This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Laffitte, B. A.
Right arrow Articles by Tontonoz, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Laffitte, B. A.
Right arrow Articles by Tontonoz, P.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, November 2001, p. 7558-7568, Vol. 21, No. 22
0270-7306/01/$04.00+0   DOI: 10.1128/MCB.21.22.7558-7568.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

Autoregulation of the Human Liver X Receptor alpha  Promoter

Bryan A. Laffitte,1 Sean B. Joseph,2 Robert Walczak,1 Liming Pei,2 Damien C. Wilpitz,1 Jon L. Collins,3 and Peter Tontonoz1,2,*

Howard Hughes Medical Institute1 and Department of Pathology and Laboratory Medicine,2 University of California, Los Angeles, California 90095-1662, and Nuclear Receptor Discovery Research, GlaxoSmithKline, Research Triangle Park, North Carolina 27709-33983

Received 17 April 2001/Returned for modification 29 June 2001/Accepted 28 August 2001


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Previous work has implicated the nuclear receptors liver X receptor alpha  (LXRalpha ) and LXRbeta in the regulation of macrophage gene expression in response to oxidized lipids. Macrophage lipid loading leads to ligand activation of LXRs and to induction of a pathway for cholesterol efflux involving the LXR target genes ABCA1 and apoE. We demonstrate here that autoregulation of the LXRalpha gene is an important component of this lipid-inducible efflux pathway in human macrophages. Oxidized low-density lipoprotein, oxysterols, and synthetic LXR ligands induce expression of LXRalpha mRNA in human monocyte-derived macrophages and human macrophage cell lines but not in murine peritoneal macrophages or cell lines. This is in contrast to peroxisome proliferator-activated receptor gamma  (PPARgamma )-specific ligands, which stimulate LXRalpha expression in both human and murine macrophages. We further demonstrate that LXR and PPARgamma ligands cooperate to induce LXRalpha expression in human but not murine macrophages. Analysis of the human LXRalpha promoter led to the identification of multiple LXR response elements. Interestingly, the previously identified PPAR response element (PPRE) in the murine LXRalpha gene is not conserved in humans; however, a different PPRE is present in the human LXR 5'-flanking region. These results have implications for cholesterol metabolism in human macrophages and its potential to be regulated by synthetic LXR and/or PPARgamma ligands. The ability of LXRalpha to regulate its own promoter is likely to be an integral part of the macrophage physiologic response to lipid loading.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Oxidized lipid signaling in macrophages is central to the pathogenesis of atherosclerosis (20, 24). Exposure of macrophages and other vascular cells to oxidized low-density lipoprotein (oxLDL) leads to complex changes in gene expression that are collectively thought to influence the development of the atherosclerotic lesion. Mounting evidence suggests that nuclear receptor signaling pathways mediate many of the effects of oxidized lipids on cellular gene expression. Macrophage uptake of oxLDL has the potential to provide the cell with oxidized fatty acid ligands of peroxisome proliferator-activated receptor gamma  (PPARgamma ) as well as oxysterol ligands of liver X receptor alpha  (LXRalpha ) and LXRbeta (8, 12, 13).

LXRalpha and LXRbeta have been identified as key regulators of lipid homeostasis in multiple cell types (18). Targeted disruption of the Lxralpha gene in mice uncovered roles for this receptor in the regulation of both hepatic bile acid synthesis and intestinal cholesterol absorption (16, 19). The observation that sterol regulatory element-binding protein 1-c is a target for LXRs suggests that LXRs may be involved in the control of lipogenesis (6, 17, 21). Recent work has also implicated LXRs in the control of gene expression in response to macrophage lipid loading. Multiple genes potentially involved in the cellular cholesterol efflux pathway, including the putative cholesterol/phospholipid transporter ABCA1 (5, 19, 22, 28), ABCG1 (29), and apolipoprotein E (apoE) (11), have been identified as transcriptional targets of LXR/retinoid X receptor (RXR) heterodimers. Moreover, ligand activation and/or retroviral expression of LXRalpha in macrophages and fibroblasts stimulates ABCA1-mediated cholesterol efflux to extracellular acceptors such as apoAI (22, 28). These observations suggest that the rate of cholesterol efflux in macrophages and other peripheral cells is controlled, at least in part, by LXR signaling pathways.

The mechanisms that control expression of the LXRalpha and LXRbeta genes are not well understood. In mice, LXRalpha is expressed primarily in the liver, intestine, adipose tissue, and macrophages, whereas LXRbeta is widely expressed (15, 30). Clearly, distinct trans-acting factors must be involved in the regulation of these genes. Liver expression of LXRalpha has been reported to be responsive to dietary fatty acids in mice (25). This led to the suggestion that the murine LXRalpha (mLXRalpha ) gene may be a target for PPARalpha regulation in the liver; however, synthetic PPARalpha -selective ligands have not been shown to influence LXRalpha expression in liver cells. It has previously been shown that expression of LXRalpha , but not LXRbeta , is induced by synthetic PPARgamma ligands in both human and murine macrophages (2). As a consequence of this regulation, ligands for LXR and PPARgamma additively promote cholesterol efflux from macrophages. We identified a functional PPAR response element (PPRE) in the promoter of the mLXRalpha gene and demonstrated that induction by synthetic PPARgamma ligands is lost in PPARgamma -deficient murine macrophages. Thus, expression of LXRalpha is not only tissue specific, but it is also likely to be regulated in response to certain metabolic signals.

We demonstrate here that expression of LXRalpha is highly induced in human macrophages in response to lipid loading. Moreover, we demonstrate that this lipid inducibility is likely to result from feedback induction of the LXRalpha gene by LXR/RXR heterodimers. The human LXRalpha gene (hLXRalpha ) is a direct target for regulation by both LXR and PPARgamma , and synthetic ligands for these receptors cooperatively induce its expression in macrophages. Interestingly, autoregulation of the LXRalpha promoter is not observed in murine macrophages. Consistent with this difference, we show that certain LXR target genes, such as apoE, are more highly regulated by LXR ligands in human versus murine macrophages. This species-specific difference in LXRalpha regulation may have implications for cholesterol metabolism and its potential to be regulated by synthetic LXR and/or PPARgamma ligands.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Reagents and plasmids. pCMX expression plasmids for PPARgamma , RXRalpha , LXRalpha , and LXRbeta have been described (7, 28). pCMX-VP16-LXRalpha was a gift from Ron Evans (Salk Institute). GW7845, GW3965, and T0901317 were provided by Tim Willson (GlaxoSmithKline). LG268 was provided by Rich Heyman (Ligand Pharmaceuticals). Ligands were dissolved in ethanol or dimethyl sulfoxide prior to use in cell culture. The hLXRalpha promoter was cloned from the bacterial artificial chromosome (BAC) clone RP11-390K5 by PCR using the high-fidelity polymerase Pfu. A region spanning from -2625 to -1368 (relative to the transcription start site from exon 1A) was amplified by PCR from RP11-390K5 and cloned into the BamHI site of pTK-Luciferase to create pTK-hLXRalpha (-2625)-Luc. Regions corresponding to bp -2625 to +375, -2210 to +375, -1383 to +375, and -560 to +375 of the hLXRalpha promoter were amplified by PCR and cloned into KpnI/NheI-digested pGL3-Luciferase (Promega), creating pGL3-hLXRalpha (-2625)-Luc, pGL3-hLXRalpha (-2210)-Luc, pGL3-hLXRalpha (-1383)-Luc, and pGL3-hLXRalpha (-560)-Luc.

5' RACE. 5' rapid amplification of cDNA ends (RACE) was performed using the SMART RACE cDNA Amplification kit (Clontech). Briefly, first-strand cDNA was synthesized from total RNA derived from primary human macrophages or tetradecanoyl phorbol acetate-differentiated THP-1 cells using a poly(dT) primer and the SMART II oligonucleotide. 5' RACE PCR was then performed using the Universal Primer mix and either of two gene-specific primers complementary to the hLXRalpha mRNA sequence [hLXRalpha (141), TGCCTCCCTGGGCCTGGCTGCTT, or hLXRalpha (391), TTGCAGCCCTCGCAGCTCAGAACAT]. Amplification was performed using touchdown PCR on a BioRad iCycler Thermal Cycler (BioRad). 5' RACE products were cloned by TOPO TA Cloning (Invitrogen). Approximately 40 clones were sequenced.

