 1 mM UTP, 0.2 mM 3'-OMeGTP, 6 mM dithiothreitol, 20 U of
anti-RNase, and 1 µl of 180 µM CTP containing 30 µCi of
[-32P]CTP. After a 10-min cold chase with 1 µl of 40 mM CTP, 1 µl (15 U) of T1 RNase and
1 µl of 50 mM EDTA were added for an additional 30 min at 30°C.
Following digestion with 2 µl of DNase I (20 U) for 15 min at 30°C,
1.8 µl of 10% sodium dodecyl sulfate was added. The sample was then
extracted with 500 µl of TRIzol and 140 µl of chloroform, and 20 µg of carrier tRNA and 500 µl of isopropanol were added to the
aqueous phase to precipitate the RNA. The RNA was resuspended in 32 µl of 10 mM Tris-1 mM EDTA (pH 7), heated for 2 min at 90°C, and
cooled on ice for 1 min, and then 1 µl (250 U) of
T1 was added for 30 min at 30°C. TRIzol (350 µl) extraction was then carried out in a manner similar to that
described above.
RNase protection assay.
RNA from the equivalent of four
standard signaling assays (with cold CTP replacing
[-32P]-CTP) or transfected RNA was analyzed
as described (18) with hybridization carried out at
63.5°C. The probe used was a T7 RNA polymerase transcript of
BglI-digested pAPcat into which the T7 promoter
(HincII-PvuII fragment from pBluescript II SK
[Stratagene]) had been inserted at the HindIII site.
| |
RESULTS |
Poly(A) signaling in vitro mimics poly(A)-dependent termination in
vivo.
Poly(A) signaling in our system is detected as a decrease in
the elongation efficiency of RNAPII after crossing a poly(A) site. To
measure signaling we modified a G-less cassette assay previously used
to monitor the efficiency of transcriptional elongation in vitro
(48, 51). Figure 1
illustrates the use of this assay to study signaling during
transcription in nuclear extracts and compares the results obtained for
signaling in vitro with parallel results obtained for termination in
vivo.
View larger version (26K):
[in this window]
[in a new window]
|
FIG. 1.
Poly(A) signaling in vitro. (A) The
pAPC9377 construct drawn to scale. The arrows
indicate the start point of transcription for the SV40 early-early
promoter (9) and the position of poly(A) site cleavage
(20). (B) G-less cassette transcripts from a signaling
assay carried out with mutant and wild-type versions of
pAPC9377. The line graphs showing signal intensities
for the two gel lanes were superimposed, but offset slightly for
clarity, and then aligned with the gel images. (C) Quantitative
comparison of poly(A) signaling in vitro with poly(A)-dependent
termination in vivo on the pAPC9377 template. The
efficiency of elongation (% wild-type readthrough) downstream of the
wild-type poly(A) site is expressed (after normalizing all signals on
each template to that for the 120-nt cassette) as the ratio of the
intensity for each cassette on the wild-type template to that for the
same cassette on the mutant template. (The images in panel A were also
normalized with respect to the 120-nt cassette for purposes of
presentation.)
|
|
Figure
1A shows a diagram of pAP
C
9377
, the
DNA template used for these experiments. It contains the core SV40
early poly(A)
signal followed immediately by a short, 120-nt G-less
cassette.
Two additional cassettes, distinguishable in size, lie
farther
downstream, separated from the upstream cassette by a spacer
sequence
(called C
9). The efficiency of
elongation downstream of the poly(A)
site is indicated by the extent to
which the two downstream cassettes
(postcassettes) are transcribed
relative to the upstream cassette
(precassette). Poly(A) signaling is
evident when this elongation
efficiency is less for templates with
wild-type poly(A) sites
than for templates with mutant poly(A) sites
(hereafter called
mutant or wild-type
templates).
Figure
1B, lane 1, shows the G-less RNAs that survive RNase
T
1 digestion of the transcripts produced in vitro
from the wild-type
version of the pAP
C
9377
template. Lane 2 shows the results,
obtained in parallel, for the
mutant version of the template which
differs only in that the AATAAA
hexamer of the poly(A) signal
has been mutated to AgTAct. Clearly the
downstream cassettes are
transcribed less efficiently from the
wild-type template than
from the mutant template. The results are
presented quantitatively
to the right of the gel images. The molar
ratio of 261-nt postcassette
transcripts to 120-nt precassette
transcripts is 0.51 for the
mutant but only 0.19 for the wild-type
template. Thus, transcriptional
elongation on the wild-type template
between the 120- and the
261-nt cassettes is only 37% as efficient as
on the mutant template.
In Fig.
1B and C, and throughout this report,
we refer to this
as the percent wild-type
readthrough.
We note that the postcassette/precassette molar ratio is less
than one even for the mutant template. This may reflect, in
part,
frequent pause and/or arrest of RNAPII induced by the low
concentrations of CTP in our transcription mixtures (
66)
combined
with protein binding to the DNA in our extracts and an
insufficient
concentration of TFIIS to efficiently override these
nonspecific
impediments to transcription (
47). The low
postcassette/precassette
ratio also reflects our use of relatively
short transcription
times for these experiments. We have chosen to
concentrate our
attention on the forward wave of polymerases that
elongate most
efficiently down the template, which means that many
stragglers
and late-initiating polymerases will have transcribed the
precassette
but not yet arrived at the postcassette by the time that we
stop
the reaction. However, these effects of transcription time and
CTP
concentration do not compromise our conclusions, because they
apply to
both wild-type and mutant templates equally and are thus
normalized
away when we take the wild-type/mutant ratios. Control
experiments show
that none of our conclusions depends on the particular
transcription
time or concentration of CTP
chosen.
The ability of the wild-type poly(A) signal to decrease recovery of the
downstream cassettes relative to the upstream cassette
reflects a
decrease in downstream transcription on the wild-type
template. The
reduced recovery is not a consequence of preferential
degradation of
the downstream cassettes following 3' end processing
of the wild-type
transcript. This conclusion follows from the
design of the template:
all three cassettes in pAP
C
9377
lie
downstream of the poly(A) signal (Fig.
1A). Thus, although processing
would indeed destabilize downstream RNA, this would include all
of the
cassettes. Moreover, the upstream cassette would, if anything,
be more,
not less vulnerable to degradation since degradation
is probably
mediated by a 5'-specific exonuclease (
60,
81).
Therefore,
the observed effect must be transcriptional, not posttranscriptional,
in nature (see also
below).
Next we asked whether the poly(A) signaling observed in vitro (Fig.
1B)
is related to poly(A)-dependent termination as measured
in vivo
(
79). To measure termination in vivo we transfected
mutant
and wild-type pAP
C
9377
into COS cells. We
then harvested
nuclei after 2 days and carried out nascent-transcript
analysis
to determine the steady-state distribution of polymerases over
the three G-less cassettes in vivo (
79). It should be
emphasized
that this nascent-transcript G-less-cassette analysis
reflects
actual termination in vivo (not pausing) and is free of many
of
the potential artifacts associated with conventional run-on
transcription-hybridization
analyses (see reference
79 for
a discussion). Figure
1C is a
plot of the efficiency with which
polymerases reach the downstream
cassettes on the wild-type compared to
the mutant templates both
in vivo and in vitro. Clearly the signaling
that occurs in vitro
closely parallels the termination that occurs in
vivo. We conclude
that signaling either yields termination directly, or
it triggers
an event such as pausing that leads to termination with
high
efficiency.
Poly(A) signaling commences at the poly(A) site.
The results
of Fig. 1 show that transcription is impaired downstream of a wild-type
poly(A) site. The simplest interpretation is that the polymerases
become transcriptionally impaired as a consequence of crossing the
poly(A) site. However, it is formally possible that the wild-type
template differs from the mutant template in some global property
(e.g., supercoiling) that impairs transcription throughout the plasmid.
To distinguish between these possibilities, we assayed transcription
both upstream and downstream of the poly(A) site on mutant and
wild-type versions of the p377A174PC9
template. This plasmid contains four cassettes, two upstream and two
downstream of the poly(A) site (Fig. 2).
View larger version (39K):
[in this window]
[in a new window]
|
FIG. 2.
Transcription is impaired only downstream of the poly(A)
site. (A) Cassettes are transcribed sequentially from the SV40 early
promoter. Transcription of the mutant version of
p377A174PC9 was carried out as described in Materials
and Methods except that 7 mM Mg2+ and 7 mM citrate were
used, and transcription times were varied from 1 to 32 min. The top
panel shows molar amounts of each cassette produced plotted on an
arbitrary scale. The bottom panel shows molar ratios of each cassette
produced relative to the 377-nt cassette. (B) Elongation
efficiency drops after crossing the poly(A) site. The percent
readthrough for each cassette on the wild-type template relative to
that of the mutant is plotted, as for Fig. 1C, above a scale map of the
template.
|
|
First, we confirmed that the four cassettes in this plasmid are
transcribed successively, as predicted for polymerases that
initiate at the SV40 early promoter, and then traverse each
cassette
in turn. To avoid any effect on transcription from an
active poly(A)
site we used the mutant version of
p377A174P
C
9 for these preliminary
experiments. Figure
2A (top panel) shows that the cassette RNAs
do
indeed appear sequentially during transcription and then build
in
concentration. In the bottom panel of Fig.
2A the cassette
RNA
concentrations are expressed relative to that of the first
cassette in
the series to emphasize their sequential appearance.
Figure
2B shows
that the cassettes upstream of the poly(A) site
are transcribed
similarly from the mutant and wild-type templates
but that, downstream
of the poly(A) site, transcription on the
wild-type template rapidly
falls off. Thus, transcription on the
wild-type template diminishes
relative to the mutant only after
the polymerases cross the poly(A)
site.
Different poly(A) sites signal similarly.
