Previous Article | Next Article 
Molecular and Cellular Biology, November 2001, p. 7569-7575, Vol. 21, No. 22
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.22.7569-7575.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Hsp104 Interacts with Hsp90 Cochaperones
in Respiring Yeast
Toufik
Abbas-Terki,
Olivier
Donzé,
Pierre-André
Briand, and
Didier
Picard*
Département de Biologie Cellulaire,
Université de Genève, Sciences III, CH-1211 Geneva 4, Switzerland
Received 2 July 2001/Returned for modification 3 August
2001/Accepted 13 August 2001
 |
ABSTRACT |
The highly abundant molecular chaperone Hsp90 functions
with assistance from auxiliary factors, collectively referred to as Hsp90 cochaperones, and the Hsp70 system. Hsp104, a molecular chaperone
required for stress tolerance and for maintenance of [psi+] prions in the budding yeast
Saccharomyces cerevisiae, appears to collaborate only
with the Hsp70 system. We now report that several cochaperones
previously thought to be dedicated to Hsp90 are shared with Hsp104. We
show that the Hsp90 cochaperones Sti1, Cpr7, and Cns1, which utilize
tetratricopeptide repeat (TPR) domains to interact with a common
surface on Hsp90, form complexes with Hsp104 in vivo and that Sti1 and
Cpr7 interact with Hsp104 directly in vitro. The interaction is Hsp90
independent, as further emphasized by the fact that two distinct TPR
domains of Sti1 are required for binding Hsp90 and Hsp104. In a
striking parallel to the sequence requirements of Hsp90 for binding TPR
proteins, binding of Sti1 to Hsp104 requires a related acidic sequence
at the C-terminal tail of Hsp104. While Hsp90 efficiently sequesters
the cochaperones during fermentative growth, respiratory conditions
induce the interaction of a fraction of Hsp90 cochaperones with Hsp104.
This suggests that cochaperone sharing may favor adaptation to altered metabolic conditions.
| |
INTRODUCTION |
The molecular chaperone Hsp90 is a
highly conserved and abundant protein that has been shown to be
essential in both multicellular organisms and yeasts (6, 7,
36). In the budding yeast Saccharomyces cerevisiae,
at least one of the two almost identical Hsp90 isoforms, Hsc82 and
Hsp82, has to be maintained for viability (4).
Hsp90 fulfills its functions with a cohort of Hsp90 cochaperones, which
are thought to modulate its substrate recognition and binding and its
functions (reviewed in references 6, 7, 12, and
36). The Hsp90 cochaperones Sti1 (the yeast homolog of
mammalian Hop), Cpr6 and Cpr7 (yeast cyclophilin-40), and Cns1 contain
tetratricopeptide repeats (TPR) mediating binding to a common surface
on Hsp90 encompassing a highly conserved C-terminal peptide sequence
(see references 23 and 41 and references therein), and participate in complexes with many and perhaps most Hsp90
substrates. A subset of Hsp90 cochaperones, notably Cpr6 and Cpr7,
Cdc37, and Sba1 (yeast homolog of mammalian p23), have chaperone
activity on their own (5, 22, 26, 31, 37, 46), but it is
not clear to what extent they interact directly with proteins other
than molecular chaperones. Surprisingly, the Hsp90 cochaperones Sti1,
Cpr6 and Cpr7, and Sba1 have proven to be dispensable for vegetative
growth of S. cerevisiae under standard growth conditions
(3, 14, 19, 20, 34, 45), although 
cpr7 cells
display a slow-growth phenotype (14, 19), and Sti1 and
Sba1 are essential during amino acid starvation (17).
Hsp104 is a molecular chaperone of the Hsp100/Clp family (for a review,
see reference 42). While Hsp104 is dispensable for growth
of S. cerevisiae at moderate temperatures, it is the key factor conferring stress-induced tolerance to extreme temperatures (28, 38) by promoting the resolubilization of protein
aggregates (24, 35). Interestingly, through this
function, Hsp104 controls the aggregation state of the
Sup35-based [psi+] prion-like factor.
Overexpression of Hsp104 results in the solubilization of these
particles and cures yeast of these prions; deletion of the
HSP104 gene has the same effect, perhaps because oversized particles get lost during mitosis (reviewed in reference
43). Thus, normal levels of Hsp104 are required for
maintenance of the [psi+]
(11) and other prions (33).
