INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Oxidized lipid signaling in macrophages is central to the pathogenesis of atherosclerosis (20, 24). Exposure of macrophages and other vascular cells to oxidized low-density lipoprotein (oxLDL) leads to complex changes in gene expression that are collectively thought to influence the development of the atherosclerotic lesion. Mounting evidence suggests that nuclear receptor signaling pathways mediate many of the effects of oxidized lipids on cellular gene expression. Macrophage uptake of oxLDL has the potential to provide the cell with oxidized fatty acid ligands of peroxisome proliferator-activated receptor  (PPAR) as well as oxysterol ligands of liver X receptor  (LXR) and LXR (8, 12, 13).

LXR and LXR have been identified as key regulators of lipid homeostasis in multiple cell types (18). Targeted disruption of the Lxr gene in mice uncovered roles for this receptor in the regulation of both hepatic bile acid synthesis and intestinal cholesterol absorption (16, 19). The observation that sterol regulatory element-binding protein 1-c is a target for LXRs suggests that LXRs may be involved in the control of lipogenesis (6, 17, 21). Recent work has also implicated LXRs in the control of gene expression in response to macrophage lipid loading. Multiple genes potentially involved in the cellular cholesterol efflux pathway, including the putative cholesterol/phospholipid transporter ABCA1 (5, 19, 22, 28), ABCG1 (29), and apolipoprotein E (apoE) (11), have been identified as transcriptional targets of LXR/retinoid X receptor (RXR) heterodimers. Moreover, ligand activation and/or retroviral expression of LXR in macrophages and fibroblasts stimulates ABCA1-mediated cholesterol efflux to extracellular acceptors such as apoAI (22, 28). These observations suggest that the rate of cholesterol efflux in macrophages and other peripheral cells is controlled, at least in part, by LXR signaling pathways.

The mechanisms that control expression of the LXR and LXR genes are not well understood. In mice, LXR is expressed primarily in the liver, intestine, adipose tissue, and macrophages, whereas LXR is widely expressed (15, 30). Clearly, distinct trans-acting factors must be involved in the regulation of these genes. Liver expression of LXR has been reported to be responsive to dietary fatty acids in mice (25). This led to the suggestion that the murine LXR (mLXR) gene may be a target for PPAR regulation in the liver; however, synthetic PPAR-selective ligands have not been shown to influence LXR expression in liver cells. It has previously been shown that expression of LXR, but not LXR, is induced by synthetic PPAR ligands in both human and murine macrophages (2). As a consequence of this regulation, ligands for LXR and PPAR additively promote cholesterol efflux from macrophages. We identified a functional PPAR response element (PPRE) in the promoter of the mLXR gene and demonstrated that induction by synthetic PPAR ligands is lost in PPAR-deficient murine macrophages. Thus, expression of LXR is not only tissue specific, but it is also likely to be regulated in response to certain metabolic signals.

We demonstrate here that expression of LXR is highly induced in human macrophages in response to lipid loading. Moreover, we demonstrate that this lipid inducibility is likely to result from feedback induction of the LXR gene by LXR/RXR heterodimers. The human LXR gene (hLXR) is a direct target for regulation by both LXR and PPAR, and synthetic ligands for these receptors cooperatively induce its expression in macrophages. Interestingly, autoregulation of the LXR promoter is not observed in murine macrophages. Consistent with this difference, we show that certain LXR target genes, such as apoE, are more highly regulated by LXR ligands in human versus murine macrophages. This species-specific difference in LXR regulation may have implications for cholesterol metabolism and its potential to be regulated by synthetic LXR and/or PPAR ligands.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Reagents and plasmids. pCMX expression plasmids for PPAR, RXR, LXR, and LXR have been described (7, 28). pCMX-VP16-LXR was a gift from Ron Evans (Salk Institute). GW7845, GW3965, and T0901317 were provided by Tim Willson (GlaxoSmithKline). LG268 was provided by Rich Heyman (Ligand Pharmaceuticals). Ligands were dissolved in ethanol or dimethyl sulfoxide prior to use in cell culture. The hLXR promoter was cloned from the bacterial artificial chromosome (BAC) clone RP11-390K5 by PCR using the high-fidelity polymerase Pfu. A region spanning from 2625 to 1368 (relative to the transcription start site from exon 1A) was amplified by PCR from RP11-390K5 and cloned into the BamHI site of pTK-Luciferase to create pTK-hLXR(2625)-Luc. Regions corresponding to bp 2625 to +375, 2210 to +375, 1383 to +375, and 560 to +375 of the hLXR promoter were amplified by PCR and cloned into KpnI/NheI-digested pGL3-Luciferase (Promega), creating pGL3-hLXR(2625)-Luc, pGL3-hLXR(2210)-Luc, pGL3-hLXR(1383)-Luc, and pGL3-hLXR(560)-Luc.

