Previous Article | Next Article 
Molecular and Cellular Biology, November 2001, p. 7558-7568, Vol. 21, No. 22
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.22.7558-7568.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Autoregulation of the Human Liver X Receptor
Promoter
Bryan A.
Laffitte,1
Sean B.
Joseph,2
Robert
Walczak,1
Liming
Pei,2
Damien C.
Wilpitz,1
Jon L.
Collins,3 and
Peter
Tontonoz1,2,*
Howard Hughes Medical
Institute1 and Department of Pathology
and Laboratory Medicine,2 University of
California, Los Angeles, California 90095-1662, and Nuclear
Receptor Discovery Research, GlaxoSmithKline, Research Triangle
Park, North Carolina 27709-33983
Received 17 April 2001/Returned for modification 29 June
2001/Accepted 28 August 2001
 |
ABSTRACT |
Previous work has implicated the nuclear receptors liver X receptor
(LXR
) and LXR
in the regulation of macrophage gene expression
in response to oxidized lipids. Macrophage lipid loading leads to
ligand activation of LXRs and to induction of a pathway for cholesterol
efflux involving the LXR target genes ABCA1 and apoE. We demonstrate here that autoregulation of the
LXR
gene is an important component of this lipid-inducible efflux
pathway in human macrophages. Oxidized low-density lipoprotein,
oxysterols, and synthetic LXR ligands induce expression of LXR
mRNA
in human monocyte-derived macrophages and human macrophage cell lines
but not in murine peritoneal macrophages or cell lines. This is in contrast to peroxisome proliferator-activated receptor
(PPAR
)-specific ligands, which stimulate LXR
expression in both
human and murine macrophages. We further demonstrate that LXR and
PPAR
ligands cooperate to induce LXR
expression in human but not
murine macrophages. Analysis of the human LXR
promoter led to the
identification of multiple LXR response elements. Interestingly, the
previously identified PPAR response element (PPRE) in the murine LXR
gene is not conserved in humans; however, a different PPRE is present in the human LXR 5'-flanking region. These results have implications for cholesterol metabolism in human macrophages and its potential to be
regulated by synthetic LXR and/or PPAR
ligands. The ability of
LXR
to regulate its own promoter is likely to be an integral part of
the macrophage physiologic response to lipid loading.
 |
INTRODUCTION |
Oxidized lipid signaling in
macrophages is central to the pathogenesis of atherosclerosis
(20, 24). Exposure of macrophages and other vascular cells
to oxidized low-density lipoprotein (oxLDL) leads to complex changes in
gene expression that are collectively thought to influence the
development of the atherosclerotic lesion. Mounting evidence suggests
that nuclear receptor signaling pathways mediate many of the effects of
oxidized lipids on cellular gene expression. Macrophage uptake of oxLDL
has the potential to provide the cell with oxidized fatty acid ligands
of peroxisome proliferator-activated receptor
(PPAR
) as well as
oxysterol ligands of liver X receptor
(LXR
) and LXR
(8,
12, 13).
LXR
and LXR
have been identified as key regulators of lipid
homeostasis in multiple cell types (18). Targeted
disruption of the Lxr
gene in mice uncovered roles for
this receptor in the regulation of both hepatic bile acid synthesis and
intestinal cholesterol absorption (16, 19). The
observation that sterol regulatory element-binding protein
1-c is a target for LXRs suggests that LXRs may be involved
in the control of lipogenesis (6, 17, 21). Recent work has
also implicated LXRs in the control of gene expression in response to
macrophage lipid loading. Multiple genes potentially involved in the
cellular cholesterol efflux pathway, including the putative
cholesterol/phospholipid transporter ABCA1 (5, 19, 22,
28), ABCG1 (29), and apolipoprotein E
(apoE) (11), have been identified as
transcriptional targets of LXR/retinoid X receptor (RXR) heterodimers.
Moreover, ligand activation and/or retroviral expression of LXR
in
macrophages and fibroblasts stimulates ABCA1-mediated cholesterol
efflux to extracellular acceptors such as apoAI (22,
28). These observations suggest that the rate of cholesterol
efflux in macrophages and other peripheral cells is controlled, at
least in part, by LXR signaling pathways.
The mechanisms that control expression of the LXR
and LXR
genes
are not well understood. In mice, LXR
is expressed primarily in the
liver, intestine, adipose tissue, and macrophages, whereas LXR
is
widely expressed (15, 30). Clearly, distinct
trans-acting factors must be involved in the regulation of
these genes. Liver expression of LXR
has been reported to be
responsive to dietary fatty acids in mice (25). This led
to the suggestion that the murine LXR
(mLXR
) gene may be a target
for PPAR
regulation in the liver; however, synthetic
PPAR
-selective ligands have not been shown to influence LXR
expression in liver cells. It has previously been shown that expression
of LXR
, but not LXR
, is induced by synthetic PPAR
ligands in both human and murine macrophages (2). As a
consequence of this regulation, ligands for LXR and PPAR
additively
promote cholesterol efflux from macrophages. We identified a functional
PPAR response element (PPRE) in the promoter of the mLXR
gene and
demonstrated that induction by synthetic PPAR
ligands is lost in
PPAR
-deficient murine macrophages. Thus, expression of LXR
is not
only tissue specific, but it is also likely to be regulated in response
to certain metabolic signals.
We demonstrate here that expression of LXR
is highly induced in
human macrophages in response to lipid loading. Moreover, we
demonstrate that this lipid inducibility is likely to result from
feedback induction of the LXR
gene by LXR/RXR heterodimers. The
human LXR
gene (hLXR
) is a direct target for regulation by both
LXR and PPAR
, and synthetic ligands for these receptors cooperatively induce its expression in macrophages. Interestingly, autoregulation of the LXR
promoter is not observed in murine macrophages. Consistent with this difference, we show that certain LXR
target genes, such as apoE, are more highly regulated by LXR ligands in human versus murine macrophages. This species-specific difference in LXR
regulation may have implications for cholesterol metabolism and its potential to be regulated by synthetic LXR and/or
PPAR
ligands.
 |
MATERIALS AND METHODS |
Reagents and plasmids.
pCMX expression plasmids for PPAR
,
RXR
, LXR
, and LXR
have been described (7, 28).
pCMX-VP16-LXR
was a gift from Ron Evans (Salk Institute). GW7845,
GW3965, and T0901317 were provided by Tim Willson (GlaxoSmithKline).
LG268 was provided by Rich Heyman (Ligand Pharmaceuticals). Ligands
were dissolved in ethanol or dimethyl sulfoxide prior to use in cell
culture. The hLXR
promoter was cloned from the bacterial artificial
chromosome (BAC) clone RP11-390K5 by PCR using the high-fidelity
polymerase Pfu. A region spanning from
2625 to
1368
(relative to the transcription start site from exon 1A) was amplified
by PCR from RP11-390K5 and cloned into the BamHI site of
pTK-Luciferase to create pTK-hLXR
(
2625)-Luc. Regions corresponding
to bp
2625 to +375,
2210 to +375,
1383 to +375, and
560 to +375
of the hLXR
promoter were amplified by PCR and cloned into
KpnI/NheI-digested pGL3-Luciferase (Promega), creating pGL3-hLXR
(
2625)-Luc, pGL3-hLXR
(
2210)-Luc,
pGL3-hLXR
(
1383)-Luc, and pGL3-hLXR
(
560)-Luc.
5' RACE.
5' rapid amplification of cDNA ends (RACE) was
performed using the SMART RACE cDNA Amplification kit (Clontech).
Briefly, first-strand cDNA was synthesized from total RNA derived from primary human macrophages or tetradecanoyl phorbol
acetate-differentiated THP-1 cells using a poly(dT) primer and
the SMART II oligonucleotide. 5' RACE PCR was then performed using the
Universal Primer mix and either of two gene-specific primers
complementary to the hLXR
mRNA sequence
[hLXR
(141), TGCCTCCCTGGGCCTGGCTGCTT,
or hLXR
(391), TTGCAGCCCTCGCAGCTCAGAACAT]. Amplification was performed
using touchdown PCR on a BioRad iCycler Thermal Cycler (BioRad). 5' RACE products were cloned by TOPO TA Cloning (Invitrogen).
Approximately 40 clones were sequenced.
Cell culture and transfections.
THP-1 and MonoMac-6 cells
were cultured in RPMI medium containing 10% fetal bovine serum (FBS).
NIH 3T3 and 3T3-F442A cells were grown in Dulbecco's modified Eagle's
medium (DMEM) containing 10% calf serum, and HepG2 cells were
grown in modified Eagle's medium (MEM) containing 10% FBS.
Peritoneal macrophages were obtained from thioglycolate-injected mice
as described (29) and cultured in DMEM containing 10%
FBS. Human primary monocytes/macrophages were obtained as previously
described (29) and maintained in Iscove's modified
Dulbecco's medium containing 10% FBS. Human primary
preadipocytes were obtained from ZenBio, Inc., and cultured in a Ham's
F-12 medium-DMEM mixture (1:1). For ligand treatments, cells were
cultured in RPMI medium, DMEM, Iscove's modified Dulbecco's medium,
or Ham's F-12 medium supplemented with 10% lipoprotein-deficient serum (LPDS) (Intracel) and receptor ligands for 48 h. In some experiments, cells were sterol depleted by inclusion of 5 µM
simvastatin and 100 µM mevalonic acid during the treatment period.