Cell culture and transfections. THP-1 and MonoMac-6 cells were cultured in RPMI medium containing 10% fetal bovine serum (FBS). NIH 3T3 and 3T3-F442A cells were grown in Dulbecco's modified Eagle's medium (DMEM) containing 10% calf serum, and HepG2 cells were grown in modified Eagle's medium (MEM) containing 10% FBS. Peritoneal macrophages were obtained from thioglycolate-injected mice as described (29) and cultured in DMEM containing 10% FBS. Human primary monocytes/macrophages were obtained as previously described (29) and maintained in Iscove's modified Dulbecco's medium containing 10% FBS. Human primary preadipocytes were obtained from ZenBio, Inc., and cultured in a Ham's F-12 medium-DMEM mixture (1:1). For ligand treatments, cells were cultured in RPMI medium, DMEM, Iscove's modified Dulbecco's medium, or Ham's F-12 medium supplemented with 10% lipoprotein-deficient serum (LPDS) (Intracel) and receptor ligands for 48 h. In some experiments, cells were sterol depleted by inclusion of 5 µM simvastatin and 100 µM mevalonic acid during the treatment period. Transient transfections of HepG2 cells were performed in triplicate in 48-well plates. Cells were transfected with reporter plasmid (100 ng/well), receptor plasmids (5 to 50 ng/well), pCMV-beta -galactosidase (50 ng/well), and pTKCIII (to a total of 205 ng/well) using the MBS mammalian transfection kit (Stratagene). Following transfection, cells were incubated in MEM containing 10% LPDS and the indicated ligands or vehicle control for 24 h. Luciferase activity was normalized to beta -galactosidase activity.

RNA analysis. Total RNA was isolated using Trizol reagent (Life Technologies, Inc.). Northern analysis was performed as described (26) using radiolabeled cDNA probes. Blots were normalized using cDNA probes to 36B4 and quantitated by PhosphorImager (Molecular Dynamics) analysis. Real-time quantitative PCR assays were performed using an Applied Biosystems 7700 sequence detector. Briefly, 1 µg of total RNA was reverse transcribed with random hexamers using the Taqman Reverse Transcription Reagents kit (Applied Biosystems) according to the manufacturer's protocol. Each amplification mixture (50 µl) contained 50 ng of cDNA, 900 nM forward primer, 900 nM reverse primer, 100 nM dual-labeled fluorogenic probe (Applied Biosystems), and 25 µl of Universal PCR Master mix. PCR thermocycling parameters were 50°C for 2 min, 95°C for 10 min, and 40 cycles of 95°C for 15 and 60°C for 1 min. All samples were analyzed for beta -actin (human) or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (mouse) expression in parallel in the same run using probe and primers from predeveloped assays for beta -actin and GAPDH (Applied Biosystems). Quantitative expression values were extrapolated from separate standard curves for beta -actin or GAPDH and human- or mouse-generated expression with 10-fold dilutions of cDNA (in duplicate). Each sample was normalized to beta -actin or GAPDH, and replicates were then averaged and fold induction was determined. The following human primers were used: hLXRalpha forward (F) (5'-AAGCCCTGCATGCCTACGT-3'), hLXRalpha reverse (R) (5'-TGCAGACGCAGTGCAAACA-3'), hLXRalpha Taqman probe (FAM-CCACCATCCCCATGACCGACTGAT-TAMRA), human apoE (hapoE) F (5'-CGCTGGGTGCAGACACTGT-3'), hapoE R (5'-GGCCTTCAACTCCTTCATGGT-3'), and hapoE probe (FAM-TCCATCAGCGCCCTCAGTTCCTG-TAMRA). The following murine primers were used: mLXRalpha F (5'-CAACAGTGTAACAGGCGCT-3'), mLXRalpha R (5'-TGCAATGGGCCAAGGC-3'), mLXRalpha Taqman probe (FAM-TCAGACCGCCTGCGCGTCA-TAMRA), murine apoE (mapoE) F (5'-GGAGGTGACAGATCAGCTCGA-3'), mapoE R (5'-TCCCAGAAGCGGTTCAGG-3'), and mapoE probe (FAM-CAAAGCAACCAACCCTGGGAGCAG-TAMRA).

Gel shift assays. In vitro-translated RXRalpha , LXRalpha , and PPARgamma were generated from pCMX-RXRalpha , pCMX-hLXRalpha , and pCMX-PPARgamma plasmids using the TNT Quick Coupled Transcription/Translation system (Promega). Gel shift assays were performed as described (10) using in vitro-translated proteins and the following oligonucleotides (only one strand shown): hLXRalpha PPRE (GATCGGATTTTGAACTTTGTACTTGTTTCC), hLXRalpha DR4-A (GATCGGGTGGATCACTTGAGGTCAGGAG), hLXRalpha DR4-B (GATCAGATGGATCACTTGAGGTCAGGAG), hLXRalpha DR4-C (GATCGCTGAGGTTACTGCTGGTCATTCA), and CYP7A LXR response element (LXRE) (CCTTTGGTCACTCAAGTTCAAGTG).


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Previous work has demonstrated that macrophage expression of PPARgamma is induced in response to oxLDL (27). We investigated whether expression of LXRalpha or LXRbeta in macrophages might also be regulated by modified lipoproteins. The human monocytic cell line THP-1 was used as a model system. THP-1 cells were differentiated for 24 h with 40 ng of tetradecanoyl phorbol acetate per ml and then treated in the presence of LPDS for 48 h with either vehicle alone or 100 µg of (protein) LDL, oxLDL, or acetylated LDL (acLDL) per ml. In order to ensure maximal sterol depletion of the cells, treatments were carried out in the presence of the 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitor simvastatin (5 µM) and mevalonic acid (100 µM). As shown in Fig. 1, the treatment of THP-1 macrophages with oxLDL or acLDL led to a significant induction of LXRalpha mRNA. In contrast, native LDL, which is not readily internalized by these cells, had no effect on LXRalpha expression. Expression of the related nuclear receptor LXRbeta was not altered in response to native or modified LDL. Induction of LXRalpha mRNA in these experiments paralleled that of the known LXR target genes ABCA1 and ABCG1. Similar results were obtained with primary human monocyte-derived macrophages (Fig. 1). Surprisingly, while oxLDL and acLDL were effective inducers of ABCA1 and ABCG1 expression in murine macrophages, they had little or no effect on LXRalpha expression. Modified LDL also had no effect on LXRalpha expression in murine RAW264.7 macrophages (reference 28 and data not shown). These observations suggest that species-specific differences may exist in the mechanisms controlling LXRalpha expression.


View larger version (76K):
[in this window]
[in a new window]
 
FIG. 1.   Induction of LXRalpha expression in human macrophages in response to modified LDL loading. Differentiated THP-1 macrophages, primary human monocyte-derived macrophages (Mphi ), or thioglycolate-elicited mouse peritoneal macrophages were incubated for 48 h in RPMI medium containing 10% LPDS, 5 µM simvastatin, and 100 µM mevalonic acid. Cells were treated with vehicle control or 100 µg (protein) of either LDL, oxLDL, or acLDL per ml as indicated. Total RNA (10 µg/lane) was electrophoresed through formaldehyde-containing gels, transferred to nylon, and hybridized to 32P-labeled cDNA probes. 36B4 was used as a control for loading and integrity of the RNA.

The ability of modified LDL to modulate LXRalpha gene expression led us to hypothesize that the LXRalpha gene might itself be a downstream target of the LXR signaling pathway in human macrophages. To address this possibility, we examined the ability of oxysterols and synthetic LXR ligands to regulate LXRalpha expression in various macrophage cell lines. As shown in Fig. 2A, the treatment of human THP-1 macrophages with the oxysterol LXR ligand 22(R)-hydroxycholesterol (2 µg/ml) or with either of two synthetic LXR agonists, T1317 (19, 21) and GW3965 (14), led to a prominent induction of LXRalpha mRNA expression. Treatment with the synthetic RXR-specific agonist LG268 (100 nM) also induced LXRalpha expression, and the combination of the LXR ligand and LG268 had an additive effect. 22(S)-hydroxycholesterol (2 µg/ml), which binds but does not activate LXRs (23), did not alter LXRalpha expression. Similar to the results obtained with modified lipoproteins (Fig. 1), induction of ABCA1 and ABCG1 expression by nuclear receptor ligands paralleled that of LXRalpha . Expression of LXRbeta was not influenced by LXR or RXR ligands. An even more dramatic induction of LXRalpha expression by LXR ligands was observed when endogenous cholesterol synthesis was inhibited by treatment with simvastatin (Fig. 2B). Similar results were observed in primary human monocyte-derived macrophages and MonoMac-6 cells (Fig. 3 and data not shown). The reduced basal expression of LXRalpha observed in the presence of simvastatin suggests that endogenous oxysterol LXR ligands are required for tonic expression of LXRalpha . Interestingly, the sterol regulatory element-binding protein 1-c gene has been reported to be a target for LXR and to be similarly dependent on endogenous LXR ligands for its expression in liver cells (6, 17).


View larger version (59K):
[in this window]
[in a new window]
 
FIG. 2.   Oxysterols and synthetic LXR ligands stimulate LXRalpha expression in THP-1 macrophages. Differentiated THP-1 macrophages (A and B) or thioglycolate-elicited mouse peritoneal macrophages (Mphi ) (C) were incubated for 48 h in RPMI medium plus 10% LPDS or RPMI medium plus 10% LPDS, 5 µM simvastatin, and 100 µM mevalonic acid (unloaded). Oxysterols [20(S)HC, 22(R)HC, or 22(S)HC, 2.0 µg/ml], synthetic LXR ligand (GW3965 or T1317, 0.1 to 10.0 µM), or RXR ligand (LG268, 50 nM) was included as indicated. Northern analysis was performed as described in the legend to Fig. 1.