5' RACE. 5' rapid amplification of cDNA ends (RACE) was performed using the SMART RACE cDNA Amplification kit (Clontech). Briefly, first-strand cDNA was synthesized from total RNA derived from primary human macrophages or tetradecanoyl phorbol acetate-differentiated THP-1 cells using a poly(dT) primer and the SMART II oligonucleotide. 5' RACE PCR was then performed using the Universal Primer mix and either of two gene-specific primers complementary to the hLXR mRNA sequence [hLXR(141), TGCCTCCCTGGGCCTGGCTGCTT, or hLXR(391), TTGCAGCCCTCGCAGCTCAGAACAT]. Amplification was performed using touchdown PCR on a BioRad iCycler Thermal Cycler (BioRad). 5' RACE products were cloned by TOPO TA Cloning (Invitrogen). Approximately 40 clones were sequenced.

Cell culture and transfections. THP-1 and MonoMac-6 cells were cultured in RPMI medium containing 10% fetal bovine serum (FBS). NIH 3T3 and 3T3-F442A cells were grown in Dulbecco's modified Eagle's medium (DMEM) containing 10% calf serum, and HepG2 cells were grown in modified Eagle's medium (MEM) containing 10% FBS. Peritoneal macrophages were obtained from thioglycolate-injected mice as described (29) and cultured in DMEM containing 10% FBS. Human primary monocytes/macrophages were obtained as previously described (29) and maintained in Iscove's modified Dulbecco's medium containing 10% FBS. Human primary preadipocytes were obtained from ZenBio, Inc., and cultured in a Ham's F-12 medium-DMEM mixture (1:1). For ligand treatments, cells were cultured in RPMI medium, DMEM, Iscove's modified Dulbecco's medium, or Ham's F-12 medium supplemented with 10% lipoprotein-deficient serum (LPDS) (Intracel) and receptor ligands for 48 h. In some experiments, cells were sterol depleted by inclusion of 5 µM simvastatin and 100 µM mevalonic acid during the treatment period. Transient transfections of HepG2 cells were performed in triplicate in 48-well plates. Cells were transfected with reporter plasmid (100 ng/well), receptor plasmids (5 to 50 ng/well), pCMV--galactosidase (50 ng/well), and pTKCIII (to a total of 205 ng/well) using the MBS mammalian transfection kit (Stratagene). Following transfection, cells were incubated in MEM containing 10% LPDS and the indicated ligands or vehicle control for 24 h. Luciferase activity was normalized to -galactosidase activity.

RNA analysis. Total RNA was isolated using Trizol reagent (Life Technologies, Inc.). Northern analysis was performed as described (26) using radiolabeled cDNA probes. Blots were normalized using cDNA probes to 36B4 and quantitated by PhosphorImager (Molecular Dynamics) analysis. Real-time quantitative PCR assays were performed using an Applied Biosystems 7700 sequence detector. Briefly, 1 µg of total RNA was reverse transcribed with random hexamers using the Taqman Reverse Transcription Reagents kit (Applied Biosystems) according to the manufacturer's protocol. Each amplification mixture (50 µl) contained 50 ng of cDNA, 900 nM forward primer, 900 nM reverse primer, 100 nM dual-labeled fluorogenic probe (Applied Biosystems), and 25 µl of Universal PCR Master mix. PCR thermocycling parameters were 50°C for 2 min, 95°C for 10 min, and 40 cycles of 95°C for 15 and 60°C for 1 min. All samples were analyzed for -actin (human) or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (mouse) expression in parallel in the same run using probe and primers from predeveloped assays for -actin and GAPDH (Applied Biosystems). Quantitative expression values were extrapolated from separate standard curves for -actin or GAPDH and human- or mouse-generated expression with 10-fold dilutions of cDNA (in duplicate). Each sample was normalized to -actin or GAPDH, and replicates were then averaged and fold induction was determined. The following human primers were used: hLXR forward (F) (5'-AAGCCCTGCATGCCTACGT-3'), hLXR reverse (R) (5'-TGCAGACGCAGTGCAAACA-3'), hLXR Taqman probe (FAM-CCACCATCCCCATGACCGACTGAT-TAMRA), human apoE (hapoE) F (5'-CGCTGGGTGCAGACACTGT-3'), hapoE R (5'-GGCCTTCAACTCCTTCATGGT-3'), and hapoE probe (FAM-TCCATCAGCGCCCTCAGTTCCTG-TAMRA). The following murine primers were used: mLXR F (5'-CAACAGTGTAACAGGCGCT-3'), mLXR R (5'-TGCAATGGGCCAAGGC-3'), mLXR Taqman probe (FAM-TCAGACCGCCTGCGCGTCA-TAMRA), murine apoE (mapoE) F (5'-GGAGGTGACAGATCAGCTCGA-3'), mapoE R (5'-TCCCAGAAGCGGTTCAGG-3'), and mapoE probe (FAM-CAAAGCAACCAACCCTGGGAGCAG-TAMRA).