Transient transfections of HepG2 cells were performed in triplicate in
48-well plates. Cells were transfected with reporter plasmid (100 ng/well), receptor plasmids (5 to 50 ng/well), pCMV-
-galactosidase
(50 ng/well), and pTKCIII (to a total of 205 ng/well) using the MBS mammalian transfection kit (Stratagene). Following transfection, cells
were incubated in MEM containing 10% LPDS and the indicated ligands or
vehicle control for 24 h. Luciferase activity was normalized to
-galactosidase activity.
RNA analysis.
Total RNA was isolated using Trizol reagent
(Life Technologies, Inc.). Northern analysis was performed as described
(26) using radiolabeled cDNA probes. Blots were normalized
using cDNA probes to 36B4 and quantitated by PhosphorImager (Molecular
Dynamics) analysis. Real-time quantitative PCR assays were performed
using an Applied Biosystems 7700 sequence detector. Briefly, 1 µg of total RNA was reverse transcribed with random hexamers using the Taqman
Reverse Transcription Reagents kit (Applied Biosystems) according to
the manufacturer's protocol. Each amplification mixture (50 µl)
contained 50 ng of cDNA, 900 nM forward primer, 900 nM reverse primer,
100 nM dual-labeled fluorogenic probe (Applied Biosystems), and 25 µl
of Universal PCR Master mix. PCR thermocycling parameters were 50°C
for 2 min, 95°C for 10 min, and 40 cycles of 95°C for 15 and
60°C for 1 min. All samples were analyzed for
-actin (human) or
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (mouse) expression in
parallel in the same run using probe and primers from predeveloped
assays for
-actin and GAPDH (Applied Biosystems). Quantitative
expression values were extrapolated from separate standard curves for
-actin or GAPDH and human- or mouse-generated expression with
10-fold dilutions of cDNA (in duplicate). Each sample was normalized to
-actin or GAPDH, and replicates were then averaged and fold
induction was determined. The following human primers were used:
hLXR
forward (F) (5'-AAGCCCTGCATGCCTACGT-3'), hLXR
reverse (R) (5'-TGCAGACGCAGTGCAAACA-3'),
hLXR
Taqman probe (FAM-CCACCATCCCCATGACCGACTGAT-TAMRA), human apoE
(hapoE) F (5'-CGCTGGGTGCAGACACTGT-3'), hapoE R (5'-GGCCTTCAACTCCTTCATGGT-3'), and
hapoE probe (FAM-TCCATCAGCGCCCTCAGTTCCTG-TAMRA). The following murine primers were used: mLXR
F (5'-CAACAGTGTAACAGGCGCT-3'), mLXR
R
(5'-TGCAATGGGCCAAGGC-3'), mLXR
Taqman probe
(FAM-TCAGACCGCCTGCGCGTCA-TAMRA), murine apoE
(mapoE) F (5'-GGAGGTGACAGATCAGCTCGA-3'),
mapoE R (5'-TCCCAGAAGCGGTTCAGG-3'), and
mapoE probe (FAM-CAAAGCAACCAACCCTGGGAGCAG-TAMRA).
Gel shift assays.
In vitro-translated RXR
, LXR
, and
PPAR
were generated from pCMX-RXR
, pCMX-hLXR
, and pCMX-PPAR
plasmids using the TNT Quick Coupled Transcription/Translation system
(Promega). Gel shift assays were performed as described
(10) using in vitro-translated proteins and the following
oligonucleotides (only one strand shown): hLXR
PPRE
(GATCGGATTTTGAACTTTGTACTTGTTTCC), hLXR
DR4-A
(GATCGGGTGGATCACTTGAGGTCAGGAG), hLXR
DR4-B
(GATCAGATGGATCACTTGAGGTCAGGAG), hLXR
DR4-C
(GATCGCTGAGGTTACTGCTGGTCATTCA), and CYP7A LXR response
element (LXRE) (CCTTTGGTCACTCAAGTTCAAGTG).
 |
RESULTS |
Previous work has demonstrated that macrophage expression of
PPAR
is induced in response to oxLDL (27). We
investigated whether expression of LXR
or LXR
in macrophages
might also be regulated by modified lipoproteins. The human monocytic
cell line THP-1 was used as a model system. THP-1 cells were
differentiated for 24 h with 40 ng of tetradecanoyl phorbol
acetate per ml and then treated in the presence of LPDS for 48 h
with either vehicle alone or 100 µg of (protein) LDL, oxLDL, or
acetylated LDL (acLDL) per ml. In order to ensure maximal sterol
depletion of the cells, treatments were carried out in the presence of
the 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitor
simvastatin (5 µM) and mevalonic acid (100 µM). As shown in Fig.
1, the treatment of THP-1 macrophages with oxLDL or acLDL led to a significant induction of LXR
mRNA. In
contrast, native LDL, which is not readily internalized by these cells,
had no effect on LXR
expression. Expression of the related nuclear
receptor LXR
was not altered in response to native or modified LDL.
Induction of LXR
mRNA in these experiments paralleled that of the
known LXR target genes ABCA1 and ABCG1. Similar
results were obtained with primary human monocyte-derived macrophages (Fig. 1). Surprisingly, while oxLDL and acLDL were effective inducers of ABCA1 and ABCG1 expression in murine macrophages, they had little or
no effect on LXR
expression. Modified LDL also had no effect on
LXR
expression in murine RAW264.7 macrophages (reference 28 and data not shown). These observations suggest that
species-specific differences may exist in the mechanisms controlling
LXR
expression.

View larger version (76K):
[in this window]
[in a new window]
|
FIG. 1.
Induction of LXR expression in human macrophages in
response to modified LDL loading. Differentiated THP-1 macrophages,
primary human monocyte-derived macrophages (M ), or
thioglycolate-elicited mouse peritoneal macrophages were incubated for
48 h in RPMI medium containing 10% LPDS, 5 µM simvastatin, and 100 µM mevalonic acid. Cells were treated with vehicle control or 100 µg (protein) of either LDL, oxLDL, or acLDL per ml as indicated.
Total RNA (10 µg/lane) was electrophoresed through
formaldehyde-containing gels, transferred to nylon, and hybridized to
32P-labeled cDNA probes. 36B4 was used as a control for
loading and integrity of the RNA.
|
|
The ability of modified LDL to modulate LXR
gene expression led us
to hypothesize that the LXR
gene might itself be a downstream target
of the LXR signaling pathway in human macrophages. To address this
possibility, we examined the ability of oxysterols and synthetic LXR
ligands to regulate LXR
expression in various macrophage cell lines.
As shown in Fig. 2A, the treatment of
human THP-1 macrophages with the oxysterol LXR ligand
22(R)-hydroxycholesterol (2 µg/ml) or with either of two
synthetic LXR agonists, T1317 (19, 21) and GW3965
(14), led to a prominent induction of LXR
mRNA
expression. Treatment with the synthetic RXR-specific agonist LG268
(100 nM) also induced LXR
expression, and the combination of the LXR
ligand and LG268 had an additive effect.
22(S)-hydroxycholesterol (2 µg/ml), which binds but does
not activate LXRs (23), did not alter LXR
expression.
Similar to the results obtained with modified lipoproteins (Fig. 1),
induction of ABCA1 and ABCG1 expression by nuclear receptor ligands
paralleled that of LXR
. Expression of LXR
was not influenced by
LXR or RXR ligands. An even more dramatic induction of LXR
expression by LXR ligands was observed when endogenous cholesterol
synthesis was inhibited by treatment with simvastatin (Fig. 2B).
Similar results were observed in primary human monocyte-derived
macrophages and MonoMac-6 cells (Fig. 3 and data not shown). The reduced basal expression of LXR
observed in
the presence of simvastatin suggests that endogenous oxysterol LXR
ligands are required for tonic expression of LXR
. Interestingly, the
sterol regulatory element-binding protein 1-c gene has been reported to
be a target for LXR and to be similarly dependent on endogenous LXR
ligands for its expression in liver cells (6, 17).

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 2.
Oxysterols and synthetic LXR ligands stimulate LXR
expression in THP-1 macrophages. Differentiated THP-1 macrophages (A
and B) or thioglycolate-elicited mouse peritoneal macrophages (M )
(C) were incubated for 48 h in RPMI medium plus 10% LPDS or RPMI
medium plus 10% LPDS, 5 µM simvastatin, and 100 µM mevalonic acid
(unloaded). Oxysterols [20(S)HC, 22(R)HC, or
22(S)HC, 2.0 µg/ml], synthetic LXR ligand (GW3965
or T1317, 0.1 to 10.0 µM), or RXR ligand (LG268, 50 nM) was included
as indicated. Northern analysis was performed as described in the
legend to Fig. 1.
|
|

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 3.