View larger version (17K):
[in this window]
[in a new window]
 
FIG. 3.   Differential induction of the LXR target gene apoE by LXR ligands in human and murine macrophages. Differentiated THP-1 macrophages or thioglycolate-elicited mouse peritoneal macrophages were incubated for 48 h in RPMI medium plus 10% LPDS, 5 µM simvastatin, and 100 µM mevalonic acid. Cells were treated with the indicated concentrations of either T1317 or GW3965. The expression of apoE mRNA was monitored by real-time quantitative PCR (Taqman) assays (see Materials and Methods).

In contrast to the results obtained with human macrophages, treatment of primary murine macrophages or the murine macrophage cell line RAW264.7 with LXR-selective ligands did not significantly alter LXRalpha expression (Fig. 2C and data not shown). The failure of LXRalpha to be induced in murine macrophages does not result from a general defect in the LXR signaling pathway, since the LXR target genes ABCA1 and ABCG1 are effectively induced in these cells (Fig. 2C). Rather, the ability of LXRs to regulate LXRalpha expression is apparently species specific. The possibility that the murine gene is responsive to LXR ligands in certain tissues or under certain conditions not tested here, however, cannot be excluded.

The species-specific difference in the ability of LXR ligands to induce LXRalpha receptor expression suggested the possibility that human macrophages may be more responsive than murine macrophages to LXR activation. Previous work has indicated that the LXR target gene apoE is particularly sensitive to the level of LXR present in the cell. Induction of apoE expression by LXR ligand is significantly reduced in macrophages from either LXRalpha -/- or LXRbeta -/- mice, even in the presence of high concentrations of ligand (11). We therefore compared the dose response of the LXR target apoE to two synthetic LXR ligands in THP-1 cells and murine macrophages. As shown in Fig. 3, the induction of apoE was significantly higher in human cells in response to both GW3965 and T1317. This difference is consistent with the higher level of LXRalpha receptor expression in human cells in the presence of LXR ligand. Thus, the ability of the hLXRalpha gene to undergo autoregulation is likely to have implications for LXR target gene expression.

Previous work has shown that macrophage LXRalpha expression is also induced by PPARgamma -specific ligands (2, 4). Accordingly, activation of PPARgamma in THP-1 cells leads to the induction of primary LXR target genes such as ABCA1 and ABCG1. In contrast to LXR ligands, PPARgamma ligands have been shown to promote LXRalpha mRNA expression in both human and murine macrophages. We therefore examined the effects of simultaneous activation of both the PPARgamma and LXR pathways on macrophage gene expression. RNA expression was monitored by either Northern analysis or real-time quantitative PCR (Taqman) assays (see Materials and Methods). As shown in Fig. 4, the treatment of THP-1 macrophages with oxysterol LXR ligands, synthetic LXR ligands (T1317 or GW3965), or synthetic PPARgamma ligands alone (rosiglitazone or GW7845) stimulated LXRalpha expression. The combination of an LXR ligand and a PPARgamma ligand had an additive effect. Similar results were obtained with the human monocytic cell line MonoMac-6 (Fig. 4A) and human primary monocytes/macrophages (Fig. 4B). Interestingly, the response of LXRalpha to this combined treatment was much more prominent than that observed for ABCA1 or ABCG1 (reference 2 and data not shown). This observation suggested that the hLXRalpha gene might be a direct target of both LXR/RXR and PPARgamma /RXR heterodimers, whereas ABCA1 and ABCG1 are likely to be direct targets of only LXR/RXR. Consistent with the results shown in Fig. 2C, LXR ligands failed to induce LXRalpha expression in murine macrophages, even when used in combination with a PPARgamma ligand (Fig. 4B).


View larger version (48K):
[in this window]
[in a new window]
 
FIG. 4.   Ligands for LXR and PPARgamma additively induce LXRalpha expression in human macrophages. Differentiated THP-1 macrophages, MonoMac-6 cells, human monocyte-derived macrophages (Mphi ), or thioglycolate-elicited mouse peritoneal macrophages were incubated for 48 h in RPMI medium plus 10% LPDS. Oxysterols {20(S)HC [20 (S)] or 22(R)HC [22 (R)], 2.0 µg/ml}, synthetic LXR ligands (GW3965 or T1317, 5 µM), and/or PPARgamma ligands (rosiglitazone [Rosi] or GW7845, 5 µM) were included as indicated. Northern blots (A) were quantitated by phosphorimager analysis and normalized to 36B4. The level of expression relative to LPDS control (fold induction) is indicated; real-time quantitative PCR assays (B) were performed in duplicate as described in Materials and Methods and normalized to 36B4 or beta -actin. The level of mRNA expression relative to control (fold induction) is indicated.

We further addressed whether the ability of LXRs and PPARs to regulate LXRalpha expression was specific to macrophages or whether it also occurred in other cell types. As shown in Fig. 5, autoregulation of the hLXRalpha gene was also observed in liver and adipose cell lines. Treatment with the LXR ligand GW3965 or T1317 induced LXRalpha expression in both human preadipocytes and the human hepatoma cell line HepG2. As in macrophages, induction of LXRalpha expression paralleled induction of ABCA1. In contrast, ligands for PPARgamma (GW7845) or PPARalpha (WY14613) had no effect on LXRalpha expression in HepG2 cells. Consistent with the results obtained in macrophages, the mLXRalpha gene was induced by the PPARgamma ligand but not by the LXR ligand in 3T3-F442A preadipocytes under similar conditions. In experiments not shown, we have observed induction of LXRalpha mRNA expression by synthetic PPARgamma and LXR ligands in THP-1 cells in the presence of the protein synthesis inhibitor cycloheximide but not in the presence of the RNA polymerase inhibitor actinomycin D, consistent with direct transcriptional effects. Taken together, these results reveal a partially overlapping pattern of regulation of the mLXRalpha and hLXRalpha genes by nuclear receptors. Both the hLXRalpha and mLXRalpha genes are targets for PPARgamma regulation in macrophages and adipocytes. The hLXRalpha gene, but not the mLXRalpha , is also regulated by LXR itself in multiple cell types, including macrophages, adipocytes, and hepatocytes.


View larger version (52K):
[in this window]
[in a new window]
 
FIG. 5.   Autoregulation of the hLXRalpha gene in preadipocytes and HepG2 cells. Primary human preadipocytes (Pre Ad), HepG2 cells, or 3T3-F442A murine preadipocytes were cultured for 48 h in media containing 10% LPDS and one or more of the following nuclear receptor ligands as indicated: GW3965 (5 µM), T1317 (5 µM), GW7845 (5 µM), and Wy14643 (50 µM).

To investigate the molecular basis for the regulation of hLXRalpha expression by LXR and PPARgamma ligands, we cloned and analyzed the 5'-flanking region from the hLXRalpha gene. The transcriptional start site of the hLXRalpha gene was mapped by 5' RACE using RNA derived from primary human macrophages and THP-1 cells. Analysis of the 5' RACE products revealed two distinct transcriptional start sites (Fig. 6). As a result of alternative splicing, these give rise to two alternatively utilized exon 1 sequences (Fig. 7A). The vast majority of the products of the 5' RACE reactions corresponded to use of the downstream (exon 1B) start site, suggesting that this is the primary site utilized in human macrophages. The genomic sequence and organization of the hLXRalpha gene were determined by searching the human genome and the high throughput genomic sequence databases (National Center for Biotechnology Information) using the revised mRNA sequence for hLXRalpha . We identified a BAC clone (RP11-390K5) containing the entire hLXRalpha mRNA sequence and approximately 5 kb of the 5'-flanking sequence. Comparison of the hLXRalpha and mLXRalpha genomic sequences revealed a similar genomic structure, with each gene composed of 10 exons. Exon 1A from the hLXRalpha gene shows a high level of homology to the previously reported transcriptional start site for the mLXRalpha gene. In the human genomic sequence, exon 1B is located approximately 343 bp downstream of the exon 1A start site. This sequence is conserved in the murine genomic sequence, and a previous report suggested that this region might be utilized as an alternative start site in the mouse (1). In both humans and mice, exon 1 is comprised entirely of untranslated sequence; therefore, the use of alternative exon 1 sequences does not impact the protein product.


View larger version (32K):
[in this window]
[in a new window]
 
FIG. 6.   Sequence comparison of the hLXRalpha and mLXRalpha transcriptional start sites. The putative transcriptional start sites are marked by arrows. The initiator element is indicated in bold type. The previously published mouse transcriptional start site is designated as position +1 (1).


View larger version (25K):
[in this window]
[in a new window]
 
FIG. 7.   Comparison of the hLXRalpha and mLXRalpha promoter regions. (A) Schematic representation of the hLXRalpha and mLXRalpha genes. Transcription start sites, genomic structure, sequence identity, and nuclear receptor binding sites are indicated. The asterisk denotes the major start site in macrophages. The arrows indicate hormone response element half sites. (B) Sequences of the LXREs and PPREs from the hLXRalpha and mLXRalpha promoters.