Gel shift assays. In vitro-translated RXR, LXR, and PPAR were generated from pCMX-RXR, pCMX-hLXR, and pCMX-PPAR plasmids using the TNT Quick Coupled Transcription/Translation system (Promega). Gel shift assays were performed as described (10) using in vitro-translated proteins and the following oligonucleotides (only one strand shown): hLXR PPRE (GATCGGATTTTGAACTTTGTACTTGTTTCC), hLXR DR4-A (GATCGGGTGGATCACTTGAGGTCAGGAG), hLXR DR4-B (GATCAGATGGATCACTTGAGGTCAGGAG), hLXR DR4-C (GATCGCTGAGGTTACTGCTGGTCATTCA), and CYP7A LXR response element (LXRE) (CCTTTGGTCACTCAAGTTCAAGTG).

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Previous work has demonstrated that macrophage expression of PPAR is induced in response to oxLDL (27). We investigated whether expression of LXR or LXR in macrophages might also be regulated by modified lipoproteins. The human monocytic cell line THP-1 was used as a model system. THP-1 cells were differentiated for 24 h with 40 ng of tetradecanoyl phorbol acetate per ml and then treated in the presence of LPDS for 48 h with either vehicle alone or 100 µg of (protein) LDL, oxLDL, or acetylated LDL (acLDL) per ml. In order to ensure maximal sterol depletion of the cells, treatments were carried out in the presence of the 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitor simvastatin (5 µM) and mevalonic acid (100 µM). As shown in Fig. 1, the treatment of THP-1 macrophages with oxLDL or acLDL led to a significant induction of LXR mRNA. In contrast, native LDL, which is not readily internalized by these cells, had no effect on LXR expression. Expression of the related nuclear receptor LXR was not altered in response to native or modified LDL. Induction of LXR mRNA in these experiments paralleled that of the known LXR target genes ABCA1 and ABCG1. Similar results were obtained with primary human monocyte-derived macrophages (Fig. 1). Surprisingly, while oxLDL and acLDL were effective inducers of ABCA1 and ABCG1 expression in murine macrophages, they had little or no effect on LXR expression. Modified LDL also had no effect on LXR expression in murine RAW264.7 macrophages (reference 28 and data not shown). These observations suggest that species-specific differences may exist in the mechanisms controlling LXR expression.

View larger version (76K): [in this window] [in a new window]   FIG. 1.   Induction of LXR expression in human macrophages in response to modified LDL loading. Differentiated THP-1 macrophages, primary human monocyte-derived macrophages (M), or thioglycolate-elicited mouse peritoneal macrophages were incubated for 48 h in RPMI medium containing 10% LPDS, 5 µM simvastatin, and 100 µM mevalonic acid. Cells were treated with vehicle control or 100 µg (protein) of either LDL, oxLDL, or acLDL per ml as indicated. Total RNA (10 µg/lane) was electrophoresed through formaldehyde-containing gels, transferred to nylon, and hybridized to 32P-labeled cDNA probes. 36B4 was used as a control for loading and integrity of the RNA.

The ability of modified LDL to modulate LXR gene expression led us to hypothesize that the LXR gene might itself be a downstream target of the LXR signaling pathway in human macrophages. To address this possibility, we examined the ability of oxysterols and synthetic LXR ligands to regulate LXR expression in various macrophage cell lines. As shown in Fig. 2A, the treatment of human THP-1 macrophages with the oxysterol LXR ligand 22(R)-hydroxycholesterol (2 µg/ml) or with either of two synthetic LXR agonists, T1317 (19, 21) and GW3965 (14), led to a prominent induction of LXR mRNA expression. Treatment with the synthetic RXR-specific agonist LG268 (100 nM) also induced LXR expression, and the combination of the LXR ligand and LG268 had an additive effect. 22(S)-hydroxycholesterol (2 µg/ml), which binds but does not activate LXRs (23), did not alter LXR expression. Similar to the results obtained with modified lipoproteins (Fig. 1), induction of ABCA1 and ABCG1 expression by nuclear receptor ligands paralleled that of LXR. Expression of LXR was not influenced by LXR or RXR ligands. An even more dramatic induction of LXR expression by LXR ligands was observed when endogenous cholesterol synthesis was inhibited by treatment with simvastatin (Fig. 2B). Similar results were observed in primary human monocyte-derived macrophages and MonoMac-6 cells (Fig. 3 and data not shown). The reduced basal expression of LXR observed in the presence of simvastatin suggests that endogenous oxysterol LXR ligands are required for tonic expression of LXR. Interestingly, the sterol regulatory element-binding protein 1-c gene has been reported to be a target for LXR and to be similarly dependent on endogenous LXR ligands for its expression in liver cells (6, 17).