Differential induction of the LXR target gene
apoE by LXR ligands in human and murine macrophages.
Differentiated THP-1 macrophages or thioglycolate-elicited mouse
peritoneal macrophages were incubated for 48 h in RPMI medium plus
10% LPDS, 5 µM simvastatin, and 100 µM mevalonic acid. Cells were
treated with the indicated concentrations of either T1317 or GW3965.
The expression of apoE mRNA was monitored by real-time
quantitative PCR (Taqman) assays (see Materials and Methods).
|
|
In contrast to the results obtained with human macrophages, treatment
of primary murine macrophages or the murine macrophage cell line
RAW264.7 with LXR-selective ligands did not significantly alter LXR
expression (Fig. 2C and data not shown). The failure of LXR
to be
induced in murine macrophages does not result from a general defect in
the LXR signaling pathway, since the LXR target genes ABCA1
and ABCG1 are effectively induced in these cells (Fig. 2C).
Rather, the ability of LXRs to regulate LXR
expression is apparently
species specific. The possibility that the murine gene is responsive to
LXR ligands in certain tissues or under certain conditions not tested
here, however, cannot be excluded.
The species-specific difference in the ability of LXR ligands to induce
LXR
receptor expression suggested the possibility that human
macrophages may be more responsive than murine macrophages to LXR
activation. Previous work has indicated that the LXR target gene
apoE is particularly sensitive to the level of LXR present in the cell. Induction of apoE expression by LXR ligand is
significantly reduced in macrophages from either
LXR
/
or LXR
/
mice, even in the
presence of high concentrations of ligand (11). We
therefore compared the dose response of the LXR target apoE to two synthetic LXR ligands in THP-1 cells and murine macrophages. As
shown in Fig. 3, the induction of apoE was significantly
higher in human cells in response to both GW3965 and T1317. This
difference is consistent with the higher level of LXR
receptor
expression in human cells in the presence of LXR ligand. Thus, the
ability of the hLXR
gene to undergo autoregulation is likely to have implications for LXR target gene expression.
Previous work has shown that macrophage LXR
expression is also
induced by PPAR
-specific ligands (2, 4). Accordingly, activation of PPAR
in THP-1 cells leads to the induction of primary LXR target genes such as ABCA1 and ABCG1. In
contrast to LXR ligands, PPAR
ligands have been shown to promote
LXR
mRNA expression in both human and murine macrophages. We
therefore examined the effects of simultaneous activation of both the
PPAR
and LXR pathways on macrophage gene expression. RNA expression
was monitored by either Northern analysis or real-time quantitative PCR
(Taqman) assays (see Materials and Methods). As shown in Fig.
4, the treatment of THP-1 macrophages
with oxysterol LXR ligands, synthetic LXR ligands (T1317 or GW3965), or
synthetic PPAR
ligands alone (rosiglitazone or GW7845) stimulated
LXR
expression. The combination of an LXR ligand and a PPAR
ligand had an additive effect. Similar results were obtained with the
human monocytic cell line MonoMac-6 (Fig. 4A) and human primary
monocytes/macrophages (Fig. 4B). Interestingly, the response of LXR
to this combined treatment was much more prominent than that observed
for ABCA1 or ABCG1 (reference 2 and data not shown). This
observation suggested that the hLXR
gene might be a direct target of
both LXR/RXR and PPAR
/RXR heterodimers, whereas ABCA1 and ABCG1 are
likely to be direct targets of only LXR/RXR. Consistent with the
results shown in Fig. 2C, LXR ligands failed to induce LXR
expression in murine macrophages, even when used in combination with a
PPAR
ligand (Fig. 4B).

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 4.
Ligands for LXR and PPAR additively induce LXR
expression in human macrophages. Differentiated THP-1 macrophages,
MonoMac-6 cells, human monocyte-derived macrophages (M ), or
thioglycolate-elicited mouse peritoneal macrophages were incubated for
48 h in RPMI medium plus 10% LPDS. Oxysterols
{20(S)HC [20 (S)] or 22(R)HC [22
(R)], 2.0 µg/ml}, synthetic LXR ligands (GW3965
or T1317, 5 µM), and/or PPAR ligands (rosiglitazone [Rosi] or
GW7845, 5 µM) were included as indicated. Northern blots (A) were
quantitated by phosphorimager analysis and normalized to 36B4.
The level of expression relative to LPDS control (fold induction) is
indicated; real-time quantitative PCR assays (B) were performed in
duplicate as described in Materials and Methods and normalized to 36B4
or -actin. The level of mRNA expression relative to control (fold
induction) is indicated.
|
|
We further addressed whether the ability of LXRs and PPARs to regulate
LXR
expression was specific to macrophages or whether it also
occurred in other cell types. As shown in Fig.
5, autoregulation of the hLXR
gene was
also observed in liver and adipose cell lines. Treatment with the LXR
ligand GW3965 or T1317 induced LXR
expression in both human
preadipocytes and the human hepatoma cell line HepG2. As in
macrophages, induction of LXR
expression paralleled induction of
ABCA1. In contrast, ligands for PPAR
(GW7845) or PPAR
(WY14613)
had no effect on LXR
expression in HepG2 cells. Consistent with the
results obtained in macrophages, the mLXR
gene was induced by the
PPAR
ligand but not by the LXR ligand in 3T3-F442A preadipocytes
under similar conditions. In experiments not shown, we have observed
induction of LXR
mRNA expression by synthetic PPAR
and LXR
ligands in THP-1 cells in the presence of the protein synthesis
inhibitor cycloheximide but not in the presence of the RNA polymerase
inhibitor actinomycin D, consistent with direct transcriptional
effects. Taken together, these results reveal a partially overlapping
pattern of regulation of the mLXR
and hLXR
genes by nuclear
receptors. Both the hLXR
and mLXR
genes are targets for PPAR
regulation in macrophages and adipocytes. The hLXR
gene, but not the
mLXR
, is also regulated by LXR itself in multiple cell types,
including macrophages, adipocytes, and hepatocytes.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 5.
Autoregulation of the hLXR gene in preadipocytes and
HepG2 cells. Primary human preadipocytes (Pre Ad), HepG2 cells, or
3T3-F442A murine preadipocytes were cultured for 48 h in media
containing 10% LPDS and one or more of the following nuclear receptor
ligands as indicated: GW3965 (5 µM), T1317 (5 µM), GW7845 (5 µM),
and Wy14643 (50 µM).
|
|
To investigate the molecular basis for the regulation of hLXR
expression by LXR and PPAR
ligands, we cloned and analyzed the
5'-flanking region from the hLXR
gene. The transcriptional start
site of the hLXR
gene was mapped by 5' RACE using RNA derived from
primary human macrophages and THP-1 cells. Analysis of the 5' RACE
products revealed two distinct transcriptional start sites (Fig.
6). As a result of alternative splicing,
these give rise to two alternatively utilized exon 1 sequences (Fig.
7A). The vast majority of the products of
the 5' RACE reactions corresponded to use of the downstream (exon 1B)
start site, suggesting that this is the primary site utilized in human
macrophages. The genomic sequence and organization of the hLXR
gene
were determined by searching the human genome and the high throughput
genomic sequence databases (National Center for Biotechnology
Information) using the revised mRNA sequence for hLXR
. We identified
a BAC clone (RP11-390K5) containing the entire hLXR
mRNA sequence
and approximately 5 kb of the 5'-flanking sequence. Comparison of the
hLXR
and mLXR
genomic sequences revealed a similar genomic
structure, with each gene composed of 10 exons. Exon 1A from the
hLXR
gene shows a high level of homology to the previously reported
transcriptional start site for the mLXR
gene. In the human genomic
sequence, exon 1B is located approximately 343 bp downstream of the
exon 1A start site. This sequence is conserved in the murine genomic sequence, and a previous report suggested that this region might be
utilized as an alternative start site in the mouse (1). In
both humans and mice, exon 1 is comprised entirely of untranslated sequence; therefore, the use of alternative exon 1 sequences does not
impact the protein product.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 6.
Sequence comparison of the hLXR and mLXR
transcriptional start sites. The putative transcriptional start sites
are marked by arrows. The initiator element is indicated in bold type.
The previously published mouse transcriptional start site is
designated as position +1 (1).
|
|

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 7.
Comparison of the hLXR and mLXR promoter regions.
(A) Schematic representation of the hLXR and mLXR genes.
Transcription start sites, genomic structure, sequence identity, and
nuclear receptor binding sites are indicated. The asterisk denotes the
major start site in macrophages. The arrows indicate hormone response
element half sites. (B) Sequences of the LXREs and PPREs from
the hLXR and mLXR promoters.
|
|
The proximal 2.6 kb of the hLXR
promoter region from BAC clone
RP11-390K5 was cloned and sequenced. Comparison with the mLXR
gene
revealed conservation of the transcriptional start regions and
similarity up to approximately 250 bp upstream of the exon 1A start
site (79% identity) (Fig. 6 and 7). However, relatively poor
conservation of the sequence was found further upstream. In particular,
the previously identified PPRE located in the mLXR
gene
(2) is not conserved in the human sequence. A potential PPRE (DR-1) was identified in the hLXR
5'-flanking region that is
not conserved in location or sequence in comparison to the mouse (Fig.