Figure
3 summarizes results showing that in
addition to P (the core SV40 early site), both S (SPA of reference
49) and L (the complete SV40 late site) carry out
signaling in our assay. Thus,
pAPwC9377 exhibits
impaired elongation compared to its mutant (Fig. 3, constructs 1 and 2)
as we have already shown (Fig. 1). However, when the mutant poly(A)
site of pAPmC9377 was
replaced, following HpaI-BamHI digestion, by
either wild-type S (construct 3) or wild-type L (construct 4),
signaling was restored. Thus, the ability of the system described here
to support signaling in vitro is quite general.
View larger version (22K):
[in this window]
[in a new window]
|
FIG. 3.
Poly(A) signaling by different poly(A) sites. Construct
pASwC9377 was obtained by replacing the
mutant poly(A) site of pAPmC9377 with an
HpaI-BamHI fragment differing only at the
ends from the SPA sequence used previously (18):
5'-aacaataa... tgtgtctagaactagtg-3'. Similarly, for
pALwC9377 the mutant poly(A) site was
replaced with a SmaI-BamHI-trimmed PCR
copy of the SV40 late site differing only at the ends from that used
previously (18): 5'-ggggatctggac...
tgggag-3'. The histogram shows the percent readthrough for the
261-nt cassette of each template relative to that of
pAPmC9377. For the extract preparation
used in these assays the citrate and Mg2+ concentrations
were both 7 mM.
|
|
Characteristics of the signaling reaction.
The most striking
characteristic of the in vitro poly(A) signaling reaction is the
citrate requirement. This is illustrated in Fig.
4A where the efficiency
of signaling (i.e., 100 
% readthrough) is plotted as a
function of citrate concentration. Signaling is not observed in the
absence of citrate, but as the citrate concentration is increased (in
the presence of 7 mM Mg2+ for this extract)
signaling rises and goes through a maximum at a citrate concentration
of about 8 mM (Fig. 4A). Citrate curtails RNAPII carboxyl-terminal
domain (CTD) phosphorylation and reduces the elongation efficiency of
transcription in vitro (64). We were drawn to the use of
citrate in the signaling reaction because of the role of citrate in
allowing the transactivation response (TAR) element in nascent
human immunodeficiency virus (HIV) transcripts to mediate an increase
in HIV transcription elongation efficiency (64). In the
absence of citrate, apparently, the intrinsic elongation efficiency of
HIV transcription is too high to be augmented by TAR. Similarly, after
a long period of fruitless experimentation, we reasoned that perhaps
the intransigence of our system reflected an intrinsic transcription
elongation efficiency that was too high in vitro to be abrogated by the
poly(A) signal.
View larger version (26K):
[in this window]
[in a new window]
|
FIG. 4.
Citrate and Mg2+ titrations of the signaling
reaction. Total transcription refers to the yield, in arbitrary
PhosphorImager units, of the 120-nt cassette from the mutant template.
It is called total transcription because both initiation and elongation
efficiencies contribute to the yield. Elongation efficiency is defined
here as the efficiency of 120- to 261-nt cassette readthrough,
in this case when signaling is absent (i.e., the molar ratio of 261- to
120-nt cassette transcription on the mutant template). Signaling is
defined as 100% % wild-type readthrough (i.e., 100 minus the wild
type-versus-mutant elongation efficiency ratio, expressed as a
percentage). Points without error bars correspond to values taken from
a single experiment only. Several different extract preparations were
used for the experiments reported in this paper. Therefore, the citrate
and Mg2+ optima exhibited in this figure differ slightly
from the concentrations used for other experiments reflecting the use
of a different extract preparation here. Also note in panels B and C that equivalent signaling
efficiencies can be obtained using different combinations of citrate
and Mg2+ concentrations, further accounting for the use of
different concentrations of these constituents in different
experiments.
|
|
The results in Fig.
4A show how the relationship between signaling and
elongation efficiency varies as a function of citrate
concentration.
The hypothesized inverse correlation between these
two parameters is
evident between 4 and 8 mM citrate as the signaling
curve rises to its
maximum. At higher citrate concentrations (10
and 12 mM) signaling
declines. This decline may reflect, in part,
the ability of citrate to
chelate Mg
2+, since the detection of signaling in
our system is impaired at
low [Mg
2+] (Fig.
4B
and
C).
Figure
4A also confirms that the effect of citrate on transcription is
principally at the level of elongation rather than
initiation, since
the elongation efficiency curve closely matches
the curve for total
transcription in the range of 4 to 12 mM citrate.
It is not surprising
that elongation efficiency is an important
determinant of cassette
yield since, for templates such as
pAP
C
9377
,
even the first cassette lies
nearly 800 bp downstream of the start
point of transcription. The curve
for total transcription drops
below that for elongation efficiency at 0 mM citrate, probably
because initiation is impaired at the higher free
Mg
2+ concentration that exists in the absence of
chelation by citrate.
This [Mg
2+] is
considerably higher than the optimum for the SV40 early promoter
(<2
mM) in our extracts (data not shown). A similar effect is
apparent in
Fig.
4B and C, where the curve for total transcription
decreases at
high Mg
+ concentrations despite continuing
increases in elongation
efficiency.
In addition to citrate, the signaling reaction at its present state of
development requires that the nuclear extract be very
crude. As yet we
have not subjected this parameter to careful
scrutiny, but consistently
we have obtained the best signaling
with extracts subjected only to a
relatively low-speed spin following
extraction of the nuclei (see
Materials and Methods). The state
of the DNA (linear or supercoiled),
its method of purification
(spin column, gel, or CsCl), and the
presence or absence of DNA
or RNA carrier are unimportant to signaling.
Cassette signals
are completely
-amanitin sensitive at 0.2 µg/ml
(data not shown)
and therefore arise entirely from RNAPII
transcription. In summary,
poly(A) signaling in our in vitro system is
robust and reproducible
and therefore suitable for use in mechanistic
studies.
Poly(A) signaling resembles a stochastic process and requires no
special element in the downstream DNA.
The data in Fig. 1C suggest
that the ability to elongate is lost increasingly with distance after
crossing the poly(A) site. This trend is illustrated further in Fig.
5, which shows examples of experiments
that are representative of our experience with the system. In Fig. 5
the histogram peaks have been aligned with the distal ends of their
corresponding cassettes to reflect the distances that must be traveled
by the individual polymerases to produce the various cassette
transcripts. The data show that transcription gradually decreases
across more than 1.8 kb of DNA downstream of the core SV40 early
poly(A) site. We have shown previously that commitment of the SV40
early poly(A) site to cleavage and polyadenylation in vivo is a
stochastic process (18). In this respect, signaling by
this poly(A) site to stop transcription appears to be similar.
View larger version (29K):
[in this window]
[in a new window]
|
FIG. 5.
Transcription diminishes gradually with distance
following the poly(A) site. Poly(A) signaling on the
pAPC9377 template (Fig. 1B) is compared with that of
two other templates having cassettes separated by shorter distances.
Only single examples of reactions with pAP377 and
pAPC9 are presented here. These reactions were
carried out under conditions similar to those described for Fig. 1B and
could therefore be directly compared. However, the conclusions for
these constructs are consistent with numerous other experiments carried
out under a variety of slightly different conditions (that prevent
their being plotted on the same graph).
|
|
Significantly, the poly(A)-dependent decrease of transcription for the
templates in Fig.
5 appears to be relatively insensitive
to the nature
of the downstream DNA. Thus, for the pAP
377
template,
substantial
poly(A)-dependent loss of transcription occurs across
a region that
contains no eukaryotic DNA. In this template the
DNA contains, for more
than 1 kb downstream of the poly(A) signal,
only a mixture of
artificial sequences (G-less cassettes and multiple
cloning sites) and
prokaryotic DNA (chloramphenicol acetyltransferase
and
pBR322). In contrast, the DNA between the cassettes in
pAP
C
9 is mostly eukaryotic in origin,
having been obtained from the
transcription termination region of the
chicken
H globin gene. Yet both templates fit
the same trend for decrease
of transcription with distance following
the poly(A) site. This
lack of sensitivity to the nature of the
underlying DNA is further
underscored by the results for pAP
cat
of Fig.
6. Here the poly(A)-dependent
loss of transcription takes place across yet a different downstream
DNA
sequence, but the effect still fits the trend shown in Fig.
5. Since
DNA from eukaryotic termination regions, prokaryotic
coding regions,
and artificial constructs all support signaling
similarly, we conclude
that signaling in vitro does not require
any special element in the
downstream DNA.
View larger version (45K):
[in this window]
[in a new window]
|
FIG. 6.
Signaling is not an early event following poly(A) site
transcription. (A) Signaling can be inhibited by an antisense
transcript placed 126 nt downstream of the poly(A) site. The antisense
segment (open arrow) is the HinfI-BamHI
fragment of the sequence in panel B inserted backwards into either
HindIII- or EcoRV-cut pAPcat. The
region targeted by the antisense sequence is denoted by the grey arrow.
The sense-antisense separations for constructs 2 and 3 are 126 and 686 nt, respectively. (B) Sequence for the region denoted by the square
bracket over construct 2 in panel A. The sequence for the wild-type
version, pAPwcat, is shown. The complete sense
region (underlined) and part of the antisense region (also underlined)
are presented. The poly(A) signal and its downstream complement are
shown in boldface type. The G-less cassette is shown in lowercase type.
(C) Diagram, drawn linearly to scale, of the stem-loop structure
predicted to form in the sense-antisense region of transcripts from the
mutant version, pAPmcat, of construct 2. The tick
marks above and below the duplex indicate the positions of G residues.
Note that since it is the mutant version of the stem-loop that is
shown, there is a G in the hexamer region of the sense strand
reflecting the presence of the hexamer mutation (see Materials and
Methods). Accompanying this mutation is a small interruption of base
pairing in the stem at the position of the hexamer since the wild-type
sequence was used for the antisense module in all of our constructs.