View larger version (59K): [in this window] [in a new window]   FIG. 2.   Oxysterols and synthetic LXR ligands stimulate LXR expression in THP-1 macrophages. Differentiated THP-1 macrophages (A and B) or thioglycolate-elicited mouse peritoneal macrophages (M) (C) were incubated for 48 h in RPMI medium plus 10% LPDS or RPMI medium plus 10% LPDS, 5 µM simvastatin, and 100 µM mevalonic acid (unloaded). Oxysterols [20(S)HC, 22(R)HC, or 22(S)HC, 2.0 µg/ml], synthetic LXR ligand (GW3965 or T1317, 0.1 to 10.0 µM), or RXR ligand (LG268, 50 nM) was included as indicated. Northern analysis was performed as described in the legend to Fig. 1.

View larger version (17K): [in this window] [in a new window]   FIG. 3.   Differential induction of the LXR target gene apoE by LXR ligands in human and murine macrophages. Differentiated THP-1 macrophages or thioglycolate-elicited mouse peritoneal macrophages were incubated for 48 h in RPMI medium plus 10% LPDS, 5 µM simvastatin, and 100 µM mevalonic acid. Cells were treated with the indicated concentrations of either T1317 or GW3965. The expression of apoE mRNA was monitored by real-time quantitative PCR (Taqman) assays (see Materials and Methods).

In contrast to the results obtained with human macrophages, treatment of primary murine macrophages or the murine macrophage cell line RAW264.7 with LXR-selective ligands did not significantly alter LXR expression (Fig. 2C and data not shown). The failure of LXR to be induced in murine macrophages does not result from a general defect in the LXR signaling pathway, since the LXR target genes ABCA1 and ABCG1 are effectively induced in these cells (Fig. 2C). Rather, the ability of LXRs to regulate LXR expression is apparently species specific. The possibility that the murine gene is responsive to LXR ligands in certain tissues or under certain conditions not tested here, however, cannot be excluded.

The species-specific difference in the ability of LXR ligands to induce LXR receptor expression suggested the possibility that human macrophages may be more responsive than murine macrophages to LXR activation. Previous work has indicated that the LXR target gene apoE is particularly sensitive to the level of LXR present in the cell. Induction of apoE expression by LXR ligand is significantly reduced in macrophages from either LXR^/ or LXR^/ mice, even in the presence of high concentrations of ligand (11). We therefore compared the dose response of the LXR target apoE to two synthetic LXR ligands in THP-1 cells and murine macrophages. As shown in Fig. 3, the induction of apoE was significantly higher in human cells in response to both GW3965 and T1317. This difference is consistent with the higher level of LXR receptor expression in human cells in the presence of LXR ligand. Thus, the ability of the hLXR gene to undergo autoregulation is likely to have implications for LXR target gene expression.

Previous work has shown that macrophage LXR expression is also induced by PPAR-specific ligands (2, 4). Accordingly, activation of PPAR in THP-1 cells leads to the induction of primary LXR target genes such as ABCA1 and ABCG1. In contrast to LXR ligands, PPAR ligands have been shown to promote LXR mRNA expression in both human and murine macrophages. We therefore examined the effects of simultaneous activation of both the PPAR and LXR pathways on macrophage gene expression. RNA expression was monitored by either Northern analysis or real-time quantitative PCR (Taqman) assays (see Materials and Methods). As shown in Fig. 4, the treatment of THP-1 macrophages with oxysterol LXR ligands, synthetic LXR ligands (T1317 or GW3965), or synthetic PPAR ligands alone (rosiglitazone or GW7845) stimulated LXR expression. The combination of an LXR ligand and a PPAR ligand had an additive effect. Similar results were obtained with the human monocytic cell line MonoMac-6 (Fig. 4A) and human primary monocytes/macrophages (Fig. 4B). Interestingly, the response of LXR to this combined treatment was much more prominent than that observed for ABCA1 or ABCG1 (reference 2 and data not shown). This observation suggested that the hLXR gene might be a direct target of both LXR/RXR and PPAR/RXR heterodimers, whereas ABCA1 and ABCG1 are likely to be direct targets of only LXR/RXR. Consistent with the results shown in Fig. 2C, LXR ligands failed to induce LXR expression in murine macrophages, even when used in combination with a PPAR ligand (Fig. 4B).