6). In addition, the hLXR
gene was found to contain three potential
LXREs (DR-4). Only one of these potential LXREs (LXRE-C) was in a
region conserved in the mouse promoter sequence; furthermore, the mouse
DR4-C sequence differed from the human sequence within one half site.
We next endeavored to determine whether the identified elements
represented bona fide binding sites for LXR/RXR or PPAR
/RXR heterodimers. As shown in Fig. 8A, gel
mobility shift analysis using in vitro-translated proteins and
radiolabeled oligonucleotides confirmed that the putative PPRE from the
hLXR
gene bound PPAR
/RXR heterodimers with affinity similar to
that of the previously identified PPRE from the mLXR
gene
(2). Furthermore, all three putative LXREs bound in
vitro-translated LXR
/RXR (Fig. 8B). Competition assays indicated
that the distal element (LXRE-C) bound LXR
/RXR with significantly
higher affinity than LXRE-A, LXRE-B, or the LXRE from the murine CYP7A
gene (Fig. 8C).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 8.
PPAR and LXR bind to response elements in the
hLXR promoter. Gel mobility shift assays were performed using in
vitro-translated receptors and end-labeled oligonucleotide probes as
described in Materials and Methods. (A) Direct binding of PPAR /RXR
heterodimers to a putative PPRE from the hLXR promoter. (B) Direct
binding of LXR /RXR heterodimers to the LXRE-A, LXRE-B, and LXRE-C
sites from the hLXR promoter. (C) Competition for LXR /RXR binding
to LXRE-C. Unlabeled oligonucleotide was included in the binding
reaction at the indicated molar excess.
|
|
Finally, we analyzed the ability of PPAR
, LXR
, and LXR
to
regulate the hLXR
promoter in transient transfection assays. A
pGL3-based luciferase reporter construct containing bp
2625 to +345
of the hLXR
promoter (
2625 hLXR
-luc) was transiently transfected into HepG2 cells along with pCMX expression vectors encoding LXR
, LXR
, RXR
, and/or PPAR
. As shown in Fig.
9A, the LXR
/RXR
and LXR
/RXR
heterodimers activated the hLXR
promoter in a ligand-dependent
manner, but they had no effect on the control pGL3-luc reporter. Note
that since HepG2 cells express endogenous LXRs, a background level of
ligand-dependent induction of the reporter is seen in the absence of
transfected receptor. When expression vectors for both LXR
and
PPAR
were cotransfected with the hLXR
promoter, an additive
effect of LXR-selective (GW3965) and PPAR
-selective (GW7845) ligands
was observed (Fig. 9B). These results confirm that the LXR and PPAR
binding sites identified above are in fact able to mediate activation
of the hLXR
promoter by PPAR
/RXR, LXR
/RXR, and
LXR
/RXR heterodimers. Moreover, the additive effect of
PPAR
and LXR activation on the hLXR
promoter in transient
transfection assays is consistent with the ability of PPAR and LXR
ligands to additively induce expression of the endogenous hLXR
gene.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 9.
LXR , LXR , and PPAR activate the hLXR
promoter. (A) LXR /RXR and LXR /RXR heterodimers activate the
2625-bp LXR proximal promoter. HepG2 cells were transfected with
either control pGL3-luc or -2625 LXR -luc reporters with or without
CMX-mLXR /CMX-RXR or CMX-mLXR /CMX-RXR and
CMV- -galactosidase. Following transfection, cells were incubated
for 24 h in MEM supplemented with 10% LPDS and 1 µM GW3965 or
vehicle control. Luciferase activity was normalized for transfection
efficiency using -galactosidase activity. (B) Ligand activation of
PPAR and LXR has an additive effect on the 2625-bp LXR
promoter. HepG2 cells were transfected as in panel A except that
CMX-mPPAR 1 and GW7845 (1 µM) were included as indicated.
|
|
In order to address the relative importance of the individual nuclear
receptor binding sites, deletion and mutation analyses were performed.
We analyzed the ability of LXR
and RXR expression vectors to
activate luciferase reporters containing bp
2625 to +345,
2210 to
+345,
1310 to +345, or 560 to +345 of the hLXR
promoter.
Surprisingly, deletion from bp
2625 to
2210, which deletes LXRE-C,
resulted in the complete loss of LXR responsiveness (Fig.
10A). Similar results were obtained
with an expression vector encoding a superactive VP16-LXR
fusion
protein (11). The construct containing LXRE-C (bp
2625
to +345) was activated over 30-fold by VP16-LXR
, whereas those
lacking this element were unresponsive (Fig. 10B). These observations
suggested that the LXRE-C element is required for induction of the
hLXR
promoter by LXR. To test this directly, we introduced specific
mutations in each of the LXREs. As shown in Fig. 10, mutation of LXRE-C
alone abolished promoter activation by LXR
, while simultaneous
mutation of LXRE-A and LXRE-B had no effect. These results indicate
that LXRE-C is the primary element mediating induction of the LXR
promoter by LXR/RXR heterodimers. The other potential response elements
(LXRE-A and -B) apparently do not contribute to the induction of the
hLXR
promoter despite their ability to bind LXR/RXR in vitro. This is consistent with the observation that LXRE-C has the highest affinity
for LXR/RXR of the three sites (Fig. 8). Taken together, these results
demonstrate that the hLXR
promoter is a direct target for regulation
by both PPAR
/RXR and LXR
/RXR heterodimers.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 10.
Deletion and mutation analysis of the hLXR proximal
promoter. (A) Luciferase reporters containing bp 2625 to +345, 2210
to +345, 1310 to + 345, or 560 to +345 of the hLXR promoter
were transfected into HepG2 cells in the presence or absence of
CMX-hLXR , CMX-RXR , and 5 µM T1317. Luciferase activity was
normalized for transfection efficiency using -galactosidase
activity. The data are expressed as fold activations in the presence of
the indicated ligand versus in the absence of ligand and represent the
average of triplicate experiments. (B) hLXR promoter constructs were
cotransfected into HepG2 cells along with CMX vector or CMX-VP16-LXR
in the presence of 5 µM T1317. Data are expressed as relative
luciferase activities normalized to -galactosidase activities and
represent the average of triplicate experiments. (C) Mutations were
introduced into individual LXREs in the bp 2625 to +345 hLXR
promoter construct by site-directed mutagenesis. Wild-type (WT) and
mutant (Mut) reporters were transfected into HepG2 cells along with
CMX-hLXR and CMX-RXR in the presence or absence of 1 µM GW3965.
Data are expressed as luciferase activities normalized to
-galactosidase activities and represent the averages of triplicate
experiments.
|
|
 |
DISCUSSION |
Members of the nuclear receptor superfamily are now recognized to
play a central role in the control of lipid-inducible gene expression.
Both the PPAR and LXR subfamilies have been implicated in the
regulation of gene expression and lipid metabolism in response to
specific lipid ligands. PPAR
is expressed at high levels in a number
of specialized cell types, including adipocytes, colonic epithelia, and
macrophages. No high-affinity endogenous ligand for this receptor has
been described; however, physiologic activators of PPAR
are likely
to include native and oxidized polyunsaturated fatty acids (7, 9,
13). LXR
is expressed at high levels in many of the same
tissues as PPAR
, including macrophages and adipose tissue, while
LXR
is ubiquitously expressed. Considerable evidence suggests that
the physiologic ligands for LXRs are oxysterols such as
24(S)-hydroxycholesterol and
24(S),25-epoxycholesterol (8, 12, 23).
In macrophages, the PPAR and LXR families appear to coordinate a
physiologic response to oxLDL uptake and lipid loading. A primary
functional consequence of PPAR and LXR activation in macrophages is the
induction of a pathway for cholesterol and phospholipid efflux. Ligands
for either receptor additively promote cholesterol efflux from human
macrophages (2, 28). The role of PPAR
in this response
appears to be to induce expression of the scavenger receptor CD36, the
HDL receptor SR-BI, and LXR
(2, 3, 27). The role of LXR
in this response appears to be to regulate several genes that have been
directly implicated in the cholesterol efflux pathway including
ABCA1, ABCG1, and apoE (5, 11,
22, 28, 29). Ligands for PPAR
and LXR additively promote
cholesterol efflux from macrophages, presumably as a consequence of the
ability of PPAR
to control LXR
expression.
In the present study, we have shown that the hLXR
gene is itself
induced in macrophages in response to cellular lipid loading. Moreover,
we have shown that this induction is likely to be mediated by the
direct binding of LXR/RXR heterodimers to the LXR
promoter. Interestingly, tonic expression of LXR
in human cells appears to be
dependent on endogenous production of oxysterol intermediates in the
cholesterol biosynthetic pathway. Inhibition of cholesterol synthesis
by simvastatin led to a complete loss of LXR
expression in THP-1
cells. Surprisingly, the ability of LXR
to regulate its own promoter
appears to be species specific. Oxysterol and synthetic ligands of LXRs
induce LXR
expression in human macrophage cell lines and primary
human macrophages but not in murine cell lines or primary murine
macrophages. In humans, this induction is observed in multiple cell
types, including macrophages, adipocytes, and hepatoma cells. Cloning
and analysis of the human LXR
5'-flanking region led to the
identification of the critical LXRE that is likely to mediate lipid inducibility.