The proximal 2.6 kb of the hLXRalpha promoter region from BAC clone RP11-390K5 was cloned and sequenced. Comparison with the mLXRalpha gene revealed conservation of the transcriptional start regions and similarity up to approximately 250 bp upstream of the exon 1A start site (79% identity) (Fig. 6 and 7). However, relatively poor conservation of the sequence was found further upstream. In particular, the previously identified PPRE located in the mLXRalpha gene (2) is not conserved in the human sequence. A potential PPRE (DR-1) was identified in the hLXRalpha 5'-flanking region that is not conserved in location or sequence in comparison to the mouse (Fig. 6). In addition, the hLXRalpha gene was found to contain three potential LXREs (DR-4). Only one of these potential LXREs (LXRE-C) was in a region conserved in the mouse promoter sequence; furthermore, the mouse DR4-C sequence differed from the human sequence within one half site.

We next endeavored to determine whether the identified elements represented bona fide binding sites for LXR/RXR or PPARgamma /RXR heterodimers. As shown in Fig. 8A, gel mobility shift analysis using in vitro-translated proteins and radiolabeled oligonucleotides confirmed that the putative PPRE from the hLXRalpha gene bound PPARgamma /RXR heterodimers with affinity similar to that of the previously identified PPRE from the mLXRalpha gene (2). Furthermore, all three putative LXREs bound in vitro-translated LXRalpha /RXR (Fig. 8B). Competition assays indicated that the distal element (LXRE-C) bound LXRalpha /RXR with significantly higher affinity than LXRE-A, LXRE-B, or the LXRE from the murine CYP7A gene (Fig. 8C).


View larger version (31K):
[in this window]
[in a new window]
 
FIG. 8.   PPARgamma and LXRalpha bind to response elements in the hLXRalpha promoter. Gel mobility shift assays were performed using in vitro-translated receptors and end-labeled oligonucleotide probes as described in Materials and Methods. (A) Direct binding of PPARgamma /RXR heterodimers to a putative PPRE from the hLXRalpha promoter. (B) Direct binding of LXRalpha /RXR heterodimers to the LXRE-A, LXRE-B, and LXRE-C sites from the hLXRalpha promoter. (C) Competition for LXRalpha /RXR binding to LXRE-C. Unlabeled oligonucleotide was included in the binding reaction at the indicated molar excess.

Finally, we analyzed the ability of PPARgamma , LXRalpha , and LXRbeta to regulate the hLXRalpha promoter in transient transfection assays. A pGL3-based luciferase reporter construct containing bp -2625 to +345 of the hLXRalpha promoter (-2625 hLXRalpha -luc) was transiently transfected into HepG2 cells along with pCMX expression vectors encoding LXRalpha , LXRbeta , RXRalpha , and/or PPARgamma . As shown in Fig. 9A, the LXRalpha /RXRalpha and LXRbeta /RXRalpha heterodimers activated the hLXRalpha promoter in a ligand-dependent manner, but they had no effect on the control pGL3-luc reporter. Note that since HepG2 cells express endogenous LXRs, a background level of ligand-dependent induction of the reporter is seen in the absence of transfected receptor. When expression vectors for both LXRalpha and PPARgamma were cotransfected with the hLXRalpha promoter, an additive effect of LXR-selective (GW3965) and PPARgamma -selective (GW7845) ligands was observed (Fig. 9B). These results confirm that the LXR and PPAR binding sites identified above are in fact able to mediate activation of the hLXRalpha promoter by PPARgamma /RXR, LXRalpha /RXR, and LXRbeta /RXR heterodimers. Moreover, the additive effect of PPARgamma and LXR activation on the hLXRalpha promoter in transient transfection assays is consistent with the ability of PPAR and LXR ligands to additively induce expression of the endogenous hLXRalpha gene.


View larger version (20K):
[in this window]
[in a new window]
 
FIG. 9.   LXRalpha , LXRbeta , and PPARgamma activate the hLXRalpha promoter. (A) LXRalpha /RXRalpha and LXRbeta /RXR heterodimers activate the -2625-bp LXRalpha proximal promoter. HepG2 cells were transfected with either control pGL3-luc or -2625 LXRalpha -luc reporters with or without CMX-mLXRalpha /CMX-RXRalpha or CMX-mLXRbeta /CMX-RXRalpha and CMV-beta -galactosidase. Following transfection, cells were incubated for 24 h in MEM supplemented with 10% LPDS and 1 µM GW3965 or vehicle control. Luciferase activity was normalized for transfection efficiency using beta -galactosidase activity. (B) Ligand activation of PPARgamma and LXRalpha has an additive effect on the -2625-bp LXRalpha promoter. HepG2 cells were transfected as in panel A except that CMX-mPPARgamma 1 and GW7845 (1 µM) were included as indicated.

In order to address the relative importance of the individual nuclear receptor binding sites, deletion and mutation analyses were performed. We analyzed the ability of LXRalpha and RXR expression vectors to activate luciferase reporters containing bp -2625 to +345, -2210 to +345, -1310 to +345, or 560 to +345 of the hLXRalpha promoter. Surprisingly, deletion from bp -2625 to -2210, which deletes LXRE-C, resulted in the complete loss of LXR responsiveness (Fig. 10A). Similar results were obtained with an expression vector encoding a superactive VP16-LXRalpha fusion protein (11). The construct containing LXRE-C (bp -2625 to +345) was activated over 30-fold by VP16-LXRalpha , whereas those lacking this element were unresponsive (Fig. 10B). These observations suggested that the LXRE-C element is required for induction of the hLXRalpha promoter by LXR. To test this directly, we introduced specific mutations in each of the LXREs. As shown in Fig. 10, mutation of LXRE-C alone abolished promoter activation by LXRalpha , while simultaneous mutation of LXRE-A and LXRE-B had no effect. These results indicate that LXRE-C is the primary element mediating induction of the LXRalpha promoter by LXR/RXR heterodimers. The other potential response elements (LXRE-A and -B) apparently do not contribute to the induction of the hLXRalpha promoter despite their ability to bind LXR/RXR in vitro. This is consistent with the observation that LXRE-C has the highest affinity for LXR/RXR of the three sites (Fig. 8). Taken together, these results demonstrate that the hLXRalpha promoter is a direct target for regulation by both PPARgamma /RXR and LXRalpha /RXR heterodimers.


View larger version (27K):
[in this window]
[in a new window]
 
FIG. 10.   Deletion and mutation analysis of the hLXRalpha proximal promoter. (A) Luciferase reporters containing bp -2625 to +345, -2210 to +345, -1310 to + 345, or 560 to +345 of the hLXRalpha promoter were transfected into HepG2 cells in the presence or absence of CMX-hLXRalpha , CMX-RXRalpha , and 5 µM T1317. Luciferase activity was normalized for transfection efficiency using beta -galactosidase activity. The data are expressed as fold activations in the presence of the indicated ligand versus in the absence of ligand and represent the average of triplicate experiments. (B) hLXRalpha promoter constructs were cotransfected into HepG2 cells along with CMX vector or CMX-VP16-LXRalpha in the presence of 5 µM T1317. Data are expressed as relative luciferase activities normalized to beta -galactosidase activities and represent the average of triplicate experiments. (C) Mutations were introduced into individual LXREs in the bp -2625 to +345 hLXRalpha promoter construct by site-directed mutagenesis. Wild-type (WT) and mutant (Mut) reporters were transfected into HepG2 cells along with CMX-hLXRalpha and CMX-RXRalpha in the presence or absence of 1 µM GW3965. Data are expressed as luciferase activities normalized to beta -galactosidase activities and represent the averages of triplicate experiments.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Members of the nuclear receptor superfamily are now recognized to play a central role in the control of lipid-inducible gene expression. Both the PPAR and LXR subfamilies have been implicated in the regulation of gene expression and lipid metabolism in response to specific lipid ligands. PPARgamma is expressed at high levels in a number of specialized cell types, including adipocytes, colonic epithelia, and macrophages. No high-affinity endogenous ligand for this receptor has been described; however, physiologic activators of PPARgamma are likely to include native and oxidized polyunsaturated fatty acids (7, 9, 13). LXRalpha is expressed at high levels in many of the same tissues as PPARgamma , including macrophages and adipose tissue, while LXRbeta is ubiquitously expressed. Considerable evidence suggests that the physiologic ligands for LXRs are oxysterols such as 24(S)-hydroxycholesterol and 24(S),25-epoxycholesterol (8, 12, 23).

In macrophages, the PPAR and LXR families appear to coordinate a physiologic response to oxLDL uptake and lipid loading. A primary functional consequence of PPAR and LXR activation in macrophages is the induction of a pathway for cholesterol and phospholipid efflux. Ligands for either receptor additively promote cholesterol efflux from human macrophages (2, 28). The role of PPARgamma in this response appears to be to induce expression of the scavenger receptor CD36, the HDL receptor SR-BI, and LXRalpha (2, 3, 27). The role of LXR in this response appears to be to regulate several genes that have been directly implicated in the cholesterol efflux pathway including ABCA1, ABCG1, and apoE (5, 11, 22, 28, 29). Ligands for PPARgamma and LXR additively promote cholesterol efflux from macrophages, presumably as a consequence of the ability of PPARgamma to control LXRalpha expression.