View larger version (48K): [in this window] [in a new window]   FIG. 4.   Ligands for LXR and PPAR additively induce LXR expression in human macrophages. Differentiated THP-1 macrophages, MonoMac-6 cells, human monocyte-derived macrophages (M), or thioglycolate-elicited mouse peritoneal macrophages were incubated for 48 h in RPMI medium plus 10% LPDS. Oxysterols {20(S)HC [20 (S)] or 22(R)HC [22 (R)], 2.0 µg/ml}, synthetic LXR ligands (GW3965 or T1317, 5 µM), and/or PPAR ligands (rosiglitazone [Rosi] or GW7845, 5 µM) were included as indicated. Northern blots (A) were quantitated by phosphorimager analysis and normalized to 36B4. The level of expression relative to LPDS control (fold induction) is indicated; real-time quantitative PCR assays (B) were performed in duplicate as described in Materials and Methods and normalized to 36B4 or -actin. The level of mRNA expression relative to control (fold induction) is indicated.

We further addressed whether the ability of LXRs and PPARs to regulate LXR expression was specific to macrophages or whether it also occurred in other cell types. As shown in Fig. 5, autoregulation of the hLXR gene was also observed in liver and adipose cell lines. Treatment with the LXR ligand GW3965 or T1317 induced LXR expression in both human preadipocytes and the human hepatoma cell line HepG2. As in macrophages, induction of LXR expression paralleled induction of ABCA1. In contrast, ligands for PPAR (GW7845) or PPAR (WY14613) had no effect on LXR expression in HepG2 cells. Consistent with the results obtained in macrophages, the mLXR gene was induced by the PPAR ligand but not by the LXR ligand in 3T3-F442A preadipocytes under similar conditions. In experiments not shown, we have observed induction of LXR mRNA expression by synthetic PPAR and LXR ligands in THP-1 cells in the presence of the protein synthesis inhibitor cycloheximide but not in the presence of the RNA polymerase inhibitor actinomycin D, consistent with direct transcriptional effects. Taken together, these results reveal a partially overlapping pattern of regulation of the mLXR and hLXR genes by nuclear receptors. Both the hLXR and mLXR genes are targets for PPAR regulation in macrophages and adipocytes. The hLXR gene, but not the mLXR, is also regulated by LXR itself in multiple cell types, including macrophages, adipocytes, and hepatocytes.

View larger version (52K): [in this window] [in a new window]   FIG. 5.   Autoregulation of the hLXR gene in preadipocytes and HepG2 cells. Primary human preadipocytes (Pre Ad), HepG2 cells, or 3T3-F442A murine preadipocytes were cultured for 48 h in media containing 10% LPDS and one or more of the following nuclear receptor ligands as indicated: GW3965 (5 µM), T1317 (5 µM), GW7845 (5 µM), and Wy14643 (50 µM).

To investigate the molecular basis for the regulation of hLXR expression by LXR and PPAR ligands, we cloned and analyzed the 5'-flanking region from the hLXR gene. The transcriptional start site of the hLXR gene was mapped by 5' RACE using RNA derived from primary human macrophages and THP-1 cells. Analysis of the 5' RACE products revealed two distinct transcriptional start sites (Fig. 6). As a result of alternative splicing, these give rise to two alternatively utilized exon 1 sequences (Fig. 7A). The vast majority of the products of the 5' RACE reactions corresponded to use of the downstream (exon 1B) start site, suggesting that this is the primary site utilized in human macrophages. The genomic sequence and organization of the hLXR gene were determined by searching the human genome and the high throughput genomic sequence databases (National Center for Biotechnology Information) using the revised mRNA sequence for hLXR. We identified a BAC clone (RP11-390K5) containing the entire hLXR mRNA sequence and approximately 5 kb of the 5'-flanking sequence. Comparison of the hLXR and mLXR genomic sequences revealed a similar genomic structure, with each gene composed of 10 exons. Exon 1A from the hLXR gene shows a high level of homology to the previously reported transcriptional start site for the mLXR gene. In the human genomic sequence, exon 1B is located approximately 343 bp downstream of the exon 1A start site. This sequence is conserved in the murine genomic sequence, and a previous report suggested that this region might be utilized as an alternative start site in the mouse (1). In both humans and mice, exon 1 is comprised entirely of untranslated sequence; therefore, the use of alternative exon 1 sequences does not impact the protein product.