Previous work demonstrated that expression of the LXR
gene is
induced in both human and murine macrophages by PPAR
-specific ligands (2, 4). A functional PPRE has been identified in the promoter of the mLXR
gene; however, the molecular basis for regulation of the hLXR
gene by PPAR
has not been explored. In the
present work, we have shown that although the PPRE present in the
murine proximal promoter is not conserved in the human gene, a
functional PPRE is present in a different region of the hLXR
promoter. Thus, while the hLXR
gene is a target for both PPAR
and
LXR, the murine gene appears to be a target only for PPAR
. The
possibility that the murine gene is responsive to LXR in certain
tissues or under certain conditions not tested here, however, cannot be
excluded. At present, hLXR
is the only known common
target gene for both PPAR
and LXRs. Tobin et al. have previously reported that liver LXR
expression was responsive to
dietary fatty acids and have suggested that the mLXR
gene may be a
target for PPAR
regulation in liver (25).
However, we have not observed regulation of LXR
mRNA by either
PPAR
- or PPAR
-specific ligands in liver cells (Fig. 5). Rather,
our data suggest that the LXR
gene is a target for PPAR regulation only in certain tissues such as macrophages and adipocytes.
Substantial differences in lipid metabolism exist between mice and
humans. The results presented here have implications for cholesterol
metabolism in both species and its potential to be regulated by
synthetic LXR and/or PPAR
ligands. We have outlined an unexpected
species-specific difference in the regulation of LXR
expression by
oxidized lipid ligands of LXRs. In human macrophages, the ability of
LXR
to regulate its own promoter is likely to be an integral part of
the physiologic response to lipid loading. The LXR
autoregulatory
loop provides a mechanism whereby the cellular response to lipid
loading can be amplified and maximized. The species-specific difference
in the ability to amplify the LXR response raises the possibility that
humans may be more responsive than mice to LXR agonists in general and
to LXR
agonists in particular.
Several lines of evidence support the hypothesis that upregulation of
LXR
expression can impact LXR target gene expression and cellular
function, even though most cells also express significant levels of
LXR
. First, the phenotype of LXR
/
mice clearly indicates that
the two receptors are not entirely redundant (16). Second, although studies have shown that induction of ABCA1 and ABCG1 is
preserved in LXR
/
macrophages in the presence of maximal concentrations of ligands (19, 29), expression of
apoE is reduced in either LXR
/
or LXR
/
mice
under identical conditions (11). Thus, some target genes
are more sensitive than others to the absolute levels of LXR present in
the cell. It is for this subset of genes that autoregulation of the
LXR
promoter is likely to have the greatest impact. Third, studies
have also shown that the level of LXR
expression is a key
determinant of both the sensitivity of ABCA1 induction and the rate of
cholesterol efflux. Retroviral expression of LXR
in cells that
already express LXR
shifts the dose response of ABCA1 to LXR ligands
and dramatically stimulates cholesterol efflux (28).
Finally, we have shown here that certain LXR target genes, such as
apoE, are in fact significantly more responsive to LXR
ligand in human macrophages than in murine macrophages (Fig. 3).
Our results also suggest that LXR
may play a more prominent role
than LXR
in certain human cell types, especially in the context of
cellular lipid loading. In resting macrophages, for example, expression
of LXR
is more prominent than that of LXR
(Fig. 2 and data not
shown). Upon lipid loading and LXR activation, however, the balance is
shifted dramatically in favor of LXR
. This could have an important
impact on gene expression and lipid metabolism if certain LXR target
genes are preferentially activated by either LXR
or LXR
. The
development of selective ligands for either LXR
or LXR
should
shed light on this issue.
 |
ACKNOWLEDGMENTS |
We thank Tim Willson (GlaxoSmithKline) for GW3965, GW7845, and
T0901317; Rich Heyman (Ligand Pharmaceuticals) for LG268; and Harleen
Ahuja for help with real-time PCR assays. We also thank Peter Edwards,
Matthew Kennedy, and Tim Willson for helpful discussions and Brenda
Mueller for administrative support.
P.T. is an Assistant Investigator of the Howard Hughes Medical
Institute at the University of California, Los Angeles.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Howard Hughes
Medical Institute, UCLA School of Medicine, Box 951662, Los Angeles, CA
90095-1662. Phone: (310) 206-4546. Fax: (310) 267-0382. E-mail: ptontonoz{at}mednet.ucla.edu.
 |
REFERENCES |
| 1.
|
Alberti, S.,
K. R. Steffensen, and J. A. Gustafsson.
2000.
Structural characterisation of the mouse nuclear oxysterol receptor genes LXRalpha and LXRbeta.
Gene
243:93-103[CrossRef][Medline].
|
| 2.
|
Chawla, A.,
W. A. Boisvert,
C. Lee,
B. A. Laffitte,
Y. Barak,
S. B. Joseph,
D. Liao,
L. Nagy,
P. A. Edwards,
L. K. Curtiss,
R. M. Evans, and P. Tontonoz.
2001.
A PPARgamma-LXR-ABCA1 pathway in macrophages is involved in cholesterol efflux and atherogenesis.
Mol. Cell
7:161-171[CrossRef][Medline].
|
| 3.
|
Chinetti, G.,
F. G. Gbaguidi,
S. Griglio,
Z. Mallat,
M. Antonucci,
P. Poulain,
J. Chapman,
J. C. Fruchart,
A. Tedgui,
J. Najib-Fruchart, and B. Staels.
2000.
CLA-1/SR-BI is expressed in atherosclerotic lesion macrophages and regulated by activators of peroxisome proliferator-activated receptors.
Circulation
101:2411-2417[Abstract/Free Full Text].
|
| 4.
|
Chinetti, G.,
S. Lestavel,
V. Bocher,
A. T. Remaley,
B. Neve,
I. P. Torra,
E. Teissier,
A. Minnich,
M. Jaye,
N. Duverger,
H. B. Brewer,
J. C. Fruchart,
V. Clavey, and B. Staels.
2001.
PPAR-alpha and PPAR-gamma activators induce cholesterol removal from human macrophage foam cells through stimulation of the ABCA1 pathway.
Nat. Med.
7:53-58[CrossRef][Medline].
|
| 5.
|
Costet, P.,
Y. Luo,
N. Wang, and A. R. Tall.
2000.
Sterol-dependent transactivation of the ABC1 promoter by the liver X receptor/retinoid X receptor.
J. Biol. Chem.
275:28240-28245[Abstract/Free Full Text].
|
| 6.
|
DeBose-Boyd, R. A.,
J. Ou,
J. L. Goldstein, and M. S. Brown.
2001.
Expression of sterol regulatory element-binding protein 1c (SREBP-1c) mRNA in rat hepatoma cells requires endogenous LXR ligands.
Proc. Natl. Acad. Sci. USA
98:1477-1482[Abstract/Free Full Text].
|
| 7.
|
Forman, B. M.,
P. Tontonoz,
J. Chen,
R. P. Brun,
B. M. Spiegelman, and R. M. Evans.
1995.
15-deoxy-delta 12,14-prostaglandin J2 is a ligand for the adipocyte determination factor PPAR gamma.
Cell
83:803-812[CrossRef][Medline].
|
| 8.
|
Janowski, B. A.,
P. J. Willy,
T. R. Devi,
J. R. Falck, and D. J. Mangelsdorf.
1996.
An oxysterol signalling pathway mediated by the nuclear receptor LXR alpha.
Nature
383:728-731[CrossRef][Medline].
|
| 9.
|
Kliewer, S. A.,
J. M. Lenhard,
T. M. Wilson,
I. Patel,
D. C. Morris, and J. M. Lehmann.
1995.
A prostaglandin J2 metabolite binds peroxisome proliferator-activated receptor gamma and promotes adipocyte differentiation.
Cell
83:813-819[CrossRef][Medline].
|
| 10.
|
Laffitte, B. A.,
H. R. Kast,
C. M. Nguyen,
A. M. Zavacki,
D. D. Moore, and P. A. Edwards.
2000.
Identification of the DNA binding specificity and potential target genes for the farnesoid X-activated receptor.
J. Biol. Chem.
275:10638-10647[Abstract/Free Full Text].
|
| 11.
|
Laffitte, B. A.,
J. J. Repa,
S. B. Joseph,
D. C. Wilpitz,
H. R. Kast,
D. J. Mangelsdorf, and P. Tontonoz.
2001.
LXRs control lipid-inducible expression of the apolipoprotein E gene in macrophages and adipocytes.