The loop is comprised of 117 nt from the 120-nt G-less cassette plus 9 nt of non-G-less sequence at its 3' end. Three nucleotides at the 5'
end of the G-less cassette invade the sense-antisense duplex. Multifold
secondary structure analysis (44) predicts that the three
G residues flanking the 3' end of the cassette interact with a patch of
C's (shown in white) near its 5' end. This secondary structure model
for the sense-antisense stem-loop predicts more efficient cutting by
RNase T1 in sequences flanking the base of the stem (dark
arrow) than within its loop (open arrow) and slower cutting still
(dotted arrow) at the mispaired G residue in the mutated hexamer
(38). (D) RNase T1 digestion confirms the
predicted secondary structure of the pAPmcat
stem-loop. Transcription of pAPmcat and
pAPmcat was carried out for either 15 or 2 min as
indicated. Citrate (6 mM) was used. Following transcription one-fourth
volume of RNase T1 (1,000 U/µl) was added for 0.25 min or
1.25 min as indicated, and then the mixture was extracted with TRIzol
and the RNA was analyzed by gel electrophoresis. The interpretive
drawings in the middle of the panel refer to the stem-loop structure
shown in part C cut by T1 at one or more of the indicated
positions. The mobilities of G-less markers and their nominal sizes are
shown on the left. The true sizes of the G-less markers are greater by
one than the nominal sizes owing to the single G that remains at the 3'
end following cutting by T1.
|
|
Poly(A) signaling does not occur until after poly(A) site
extrusion.
It is generally assumed that poly(A) signaling occurs
after the poly(A) site has been extruded from the polymerase. This
supposition has never been tested experimentally and is based on the
presumption that the poly(A) signal is too complex to be recognized
directly by the transcription apparatus (32). However,
Escherichia coli RNAP is able to monitor DNA sequence
throughout its 35-bp footprint to receive regulatory input for both
pausing and termination (4, 58). The DNA contacts for
RNAPII are presumably even more extensive (25). Additional
opportunities for intrinsic regulatory input come from interactions of
the RNAP with the DNA-RNA hybrid and with the RNA itself in the exit
tunnel (58). Moreover, the efficiency of poly(A)-dependent
termination is not, as previously thought (32), directly
related to processing efficiency (1, 79), indicating the
existence of additional sources and/or sources of regulatory input
different from simply the efficiency of processing. Although processing
factors are known to affect signaling (8), their role may
be limited to maintaining the transcription complex in a responsive
conformation. Thus, current data are not inconsistent with a model in
which poly(A) signaling reflects an intrinsic ability of the
transcription apparatus to recognize the poly(A) site. We therefore
decided to test this possibility directly.
If the transcriptional apparatus is intrinsically capable of
recognizing the poly(A) site, then signaling may occur before
the
poly(A) site is extruded from the polymerase. To determine
whether
poly(A) signaling occurs before or after extrusion of
the poly(A) site,
we used the
cis-antisense approach. This method
involves
cloning an inverted copy of a poly(A) signal downstream
of the properly
oriented parent and has been used to study the
timing of cleavage and
polyadenylation complex assembly in vivo
(
18).
Transcription of the inverted poly(A) signal generates
an antisense
transcript to the authentic poly(A) signal upstream.
When this
antisense transcript emerges from the polymerase, it
forms a duplex
with the previously extruded poly(A) signal and
prevents cleavage and
polyadenylation (
18). If signaling to
the polymerase, like
assembly of the cleavage and polyadenylation
apparatus, occurs
following extrusion of the poly(A) site, then
signaling-like processing
may be blocked by the antisense transcript.
However, if signaling
occurs earlier
during transcription and
extrusion
then the antisense
should be unable to block an event
that has already
occurred.
To determine whether an antisense transcript to the poly(A) site can
block signaling to the polymerase, we prepared the constructs
diagrammed in Fig.
6A. As before, each construct shown refers
to a
mutant and wild-type pair. Construct 1, pAP
cat
, was the
parent
construct for the plasmids of this experiment. The separation
between
the cassettes in pAP
cat
is slightly greater than in
pAP
377
of Fig.
5, and pAP
cat
exhibits a slightly greater
poly(A)-dependent
decrease in transcription; readthrough for the wild
type is ~60%
of that for the mutant (Fig.
6A, construct 1).
Construct 2 contains,
just downstream of the 120-nt cassette, a 218-nt
antisense module
(
) which is an inverted repeat of the poly(A)
signal and its
upstream flanking sequences. The antisense
transcript is targeted
not only to the poly(A) signal (whose cleavage
site is 19 nt upstream
of the 120-nt G-less cassette [Fig.
6B]) but
also to some upstream
flanking sequence to ensure adequate duplex
stability when the
stem-loop (Fig.
6C) forms in the RNA
(
18).
Figure
6A shows that construct 2 exhibits no signaling: wild-type
transcription is indistinguishable (99% readthrough ratio)
from that
of the mutant. Thus, the presence of the antisense transcript
completely blocks signaling by the poly(A) site. This is despite
the
fact that the separation between the cassettes in construct
2 is
significantly greater than in construct 1 so that, other
things being
equal, signaling for construct 2 would have been
expected to be greater
than for construct 1 (Fig.
5).
Notice, for construct 2, that the nascent RNA must be extended more
than 126 nt beyond full extrusion of the poly(A) signal
from the
polymerase before the antisense transcript even begins
to appear (Fig.
6A, construct 2, and B and C). Moreover, since
the antisense must be
extruded a further 10 to 20 nt before sense-antisense
duplex formation
can even be initiated, we conclude that the signaling
normally detected
by our assay does not occur until at least 140
nt after extrusion of
the poly(A) site. In fact, the estimate
of 10 to 20 nt as the minimum
length for initiation of duplex
formation is almost certainly a
considerable underestimate. Not
only must the initiating duplex be
stable enough to form across
a large and fairly unstructured G-less RNA
loop, but it must also
be stable enough to compete with factors seeking
to bind the poly(A)
site. It is, therefore, likely that the bulk of the
signaling
detected in these assays actually does not occur until beyond
140 nt following poly(A) site
extrusion.
To determine whether the antisense module might be exerting some
unspecified negative effect on signaling for this template,
we also
assayed signaling using construct 3 of Fig.
6A. This construct
differs
from construct 2 only in that the antisense module is
located several
hundred base pairs farther downstream, near the
end of the interval
over which signaling is measured. Since construct
3 is identical to
construct 1 up to the beginning of the antisense
module, signaling for
the two constructs should be similar if
the presence of the antisense
module in the template is benign.
As shown in the histogram of Fig.
6A,
signaling for construct
3 did indeed resemble that for construct 1, confirming that the
mere presence of the antisense sequence in the
template is not
detrimental to the signaling
assay.
Taken together the above
cis-antisense inhibition results
demonstrate for the first time that the signal to stop transcription
occurs at the level of the RNA and that signaling follows extrusion
of
the poly(A) site from the polymerase. Indeed, signaling occurs
more
than 140 nt after the poly(A) signal has been completely
extruded (Fig.
6A), indicating that signal transduction occurs
sometime in the
interval between 140 nt postextrusion and the
time at which the
transcript is
cleaved.
Confirmation of sense-antisense duplex formation during
transcription in vitro.
The interpretation of the above
cis-antisense results assumes sense-antisense duplex
formation. Numerous control experiments in vivo support this mechanism
(18). Below we confirm, by means of RNase
T1 secondary structure mapping, that
sense-antisense duplex formation also occurs rapidly during
transcription in vitro. Indeed, the G-less cassette analysis for Fig.
6A required RNase T1 digestion under denaturing
conditions (T1 is single-strand specific) in
order to digest the duplexed RNA produced by constructs 2 and 3 (see
Materials and Methods).
To assess sense-antisense duplex formation during transcription we
carried out the secondary structure mapping directly in
the
transcription mixtures (Fig.
6D). For this mapping we used
pAP
mcat
and
pAP
mcat
, which are the mutant versions
of constructs
1 and 2. The mutants were chosen in order to eliminate
any differences
in transcription efficiency between the constructs due
to signaling.
Immediately following transcription we subjected the
transcription
mixtures to a 1.25-min pulse of RNase
T
1 digestion. Figure
6C
shows the structure of
the sense-antisense stem-loop that is predicted
to form in transcripts
of pAP
mcat
. RNase
T
1 is expected to
cleave rapidly in the
unstructured RNA to the right of the stem-loop,
more slowly in the loop
itself, and slowest of all at the mismatched
G in the mutated hexamer
(see Fig.
6C legend). Thus, T
1 digestion
is
predicted initially to excise an intact stem-loop and then
to process
it further by cutting between the cassette and the
antisense sequence
and at the mismatched G (Fig.
6C). The cassette
can be cleaved from the
sense sequence only when fraying at the
end of the duplex, to which it
is anchored, permits. On a denaturing
gel these products would be
expected to run as 564-, 336-, 222-,
175-, and 161-nt species,
accompanied by a small amount of 120-nt
G-less cassette (see
interpretive drawings in Fig.
6D). The results
in Fig.
6D, lane 2, confirm these predictions. The presence of
each predicted species is
apparent, together with a low yield
of the 120-nt cassette. In
contrast, lane 1 shows that for the
homologous plasmid without the
antisense no species other than
the 261-nt and 120-nt G-less cassettes
appear. When we reduced
the T
1 pulse to 0.25 min,
the 564-nt stem-loop band increased
and the 120-nt G-less cassette band
decreased in intensity (Fig.
6D, lane 4) as expected for a
precursor-product relationship.