View larger version (32K): [in this window] [in a new window]   FIG. 6.   Sequence comparison of the hLXR and mLXR transcriptional start sites. The putative transcriptional start sites are marked by arrows. The initiator element is indicated in bold type. The previously published mouse transcriptional start site is designated as position +1 (1).

View larger version (25K): [in this window] [in a new window]   FIG. 7.   Comparison of the hLXR and mLXR promoter regions. (A) Schematic representation of the hLXR and mLXR genes. Transcription start sites, genomic structure, sequence identity, and nuclear receptor binding sites are indicated. The asterisk denotes the major start site in macrophages. The arrows indicate hormone response element half sites. (B) Sequences of the LXREs and PPREs from the hLXR and mLXR promoters.

The proximal 2.6 kb of the hLXR promoter region from BAC clone RP11-390K5 was cloned and sequenced. Comparison with the mLXR gene revealed conservation of the transcriptional start regions and similarity up to approximately 250 bp upstream of the exon 1A start site (79% identity) (Fig. 6 and 7). However, relatively poor conservation of the sequence was found further upstream. In particular, the previously identified PPRE located in the mLXR gene (2) is not conserved in the human sequence. A potential PPRE (DR-1) was identified in the hLXR 5'-flanking region that is not conserved in location or sequence in comparison to the mouse (Fig. 6). In addition, the hLXR gene was found to contain three potential LXREs (DR-4). Only one of these potential LXREs (LXRE-C) was in a region conserved in the mouse promoter sequence; furthermore, the mouse DR4-C sequence differed from the human sequence within one half site.

We next endeavored to determine whether the identified elements represented bona fide binding sites for LXR/RXR or PPAR/RXR heterodimers. As shown in Fig. 8A, gel mobility shift analysis using in vitro-translated proteins and radiolabeled oligonucleotides confirmed that the putative PPRE from the hLXR gene bound PPAR/RXR heterodimers with affinity similar to that of the previously identified PPRE from the mLXR gene (2). Furthermore, all three putative LXREs bound in vitro-translated LXR/RXR (Fig. 8B). Competition assays indicated that the distal element (LXRE-C) bound LXR/RXR with significantly higher affinity than LXRE-A, LXRE-B, or the LXRE from the murine CYP7A gene (Fig. 8C).

View larger version (31K): [in this window] [in a new window]   FIG. 8.   PPAR and LXR bind to response elements in the hLXR promoter. Gel mobility shift assays were performed using in vitro-translated receptors and end-labeled oligonucleotide probes as described in Materials and Methods. (A) Direct binding of PPAR/RXR heterodimers to a putative PPRE from the hLXR promoter. (B) Direct binding of LXR/RXR heterodimers to the LXRE-A, LXRE-B, and LXRE-C sites from the hLXR promoter. (C) Competition for LXR/RXR binding to LXRE-C. Unlabeled oligonucleotide was included in the binding reaction at the indicated molar excess.

Finally, we analyzed the ability of PPAR, LXR, and LXR to regulate the hLXR promoter in transient transfection assays. A pGL3-based luciferase reporter construct containing bp 2625 to +345 of the hLXR promoter (2625 hLXR-luc) was transiently transfected into HepG2 cells along with pCMX expression vectors encoding LXR, LXR, RXR, and/or PPAR. As shown in Fig. 9A, the LXR/RXR and LXR/RXR heterodimers activated the hLXR promoter in a ligand-dependent manner, but they had no effect on the control pGL3-luc reporter. Note that since HepG2 cells express endogenous LXRs, a background level of ligand-dependent induction of the reporter is seen in the absence of transfected receptor. When expression vectors for both LXR and PPAR were cotransfected with the hLXR promoter, an additive effect of LXR-selective (GW3965) and PPAR-selective (GW7845) ligands was observed (Fig. 9B). These results confirm that the LXR and PPAR binding sites identified above are in fact able to mediate activation of the hLXR promoter by PPAR/RXR, LXR/RXR, and LXR/RXR heterodimers. Moreover, the additive effect of PPAR and LXR activation on the hLXR promoter in transient transfection assays is consistent with the ability of PPAR and LXR ligands to additively induce expression of the endogenous hLXR gene.