Proc. Natl. Acad. Sci. USA
98:507-512[Abstract/Free Full Text].
|
| 12.
|
Lehmann, J. M.,
S. A. Kliewer,
L. B. Moore,
T. A. Smith-Oliver,
B. B. Oliver,
J. L. Su,
S. S. Sundseth,
D. A. Winegar,
D. E. Blanchard,
T. A. Spencer, and T. M. Willson.
1997.
Activation of the nuclear receptor LXR by oxysterols defines a new hormone response pathway.
J. Biol. Chem.
272:3137-3140[Abstract/Free Full Text].
|
| 13.
|
Nagy, L.,
P. Tontonoz,
J. G. Alvarez,
H. Chen, and R. M. Evans.
1998.
Oxidized LDL regulates macrophage gene expression through ligand activation of PPAR gamma.
Cell
93:229-240[CrossRef][Medline].
|
| 14.
|
Oliver, W. R.,
J. L. Shenk,
M. R. Snaith,
C. S. Russell,
K. D. Plunket,
N. L. Bodkin,
M. C. Lewis,
D. A. Winegar,
M. L. Sznaidman,
M. H. Lambert,
H. E. Xu,
D. D. Sternbach,
S. A. Kliewer,
B. C. Hansen, and T. M. Willson.
2001.
A selective peroxisome proliferator-activated receptor delta agonist promotes reverse cholesterol transport.
Proc. Natl. Acad. Sci. USA
98:5306-5311[Abstract/Free Full Text].
|
| 15.
|
Peet, D. J.,
B. A. Janowski, and D. J. Mangelsdorf.
1998.
The LXRs: a new class of oxysterol receptors.
Curr. Opin. Genet. Dev.
8:571-575[CrossRef][Medline].
|
| 16.
|
Peet, D. J.,
S. D. Turley,
W. Ma,
B. A. Janowski,
J. M. Lobaccaro,
R. E. Hammer, and D. J. Mangelsdorf.
1998.
Cholesterol and bile acid metabolism are impaired in mice lacking the nuclear oxysterol receptor LXR alpha.
Cell
93:693-704[CrossRef][Medline].
|
| 17.
|
Repa, J. J.,
G. Liang,
J. Ou,
Y. Bashmakov,
J. M. Lobaccaro,
I. Shimomura,
B. Shan,
M. S. Brown,
J. L. Goldstein, and D. J. Mangelsdorf.
2000.
Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptors, LXRalpha and LXRbeta.
Genes Dev.
14:2819-2830[Abstract/Free Full Text].
|
| 18.
|
Repa, J. J., and D. J. Mangelsdorf.
2000.
The role of orphan nuclear receptors in the regulation of cholesterol homeostasis.
Annu. Rev. Cell Dev. Biol.
16:459-481[CrossRef][Medline].
|
| 19.
|
Repa, J. J.,
S. D. Turley,
J. A. Lobaccaro,
J. Medina,
L. Li,
K. Lustig,
B. Shan,
R. A. Heyman,
J. M. Dietschy, and D. J. Mangelsdorf.
2000.
Regulation of absorption and ABC1-mediated efflux of cholesterol by RXR heterodimers.
Science
289:1524-1529[Abstract/Free Full Text].
|
| 20.
|
Ross, R.
1995.
Cell biology of atherosclerosis.
Annu. Rev. Physiol.
57:791-804[CrossRef][Medline].
|
| 21.
|
Schultz, J. R.,
H. Tu,
A. Luk,
J. J. Repa,
J. C. Medina,
L. Li,
S. Schwendner,
S. Wang,
M. Thoolen,
D. J. Mangelsdorf,
K. D. Lustig, and B. Shan.
2000.
Role of LXRs in control of lipogenesis.
Genes Dev.
14:2831-2838[Abstract/Free Full Text].
|
| 22.
|
Schwartz, K.,
R. M. Lawn, and D. P. Wade.
2000.
ABC1 gene expression and ApoA-I-mediated cholesterol efflux are regulated by LXR.
Biochem. Biophys. Res. Commun.
274:794-802[CrossRef][Medline].
|
| 23.
|
Spencer, T. A.,
D. Li,
J. S. Russel,
J. L. Collins,
R. K. Bledsoe,
T. G. Consler,
L. B. Moore,
C. M. Galardi,
D. D. McKee,
J. T. Moore,
M. A. Watson,
D. J. Parks,
M. H. Lambert, and T. M. Willson.
2001.
Pharmacophore analysis of the nuclear oxysterol receptor LXRa.
J. Med. Chem.
44:886-897[CrossRef][Medline].
|
| 24.
|
Steinberg, D.
1997.
Low density lipoprotein oxidation and its pathobiological significance.
J. Biol. Chem.
272:20963-20966[Free Full Text].
|
| 25.
|
Tobin, K. A.,
H. H. Steineger,
S. Alberti,
O. Spydevold,
J. Auwerx,
J. A. Gustafsson, and H. I. Nebb.
2000.
Cross-talk between fatty acid and cholesterol metabolism mediated by liver X receptor-alpha.
Mol. Endocrinol.
14:741-752[Abstract/Free Full Text].
|
| 26.
|
Tontonoz, P.,
E. Hu, and B. M. Spiegelman.
1994.
Stimulation of adipogenesis in fibroblasts by PPARg2, a lipid-activated transcription factor.
Cell
79:1147-1156[CrossRef][Medline].
|
| 27.
|
Tontonoz, P.,
L. Nagy,
J. G. Alvarez,
V. A. Thomazy, and R. M. Evans.
1998.
PPARgamma promotes monocyte/macrophage differentiation and uptake of oxidized LDL.
Cell
93:241-252[CrossRef][Medline].
|
| 28.
|
Venkateswaran, A.,
B. A. Laffitte,
S. B. Joseph,
P. A. Mak,
D. C. Wilpitz,
P. A. Edwards, and P. Tontonoz.
2000.
Control of cellular cholesterol efflux by the nuclear oxysterol receptor LXRalpha.
Proc. Natl. Acad. Sci. USA
97:12097-12102[Abstract/Free Full Text].
|
| 29.
|
Venkateswaran, A.,
J. J. Repa,
J.-M. A. Lobaccaro,
A. Bronson,
D. J. Mangelsdorf, and P. A. Edwards.
2000.
Human white/murine ABC8 mRNA levels are highly induced in lipid-loaded macrophages.
J. Biol. Chem.
275:14700-14707[Abstract/Free Full Text].
|
| 30.
|
Willy, P. J.,
K. Umesono,
E. S. Ong,
R. M. Evans,
R. A. Heyman, and D. J. Mangelsdorf.
1995.
LXR, a nuclear receptor that defines a distinct retinoid response pathway.
Genes Dev.
9:1033-1045[Abstract/Free Full Text].
|
Molecular and Cellular Biology, November 2001, p. 7558-7568, Vol. 21, No. 22
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.22.7558-7568.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Marathe, C., Bradley, M. N., Hong, C., Chao, L., Wilpitz, D., Salazar, J., Tontonoz, P.
(2009). Preserved glucose tolerance in high-fat-fed C57BL/6 mice transplanted with PPAR{gamma}-/-, PPAR{delta}-/-, PPAR{gamma}{delta}-/-, or LXR{alpha}{beta}-/- bone marrow. J. Lipid Res.
50: 214-224
[Abstract]
[Full Text]
-
Hozoji, M., Munehira, Y., Ikeda, Y., Makishima, M., Matsuo, M., Kioka, N., Ueda, K.
(2008). Direct Interaction of Nuclear Liver X Receptor-{beta} with ABCA1 Modulates Cholesterol Efflux. J. Biol. Chem.
283: 30057-30063
[Abstract]
[Full Text]
-
Hoon Lee, J., Gong, H., Khadem, S., Lu, Y., Gao, X., Li, S., Zhang, J., Xie, W.
(2008). Androgen Deprivation by Activating the Liver X Receptor. Endocrinology
149: 3778-3788
[Abstract]
[Full Text]
-
Stayrook, K. R., Rogers, P. M., Savkur, R. S., Wang, Y., Su, C., Varga, G., Bu, X., Wei, T., Nagpal, S., Liu, X. S., Burris, T. P.
(2008). Regulation of Human 3{alpha}-Hydroxysteroid Dehydrogenase (AKR1C4) Expression by the Liver X Receptor {alpha}. Mol. Pharmacol.
73: 607-612
[Abstract]
[Full Text]
-
Herzog, B., Hallberg, M., Seth, A., Woods, A., White, R., Parker, M. G.
(2007). The Nuclear Receptor Cofactor, Receptor-Interacting Protein 140, Is Required for the Regulation of Hepatic Lipid and Glucose Metabolism by Liver X Receptor. Mol. Endocrinol.
21: 2687-2697
[Abstract]
[Full Text]
-
Qiu, G., Hill, J. S.
(2007). Atorvastatin decreases lipoprotein lipase and endothelial lipase expression in human THP-1 macrophages. J. Lipid Res.
48: 2112-2122
[Abstract]
[Full Text]
-
Ludtke, A., Buettner, J., Wu, W., Muchir, A., Schroeter, A., Zinn-Justin, S., Spuler, S., Schmidt, H. H.-J., Worman, H. J.