The vanishing 120-nt band in lane 4 suggests that stem-loop formation
is quantitative. The shorter
T
1 pulse was also accompanied by
incomplete
trimming of the cassette bands themselves (lane 3).
Similar results
have been obtained using 1/10 the concentration
of
T
1 and longer digestion
times.
The band assignments in Fig.
6D have been confirmed based on several
independent criteria. First, the bands appear only for
constructs that
produce transcripts containing antisense. Second,
the bands resulting
from secondary structure are selectively eliminated
by
T
1 digestion under denaturing conditions. Third,
the mobilities
of the bands are consistent with the sizes predicted
from Fig.
6C. Finally, the mobilities of the individual bands can be
selectively
varied by targeted sequence alterations in the predicted
stem-loop
(data not shown). Thus, (i) the positions of the bands at 336
and 161 nt can be selectively varied by altering the size of the
G-less
cassette; (ii) the bands at 175 and 161 nt are selectively
absent when
the experiment is done with pAP
wcat
,
which has
no mismatched G at the hexamer position; (iii) the position
of
the band at 222 nt varies with the length of the antisense module
used; and (iv) the G-less cassette band at 120 nt is no longer
underrepresented if a G-containing insert (which can be cut by
T
1) is placed between the sense strand of the
predicted duplex
and the
cassette.
The data above confirmed the efficient formation of the predicted
sense-antisense stem-loops by the end of a 15-min transcription.
To
determine whether these structures form continuously during
transcription we repeated the 0.25-min T
1
analysis, but after
only 2 min of transcription. Figure
6D, lane 6 shows that the
same spectrum of stem-loop digestion products is
produced within
this short period of transcription as is produced
during the standard
reaction (lane 4). Taken together these control
experiments show
that sense-antisense duplex formation occurs
efficiently and continuously
during transcription in vitro, as required
by a
cis-antisense
inhibition
mechanism.
The signal to stop transcription is generated before transcript
cleavage.
As pointed out earlier, the differential cassette
recovery that results from attenuated transcription (i.e., reduced
production of postcassette) is the opposite of that expected from the
degradation that accompanies 3'-end processing (i.e., preferential loss
of precassette). Thus, by using the differential recovery of cassettes as a criterion in the development of the in vitro signaling assay, we
simultaneously selected for conditions that would uncouple processing
from signaling. This is apparent in Fig. 4B and C, where signaling
peaks at relatively high Mg2+ concentrations and
is severely depressed at the low Mg2+
concentrations that favor cleavage in vitro (56, 59). If signaling and processing have indeed been uncoupled in our system, that
would indicate that signaling does not depend on transcript cleavage.
To determine directly whether signaling and processing are uncoupled in
our system, we made a new construct for studying signaling,
pA
G
catC
9,
as shown in Fig.
7A.
This
construct was explicitly designed so that the assay
could
work only if processing is not a prerequisite for signaling. The
essence of the design is a new 178-bp upstream cassette containing
an
imbedded G-less poly(A) signal (Fig.
7A). This cassette provides
not
only the upstream cassette for signaling analysis but also
the poly(A)
site itself. Since the poly(A) site is imbedded in
the G-less cassette,
any instance of poly(A) site cleavage will
also result in cassette
cleavage. Thus, if poly(A) signaling depends
on prior poly(A) site
cleavage, then every failure of the 261-nt
cassette to be transcribed
(because of signaling) will be matched
by a failure of the 178-nt
cassette to be recovered (because of
cleavage). That is, if cleavage is
required for poly(A) signaling,
no decrease in 261-nt cassette recovery
relative to recovery of
the 178-nt cassette will be apparent as a
result of signaling,
and the basis for detection of signaling in our
assay will be
eliminated. Therefore, if any signaling at all can be
detected
as a decreased 261-nt cassette/178-nt cassette ratio for
wild-type
(AATAAA) compared to mutant (TTTAAA)
versions of
pA
G
catC
9,
then that signaling cannot be cleavage dependent.
View larger version (25K):
[in this window]
[in a new window]
|
FIG. 7.
Signaling is not cleavage dependent. (A) Signaling by a
G-less poly(A) site is not accompanied by processing. The first step of
construction for pAGcatC9 was
similar to that for pASwC9377 of Fig. 3
except that a G-less version of S, the sequence shown in Fig. 7A, was
inserted into pAPm117cat. The G of the blunted
BamHI site remaining after ligation was converted to a T
by means of site-directed mutagenesis
(AATCGATCCAATattTCC), thereby fusing the
G-less poly(A) signal with the 117-nt G-less cassette. To enhance the
detection of signaling, the distance between the cassettes was
increased by inserting the previously described C9 fragment
into the unique EcoRV site (Fig. 4A) of the cat
sequence. The cleavage site indicated by the arrow in the wild-type
G-less poly(A) sequence is the cleavage position for the original SPA
(5). A representative experiment is shown. Citrate was
added with the nucleotides for these assays. (B) RNase protection
analysis reveals negligible processing of the in vitro transcription
products. The same RNA probe was used for all samples in the figure.
This probe spans the identical poly(A) sites of
pAPwC9 (lanes 2 and 3) and pIAPwcat (lane 4). The
latter plasmid, used as a positive control, was obtained from the
former by insertion of a PstI-RsaI
fragment from pRL-SV40 (Promega) at the StuI site. This
adds an intron to allow stable expression of RNA in vivo. The negative
control (lane 1) was pAL117cat, which has identical upstream
sequences to pAPwC9 but a different
poly(A) site. Note that the bands marked with asterisks are present
irrespective of the presence or absence of the homologous poly(A) site
in the in vitro transcribed construct. The smudge in lane 1 at the
position of uncleaved RNA is the edge of a halo from an intense band
that was in the lane to the left on the gel.
|
|
Figure
7A shows that signaling, to the extent of 28% impaired
transcription in the wild type, was indeed detected upon
comparison
of wild-type and mutant versions of the
pA
G
catC
9 template. Although this is less signaling than obtained with our
other
plasmids, we were nevertheless surprised at the vigor of
the effect,
since the poly(A) signal in this template had been
extensively mutated
(all of its G residues). Despite the unusual
sequence of the G-less
poly(A) signal, there can be no doubt that
the impaired transcription
of the wild-type plasmid is a poly(A)-dependent
effect because the
transcriptional impairment is abolished by
mutating only two of the
A's in the poly(A) hexamer (Fig.
7A).
These results unambiguously
establish that poly(A) signaling is
cleavage independent in
vitro.
Although it was clear from the data discussed above that the observed
poly(A) signaling is cleavage independent, it remained
possible that
some processing at the G-less poly(A) site, unrelated
to signaling, may
also have occurred. If so the 5' polyadenylation
product, and perhaps
also the 3' cleavage and partial degradation
products, should be
detectable on the gel (
81). However, the
lane containing
the wild type in Fig.
7A reveals no evidence of
any G-less poly(A) site
processing. Poly(A) site cleavage in the
178-nt precassette would yield
5' 28-nt and 3' 150-nt subcassettes.
Polyadenylation of the 5' product
would yield a heterogeneous
collection of G-less RNAs on the gel
ranging from perhaps 180
to 280 nt. Partial degradation of the 3'
product would yield a
heterogeneous collection of G-less RNAs on the
gel of less than
150 nt. There is no evidence in the wild
type-containing lane
of Fig.
7A for any of these products of
processing. Thus, not
only is signaling cleavage independent in this
assay but, at least
for the G-less poly(A) site, there does not seem to
be any processing
at all under these experimental
conditions.
The G-less poly(A) site offers the advantage that any signaling
detected by our assay must unambiguously have occurred by
a
cleavage-independent mechanism. However, the poly(A) site used
for most
of the experiments in the present study was the SV40
early poly(A)
site. In order to determine whether signaling is
also cleavage
independent for this site, we carried out RNase
protection assays on
the products remaining after signaling reactions.
Figure
7B shows that
essentially no cleavage at the SV40 early
poly(A) site occurred under
the conditions of our assays. Lane
2 shows the result of an RNase
protection analysis of the in vitro
transcription products of a typical
15-min signaling reaction.
Lane 3 shows the result for a signaling
reaction that was allowed
to incubate three times as long. Lane 4 shows
the RNase protection
result for authentic cellular mRNA containing the
same poly(A)
site. For the cellular RNA (lane 4) a band at the expected
position
for cleaved RNA (107 nt) is obtained, plus a subband. In
contrast,
for the in vitro RNA these bands are either scarcely visible
(15-min
reaction, lane 2) or only faintly apparent (45-min reaction,
lane
3). Instead, the in vitro RNA yields almost exclusively a
protected
species migrating near the 129-nt position expected for
uncleaved
RNA. Additional bands flanking the position for cleaved RNA
in
lanes 2 and 3 are not related to 3' end formation as they appear
also in assays of RNA from a plasmid bearing an unrelated poly(A)
site
(lane
1).
Quantitative analysis indicates an upper limit of less than 2% poly(A)
site cleavage of RNA transcribed in vitro for 15 min
(Fig.
7B, lane 2).
In contrast, poly(A) signaling can lead to
an elongation deficit of
more than 60% under the same conditions
(Fig.
1B). Thus, signaling has
occurred in the virtual absence
of cleavage. Even after 45 min of
incubation in vitro the proportion
of poly(A) site cleavage reaches
only 6% (maximum estimate from
analysis of Fig.
7B, lane 3). We
conclude that poly(A) signaling
for the SV40 early poly(A) site has
been uncoupled from poly(A)
site cleavage under our reaction
conditions. Therefore, signaling
is independent of cleavage for both a
natural and an artificial
poly(A)
site.
| |
DISCUSSION |
Poly(A) signaling in vitro.
Poly(A)-dependent termination is
presumably a complex process in which poly(A) signaling is but the
first of several mechanistic steps. For example, signaling may lead
first to pausing and then to transcript release. To focus on signaling
per se, therefore, we have used in this work an assay that does not
require transcript release in order to produce a measurable outcome.