View larger version (20K): [in this window] [in a new window]   FIG. 9.   LXR, LXR, and PPAR activate the hLXR promoter. (A) LXR/RXR and LXR/RXR heterodimers activate the 2625-bp LXR proximal promoter. HepG2 cells were transfected with either control pGL3-luc or -2625 LXR-luc reporters with or without CMX-mLXR/CMX-RXR or CMX-mLXR/CMX-RXR and CMV--galactosidase. Following transfection, cells were incubated for 24 h in MEM supplemented with 10% LPDS and 1 µM GW3965 or vehicle control. Luciferase activity was normalized for transfection efficiency using -galactosidase activity. (B) Ligand activation of PPAR and LXR has an additive effect on the 2625-bp LXR promoter. HepG2 cells were transfected as in panel A except that CMX-mPPAR1 and GW7845 (1 µM) were included as indicated.

In order to address the relative importance of the individual nuclear receptor binding sites, deletion and mutation analyses were performed. We analyzed the ability of LXR and RXR expression vectors to activate luciferase reporters containing bp 2625 to +345, 2210 to +345, 1310 to +345, or 560 to +345 of the hLXR promoter. Surprisingly, deletion from bp 2625 to 2210, which deletes LXRE-C, resulted in the complete loss of LXR responsiveness (Fig. 10A). Similar results were obtained with an expression vector encoding a superactive VP16-LXR fusion protein (11). The construct containing LXRE-C (bp 2625 to +345) was activated over 30-fold by VP16-LXR, whereas those lacking this element were unresponsive (Fig. 10B). These observations suggested that the LXRE-C element is required for induction of the hLXR promoter by LXR. To test this directly, we introduced specific mutations in each of the LXREs. As shown in Fig. 10, mutation of LXRE-C alone abolished promoter activation by LXR, while simultaneous mutation of LXRE-A and LXRE-B had no effect. These results indicate that LXRE-C is the primary element mediating induction of the LXR promoter by LXR/RXR heterodimers. The other potential response elements (LXRE-A and -B) apparently do not contribute to the induction of the hLXR promoter despite their ability to bind LXR/RXR in vitro. This is consistent with the observation that LXRE-C has the highest affinity for LXR/RXR of the three sites (Fig. 8). Taken together, these results demonstrate that the hLXR promoter is a direct target for regulation by both PPAR/RXR and LXR/RXR heterodimers.

View larger version (27K): [in this window] [in a new window]   FIG. 10.   Deletion and mutation analysis of the hLXR proximal promoter. (A) Luciferase reporters containing bp 2625 to +345, 2210 to +345, 1310 to + 345, or 560 to +345 of the hLXR promoter were transfected into HepG2 cells in the presence or absence of CMX-hLXR, CMX-RXR, and 5 µM T1317. Luciferase activity was normalized for transfection efficiency using -galactosidase activity. The data are expressed as fold activations in the presence of the indicated ligand versus in the absence of ligand and represent the average of triplicate experiments. (B) hLXR promoter constructs were cotransfected into HepG2 cells along with CMX vector or CMX-VP16-LXR in the presence of 5 µM T1317. Data are expressed as relative luciferase activities normalized to -galactosidase activities and represent the average of triplicate experiments. (C) Mutations were introduced into individual LXREs in the bp 2625 to +345 hLXR promoter construct by site-directed mutagenesis. Wild-type (WT) and mutant (Mut) reporters were transfected into HepG2 cells along with CMX-hLXR and CMX-RXR in the presence or absence of 1 µM GW3965. Data are expressed as luciferase activities normalized to -galactosidase activities and represent the averages of triplicate experiments.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Members of the nuclear receptor superfamily are now recognized to play a central role in the control of lipid-inducible gene expression. Both the PPAR and LXR subfamilies have been implicated in the regulation of gene expression and lipid metabolism in response to specific lipid ligands. PPAR is expressed at high levels in a number of specialized cell types, including adipocytes, colonic epithelia, and macrophages. No high-affinity endogenous ligand for this receptor has been described; however, physiologic activators of PPAR are likely to include native and oxidized polyunsaturated fatty acids (7, 9, 13). LXR is expressed at high levels in many of the same tissues as PPAR, including macrophages and adipose tissue, while LXR is ubiquitously expressed. Considerable evidence suggests that the physiologic ligands for LXRs are oxysterols such as 24(S)-hydroxycholesterol and 24(S),25-epoxycholesterol (8, 12, 23).

In macrophages, the PPAR and LXR families appear to coordinate a physiologic response to oxLDL uptake and lipid loading. A primary functional consequence of PPAR and LXR activation in macrophages is the induction of a pathway for cholesterol and phospholipid efflux. Ligands for either receptor additively promote cholesterol efflux from human macrophages (2, 28). The role of PPAR in this response appears to be to induce expression of the scavenger receptor CD36, the HDL receptor SR-BI, and LXR (2, 3, 27). The role of LXR in this response appears to be to regulate several genes that have been directly implicated in the cholesterol efflux pathway including ABCA1, ABCG1, and apoE (5, 11, 22, 28, 29). Ligands for PPAR and LXR additively promote cholesterol efflux from macrophages, presumably as a consequence of the ability of PPAR to control LXR expression.