Hsp104 associates with the Hsp40-type molecular chaperone Ydj1
(24), a component of the Hsp70 chaperone system, with
which Hsp104 also interacts genetically (39). Together
these chaperones constitute a rescue team for aggregated proteins
(24). Apart from substrate proteins, Ydj1 is the only
known protein that interacts with Hsp104. In searching for proteins
that interact with the TPR-containing Hsp90 cochaperones, we have
discovered a novel chaperone network. Under certain circumstances,
Hsp90 cochaperones associate with Hsp104.
| |
MATERIALS AND METHODS |
Plasmids.
Glutathione S-transferase (GST) and GST
fused to Cpr7 were expressed constitutively in yeast from the
glyceraldehyde-3-phosphate dehydrogenase promoter with plasmids
p2U/GST-2 (45) and p2U/GST.Cpr7, respectively. The latter
was constructed by inserting the PCR-generated Cpr7 open reading frame
into p2U/GST-2. Plasmid pGEX/CPR7 was constructed similarly with vector
pGEX-1 (Pharmacia). Plasmids pYesF/Cns1, pYesF/Hsp104,
pYesF/Hsp104C2, pYesF/Sti1, pYesF/Sti1(TPR1), and pYesF/Sti1(TPR2AB)
contain the coding sequences for Cns1, Hsp104, Hsp104 lacking the
C-terminal 8 amino acids, Sti1, Sti1 amino acids 1 to 200, and Sti1
amino acids 201 to 589 in the vector pYES/Flag, respectively. The last
allows galactose-inducible expression of Flag-tagged proteins in yeast
and was constructed by inserting the sequence
GAGCTCAAAGCATGGACTACAAGGACGACGATGACAAGGGGATCC between the
SacI and BamHI sites of plasmid pYES2.0 (Invitrogen).
For expression of His6-tagged proteins in
Escherichia coli, Hsp104, Hsp104C, and Sti1 coding
sequences were inserted into plasmid pTrcHis C (Invitrogen) to yield
constructs pTrcHis/Hsp104, pTrcHis/Hsp104C2, and pTrcHis/Sti1,
respectively; coding sequences for full-length Hsp82 and Hsp82 codons 1 to 704 were inserted into plasmids pET15b (Novagen) and pTrcHis B
(Invitrogen) to yield vectors pET15b/His.Hsp82 and pTrcHisB/Hsp82C, respectively.
Yeast strains and media.
As the wild-type strain we used
RMY326 (MATa his3 leu2-3,112 trp1-1
ura3-52) except for experiments with GST.Cpr7, when it was BJ2168
(MATa leu2 pep4-3 prc1-407 prb1-1122 trp1
ura3-52). Strains HH1a-p2HG/Hsp82 and HH1a-p2HG/Hsp82(1-704) have
been described (29). Yeast cells were either grown
directly in YEP or, in the case of transformants with
episomes, precultured in selective minimal medium and then
switched to YEP for overnight incubation. Unless indicated,
2% glucose was used as the carbon source.
Antibodies and recombinant proteins.
The following primary
antibodies were used: rabbit polyclonal antisera against Hsp104 (a gift
from S. Lindquist and antiserum PA3-016 from Affinity BioReagents) and
GST, and mouse monoclonal antibodies against the Flag (antibody M2 from
Sigma) and His6 (antibody His-1 from Sigma) tags
and against Sti1 (antibody Sti2; a gift from D. O. Toft).
Recombinant proteins were expressed in E. coli and purified
on glutathione-Sepharose (Pharmacia) or Ni-nitrilotriacetic acid-agarose (Qiagen) as directed by the manufacturer.
GST pull-down and immunoprecipitation experiments.
Transformants, induced with galactose by overnight incubation when
appropriate, were grown at 30°C to low or high culture density
corresponding to an optical density at 600 nm
(OD600) of 0.5 and 20, respectively. Cells were
washed once with TEG (25 mM Tris-HCl [pH 7.4], 15 mM EGTA, 10%
glycerol, 1 mM dithiothreitol, yeast protease inhibitor cocktail
[Sigma]) containing 150 mM NaCl. Cell pellets were then resuspended
in a small volume of the same buffer and broken with glass beads by two
30-s pulses at maximum speed in a Mini-BeadBeater-8 (Biospec,
Bartlesville, N.C.) at 4°C. After centrifugation at 15,000 rpm
in a tabletop centrifuge at 4°C, the supernatant was
quantitated and adjusted to 0.1% Triton X-100.