Rather, the assay detects any downstream effect of signaling that
impedes transcription.
Our results show that poly(A) signaling in vitro faithfully reflects
three important aspects of poly(A)-dependent termination
in vivo
(
79). First, of course, signaling is dependent on a
functional poly(A) site. Second, signaling exerts its effect regardless
of the nature of the downstream DNA: no special pause site or
other
element is required. Third, the effect increases with distance,
suggesting a stochastic process. Thus, the in vitro events
characterized
here recapitulate important aspects of the in vivo
process that
leads to poly(A)-dependent
termination.
Detection of signaling under our assay conditions requires citrate. The
molecular target of citrate is not known, but citrate
has been shown to
inhibit phosphorylation of the RNAPII CTD (
64)
and is said
to be an HIV-specific depressant of elongation (
63).
Here
we confirm, using an assay for elongation efficiency, that
citrate
preferentially impairs elongation (Fig.
4A). Our results
also show that
the effect is not restricted to HIV since our constructs
are driven by
the SV40 early promoter. Moreover, our elongation
efficiency assay
(Fig.
4) measures the efficiency of elongation
between 895 and 2,757 bp
downstream of the promoter, showing that
the effect of citrate is not
limited to promoter-proximal events.
Thus, the reduction of elongation
efficiency imposed by citrate
includes the region of the template
containing the poly(A) site.
It is possible that, by reducing the
phosphorylation of the CTD,
citrate renders the polymerases more
responsive to the poly(A)
signal. Alternatively, citrate may reduce a
background of efficient
elongation contributed by nonresponding
polymerases that otherwise
would mask signaling. It is also possible
that citrate affects
signaling directly, by acting on some component of
the transcription
complex independently of its effect on elongation
efficiency.
Using this poly(A) signaling assay we have shown here that signaling
occurs well after extrusion of the poly(A) site, but
before cleavage,
and that it does not depend on the presence of
pause elements in the
DNA. Assembly of the cleavage and polyadenylation
apparatus occurs in
distinguishable steps in vivo (
18). The
results reported
here support our earlier suggestion (
18) that
signaling
may occur during one of these intermediate steps, being
generated by
new interactions among known factors (
3,
8,
14,
17) or by
the recruitment of new factors responsible for
termination.
Poly(A) signaling is not coupled to extrusion of the poly(A)
site.
Before 3'-end processing can occur, the poly(A) site must
first undergo extrusion and then stepwise assembly of the cleavage and
polyadenylation apparatus (18). Cleavage-independent
models for poly(A) signaling may accordingly be divided into intrinsic and extrinsic models according to whether recognition is by the transcriptional apparatus itself or by additional factors that recognize the signal following extrusion. Here we have addressed the
intrinsic class of models which propose that the poly(A) site is
recognized as it is being transcribed and extruded, thereby leading to
termination. A precedent for such a mechanism is E. coli RNA
polymerase, which can recognize signals for pausing and termination
either directly in the DNA or in the nascent RNA during extrusion and
whose responses to these signals can be modulated by factors (4,
58). Accordingly, in eukaryotes, RNAPII may recognize the
poly(A) site during transcription, and its response to the poly(A) site
may be modulated by the polymerase-associated poly(A) site cleavage
factors that are known to be required for termination (3, 8,14,
17). This model has never been tested but is now ruled out by
the experiment of Fig. 6, which establishes that signaling cannot have
taken place during transcription of the poly(A) site, since all
signaling can still be blocked by antisense after extrusion of the
poly(A) site is complete.
Our data also address the simplest of the extrinsic models for poly(A)
signaling. This model, an extension of the above scenario,
is the
CPSF-CstF recognition model, which proposes that the signal
to
terminate is generated as the poly(A) site is propelled past
the
CTD-bound CPSF and CstF after emerging from the polymerase
(
55). The initial interaction between these factors and
the
poly(A) site is envisioned as the event that generates the signal.
Both functional and structural considerations (see below) suggest
that
CPSF and CstF interact promptly with the poly(A) site when
it emerges
from the polymerase. Yet the results of Fig.
6 show
that signaling has
still not occurred 140 or more nt after extrusion
is complete, despite
the presumed efficiency with which the poly(A)
signal is captured by
CPSF and CstF. Accordingly, our results
disfavor the
CPSF-CstF-recognition model and suggest that continued
association of
CPSF and CstF with the poly(A) site is required
in order to participate
in generating the signal to terminate
at a later step of cleavage and
polyadenylation complex
assembly.
Prompt targeting of CPSF and CstF to the poly(A) site following
extrusion is suggested by analogy to the mechanism whereby
capping
enzyme is targeted to the RNA 5' end. Like CPSF and CstF,
capping
enzyme binds to the polymerase CTD, which then delivers
it to the
emerging RNA (
43,
54). This delivery is so efficient
that
the RNA is quantitatively capped in vitro before it is 50
nt long
(
46). Additional studies in vivo suggest that capping
occurs when the RNA is between 25 and 30 nt long (
69).
Since
approximately 18 nt of RNA is contained within the structure of
the RNAPII ternary complex (
39), capping must occur on 5'
ends
that lie only about 10 nt beyond the point of extrusion. Thus,
functionally, the CTD appears to be designed to deliver capping
enzyme
and possibly other proteins to a region very close to the
point at
which the RNA emerges from the polymerase. This functional
conclusion
is consistent with the recently published crystal structure
of RNAPII,
which indicates that the newly extruded RNA emerges
at the base of the
CTD (
25,
36).
Given the juxtaposition of the CTD to the emerging RNA, the presumed
flexibility of the CTD (
25), the role of the CTD in
directing virtually immediate capping of emergent RNA, and the
role of
the CTD in facilitating 3' end processing, it is likely
that the CPSF
and the CstF on the CTD gain rapid access to the
nascent poly(A) site.
In this they would resemble the vaccinia
virus transcription
termination factor, which also travels with
the polymerase and then
accesses its cognate element in the nascent
RNA as soon as it emerges
(
40). Unlike the vaccinia situation,
however, initial
recognition of the poly(A) signal by CPSF and
CstF does not appear to
coincide with the signal transduction
event. Thus, some later event on
the way to processing is apparently
responsible for signaling.
Nevertheless, 140 nt of RNA would be
insufficient to reach the end of a
hypothetical, fully extended,
inflexible CTD. Therefore, the
CPSF-CstF-recognition model remains
a formal
possibility.
Poly(A) signaling is not cleavage dependent.
Very soon after
it was discovered that termination is poly(A) dependent, it was
suggested that processing itself might be the signal that leads to
termination (50). Subsequently, elegant models were
developed (20, 68) and refined (30, 81) to explain how cleavage could be instrumental in generating the signal. Attempts to test cleavage-dependent models have centered on the relative timing of cleavage and termination in vivo (11, 30, 61). The results for several genes indicate that these events both occur at various distances downstream of the poly(A) site but
that, within the resolution of the experiments, they tend to occur
together. This has led to the view that cleavage and termination in
vivo may both be part of a single concerted event (11, 12,
30). It has variously been suggested that this event is
triggered by cleavage (30) or that it is not triggered by
cleavage (61). Both possibilities are consistent with the available in vivo data, as are the additional possibilities that cleavage is triggered by termination or that both occur independently in response to a common signal. Thus, the central postulate of the
cleavage-dependent models, namely, that cleavage generates the signal
to the polymerase, has remained an open question.
As is often the case, the relationships among coupled events are
clarified by uncoupling them in vitro. By uncoupling cleavage
and
signaling in our assay we have shown that signaling occurs
in the
essential absence of any cleavage. This was demonstrated
directly for
the SV40 early (Fig.
7B) and the G-less poly(A) sites
(Fig.
7A).
Moreover, because optimization of the signaling assay
involved
selecting for conditions that suppress processing, this
is evidently
true for the SV40 late and the synthetic poly(A)
sites as well (Fig.
3). We hasten to point out, however, that
our extracts do carry out
efficient 3'-end processing under conventional
cleavage and
polyadenylation conditions (
75) using exogenously
prepared
pre-mRNA substrates (data not
shown).
Poly(A) signaling does not require downstream elements in the
DNA.
We have shown here that four different poly(A) sites are
capable of signaling a stop to transcription in vitro in the absence of
any identifiable downstream elements. For example, the SV40 early
poly(A) site transduces the signal to stop transcription across both
eukaryotic and artificial DNA sequences (Fig. 5), as well as across
prokaryotic DNA (Fig. 6A). The same is true for the SV40 late, the SPA,
and the G-less poly(A) signals (Fig. 3, Fig. 7A, and additional data
not shown). This confirms and extends our previous report that poly(A)
signals can induce efficient termination in vivo without the assistance
of downstream elements in the DNA (79).
Nevertheless, a number of downstream elements have been described that
do enhance termination when located downstream of poly(A)
sites
(
2,
6,
13,
21,
31,
33,
72). However, only
occasionally have the effects of the presence and absence of these
elements been determined in a background lacking poly(A) signals
(e.g.,
references
22,
31, and
41). Thus, often it is not
known
whether a poly(A)-independent effect has simply been superimposed
on a
poly(A)-containing background, or whether such an element
interacts
synergistically with the poly(A) site to constitute
a true downstream
member of a bipartite
terminator.