In the present study, we have shown that the hLXRalpha gene is itself induced in macrophages in response to cellular lipid loading. Moreover, we have shown that this induction is likely to be mediated by the direct binding of LXR/RXR heterodimers to the LXRalpha promoter. Interestingly, tonic expression of LXRalpha in human cells appears to be dependent on endogenous production of oxysterol intermediates in the cholesterol biosynthetic pathway. Inhibition of cholesterol synthesis by simvastatin led to a complete loss of LXRalpha expression in THP-1 cells. Surprisingly, the ability of LXRalpha to regulate its own promoter appears to be species specific. Oxysterol and synthetic ligands of LXRs induce LXRalpha expression in human macrophage cell lines and primary human macrophages but not in murine cell lines or primary murine macrophages. In humans, this induction is observed in multiple cell types, including macrophages, adipocytes, and hepatoma cells. Cloning and analysis of the human LXRalpha 5'-flanking region led to the identification of the critical LXRE that is likely to mediate lipid inducibility.

Previous work demonstrated that expression of the LXRalpha gene is induced in both human and murine macrophages by PPARgamma -specific ligands (2, 4). A functional PPRE has been identified in the promoter of the mLXRalpha gene; however, the molecular basis for regulation of the hLXRalpha gene by PPARgamma has not been explored. In the present work, we have shown that although the PPRE present in the murine proximal promoter is not conserved in the human gene, a functional PPRE is present in a different region of the hLXRalpha promoter. Thus, while the hLXRalpha gene is a target for both PPARgamma and LXR, the murine gene appears to be a target only for PPARgamma . The possibility that the murine gene is responsive to LXR in certain tissues or under certain conditions not tested here, however, cannot be excluded. At present, hLXRalpha is the only known common target gene for both PPARgamma and LXRs. Tobin et al. have previously reported that liver LXRalpha expression was responsive to dietary fatty acids and have suggested that the mLXRalpha gene may be a target for PPARalpha regulation in liver (25). However, we have not observed regulation of LXRalpha mRNA by either PPARalpha - or PPARgamma -specific ligands in liver cells (Fig. 5). Rather, our data suggest that the LXRalpha gene is a target for PPAR regulation only in certain tissues such as macrophages and adipocytes.

Substantial differences in lipid metabolism exist between mice and humans. The results presented here have implications for cholesterol metabolism in both species and its potential to be regulated by synthetic LXR and/or PPARgamma ligands. We have outlined an unexpected species-specific difference in the regulation of LXRalpha expression by oxidized lipid ligands of LXRs. In human macrophages, the ability of LXRalpha to regulate its own promoter is likely to be an integral part of the physiologic response to lipid loading. The LXRalpha autoregulatory loop provides a mechanism whereby the cellular response to lipid loading can be amplified and maximized. The species-specific difference in the ability to amplify the LXR response raises the possibility that humans may be more responsive than mice to LXR agonists in general and to LXRalpha agonists in particular.

Several lines of evidence support the hypothesis that upregulation of LXRalpha expression can impact LXR target gene expression and cellular function, even though most cells also express significant levels of LXRbeta . First, the phenotype of LXRalpha -/- mice clearly indicates that the two receptors are not entirely redundant (16). Second, although studies have shown that induction of ABCA1 and ABCG1 is preserved in LXRalpha -/- macrophages in the presence of maximal concentrations of ligands (19, 29), expression of apoE is reduced in either LXRalpha -/- or LXRbeta -/- mice under identical conditions (11). Thus, some target genes are more sensitive than others to the absolute levels of LXR present in the cell. It is for this subset of genes that autoregulation of the LXRalpha promoter is likely to have the greatest impact. Third, studies have also shown that the level of LXRalpha expression is a key determinant of both the sensitivity of ABCA1 induction and the rate of cholesterol efflux. Retroviral expression of LXRalpha in cells that already express LXRbeta shifts the dose response of ABCA1 to LXR ligands and dramatically stimulates cholesterol efflux (28). Finally, we have shown here that certain LXR target genes, such as apoE, are in fact significantly more responsive to LXR ligand in human macrophages than in murine macrophages (Fig. 3).

Our results also suggest that LXRalpha may play a more prominent role than LXRbeta in certain human cell types, especially in the context of cellular lipid loading. In resting macrophages, for example, expression of LXRbeta is more prominent than that of LXRalpha (Fig. 2 and data not shown). Upon lipid loading and LXR activation, however, the balance is shifted dramatically in favor of LXRalpha . This could have an important impact on gene expression and lipid metabolism if certain LXR target genes are preferentially activated by either LXRalpha or LXRbeta . The development of selective ligands for either LXRalpha or LXRbeta should shed light on this issue.


    ACKNOWLEDGMENTS

We thank Tim Willson (GlaxoSmithKline) for GW3965, GW7845, and T0901317; Rich Heyman (Ligand Pharmaceuticals) for LG268; and Harleen Ahuja for help with real-time PCR assays. We also thank Peter Edwards, Matthew Kennedy, and Tim Willson for helpful discussions and Brenda Mueller for administrative support.

P.T. is an Assistant Investigator of the Howard Hughes Medical Institute at the University of California, Los Angeles.