(2007). Peroxisome Proliferator-Activated Receptor-{gamma} C190S Mutation Causes Partial Lipodystrophy. J. Clin. Endocrinol. Metab.
92: 2248-2255
[Abstract]
[Full Text]
-
Traves, P. G., Hortelano, S., Zeini, M., Chao, T.-H., Lam, T., Neuteboom, S. T., Theodorakis, E. A., Palladino, M. A., Castrillo, A., Bosca, L.
(2007). Selective Activation of Liver X Receptors by Acanthoic Acid-Related Diterpenes. Mol. Pharmacol.
71: 1545-1553
[Abstract]
[Full Text]
-
Avallone, R., Demers, A., Rodrigue-Way, A., Bujold, K., Harb, D., Anghel, S., Wahli, W., Marleau, S., Ong, H., Tremblay, A.
(2006). A Growth Hormone-Releasing Peptide that Binds Scavenger Receptor CD36 and Ghrelin Receptor Up-Regulates Sterol Transporters and Cholesterol Efflux in Macrophages through a Peroxisome Proliferator-Activated Receptor {gamma}-Dependent Pathway. Mol. Endocrinol.
20: 3165-3178
[Abstract]
[Full Text]
-
Yang, L., Chan, C.-C., Kwon, O.-S., Liu, S., McGhee, J., Stimpson, S. A., Chen, L. Z., Harrington, W. W., Symonds, W. T., Rockey, D. C.
(2006). Regulation of peroxisome proliferator-activated receptor-{gamma} in liver fibrosis. Am. J. Physiol. Gastrointest. Liver Physiol.
291: G902-G911
[Abstract]
[Full Text]
-
Marathe, C., Bradley, M. N., Hong, C., Lopez, F., de Galarreta, C. M. R., Tontonoz, P., Castrillo, A.
(2006). The Arginase II Gene Is an Anti-inflammatory Target of Liver X Receptor in Macrophages. J. Biol. Chem.
281: 32197-32206
[Abstract]
[Full Text]
-
Jiang, Y. J., Lu, B., Kim, P., Elias, P. M., Feingold, K. R.
(2006). Regulation of ABCA1 expression in human keratinocytes and murine epidermis. J. Lipid Res.
47: 2248-2258
[Abstract]
[Full Text]
-
Quinet, E. M., Savio, D. A., Halpern, A. R., Chen, L., Schuster, G. U., Gustafsson, J.-A., Basso, M. D., Nambi, P.
(2006). Liver X Receptor (LXR)-beta Regulation in LXR{alpha}-Deficient Mice: Implications for Therapeutic Targeting. Mol. Pharmacol.
70: 1340-1349
[Abstract]
[Full Text]
-
Hummasti, S., Tontonoz, P.
(2006). The Peroxisome Proliferator-Activated Receptor N-Terminal Domain Controls Isotype-Selective Gene Expression and Adipogenesis. Mol. Endocrinol.
20: 1261-1275
[Abstract]
[Full Text]
-
Desvergne, B., Michalik, L., Wahli, W.
(2006). Transcriptional Regulation of Metabolism. Physiol. Rev.
86: 465-514
[Abstract]
[Full Text]
-
Lee, C.-H., Plutzky, J.
(2006). Liver X Receptor Activation and High-Density Lipoprotein Biology: A Reversal of Fortune?. Circulation
113: 5-8
[Full Text]
-
Chen, M., Beaven, S., Tontonoz, P.
(2005). Identification and characterization of two alternatively spliced transcript variants of human liver X receptor alpha. J. Lipid Res.
46: 2570-2579
[Abstract]
[Full Text]
-
Cheema, S. K., Agarwal-Mawal, A., Murray, C. M., Tucker, S.
(2005). Lack of stimulation of cholesteryl ester transfer protein by cholesterol in the presence of a high-fat diet. J. Lipid Res.
46: 2356-2366
[Abstract]
[Full Text]
-
Oram, J. F., Heinecke, J. W.
(2005). ATP-Binding Cassette Transporter A1: A Cell Cholesterol Exporter That Protects Against Cardiovascular Disease. Physiol. Rev.
85: 1343-1372
[Abstract]
[Full Text]
-
Lee, F. Y., Kast-Woelbern, H. R., Chang, J., Luo, G., Jones, S. A., Fishbein, M. C., Edwards, P. A.
(2005). {alpha}-Crystallin Is a Target Gene of the Farnesoid X-activated Receptor in Human Livers. J. Biol. Chem.
280: 31792-31800
[Abstract]
[Full Text]
-
Soumian, S, Albrecht, C, Davies, A., Gibbs, R.
(2005). ABCA1 and atherosclerosis. Vasc Med
10: 109-119
[Abstract]
-
She, H., Xiong, S., Hazra, S., Tsukamoto, H.
(2005). Adipogenic Transcriptional Regulation of Hepatic Stellate Cells. J. Biol. Chem.
280: 4959-4967
[Abstract]
[Full Text]
-
Davies, J. D., Carpenter, K. L. H., Challis, I. R., Figg, N. L., McNair, R., Proudfoot, D., Weissberg, P. L., Shanahan, C. M.
(2005). Adipocytic Differentiation and Liver X Receptor Pathways Regulate the Accumulation of Triacylglycerols in Human Vascular Smooth Muscle Cells. J. Biol. Chem.
280: 3911-3919
[Abstract]
[Full Text]
-
Sheth, S. S., Castellani, L. W., Chari, S., Wagg, C., Thipphavong, C. K., Bodnar, J. S., Tontonoz, P., Attie, A. D., Lopaschuk, G. D., Lusis, A. J.
(2005). Thioredoxin-interacting protein deficiency disrupts the fasting-feeding metabolic transition. J. Lipid Res.
46: 123-134
[Abstract]
[Full Text]
-
Blaschke, F., Leppanen, O., Takata, Y., Caglayan, E., Liu, J., Fishbein, M. C., Kappert, K., Nakayama, K. I., Collins, A. R., Fleck, E., Hsueh, W. A., Law, R. E., Bruemmer, D.
(2004). Liver X Receptor Agonists Suppress Vascular Smooth Muscle Cell Proliferation and Inhibit Neointima Formation in Balloon-Injured Rat Carotid Arteries. Circ. Res.
95: e110-e123
[Abstract]
[Full Text]
-
Li, A. C., Glass, C. K.
(2004). PPAR- and LXR-dependent pathways controlling lipid metabolism and the development of atherosclerosis. J. Lipid Res.
45: 2161-2173
[Abstract]
[Full Text]
-
Kawai, K., Sasaki, S., Morita, H., Ito, T., Suzuki, S., Misawa, H., Nakamura, H.
(2004). Unliganded Thyroid Hormone Receptor-{beta}1 Represses Liver X Receptor {alpha}/Oxysterol-Dependent Transactivation. Endocrinology
145: 5515-5524
[Abstract]
[Full Text]
-
Anderson, S. P., Dunn, C., Laughter, A., Yoon, L., Swanson, C., Stulnig, T. M., Steffensen, K. R., Chandraratna, R. A.S., Gustafsson, J.-A., Corton, J. C.
(2004). Overlapping Transcriptional Programs Regulated by the Nuclear Receptors Peroxisome Proliferator-Activated Receptor {alpha}, Retinoid X Receptor, and Liver X Receptor in Mouse Liver. Mol. Pharmacol.
66: 1440-1452
[Abstract]
[Full Text]
-
Wong, J., Quinn, C. M., Brown, A. J.
(2004). Statins Inhibit Synthesis of an Oxysterol Ligand for the Liver X Receptor in Human Macrophages With Consequences for Cholesterol Flux. Arterioscler. Thromb. Vasc. Bio.
24: 2365-2371
[Abstract]
[Full Text]
-
Albrecht, C., Soumian, S., Amey, J.S., Sardini, A., Higgins, C.F., Davies, A.H., Gibbs, R.G.J.
(2004). ABCA1 Expression in Carotid Atherosclerotic Plaques. Stroke
35: 2801-2806
[Abstract]
[Full Text]
-
Yue, L., Rasouli, N., Ranganathan, G., Kern, P. A., Mazzone, T.
(2004). Divergent Effects of Peroxisome Proliferator-activated Receptor {gamma} Agonists and Tumor Necrosis Factor {alpha} on Adipocyte ApoE Expression. J. Biol. Chem.
279: 47626-47632
[Abstract]
[Full Text]
-
Ulven, S. M., Dalen, K. T., Gustafsson, J.-A., Nebb, H. I.
(2004). Tissue-specific autoregulation of the LXR{alpha} gene facilitates induction of apoE in mouse adipose tissue. J. Lipid Res.
45: 2052-2062
[Abstract]
[Full Text]
-
Kino, T., Chrousos, G. P.
(2004). Combating Atherosclerosis With LXR{alpha} And PPAR{alpha} Agonists: Is Rational Multitargeted Polypharmacy the Future of Therapeutics in Complex Diseases?. Mol. Interv.
4: 254-257
[Abstract]
[Full Text]
-
Quinet, E. M., Savio, D. A., Halpern, A. R., Chen, L., Miller, C. P., Nambi, P.