Pause elements in downstream DNA are a prominent feature of most
discussions of poly(A)-dependent termination (e.g., see references
2,
6,
13,
33,
41,
73,
81, and
82). These
elements
are thought to be required to slow down the polymerase so that
the poly(A) signal can act. Yet, with one possible exception,
no
termination-enhancing element has been shown to pause polymerases
in
the absence of a functioning poly(A) signal. For example, the
nmt2 pause element of
Schizosaccharomyces pombe
(
2) does not
induce pausing if the poly(A) signal is
deleted (
41). Yet there
are pausing and efficient
termination downstream of the poly(A)
signal if the element itself is
deleted (
41). Thus, although
the element is unquestionably
an enhancer of polyadenylation (
2),
it is not a pause
element and it is not required for pausing or
termination. The possible
exception referred to above is an element
that was accompanied by both
pausing and termination downstream
of a mutant poly(A) site in one
experiment (
33) but which gave
no discernible pausing
downstream of a wild-type poly(A) site
in other experiments
(
77).
If the various downstream elements that have been described are not
pause elements and are generally not required for termination,
what
might be their function? Since we have shown both in vivo
(
79) and in vitro (this report) that a poly(A) signal
alone
is sufficient to stop transcription, these downstream elements
are unlikely to be an integral part of the poly(A)- dependent
termination mechanism. The so-called pause elements discussed
above,
actually resemble enhancers or auxiliary downstream elements
for
polyadenylation (
19,
35,
52). They may function at the
RNA
level and affect termination by modifying the pathway leading
to
cleavage and polyadenylation itself. A second type of element
functions
at the DNA level to bind a protein that enhances processing
and/or
termination when encountered by a transcription complex
(
6,
21,
81). One such element, the MAZ protein binding
site, enhances
cleavage and polyadenylation in vivo (
6). MAZ
bound to DNA
causes pausing in vitro, but the pausing per se is
not responsible for
the enhanced cleavage and polyadenylation,
since pausing by other
proteins has no effect on processing unless
the polymerases are paused
next to MAZ (
80,
81). MAZ may,
in fact, be a
poly(A)-independent termination factor in vivo (
15),
a
property shared by the only other DNA-binding protein thought
to be
involved in termination by RNAPII (
21). Significantly,
both of these proteins are known primarily for their roles in
transcription initiation. Thus, their roles in processing and
termination may be primarily to act as fail-safe devices, not
necessarily dependent on a poly(A) signal, designed to protect
promoters from transcription interference (
37).
| |
ACKNOWLEDGMENTS |
We thank Carol Eng in the laboratory of Arnie Berk for a constant
supply of HeLa cell starter cultures; Guillaume Chanfreau for
insightful comments on the manuscript; and Ian Orozco, Amir Kazerouninia, and David Tsao for contributing clones.
This work was supported by NIH grant GM50863 and by an award from the
Jonsson Cancer Center Foundation.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Chemistry and Biochemistry, University of California at Los Angeles, Los Angeles, CA 90095-1569. Phone: (310) 825-3767. Fax: (310) 206-4038. E-mail: hgm{at}chem.ucla.edu.
| |
REFERENCES |
| 1.
|
Aranda, A.,
J. E. Perez-Ortin,
C. Moore, and M. L. del Olmo.
1998.
Transcription termination downstream of the Saccharomyces cerevisiae FBP1 poly(A) site does not depend on efficient 3'end processing.
RNA
4:303-318[Abstract].
|
| 2.
|
Aranda, A., and N. J. Proudfoot.
1999.
Definition of transcriptional pause elements in fission yeast.
Mol. Cell. Biol.
19:1251-1261[Abstract/Free Full Text].
|
| 3.
|
Aranda, A., and N. Proudfoot.
2001.
Transcriptional termination factors for RNA polymerase II in yeast.
Mol. Cell
7:1003-1011[CrossRef][Medline].
|
| 4.
|
Artsimovitch, I., and R. Landick.
2000.
Pausing by bacterial RNA polymerase is mediated by mechanistically distinct classes of signals.
Proc. Natl. Acad. Sci. USA
97:7090-7095[Abstract/Free Full Text].
|
| 5.
|
Ashe, M. P.,
L. H. Pearson, and N. J. Proudfoot.
1997.
The HIV-1 5' LTR poly(A) site is inactivated by U1 snRNP interaction with the downstream major splice donor site.
EMBO J.
16:5752-5763[CrossRef][Medline].
|
| 6.
|
Ashfield, R.,
A. J. Patel,
S. A. Bossone,
H. Brown,
R. D. Campbell,
K. B. Marcu, and N. J. Proudfoot.
1994.
MAZ-dependent termination between closely spaced human complement genes.
EMBO J.
13:5656-5667[Medline].
|
| 7.
|
Baker, C. C., and J. S. Noe.
1989.
Transcriptional termination between bovine papillomavirus type 1 (BPV-1) early and late polyadenylation sites blocks late transcription in BPV-1-transformed cells.
J. Virol.
63:3529-3534[Abstract/Free Full Text].
|
| 8.
|
Barilla, D.,
B. A. Lee, and N. J. Proudfoot.
2001.
Cleavage/polyadenylation factor IA associates with the carboxyl-terminal domain of RNA polymerase II in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
98:445-450[Abstract/Free Full Text].
|
| 9.
|
Barrera-Saldana, H.,
K. Takahashi,
M. Vigneron,
A. Wildeman,
I. Davidson, and P. Chambon.
1985.
All six GC-motifs of the SV40 early upstream element contribute to promoter activity in vivo and in vitro.
EMBO J.
4:3839-3849[Medline].
|
| 10.
|
Batt, D. B.,
Y. Luo, and G. G. Carmichael.
1994.
Polyadenylation and transcription termination in gene constructs containing multiple tandem polyadenylation signals.
Nucleic Acids Res.
22:2811-2816[Abstract/Free Full Text].
|
| 11.
|
Baurén, G.,
S. Belikov, and L. Wieslander.
1998.
Transcriptional termination in the Balbiani ring 1 gene is closely coupled to 3'-end formation and excision of the 3'-terminal intron.
Genes Dev.
12:2759-2769[Abstract/Free Full Text].
|
| 12.
|
Bentley, D.
1999.
Coupling RNA polymerase II transcription with pre-mRNA processing.
Curr. Opin. Cell Biol.
11:347-351[CrossRef][Medline].
|
| 13.
|
Birse, C. E.,
B. A. Lee,
K. Hansen, and N. J. Proudfoot.
1997.
Transcriptional termination signals for RNA polymerase II in fission yeast.
EMBO J.
16:3633-3643[CrossRef][Medline].
|
| 14.
|
Birse, C. E.,
L. Minvielle-Sebastia,
B. A. Lee,
W. Keller, and N. J. Proudfoot.
1998.
Coupling termination of transcription to messenger RNA maturation in yeast.
Science
280:298-301[Abstract/Free Full Text].
|
| 15.
|
Bossone, S. A.,
C. Asselin,
A. J. Patel, and K. B. Marcu.
1992.
MAZ, a zinc finger protein, binds to c-MYC and C2 gene sequences regulating transcriptional initiation and termination.
Proc. Natl. Acad. Sci. USA
89:7452-7456[Abstract/Free Full Text].
|
| 16.
|
Brackenridge, S.,
H. L. Ashe,
M. Giacca, and N. J. Proudfoot.
1997.
Transcription and polyadenylation in a short human intergenic region.
Nucleic Acids Res.
25:2326-2336[Abstract/Free Full Text].
|
| 17.
|
Calvo, O., and J. L. Manley.
2001.
Evolutionarily conserved interaction between CstF-64 and PC4 links transcription, polyadenylation, and termination.
Mol. Cell
7:1013-1023[CrossRef][Medline].
|
| 18.
|
Chao, L. C.,
A. Jamil,
S. J. Kim,
L. Huang, and H. G. Martinson.
1999.
Assembly of the cleavage and polyadenylation apparatus requires about 10 seconds in vivo and is faster for strong than for weak poly(A) sites.
Mol. Cell. Biol.
19:5588-5600[Abstract/Free Full Text].
|
| 19.
|
Chen, F., and J. Wilusz.
1998.
Auxiliary downstream elements are required for efficient polyadenylation of mammalian pre-mRNAs.
Nucleic Acids Res.
26:2891-2898[Abstract/Free Full Text].
|
| 20.
|
Connelly, S., and J. L. Manley.
1988.
A functional mRNA polyadenylation signal is required for transcription termination by RNA polymerase II.
Genes Dev.
2:440-452[Abstract/Free Full Text].
|
| 21.
|
Connelly, S., and J. L. Manley.
1989.
RNA polymerase II transcription termination is mediated specifically by protein binding to a CCAAT box sequence.
Mol. Cell. Biol.
9:5254-5259[Abstract/Free Full Text].
|
| 22.
|
Connelly, S., and J. L. Manley.
1989.
A CCAAT box sequence in the adenovirus major late promoter functions as part of an RNA polymerase II termination signal.
Cell
57:561-571[CrossRef][Medline].
|
| 23.
|
Conrad, N. K.,
S. M. Wilson,
E. J. Steinmetz,
M. Patturajan,
D. A. Brow,
M. S. Swanson, and J. L. Corden.
2000.
A yeast heterogeneous nuclear ribonucleoprotein complex associated with RNA polymerase II.
Genetics
154:557-571[Abstract/Free Full Text].
|
| 24.
|
Coulon, V.,
J. L. Veyrune,
N. Tourkine,
A. Vie,
R. A. Hipskind, and J. M. Blanchard.
1999.
A novel calcium signaling pathway targets the c-fos intragenic transcriptional pausing site.
J. Biol. Chem.
274:30439-30446[Abstract/Free Full Text].
|
| 25.
|
Cramer, P.,
D. A. Bushnell, and R. D. Kornberg.
2001.
Structural basis of transcription: RNA polymerase II at 2.8 angstrom resolution.
Science
292:1863-1876[Abstract/Free Full Text].
|
| 26.
|
Dantonel, J. C.,
K. G. Murthy,
J. L. Manley, and L. Tora.
1997.
Transcription factor TFIID recruits factor CPSF for formation of 3' end of mRNA.