    FOOTNOTES

* Corresponding author. Mailing address: Howard Hughes Medical Institute, UCLA School of Medicine, Box 951662, Los Angeles, CA 90095-1662. Phone: (310) 206-4546. Fax: (310) 267-0382. E-mail: ptontonoz{at}mednet.ucla.edu.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Alberti, S., K. R. Steffensen, and J. A. Gustafsson. 2000. Structural characterisation of the mouse nuclear oxysterol receptor genes LXRalpha and LXRbeta. Gene 243:93-103[CrossRef][Medline].
2. Chawla, A., W. A. Boisvert, C. Lee, B. A. Laffitte, Y. Barak, S. B. Joseph, D. Liao, L. Nagy, P. A. Edwards, L. K. Curtiss, R. M. Evans, and P. Tontonoz. 2001. A PPARgamma-LXR-ABCA1 pathway in macrophages is involved in cholesterol efflux and atherogenesis. Mol. Cell 7:161-171[CrossRef][Medline].
3. Chinetti, G., F. G. Gbaguidi, S. Griglio, Z. Mallat, M. Antonucci, P. Poulain, J. Chapman, J. C. Fruchart, A. Tedgui, J. Najib-Fruchart, and B. Staels. 2000. CLA-1/SR-BI is expressed in atherosclerotic lesion macrophages and regulated by activators of peroxisome proliferator-activated receptors. Circulation 101:2411-2417[Abstract/Free Full Text].
4. Chinetti, G., S. Lestavel, V. Bocher, A. T. Remaley, B. Neve, I. P. Torra, E. Teissier, A. Minnich, M. Jaye, N. Duverger, H. B. Brewer, J. C. Fruchart, V. Clavey, and B. Staels. 2001. PPAR-alpha and PPAR-gamma activators induce cholesterol removal from human macrophage foam cells through stimulation of the ABCA1 pathway. Nat. Med. 7:53-58[CrossRef][Medline].
5. Costet, P., Y. Luo, N. Wang, and A. R. Tall. 2000. Sterol-dependent transactivation of the ABC1 promoter by the liver X receptor/retinoid X receptor. J. Biol. Chem. 275:28240-28245[Abstract/Free Full Text].
6. DeBose-Boyd, R. A., J. Ou, J. L. Goldstein, and M. S. Brown. 2001. Expression of sterol regulatory element-binding protein 1c (SREBP-1c) mRNA in rat hepatoma cells requires endogenous LXR ligands. Proc. Natl. Acad. Sci. USA 98:1477-1482[Abstract/Free Full Text].
7. Forman, B. M., P. Tontonoz, J. Chen, R. P. Brun, B. M. Spiegelman, and R. M. Evans. 1995. 15-deoxy-delta 12,14-prostaglandin J2 is a ligand for the adipocyte determination factor PPAR gamma. Cell 83:803-812[CrossRef][Medline].
8. Janowski, B. A., P. J. Willy, T. R. Devi, J. R. Falck, and D. J. Mangelsdorf. 1996. An oxysterol signalling pathway mediated by the nuclear receptor LXR alpha. Nature 383:728-731[CrossRef][Medline].
9. Kliewer, S. A., J. M. Lenhard, T. M. Wilson, I. Patel, D. C. Morris, and J. M. Lehmann. 1995. A prostaglandin J2 metabolite binds peroxisome proliferator-activated receptor gamma and promotes adipocyte differentiation. Cell 83:813-819[CrossRef][Medline].
10. Laffitte, B. A., H. R. Kast, C. M. Nguyen, A. M. Zavacki, D. D. Moore, and P. A. Edwards. 2000. Identification of the DNA binding specificity and potential target genes for the farnesoid X-activated receptor. J. Biol. Chem. 275:10638-10647[Abstract/Free Full Text].
11. Laffitte, B. A., J. J. Repa, S. B. Joseph, D. C. Wilpitz, H. R. Kast, D. J. Mangelsdorf, and P. Tontonoz. 2001. LXRs control lipid-inducible expression of the apolipoprotein E gene in macrophages and adipocytes. Proc. Natl. Acad. Sci. USA 98:507-512[Abstract/Free Full Text].
12. Lehmann, J. M., S. A. Kliewer, L. B. Moore, T. A. Smith-Oliver, B. B. Oliver, J. L. Su, S. S. Sundseth, D. A. Winegar, D. E. Blanchard, T. A. Spencer, and T. M. Willson. 1997. Activation of the nuclear receptor LXR by oxysterols defines a new hormone response pathway. J. Biol. Chem. 272:3137-3140[Abstract/Free Full Text].
13. Nagy, L., P. Tontonoz, J. G. Alvarez, H. Chen, and R. M. Evans. 1998. Oxidized LDL regulates macrophage gene expression through ligand activation of PPAR gamma. Cell 93:229-240[CrossRef][Medline].
14. Oliver, W. R., J. L. Shenk, M. R. Snaith, C. S. Russell, K. D. Plunket, N. L. Bodkin, M. C. Lewis, D. A. Winegar, M. L. Sznaidman, M. H. Lambert, H. E. Xu, D. D. Sternbach, S. A. Kliewer, B. C. Hansen, and T. M. Willson. 2001. A selective peroxisome proliferator-activated receptor delta agonist promotes reverse cholesterol transport. Proc. Natl. Acad. Sci. USA 98:5306-5311[Abstract/Free Full Text].
15. Peet, D. J., B. A. Janowski, and D. J. Mangelsdorf. 1998. The LXRs: a new class of oxysterol receptors. Curr. Opin. Genet. Dev. 8:571-575[CrossRef][Medline].
16. Peet, D. J., S. D. Turley, W. Ma, B. A. Janowski, J. M. Lobaccaro, R. E. Hammer, and D. J. Mangelsdorf. 1998. Cholesterol and bile acid metabolism are impaired in mice lacking the nuclear oxysterol receptor LXR alpha. Cell 93:693-704[CrossRef][Medline].
17. Repa, J. J., G. Liang, J. Ou, Y. Bashmakov, J. M. Lobaccaro, I. Shimomura, B. Shan, M. S. Brown, J. L. Goldstein, and D. J. Mangelsdorf. 2000. Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptors, LXRalpha and LXRbeta. Genes Dev. 14:2819-2830[Abstract/Free Full Text].
18. Repa, J. J., and D. J. Mangelsdorf. 2000. The role of orphan nuclear receptors in the regulation of cholesterol homeostasis. Annu. Rev. Cell Dev. Biol. 16:459-481[CrossRef][Medline].
19. Repa, J. J., S. D. Turley, J. A. Lobaccaro, J. Medina, L. Li, K. Lustig, B. Shan, R. A. Heyman, J. M. Dietschy, and D. J. Mangelsdorf. 2000. Regulation of absorption and ABC1-mediated efflux of cholesterol by RXR heterodimers. Science 289:1524-1529[Abstract/Free Full Text].
20. Ross, R. 1995. Cell biology of atherosclerosis. Annu. Rev. Physiol. 57:791-804[CrossRef][Medline].
21. Schultz, J. R., H. Tu, A. Luk, J. J. Repa, J. C. Medina, L. Li, S. Schwendner, S. Wang, M. Thoolen, D. J. Mangelsdorf, K. D. Lustig, and B. Shan. 2000. Role of LXRs in control of lipogenesis. Genes Dev. 14:2831-2838[Abstract/Free Full Text].
22. Schwartz, K., R. M. Lawn, and D. P. Wade. 2000. ABC1 gene expression and ApoA-I-mediated cholesterol efflux are regulated by LXR. Biochem. Biophys. Res. Commun. 274:794-802[CrossRef][Medline].
23. Spencer, T. A., D. Li, J. S. Russel, J. L. Collins, R. K. Bledsoe, T. G. Consler, L. B. Moore, C. M. Galardi, D. D. McKee, J. T. Moore, M. A. Watson, D. J. Parks, M. H. Lambert, and T. M. Willson. 2001. Pharmacophore analysis of the nuclear oxysterol receptor LXRa. J. Med. Chem. 44:886-897[CrossRef][Medline].
24. Steinberg, D. 1997. Low density lipoprotein oxidation and its pathobiological significance. J. Biol. Chem. 272:20963-20966[Free Full Text].
25. Tobin, K. A., H. H. Steineger, S. Alberti, O. Spydevold, J. Auwerx, J. A. Gustafsson, and H. I. Nebb. 2000. Cross-talk between fatty acid and cholesterol metabolism mediated by liver X receptor-alpha. Mol. Endocrinol. 14:741-752[Abstract/Free Full Text].
26. Tontonoz, P., E. Hu, and B. M. Spiegelman. 1994. Stimulation of adipogenesis in fibroblasts by PPARg2, a lipid-activated transcription factor. Cell 79:1147-1156[CrossRef][Medline].
27. Tontonoz, P., L. Nagy, J. G. Alvarez, V. A. Thomazy, and R. M. Evans. 1998. PPARgamma promotes monocyte/macrophage differentiation and uptake of oxidized LDL. Cell 93:241-252[CrossRef][Medline].
28. Venkateswaran, A., B. A. Laffitte, S. B. Joseph, P. A. Mak, D. C. Wilpitz, P. A. Edwards, and P. Tontonoz. 2000. Control of cellular cholesterol efflux by the nuclear oxysterol receptor LXRalpha. Proc. Natl. Acad. Sci. USA 97:12097-12102[Abstract/Free Full Text].
29. Venkateswaran, A., J. J. Repa, J.-M. A. Lobaccaro, A. Bronson, D. J. Mangelsdorf, and P. A. Edwards. 2000. Human white/murine ABC8 mRNA levels are highly induced in lipid-loaded macrophages. J. Biol. Chem. 275:14700-14707[Abstract/Free Full Text].
30. Willy, P. J., K. Umesono, E. S. Ong, R. M. Evans, R. A. Heyman, and D. J. Mangelsdorf. 1995. LXR, a nuclear receptor that defines a distinct retinoid response pathway. Genes Dev. 9:1033-1045[Abstract/Free Full Text].