GST pull-down experiments with extracts were done as described
(
1). For immunoprecipitations, 3 mg of total cell extracts
was incubated with the anti-Sti1 antibody for 2 h at 4°C with
tumbling. Then protein G-Sepharose (Pharmacia) was added for an
additional hour. In the case of Flag-tagged proteins, the
immunoprecipitation
was performed with the anti-Flag monoclonal
antibody or by directly
adding the M2 anti-Flag resin
(Sigma).
Immunoprecipitation experiments with purified recombinant proteins were
done at 4°C as follows. The anti-Sti1 antibody was
bound to protein
G-Sepharose in phosphate-buffered saline (PBS)
for 90 min and washed
several times with PBS containing 0.1% Triton
X-100; 2 µg of
purified Sti1 per sample was then added in PBS-0.1%
Triton X-100 and
tumbled for 2 h before addition of 2 µg of purified
Hsp104,
Hsp104
C, or Hsp82 and tumbling for an additional 2 h;
following
three washes with the same buffer, proteins were solubilized
by boiling
in sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE)
sample buffer. GST pull-down experiments with purified
proteins were
done similarly with 1 µg of protein; test proteins
were added to
glutathione-Sepharose-bound GST
proteins.
Gel staining and immunoblot experiments.
Silver staining of
SDS-PAGE gels was done according to published procedures (2,
44). For identification of new protein bands, SDS-PAGE gels were
stained with Coomassie blue, and bands of interest were excised,
digested in-gel with trypsin, and subjected to mass spectrometric
analysis. Immunoblotting was done as described (1).
| |
RESULTS |
Hsp104 associates with Cpr7, Cns1, and Sti1.
To identify new
interaction partners of Cpr7 in particular and of Hsp90-interacting TPR
proteins in general, we did a binding experiment with recombinant Cpr7.
Cpr7, produced in bacteria as a GST fusion protein, was bound to
glutathione beads and incubated with a whole-cell extract of a
wild-type S. cerevisiae strain. The silver-stained gel
displayed in Fig. 1A reveals
three prominent proteins that are specifically
retained by GST.Cpr7 and not by GST alone. As expected
(18), the doublet above GST.Cpr7 corresponds to the two
Hsp90 isoforms Hsp82 and Hsc82. The slower migrating third band was
excised from a separate gel and subjected to sequence analysis by mass
spectrometry. Several peptides identified this protein unambiguously as
Hsp104 (data not shown).
View larger version (30K):
[in this window]
[in a new window]
|
FIG. 1.
Hsp104 forms complexes with Cpr7 and Cns1. (A)
Recombinant GST.Cpr7 retains Hsp104 from a total yeast extract. GST or
GST.Cpr7 purified from bacteria (4 µg) was bound to beads and
incubated with 3 mg of yeast extract. Arrows on the right of the
silver-stained SDS-PAGE gel point to identified bands. (B) GST.Cpr7
expressed in yeast pulls down Hsp104. The upper panel represents the
Ponceau red-stained nitrocellulose filter of the anti-Hsp104 immunoblot
in the lower panel. Lane M, molecular size marker proteins. (C)
Flag-tagged Cns1 coprecipitates with Hsp104. Cells were grown either
with glucose ( ; no expression of Flag.Cns1) or in galactose (+;
induced expression). Following immunoprecipitation (IP) with an
anti- Flag antibody, Flag.Cns1 and endogenous Hsp104 were revealed
by immunoblotting with anti-Flag and anti-Hsp104 antibodies,
respectively. Input designates a small aliquot of the extract prior to
immunoprecipitation.
|
|
To establish that Cpr7-Hsp104 complexes also exist in vivo, GST.Cpr7
was expressed in yeast. The GST pull-down experiment
in Fig.