Nature
389:399-402[CrossRef][Medline].
|
| 27.
|
Deng, L.,
J. Hagler, and S. Shuman.
1996.
Factor-dependent release of nascent RNA by ternary complexes of vaccinia RNA polymerase.
J. Biol. Chem.
271:19556-19562[Abstract/Free Full Text].
|
| 28.
|
Deng, L., and S. Shuman.
1998.
Vaccinia NPH-I, a DExH-box ATPase, is the energy coupling factor for mRNA transcription termination.
Genes Dev.
12:538-546[Abstract/Free Full Text].
|
| 29.
|
Dichtl, B., and W. Keller.
2001.
Recognition of polyadenylation sites in yeast pre-mRNAs by cleavage and polyadenylation factor.
EMBO J.
20:3197-3209[CrossRef][Medline].
|
| 30.
|
Dye, M. J., and N. J. Proudfoot.
1999.
Terminal exon definition occurs cotranscriptionally and promotes termination of RNA polymerase II.
Mol. Cell
3:371-378[CrossRef][Medline].
|
| 31.
|
Dye, M. J., and N. J. Proudfoot.
2001.
Multiple transcript cleavage precedes polymerase release in termination by RNA polymerase II.
Cell
105:669-681[CrossRef][Medline].
|
| 32.
|
Edwalds-Gilbert, G.,
J. Prescott, and E. Falck-Pedersen.
1993.
3' RNA processing efficiency plays a primary role in generating termination-competent RNA polymerase II elongation complexes.
Mol. Cell. Biol.
13:3472-3480[Abstract/Free Full Text].
|
| 33.
|
Enriquez-Harris, P.,
N. Levitt,
D. Briggs, and N. J. Proudfoot.
1991.
A pause site for RNA polymerase II is associated with termination of transcription.
EMBO J.
10:1833-1842[Medline].
|
| 34.
|
Flaherty, S. M.,
P. Fortes,
E. Izaurralde,
I. W. Mattaj, and G. M. Gilmartin.
1997.
Participation of the nuclear cap binding complex in pre-mRNA 3' processing.
Proc. Natl. Acad. Sci. USA
94:11893-11898[Abstract/Free Full Text].
|
| 35.
|
Gilmartin, G. M.,
S. L. Hung,
J. D. DeZazzo,
E. S. Fleming, and M. J. Imperiale.
1996.
Sequences regulating poly(A) site selection within the adenovirus major late transcription unit influence the interaction of constitutive processing factors with the pre-mRNA.
J. Virol.
70:1775-1783[Abstract].
|
| 36.
|
Gnatt, A. L.,
P. Cramer,
J. Fu,
D. A. Bushnell, and R. D. Kornberg.
2001.
Structural basis of transcription: an RNA polymerase II elongation complex at 3.3 Å resolution.
Science
292:1876-1882[Abstract/Free Full Text].
|
| 37.
|
Greger, I. H.,
A. Aranda, and N. Proudfoot.
2000.
Balancing transcriptional interference and initiation on the GAL7 promoter of Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
97:8415-8420[Abstract/Free Full Text].
|
| 38.
|
Greiner-Stoffele, T.,
H. H. Foerster, and U. Hahn.
2000.
Ribonuclease T1 cleaves RNA after guanosines within single-stranded gaps of any length.
Nucleosides Nucleotides Nucleic Acids
19:1101-1109[Medline].
|
| 39.
|
Gu, W.,
M. Wind, and D. Reines.
1996.
Increased accommodation of nascent RNA in a product site on RNA polymerase II during arrest.
Proc. Natl. Acad. Sci. USA
93:6935-6940[Abstract/Free Full Text].
|
| 40.
|
Hagler, J.,
Y. Luo, and S. Shuman.
1994.
Factor-dependent transcription termination by vaccinia RNA polymerase. Kinetic coupling and requirement for ATP hydrolysis.
J. Biol. Chem.
269:10050-10060[Abstract/Free Full Text].
|
| 41.
|
Hansen, K.,
C. E. Birse, and N. J. Proudfoot.
1998.
Nascent transcription from the nmt1 and nmt2 genes of Schizosaccharomyces pombe overlaps neighbouring genes.
EMBO J.
17:3066-3077[CrossRef][Medline].
|
| 42.
|
Hirose, Y., and J. L. Manley.
2000.
RNA polymerase II and the integration of nuclear events.
Genes Dev.
14:1415-1429[Free Full Text].
|
| 43.
|
Ho, C. K.,
V. Sriskanda,
S. McCracken,
D. Bentley,
B. Schwer, and S. Shuman.
1998.
The guanylyltransferase domain of mammalian mRNA capping enzyme binds to the phosphorylated carboxyl-terminal domain of RNA polymerase II.
J. Biol. Chem.
273:9577-9585[Abstract/Free Full Text].
|
| 44.
|
Jaeger, J. A.,
D. H. Turner, and M. Zuker.
1989.
Improved predictions of secondary structures for RNA.
Proc. Natl. Acad. Sci. USA
86:7706-7710[Abstract/Free Full Text].
|
| 45.
|
Jansa, P., and I. Grummt.
1999.
Mechanism of transcription termination: PTRF interacts with the largest subunit of RNA polymerase I and dissociates paused transcription complexes from yeast and mouse.
Mol. Gen. Genet.
262:508-514[CrossRef][Medline].
|
| 46.
|
Jove, R., and J. L. Manley.
1984.
In vitro transcription from the adenovirus 2 major late promoter utilizing templates truncated at promoter-proximal sites.
J. Biol. Chem.
259:8513-8521[Abstract/Free Full Text].
|
| 47.
|
Kulish, D., and K. Struhl.
2001.
TFIIS enhances transcriptional elongation through an artificial arrest site in vivo.
Mol. Cell. Biol.
21:4162-4168[Abstract/Free Full Text].
|
| 48.
|
Lee, J. M., and A. L. Greenleaf.
1997.
Modulation of RNA polymerase II elongation efficiency by C-terminal heptapeptide repeat domain kinase I.
J. Biol. Chem.
272:10990-10993[Abstract/Free Full Text].
|
| 49.
|
Levitt, N.,
D. Briggs,
A. Gil, and N. J. Proudfoot.
1989.
Definition of an efficient synthetic poly(A) site.
Genes Dev.
3:1019-1025[Abstract/Free Full Text].
|
| 50.
|
Logan, J.,
E. Falck-Pedersen,
J. E. Darnell, Jr., and T. Shenk.
1987.
A poly(A) addition site and a downstream termination region are required for efficient cessation of transcription by RNA polymerase II in the mouse maj-globin gene.
Proc. Natl. Acad. Sci. USA
84:8306-8310[Abstract/Free Full Text].
|
| 51.
|
London, L.,
R. G. Keene, and R. Landick.
1991.
Analysis of premature termination in c-myc during transcription by RNA polymerase II in a HeLa nuclear extract.
Mol. Cell. Biol.
11:4599-4615[Abstract/Free Full Text].
|
| 52.
|
Lou, H.,
D. M. Helfman,
R. F. Gagel, and S. M. Berget.
1999.
Polypyrimidine tract-binding protein positively regulates inclusion of an alternative 3'-terminal exon.
Mol. Cell. Biol.
19:78-85[Abstract/Free Full Text].
|
| 53.
|
Maa, M. C.,
J. M. Chinsky,
V. Ramamurthy,
B. D. Martin, and R. E. Kellems.
1990.
Identification of transcription stop sites at the 5' and 3' ends of the murine adenosine deaminase gene.
J. Biol. Chem.
265:12513-12519[Abstract/Free Full Text].
|
| 54.
|
McCracken, S.,
N. Fong,
E. Rosonina,
K. Yankulov,
G. Brothers,
D. Siderovski,
A. Hessel,
S. Foster,
S. Shuman, and D. L. Bentley.
1997.
5'-Capping enzymes are targeted to pre-mRNA by binding to the phosphorylated carboxy-terminal domain of RNA polymerase II.
Genes Dev.
11:3306-3318[Abstract/Free Full Text].
|
| 55.
|
McCracken, S.,
N. Fong,
K. Yankulov,
S. Ballantyne,
G. Pan,
J. Greenblatt,
S. D. Patterson,
M. Wickens, and D. L. Bentley.
1997.
The C-terminal domain of RNA polymerase II couples mRNA processing to transcription.
Nature
385:357-361[CrossRef][Medline].
|
| 56.
|
Mifflin, R. C., and R. E. Kellems.
1991.
Coupled transcription-polyadenylation in a cell-free system.
J. Biol. Chem.
266:19593-19598[Abstract/Free Full Text].
|
| 57.
|
Miralles, V. J.
1991.
Termination of transcription in an `in vitro' system is dependent on a polyadenylation sequence.
Nucleic Acids Res.
19:3593-3599[Abstract/Free Full Text].
|
| 58.
|
Mooney, R. A.,
I. Artsimovitch, and R. Landick.
1998.
Information processing by RNA polymerase: recognition of regulatory signals during RNA chain elongation.
J. Bacteriol.
180:3265-3275[Free Full Text].
|
| 59.
|
Moore, C. L., and P. A. Sharp.
1985.
Accurate cleavage and polyadenylation of exogenous RNA substrate.
Cell
41:845-855[CrossRef][Medline].
|
| 60.
|
Murthy, K. G.,
P. Park, and J. L. Manley.
1991.
A nuclear micrococcal-sensitive, ATP-dependent exoribonuclease degrades uncapped but not capped RNA substrates.
Nucleic Acids Res.
19:2685-2692[Abstract/Free Full Text].
|
| 61.
|
Osheim, Y. N.,
N. J. Proudfoot, and A. L. Beyer.
1999.
EM visualization of transcription by RNA polymerase II: downstream termination requires a poly(A) signal but not transcript cleavage.