Molecular and Cellular Biology, November 2001, p. 7558-7568, Vol. 21, No. 22
0270-7306/01/$04.00+0   DOI: 10.1128/MCB.21.22.7558-7568.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Marathe, C., Bradley, M. N., Hong, C., Chao, L., Wilpitz, D., Salazar, J., Tontonoz, P. (2009). Preserved glucose tolerance in high-fat-fed C57BL/6 mice transplanted with PPAR{gamma}-/-, PPAR{delta}-/-, PPAR{gamma}{delta}-/-, or LXR{alpha}{beta}-/- bone marrow. J. Lipid Res. 50: 214-224 [Abstract] [Full Text]  
  • Hozoji, M., Munehira, Y., Ikeda, Y., Makishima, M., Matsuo, M., Kioka, N., Ueda, K. (2008). Direct Interaction of Nuclear Liver X Receptor-{beta} with ABCA1 Modulates Cholesterol Efflux. J. Biol. Chem. 283: 30057-30063 [Abstract] [Full Text]  
  • Hoon Lee, J., Gong, H., Khadem, S., Lu, Y., Gao, X., Li, S., Zhang, J., Xie, W. (2008). Androgen Deprivation by Activating the Liver X Receptor. Endocrinology 149: 3778-3788 [Abstract] [Full Text]  
  • Stayrook, K. R., Rogers, P. M., Savkur, R. S., Wang, Y., Su, C., Varga, G., Bu, X., Wei, T., Nagpal, S., Liu, X. S., Burris, T. P. (2008). Regulation of Human 3{alpha}-Hydroxysteroid Dehydrogenase (AKR1C4) Expression by the Liver X Receptor {alpha}. Mol. Pharmacol. 73: 607-612 [Abstract] [Full Text]  
  • Herzog, B., Hallberg, M., Seth, A., Woods, A., White, R., Parker, M. G. (2007). The Nuclear Receptor Cofactor, Receptor-Interacting Protein 140, Is Required for the Regulation of Hepatic Lipid and Glucose Metabolism by Liver X Receptor. Mol. Endocrinol. 21: 2687-2697 [Abstract] [Full Text]  
  • Qiu, G., Hill, J. S. (2007). Atorvastatin decreases lipoprotein lipase and endothelial lipase expression in human THP-1 macrophages. J. Lipid Res. 48: 2112-2122 [Abstract] [Full Text]  
  • Ludtke, A., Buettner, J., Wu, W., Muchir, A., Schroeter, A., Zinn-Justin, S., Spuler, S., Schmidt, H. H.-J., Worman, H. J. (2007). Peroxisome Proliferator-Activated Receptor-{gamma} C190S Mutation Causes Partial Lipodystrophy. J. Clin. Endocrinol. Metab. 92: 2248-2255 [Abstract] [Full Text]  
  • Traves, P. G., Hortelano, S., Zeini, M., Chao, T.-H., Lam, T., Neuteboom, S. T., Theodorakis, E. A., Palladino, M. A., Castrillo, A., Bosca, L. (2007). Selective Activation of Liver X Receptors by Acanthoic Acid-Related Diterpenes. Mol. Pharmacol. 71: 1545-1553 [Abstract] [Full Text]  
  • Avallone, R., Demers, A., Rodrigue-Way, A., Bujold, K., Harb, D., Anghel, S., Wahli, W., Marleau, S., Ong, H., Tremblay, A. (2006). A Growth Hormone-Releasing Peptide that Binds Scavenger Receptor CD36 and Ghrelin Receptor Up-Regulates Sterol Transporters and Cholesterol Efflux in Macrophages through a Peroxisome Proliferator-Activated Receptor {gamma}-Dependent Pathway. Mol. Endocrinol. 20: 3165-3178 [Abstract] [Full Text]  
  • Yang, L., Chan, C.-C., Kwon, O.-S., Liu, S., McGhee, J., Stimpson, S. A., Chen, L. Z., Harrington, W. W., Symonds, W. T., Rockey, D. C. (2006). Regulation of peroxisome proliferator-activated receptor-{gamma} in liver fibrosis. Am. J. Physiol. Gastrointest. Liver Physiol. 291: G902-G911 [Abstract] [Full Text]  
  • Marathe, C., Bradley, M. N., Hong, C., Lopez, F., de Galarreta, C. M. R., Tontonoz, P., Castrillo, A. (2006). The Arginase II Gene Is an Anti-inflammatory Target of Liver X Receptor in Macrophages. J. Biol. Chem. 281: 32197-32206 [Abstract] [Full Text]  
  • Jiang, Y. J., Lu, B., Kim, P., Elias, P. M., Feingold, K. R. (2006). Regulation of ABCA1 expression in human keratinocytes and murine epidermis. J. Lipid Res. 47: 2248-2258 [Abstract] [Full Text]  
  • Quinet, E. M., Savio, D. A., Halpern, A. R., Chen, L., Schuster, G. U., Gustafsson, J.-A., Basso, M. D., Nambi, P. (2006). Liver X Receptor (LXR)-beta Regulation in LXR{alpha}-Deficient Mice: Implications for Therapeutic Targeting. Mol. Pharmacol. 70: 1340-1349 [Abstract] [Full Text]  
  • Hummasti, S., Tontonoz, P. (2006). The Peroxisome Proliferator-Activated Receptor N-Terminal Domain Controls Isotype-Selective Gene Expression and Adipogenesis. Mol. Endocrinol. 20: 1261-1275 [Abstract] [Full Text]  
  • Desvergne, B., Michalik, L., Wahli, W. (2006). Transcriptional Regulation of Metabolism. Physiol. Rev. 86: 465-514 [Abstract] [Full Text]  
  • Lee, C.-H., Plutzky, J. (2006). Liver X Receptor Activation and High-Density Lipoprotein Biology: A Reversal of Fortune?. Circulation 113: 5-8 [Full Text]  
  • Chen, M., Beaven, S., Tontonoz, P. (2005). Identification and characterization of two alternatively spliced transcript variants of human liver X receptor alpha. J. Lipid Res. 46: 2570-2579 [Abstract] [Full Text]  
  • Cheema, S. K., Agarwal-Mawal, A., Murray, C. M., Tucker, S. (2005). Lack of stimulation of cholesteryl ester transfer protein by cholesterol in the presence of a high-fat diet. J. Lipid Res. 46: 2356-2366 [Abstract] [Full Text]  
  • Oram, J. F., Heinecke, J. W. (2005). ATP-Binding Cassette Transporter A1: A Cell Cholesterol Exporter That Protects Against Cardiovascular Disease. Physiol. Rev. 85: 1343-1372 [Abstract] [Full Text]  
  • Lee, F. Y., Kast-Woelbern, H. R., Chang, J., Luo, G., Jones, S. A., Fishbein, M. C., Edwards, P. A. (2005). {alpha}-Crystallin Is a Target Gene of the Farnesoid X-activated Receptor in Human Livers. J. Biol. Chem. 280: 31792-31800 [Abstract] [Full Text]  
  • Soumian, S, Albrecht, C, Davies, A., Gibbs, R. (2005). ABCA1 and atherosclerosis. Vasc Med 10: 109-119 [Abstract]  
  • She, H., Xiong, S., Hazra, S., Tsukamoto, H. (2005). Adipogenic Transcriptional Regulation of Hepatic Stellate Cells. J. Biol. Chem. 280: 4959-4967 [Abstract] [Full Text]  
  • Davies, J. D., Carpenter, K. L. H., Challis, I. R., Figg, N. L., McNair, R., Proudfoot, D., Weissberg, P. L., Shanahan, C. M. (2005). Adipocytic Differentiation and Liver X Receptor Pathways Regulate the Accumulation of Triacylglycerols in Human Vascular Smooth Muscle Cells. J. Biol. Chem. 280: 3911-3919 [Abstract] [Full Text]  
  • Sheth, S. S., Castellani, L. W., Chari, S., Wagg, C., Thipphavong, C. K., Bodnar, J. S., Tontonoz, P., Attie, A. D., Lopaschuk, G. D., Lusis, A. J. (2005). Thioredoxin-interacting protein deficiency disrupts the fasting-feeding metabolic transition. J. Lipid Res. 46: 123-134 [Abstract] [Full Text]  
  • Blaschke, F., Leppanen, O., Takata, Y., Caglayan, E., Liu, J., Fishbein, M. C., Kappert, K., Nakayama, K. I., Collins, A. R., Fleck, E., Hsueh, W. A., Law, R. E., Bruemmer, D. (2004). Liver X Receptor Agonists Suppress Vascular Smooth Muscle Cell Proliferation and Inhibit Neointima Formation in Balloon-Injured Rat Carotid Arteries. Circ. Res. 95: e110-e123 [Abstract] [Full Text]  
  • Li, A. C., Glass, C. K. (2004). PPAR- and LXR-dependent pathways controlling lipid metabolism and the development of atherosclerosis. J. Lipid Res. 45: 2161-2173 [Abstract] [Full Text]  
  • Kawai, K., Sasaki, S., Morita, H., Ito, T., Suzuki, S., Misawa, H., Nakamura, H. (2004). Unliganded Thyroid Hormone Receptor-{beta}1 Represses Liver X Receptor {alpha}/Oxysterol-Dependent Transactivation. Endocrinology 145: 5515-5524 [Abstract] [Full Text]  
  • Anderson, S. P., Dunn, C., Laughter, A., Yoon, L., Swanson, C., Stulnig, T. M., Steffensen, K. R., Chandraratna, R. A.S., Gustafsson, J.-A., Corton, J. C. (2004). Overlapping Transcriptional Programs Regulated by the Nuclear Receptors Peroxisome Proliferator-Activated Receptor {alpha}, Retinoid X Receptor, and Liver X Receptor in Mouse Liver. Mol. Pharmacol. 66: 1440-1452 [Abstract] [Full Text]  
  • Wong, J., Quinn, C. M., Brown, A. J. (2004). Statins Inhibit Synthesis of an Oxysterol Ligand for the Liver X Receptor in Human Macrophages With Consequences for Cholesterol Flux. Arterioscler. Thromb. Vasc. Bio. 24: 2365-2371 [Abstract] [Full Text]  
  • Albrecht, C., Soumian, S., Amey, J.S., Sardini, A., Higgins, C.F., Davies, A.H., Gibbs, R.G.J. (2004). ABCA1 Expression in Carotid Atherosclerotic Plaques. Stroke 35: 2801-2806 [Abstract] [Full Text]  