In the present study, we have shown that the hLXR gene is itself induced in macrophages in response to cellular lipid loading. Moreover, we have shown that this induction is likely to be mediated by the direct binding of LXR/RXR heterodimers to the LXR promoter. Interestingly, tonic expression of LXR in human cells appears to be dependent on endogenous production of oxysterol intermediates in the cholesterol biosynthetic pathway. Inhibition of cholesterol synthesis by simvastatin led to a complete loss of LXR expression in THP-1 cells. Surprisingly, the ability of LXR to regulate its own promoter appears to be species specific. Oxysterol and synthetic ligands of LXRs induce LXR expression in human macrophage cell lines and primary human macrophages but not in murine cell lines or primary murine macrophages. In humans, this induction is observed in multiple cell types, including macrophages, adipocytes, and hepatoma cells. Cloning and analysis of the human LXR 5'-flanking region led to the identification of the critical LXRE that is likely to mediate lipid inducibility.

Previous work demonstrated that expression of the LXR gene is induced in both human and murine macrophages by PPAR-specific ligands (2, 4). A functional PPRE has been identified in the promoter of the mLXR gene; however, the molecular basis for regulation of the hLXR gene by PPAR has not been explored. In the present work, we have shown that although the PPRE present in the murine proximal promoter is not conserved in the human gene, a functional PPRE is present in a different region of the hLXR promoter. Thus, while the hLXR gene is a target for both PPAR and LXR, the murine gene appears to be a target only for PPAR. The possibility that the murine gene is responsive to LXR in certain tissues or under certain conditions not tested here, however, cannot be excluded. At present, hLXR is the only known common target gene for both PPAR and LXRs. Tobin et al. have previously reported that liver LXR expression was responsive to dietary fatty acids and have suggested that the mLXR gene may be a target for PPAR regulation in liver (25). However, we have not observed regulation of LXR mRNA by either PPAR- or PPAR-specific ligands in liver cells (Fig. 5). Rather, our data suggest that the LXR gene is a target for PPAR regulation only in certain tissues such as macrophages and adipocytes.

Substantial differences in lipid metabolism exist between mice and humans. The results presented here have implications for cholesterol metabolism in both species and its potential to be regulated by synthetic LXR and/or PPAR ligands. We have outlined an unexpected species-specific difference in the regulation of LXR expression by oxidized lipid ligands of LXRs. In human macrophages, the ability of LXR to regulate its own promoter is likely to be an integral part of the physiologic response to lipid loading. The LXR autoregulatory loop provides a mechanism whereby the cellular response to lipid loading can be amplified and maximized. The species-specific difference in the ability to amplify the LXR response raises the possibility that humans may be more responsive than mice to LXR agonists in general and to LXR agonists in particular.

Several lines of evidence support the hypothesis that upregulation of LXR expression can impact LXR target gene expression and cellular function, even though most cells also express significant levels of LXR. First, the phenotype of LXR/ mice clearly indicates that the two receptors are not entirely redundant (16). Second, although studies have shown that induction of ABCA1 and ABCG1 is preserved in LXR/ macrophages in the presence of maximal concentrations of ligands (19, 29), expression of apoE is reduced in either LXR/ or LXR/ mice under identical conditions (11). Thus, some target genes are more sensitive than others to the absolute levels of LXR present in the cell. It is for this subset of genes that autoregulation of the LXR promoter is likely to have the greatest impact. Third, studies have also shown that the level of LXR expression is a key determinant of both the sensitivity of ABCA1 induction and the rate of cholesterol efflux. Retroviral expression of LXR in cells that already express LXR shifts the dose response of ABCA1 to LXR ligands and dramatically stimulates cholesterol efflux (28). Finally, we have shown here that certain LXR target genes, such as apoE, are in fact significantly more responsive to LXR ligand in human macrophages than in murine macrophages (Fig. 3).

Our results also suggest that LXR may play a more prominent role than LXR in certain human cell types, especially in the context of cellular lipid loading. In resting macrophages, for example, expression of LXR is more prominent than that of LXR (Fig. 2 and data not shown). Upon lipid loading and LXR activation, however, the balance is shifted dramatically in favor of LXR. This could have an important impact on gene expression and lipid metabolism if certain LXR target genes are preferentially activated by either LXR or LXR. The development of selective ligands for either LXR or LXR should shed light on this issue.