(2004). Gene-selective modulation by a synthetic oxysterol ligand of the liver X receptor. J. Lipid Res.
45: 1929-1942
[Abstract]
[Full Text]
-
Szanto, A., Benko, S., Szatmari, I., Balint, B. L., Furtos, I., Ruhl, R., Molnar, S., Csiba, L., Garuti, R., Calandra, S., Larsson, H., Diczfalusy, U., Nagy, L.
(2004). Transcriptional Regulation of Human CYP27 Integrates Retinoid, Peroxisome Proliferator-Activated Receptor, and Liver X Receptor Signaling in Macrophages. Mol. Cell. Biol.
24: 8154-8166
[Abstract]
[Full Text]
-
Hummasti, S., Laffitte, B. A., Watson, M. A., Galardi, C., Chao, L. C., Ramamurthy, L., Moore, J. T., Tontonoz, P.
(2004). Liver X receptors are regulators of adipocyte gene expression but not differentiation: identification of apoD as a direct target. J. Lipid Res.
45: 616-625
[Abstract]
[Full Text]
-
Dalen, K. T., Ulven, S. M., Bamberg, K., Gustafsson, J.-A., Nebb, H. I.
(2003). Expression of the Insulin-responsive Glucose Transporter GLUT4 in Adipocytes Is Dependent on Liver X Receptor {alpha}. J. Biol. Chem.
278: 48283-48291
[Abstract]
[Full Text]
-
Chisholm, J. W., Hong, J., Mills, S. A., Lawn, R. M.
(2003). The LXR ligand T0901317 induces severe lipogenesis in the db/db diabetic mouse. J. Lipid Res.
44: 2039-2048
[Abstract]
[Full Text]
-
Lund, E. G., Menke, J. G., Sparrow, C. P.
(2003). Liver X Receptor Agonists as Potential Therapeutic Agents for Dyslipidemia and Atherosclerosis. Arterioscler. Thromb. Vasc. Bio.
23: 1169-1177
[Abstract]
[Full Text]
-
Francis, G. A., Annicotte, J.-S., Auwerx, J.
(2003). PPAR-{alpha} effects on the heart and other vascular tissues. Am. J. Physiol. Heart Circ. Physiol.
285: H1-H9
[Abstract]
[Full Text]
-
Tontonoz, P., Mangelsdorf, D. J.
(2003). Liver X Receptor Signaling Pathways in Cardiovascular Disease. Mol. Endocrinol.
17: 985-993
[Abstract]
[Full Text]
-
Oram, J. F.
(2003). HDL Apolipoproteins and ABCA1: Partners in the Removal of Excess Cellular Cholesterol. Arterioscler. Thromb. Vasc. Bio.
23: 720-727
[Abstract]
[Full Text]
-
Laffitte, B. A., Chao, L. C., Li, J., Walczak, R., Hummasti, S., Joseph, S. B., Castrillo, A., Wilpitz, D. C., Mangelsdorf, D. J., Collins, J. L., Saez, E., Tontonoz, P.
(2003). Activation of liver X receptor improves glucose tolerance through coordinate regulation of glucose metabolism in liver and adipose tissue. Proc. Natl. Acad. Sci. USA
100: 5419-5424
[Abstract]
[Full Text]
-
Han, S.-R., Momeni, A., Strach, K., Suriyaphol, P., Fenske, D., Paprotka, K., Hashimoto, S. I., Torzewski, M., Bhakdi, S., Husmann, M.
(2003). Enzymatically Modified LDL Induces Cathepsin H in Human Monocytes: Potential Relevance in Early Atherogenesis. Arterioscler. Thromb. Vasc. Bio.
23: 661-667
[Abstract]
[Full Text]
-
Castrillo, A., Joseph, S. B., Marathe, C., Mangelsdorf, D. J., Tontonoz, P.
(2003). Liver X Receptor-dependent Repression of Matrix Metalloproteinase-9 Expression in Macrophages. J. Biol. Chem.
278: 10443-10449
[Abstract]
[Full Text]
-
Juvet, L. K., Andresen, S. M., Schuster, G. U., Dalen, K. T., Tobin, K. A. R., Hollung, K., Haugen, F., Jacinto, S., Ulven, S. M., Bamberg, K., Gustafsson, J.-A., Nebb, H. I.
(2003). On the Role of Liver X Receptors in Lipid Accumulation in Adipocytes. Mol. Endocrinol.
17: 172-182
[Abstract]
[Full Text]
-
Zhang, Y., Kast-Woelbern, H. R., Edwards, P. A.
(2003). Natural Structural Variants of the Nuclear Receptor Farnesoid X Receptor Affect Transcriptional Activation. J. Biol. Chem.
278: 104-110
[Abstract]
[Full Text]
-
Stulnig, T. M., Steffensen, K. R., Gao, H., Reimers, M., Dahlman-Wright, K., Schuster, G. U., Gustafsson, J.-A.
(2002). Novel Roles of Liver X Receptors Exposed by Gene Expression Profiling in Liver and Adipose Tissue. Mol. Pharmacol.
62: 1299-1305
[Abstract]
[Full Text]
-
Muscat, G. E. O., Wagner, B. L., Hou, J., Tangirala, R. K., Bischoff, E. D., Rohde, P., Petrowski, M., Li, J., Shao, G., Macondray, G., Schulman, I. G.
(2002). Regulation of Cholesterol Homeostasis and Lipid Metabolism in Skeletal Muscle by Liver X Receptors. J. Biol. Chem.
277: 40722-40728
[Abstract]
[Full Text]
-
Wang, L., Schuster, G. U., Hultenby, K., Zhang, Q., Andersson, S., Gustafsson, J.-A.
(2002). Liver X receptors in the central nervous system: From lipid homeostasis to neuronal degeneration. Proc. Natl. Acad. Sci. USA
99: 13878-13883
[Abstract]
[Full Text]
-
Brown, B. G., Cheung, M. C., Lee, A. C., Zhao, X.-Q., Chait, A.
(2002). Antioxidant Vitamins and Lipid Therapy: End of a Long Romance?. Arterioscler. Thromb. Vasc. Bio.
22: 1535-1546
[Abstract]
[Full Text]
-
Chiang, J. Y. L.
(2002). Bile Acid Regulation of Gene Expression: Roles of Nuclear Hormone Receptors. Endocr. Rev.
23: 443-463
[Abstract]
[Full Text]
-
Whitney, K. D., Watson, M. A., Collins, J. L., Benson, W. G., Stone, T. M., Numerick, M. J., Tippin, T. K., Wilson, J. G., Winegar, D. A., Kliewer, S. A.
(2002). Regulation of Cholesterol Homeostasis by the Liver X Receptors in the Central Nervous System. Mol. Endocrinol.
16: 1378-1385
[Abstract]
[Full Text]
-
Joseph, S. B., McKilligin, E., Pei, L., Watson, M. A., Collins, A. R., Laffitte, B. A., Chen, M., Noh, G., Goodman, J., Hagger, G. N., Tran, J., Tippin, T. K., Wang, X., Lusis, A. J., Hsueh, W. A., Law, R. E., Collins, J. L., Willson, T. M., Tontonoz, P.
(2002). Synthetic LXR ligand inhibits the development of atherosclerosis in mice. Proc. Natl. Acad. Sci. USA
99: 7604-7609
[Abstract]
[Full Text]
-
Zhang, Y., Mangelsdorf, D. J.
(2002). LuXuRies of Lipid Homeostasis: The Unity of Nuclear Hormone Receptors, Transcription Regulation, and Cholesterol Sensing. Mol. Interv.
2: 78-87
[Abstract]
[Full Text]
-
Walczak, R., Tontonoz, P.
(2002). PPARadigms and PPARadoxes: expanding roles for PPAR{gamma} in the control of lipid metabolism. J. Lipid Res.
43: 177-186
[Abstract]
[Full Text]
-
Edwards, P. A., Kast, H. R., Anisfeld, A. M.
(2002). BAREing it all: the adoption of LXR and FXR and their roles in lipid homeostasis. J. Lipid Res.
43: 2-12
[Abstract]
[Full Text]
-
Whitney, K. D., Watson, M. A., Goodwin, B., Galardi, C. M., Maglich, J. M., Wilson, J. G., Willson, T. M., Collins, J. L., Kliewer, S. A.
(2001). Liver X Receptor (LXR) Regulation of the LXRalpha Gene in Human Macrophages. J. Biol. Chem.
276: 43509-43515
[Abstract]
[Full Text]
-
Zaghini, I., Landrier, J.-F., Grober, J., Krief, S., Jones, S. A., Monnot, M.-C., Lefrere, I., Watson, M. A., Collins, J. L., Fujii, H., Besnard, P.
(2002). Sterol Regulatory Element-binding Protein-1c Is Responsible for Cholesterol Regulation of Ileal Bile Acid-binding Protein Gene in Vivo. POSSIBLE INVOLVEMENT OF LIVER-X-RECEPTOR. J. Biol. Chem.
277: 1324-1331
[Abstract]
[Full Text]