  • Yue, L., Rasouli, N., Ranganathan, G., Kern, P. A., Mazzone, T. (2004). Divergent Effects of Peroxisome Proliferator-activated Receptor {gamma} Agonists and Tumor Necrosis Factor {alpha} on Adipocyte ApoE Expression. J. Biol. Chem. 279: 47626-47632 [Abstract] [Full Text]  
  • Ulven, S. M., Dalen, K. T., Gustafsson, J.-A., Nebb, H. I. (2004). Tissue-specific autoregulation of the LXR{alpha} gene facilitates induction of apoE in mouse adipose tissue. J. Lipid Res. 45: 2052-2062 [Abstract] [Full Text]  
  • Kino, T., Chrousos, G. P. (2004). Combating Atherosclerosis With LXR{alpha} And PPAR{alpha} Agonists: Is Rational Multitargeted Polypharmacy the Future of Therapeutics in Complex Diseases?. Mol. Interv. 4: 254-257 [Abstract] [Full Text]  
  • Quinet, E. M., Savio, D. A., Halpern, A. R., Chen, L., Miller, C. P., Nambi, P. (2004). Gene-selective modulation by a synthetic oxysterol ligand of the liver X receptor. J. Lipid Res. 45: 1929-1942 [Abstract] [Full Text]  
  • Szanto, A., Benko, S., Szatmari, I., Balint, B. L., Furtos, I., Ruhl, R., Molnar, S., Csiba, L., Garuti, R., Calandra, S., Larsson, H., Diczfalusy, U., Nagy, L. (2004). Transcriptional Regulation of Human CYP27 Integrates Retinoid, Peroxisome Proliferator-Activated Receptor, and Liver X Receptor Signaling in Macrophages. Mol. Cell. Biol. 24: 8154-8166 [Abstract] [Full Text]  
  • Hummasti, S., Laffitte, B. A., Watson, M. A., Galardi, C., Chao, L. C., Ramamurthy, L., Moore, J. T., Tontonoz, P. (2004). Liver X receptors are regulators of adipocyte gene expression but not differentiation: identification of apoD as a direct target. J. Lipid Res. 45: 616-625 [Abstract] [Full Text]  
  • Dalen, K. T., Ulven, S. M., Bamberg, K., Gustafsson, J.-A., Nebb, H. I. (2003). Expression of the Insulin-responsive Glucose Transporter GLUT4 in Adipocytes Is Dependent on Liver X Receptor {alpha}. J. Biol. Chem. 278: 48283-48291 [Abstract] [Full Text]  
  • Chisholm, J. W., Hong, J., Mills, S. A., Lawn, R. M. (2003). The LXR ligand T0901317 induces severe lipogenesis in the db/db diabetic mouse. J. Lipid Res. 44: 2039-2048 [Abstract] [Full Text]  
  • Lund, E. G., Menke, J. G., Sparrow, C. P. (2003). Liver X Receptor Agonists as Potential Therapeutic Agents for Dyslipidemia and Atherosclerosis. Arterioscler. Thromb. Vasc. Bio. 23: 1169-1177 [Abstract] [Full Text]  
  • Francis, G. A., Annicotte, J.-S., Auwerx, J. (2003). PPAR-{alpha} effects on the heart and other vascular tissues. Am. J. Physiol. Heart Circ. Physiol. 285: H1-H9 [Abstract] [Full Text]  
  • Tontonoz, P., Mangelsdorf, D. J. (2003). Liver X Receptor Signaling Pathways in Cardiovascular Disease. Mol. Endocrinol. 17: 985-993 [Abstract] [Full Text]  
  • Oram, J. F. (2003). HDL Apolipoproteins and ABCA1: Partners in the Removal of Excess Cellular Cholesterol. Arterioscler. Thromb. Vasc. Bio. 23: 720-727 [Abstract] [Full Text]  
  • Laffitte, B. A., Chao, L. C., Li, J., Walczak, R., Hummasti, S., Joseph, S. B., Castrillo, A., Wilpitz, D. C., Mangelsdorf, D. J., Collins, J. L., Saez, E., Tontonoz, P. (2003). Activation of liver X receptor improves glucose tolerance through coordinate regulation of glucose metabolism in liver and adipose tissue. Proc. Natl. Acad. Sci. USA 100: 5419-5424 [Abstract] [Full Text]  
  • Han, S.-R., Momeni, A., Strach, K., Suriyaphol, P., Fenske, D., Paprotka, K., Hashimoto, S. I., Torzewski, M., Bhakdi, S., Husmann, M. (2003). Enzymatically Modified LDL Induces Cathepsin H in Human Monocytes: Potential Relevance in Early Atherogenesis. Arterioscler. Thromb. Vasc. Bio. 23: 661-667 [Abstract] [Full Text]  
  • Castrillo, A., Joseph, S. B., Marathe, C., Mangelsdorf, D. J., Tontonoz, P. (2003). Liver X Receptor-dependent Repression of Matrix Metalloproteinase-9 Expression in Macrophages. J. Biol. Chem. 278: 10443-10449 [Abstract] [Full Text]  
  • Juvet, L. K., Andresen, S. M., Schuster, G. U., Dalen, K. T., Tobin, K. A. R., Hollung, K., Haugen, F., Jacinto, S., Ulven, S. M., Bamberg, K., Gustafsson, J.-A., Nebb, H. I. (2003). On the Role of Liver X Receptors in Lipid Accumulation in Adipocytes. Mol. Endocrinol. 17: 172-182 [Abstract] [Full Text]  
  • Zhang, Y., Kast-Woelbern, H. R., Edwards, P. A. (2003). Natural Structural Variants of the Nuclear Receptor Farnesoid X Receptor Affect Transcriptional Activation. J. Biol. Chem. 278: 104-110 [Abstract] [Full Text]  
  • Stulnig, T. M., Steffensen, K. R., Gao, H., Reimers, M., Dahlman-Wright, K., Schuster, G. U., Gustafsson, J.-A. (2002). Novel Roles of Liver X Receptors Exposed by Gene Expression Profiling in Liver and Adipose Tissue. Mol. Pharmacol. 62: 1299-1305 [Abstract] [Full Text]  
  • Muscat, G. E. O., Wagner, B. L., Hou, J., Tangirala, R. K., Bischoff, E. D., Rohde, P., Petrowski, M., Li, J., Shao, G., Macondray, G., Schulman, I. G. (2002). Regulation of Cholesterol Homeostasis and Lipid Metabolism in Skeletal Muscle by Liver X Receptors. J. Biol. Chem. 277: 40722-40728 [Abstract] [Full Text]  
  • Wang, L., Schuster, G. U., Hultenby, K., Zhang, Q., Andersson, S., Gustafsson, J.-A. (2002). Liver X receptors in the central nervous system: From lipid homeostasis to neuronal degeneration. Proc. Natl. Acad. Sci. USA 99: 13878-13883 [Abstract] [Full Text]  
  • Brown, B. G., Cheung, M. C., Lee, A. C., Zhao, X.-Q., Chait, A. (2002). Antioxidant Vitamins and Lipid Therapy: End of a Long Romance?. Arterioscler. Thromb. Vasc. Bio. 22: 1535-1546 [Abstract] [Full Text]  
  • Chiang, J. Y. L. (2002). Bile Acid Regulation of Gene Expression: Roles of Nuclear Hormone Receptors. Endocr. Rev. 23: 443-463 [Abstract] [Full Text]  
  • Whitney, K. D., Watson, M. A., Collins, J. L., Benson, W. G., Stone, T. M., Numerick, M. J., Tippin, T. K., Wilson, J. G., Winegar, D. A., Kliewer, S. A. (2002). Regulation of Cholesterol Homeostasis by the Liver X Receptors in the Central Nervous System. Mol. Endocrinol. 16: 1378-1385 [Abstract] [Full Text]  
  • Joseph, S. B., McKilligin, E., Pei, L., Watson, M. A., Collins, A. R., Laffitte, B. A., Chen, M., Noh, G., Goodman, J., Hagger, G. N., Tran, J., Tippin, T. K., Wang, X., Lusis, A. J., Hsueh, W. A., Law, R. E., Collins, J. L., Willson, T. M., Tontonoz, P. (2002). Synthetic LXR ligand inhibits the development of atherosclerosis in mice. Proc. Natl. Acad. Sci. USA 99: 7604-7609 [Abstract] [Full Text]  
  • Zhang, Y., Mangelsdorf, D. J. (2002). LuXuRies of Lipid Homeostasis: The Unity of Nuclear Hormone Receptors, Transcription Regulation, and Cholesterol Sensing. Mol. Interv. 2: 78-87 [Abstract] [Full Text]  
  • Walczak, R., Tontonoz, P. (2002). PPARadigms and PPARadoxes: expanding roles for PPAR{gamma} in the control of lipid metabolism. J. Lipid Res. 43: 177-186 [Abstract] [Full Text]  
  • Edwards, P. A., Kast, H. R., Anisfeld, A. M. (2002). BAREing it all: the adoption of LXR and FXR and their roles in lipid homeostasis. J. Lipid Res. 43: 2-12 [Abstract] [Full Text]  
  • Whitney, K. D., Watson, M. A., Goodwin, B., Galardi, C. M., Maglich, J. M., Wilson, J. G., Willson, T. M., Collins, J. L., Kliewer, S. A. (2001). Liver X Receptor (LXR) Regulation of the LXRalpha Gene in Human Macrophages. J. Biol. Chem. 276: 43509-43515 [Abstract] [Full Text]  
  • Zaghini, I., Landrier, J.-F., Grober, J., Krief, S., Jones, S. A., Monnot, M.-C., Lefrere, I., Watson, M. A., Collins, J. L., Fujii, H., Besnard, P. (2002). Sterol Regulatory Element-binding Protein-1c Is Responsible for Cholesterol Regulation of Ileal Bile Acid-binding Protein Gene in Vivo. POSSIBLE INVOLVEMENT OF LIVER-X-RECEPTOR. J. Biol. Chem. 277: 1324-1331 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Laffitte, B. A.
Right arrow Articles by Tontonoz, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Laffitte, B. A.
Right arrow Articles by Tontonoz, P.