Mol. Cell
3:379-387[CrossRef][Medline].
|
| 62.
|
Palangat, M.,
T. I. Meier,
R. G. Keene, and R. Landick.
1998.
Transcriptional pausing at +62 of the HIV-1 nascent RNA modulates formation of the TAR RNA structure.
Mol. Cell
1:1033-1042[CrossRef][Medline].
|
| 63.
|
Parada, C. A.,
J. B. Yoon, and R. G. Roeder.
1995.
A novel LBP-1-mediated restriction of HIV-1 transcription at the level of elongation in vitro.
J. Biol. Chem.
270:2274-2283[Abstract/Free Full Text].
|
| 64.
|
Parada, C. A., and R. G. Roeder.
1996.
Enhanced processivity of RNA polymerase II triggered by Tat-induced phosphorylation of its carboxy-terminal domain.
Nature
384:375-378[CrossRef][Medline].
|
| 65.
|
Plet, A.,
D. Eick, and J. M. Blanchard.
1995.
Elongation and premature termination of transcripts initiated from c-fos and c-myc promoters show dissimilar patterns.
Oncogene
10:319-328[Medline].
|
| 66.
|
Powell, W., and D. Reines.
1996.
Mutations in the second largest subunit of RNA polymerase II cause 6-azauracil sensitivity in yeast and increased transcriptional arrest in vitro.
J. Biol. Chem.
271:6866-6873[Abstract/Free Full Text].
|
| 67.
|
Proudfoot, N.
2000.
Connecting transcription to messenger RNA processing.
Trends Biochem. Sci.
25:290-293[CrossRef][Medline].
|
| 68.
|
Proudfoot, N. J.
1989.
How RNA polymerase II terminates transcription in higher eukaryotes.
Trends Biochem. Sci.
14:105-110[CrossRef][Medline].
|
| 69.
|
Rasmussen, E. B., and J. T. Lis.
1993.
In vivo transcriptional pausing and cap formation on three Drosophila heat shock genes.
Proc. Natl. Acad. Sci. USA
90:7923-7927[Abstract/Free Full Text].
|
| 70.
|
Reeder, R. H.,
P. Guevara, and J. G. Roan.
1999.
Saccharomyces cerevisiae RNA polymerase I terminates transcription at the Reb1 terminator in vivo.
Mol. Cell. Biol.
19:7369-7376[Abstract/Free Full Text].
|
| 71.
|
Takagaki, Y., and J. L. Manley.
2000.
Complex protein interactions within the human polyadenylation machinery identify a novel component.
Mol. Cell. Biol.
20:1515-1525[Abstract/Free Full Text].
|
| 72.
|
Tantravahi, J.,
M. Alvira, and E. Falck-Pedersen.
1993.
Characterization of the mouse maj globin transcription termination region: a spacing sequence is required between the poly(A) signal sequence and multiple downstream termination elements.
Mol. Cell. Biol.
13:578-587[Abstract/Free Full Text].
|
| 73.
|
Tollervey, D., and J. F. Caceres.
2000.
RNA processing marches on.
Cell
103:703-709[CrossRef][Medline].
|
| 74.
|
Vandenbergh, D. J.,
M. James-Pederson, and R. C. Hardison.
1991.
An apparent pause site in the transcription unit of the rabbit -globin gene.
J. Mol. Biol.
220:255-270[CrossRef][Medline].
|
| 75.
|
Wahle, E., and W. Keller.
1994.
3' end-processing of mRNA, p. 1-34.
In
S. J. Higgins, and B. D. Hames (ed.), RNA processing: a practical approach, vol. II. Oxford University Press, New York, N.Y.
|
| 76.
|
Wahle, E., and U. Ruegsegger.
1999.
3'-End processing of pre-mRNA in eukaryotes.
FEMS Microbiol. Rev.
23:277-295[Medline].
|
| 77.
|
Whitelaw, E., and N. Proudfoot.
1986.
-Thalassaemia caused by a poly(A) site mutation reveals that transcriptional termination is linked to 3' end processing in the human 2 globin gene.
EMBO J.
5:2915-2922[Medline].
|
| 78.
|
Xu, M.,
M. B. Barnard,
S. M. Rose,
P. N. Cockerill,
S. Y. Huang, and W. T. Garrard.
1986.
Transcription termination and chromatin structure of the active immunoglobulin kappa gene locus.
J. Biol. Chem.
261:3838-3845[Abstract/Free Full Text].
|
| 79.
|
Yeung, G.,
L. M. Choi,
L. C. Chao,
N. J. Park,
D. Liu,
A. Jamil, and H. G. Martinson.
1998.
Poly(A)-driven and poly(A)-assisted termination: two different modes of poly(A)-dependent transcription termination.
Mol. Cell. Biol.
18:276-289[Abstract/Free Full Text].
|
| 80.
|
Yonaha, M., and N. J. Proudfoot.
1999.
Specific transcriptional pausing activates polyadenylation in a coupled in vitro system.
Mol. Cell
3:593-600[CrossRef][Medline].
|
| 81.
|
Yonaha, M., and N. J. Proudfoot.
2000.
Transcriptional termination and coupled polyadenylation in vitro.
EMBO J.
19:3770-3777[CrossRef][Medline].
|
| 82.
|
Zhao, J.,
L. Hyman, and C. Moore.
1999.
Formation of mRNA 3' ends in eukaryotes: mechanism, regulation, and interrelationships with other steps in mRNA synthesis.
Microbiol. Mol. Biol. Rev.
63:405-445[Abstract/Free Full Text].
|
Molecular and Cellular Biology, November 2001, p. 7495-7508, Vol. 21, No. 21
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.21.7495-7508.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Dengl, S., Cramer, P.
(2009). Torpedo Nuclease Rat1 Is Insufficient to Terminate RNA Polymerase II in Vitro. J. Biol. Chem.
284: 21270-21279
[Abstract]
[Full Text]
-
Rigo, F., Martinson, H. G.
(2009). Polyadenylation releases mRNA from RNA polymerase II in a process that is licensed by splicing. RNA
15: 823-836
[Abstract]
[Full Text]
-
Rigo, F., Martinson, H. G.
(2008). Functional Coupling of Last-Intron Splicing and 3'-End Processing to Transcription In Vitro: the Poly(A) Signal Couples to Splicing before Committing to Cleavage. Mol. Cell. Biol.
28: 849-862
[Abstract]
[Full Text]
-
Nag, A., Narsinh, K., Kazerouninia, A., Martinson, H. G.
(2006). The conserved AAUAAA hexamer of the poly(A) signal can act alone to trigger a stable decrease in RNA polymerase II transcription velocity. RNA
12: 1534-1544
[Abstract]
[Full Text]
-
Rosonina, E., Kaneko, S., Manley, J. L.
(2006). Terminating the transcript: breaking up is hard to do.. Genes Dev.
20: 1050-1056
[Full Text]
-
Plant, K. E., Dye, M. J., Lafaille, C., Proudfoot, N. J.
(2005). Strong Polyadenylation and Weak Pausing Combine To Cause Efficient Termination of Transcription in the Human G{gamma}-Globin Gene. Mol. Cell. Biol.
25: 3276-3285
[Abstract]
[Full Text]
-
Carroll, K. L., Pradhan, D. A., Granek, J. A., Clarke, N. D., Corden, J. L.
(2004). Identification of cis Elements Directing Termination of Yeast Nonpolyadenylated snoRNA Transcripts. Mol. Cell. Biol.
24: 6241-6252
[Abstract]
[Full Text]
-
DICHTL, B., AASLAND, R., KELLER, W.
(2004). Functions for S. cerevisiae Swd2p in 3' end formation of specific mRNAs and snoRNAs and global histone 3 lysine 4 methylation. RNA
10: 965-977
[Abstract]
[Full Text]
-
Zhang, Z., Wu, C.-H., Gilmour, D. S.
(2004). Analysis of Polymerase II Elongation Complexes by Native Gel Electrophoresis: EVIDENCE FOR A NOVEL CARBOXYL-TERMINAL DOMAIN-MEDIATED TERMINATION MECHANISM. J. Biol. Chem.
279: 23223-23228
[Abstract]
[Full Text]
-
Kim, S. J., Martinson, H. G.
(2003). Poly(A)-dependent Transcription Termination: CONTINUED COMMUNICATION OF THE POLY(A) SIGNAL WITH THE POLYMERASE IS REQUIRED LONG AFTER EXTRUSION IN VIVO. J. Biol. Chem.
278: 41691-41701
[Abstract]
[Full Text]
-
Johanson, K., Hoang, T., Sheth, M., Hyman, L. E.
(2003). GRS1, a Yeast tRNA Synthetase with a Role in mRNA 3' End Formation. J. Biol. Chem.
278: 35923-35930
[Abstract]
[Full Text]
-
Kyburz, A., Sadowski, M., Dichtl, B., Keller, W.
(2003). The role of the yeast cleavage and polyadenylation factor subunit Ydh1p/Cft2p in pre-mRNA 3'-end formation. Nucleic Acids Res
31: 3936-3945
[Abstract]
[Full Text]
-
He, X., Khan, A. U., Cheng, H., Pappas, D. L. Jr., Hampsey, M., Moore, C. L.
(2003). Functional interactions between the transcription and mRNA 3' end processing machineries mediated by Ssu72 and Sub1. Genes Dev.
17: 1030-1042
[Abstract]
[Full Text]
-
Orozco, I. J., Kim, S. J., Martinson, H. G.
(2002). The Poly(A) Signal, without the Assistance of Any Downstream Element, Directs RNA Polymerase II to Pause in Vivo and Then to Release Stochastically from the Template. J. Biol. Chem.
277: 42899-42911
[Abstract]
[Full Text]
Top
Abstract
Introduction