1B
demonstrates that the same proteins copurify with GST.Cpr7
expressed in
vivo. The specificity of the association of Hsp104
with GST.Cpr7 and
not GST was confirmed by immunoblotting with
a polyclonal anti-Hsp104
antiserum.
Cns1 is a TPR-containing protein that has been shown to interact with
both Hsp90 and Cpr7 (
15,
30). We expressed it with
an
N-terminal Flag epitope. As shown in Fig.
1C, an anti-Flag
antibody
specifically coprecipitates Hsp104 with the epitope-tagged
Cns1.
To facilitate the analysis of endogenous complexes, we switched to
Sti1, an abundant TPR-containing Hsp90 cochaperone. Endogenous
Hsp104
is coimmunoprecipitated with endogenous Sti1 (Fig.
2A;
see also below). Although it is
difficult to quantitate immunoprecipitation
experiments, it is evident
that only a fraction of both molecules
copurify.
View larger version (38K):
[in this window]
[in a new window]
|
FIG. 2.
Hsp104 associates with endogenous Sti1 and exogenous
GST.Cpr7 at high culture density. (A) Endogenous Sti1 is associated
with endogenous Hsp104 at high (H) but not at low (L) cell culture
density. Immunoprecipitation (IP) experiment with an antibody against
Sti1 (anti-Sti1). IgH, antibody heavy-chain band. (B) GST.Cpr7
expressed in yeast is associated with Hsp104 at high density. GST
pull-down experiment as in Fig. 1B. The upper panels represent the
Ponceau red-stained nitrocellulose filters of the anti-Hsp104
immunoblots in the lower panels.
|
|
Interactions of Hsp104 with Sti1 and Cpr7 are regulated.
In
the course of our experiments, we noticed that the abundance of Hsp104
complexes can be modulated. Figure 2 demonstrates that the association
of endogenous Hsp104 with endogenous Sti1 and with GST.Cpr7 depends on
cell culture density. The association is undetectable at low density
(lanes L), whereas high-density culture conditions appear to induce it
(lanes H). Although Hsp104 expression itself is increased as cells
reach stationary phase, this increase is far too small to account for
the marked difference in copurification (for example, compare lanes in
the bottom panel of Fig. 2A).
Since both Hsp90 and Hsp104 copurify with Sti1 and GST.Cpr7, we
examined whether the association of Hsp104 with Sti1 and Cpr7
is
influenced by Hsp90. The interaction of Hsp90 with Sti1 and
Cpr7
depends on their TPR domains (
9,
18,
27) and the
C-terminal
pentapeptide MEEVD of Hsp90 (
41). We therefore
took advantage
of a truncation mutant lacking this pentapeptide,
which we have
previously shown to complement an
hsp90
deletion strain without
an obvious phenotype (
29).
Our coprecipitation experiments with endogenous Sti1 and GST.Cpr7
expressed in a strain containing only a truncated version
of Hsp82,
lacking this pentapeptide (mutant 1-704), confirms the
importance of
the C-terminal pentapeptide for the Sti1-Hsp90 and
Cpr7-Hsp90
interactions (Fig.
3, top panels).
Remarkably, the
immunoblots (Fig.
3, bottom panels) reveal that Hsp104
is associated
with Sti1 and GST.Cpr7 even when these TPR proteins are
unable
to interact with Hsp90, as in the case of the 1-704 mutant
(lanes
704). These data strongly argue that the interaction of Sti1 and
Cpr7 with Hsp104 is not mediated by Hsp90. It is noteworthy that
this
experiment was performed with a low-density culture, and
hence, Hsp104
was not expected to be pulled down by GST.Cpr7 in
a strain with
wild-type Hsp82. Yet even under those conditions
Hsp104 is complexed
with Sti1 and GST.Cpr7 when the interaction
of Hsp90 with TPR proteins
is weakened by truncation. This suggests
that the binding to Hsp90 may
be dominant and exclude Hsp104 unless
some metabolic changes associated
with high cell density elicit
a switch of a fraction of Sti1 and Cpr7
molecules from Hsp90 to
Hsp104.
View larger version (39K):
[in this window]
[in a new window]
|
FIG. 3.
Hsp90 and Hsp104 compete for interaction with Sti1 and
Cpr7 in vivo. The association of Hsp104 with endogenous Sti1 (A) and
GST.Cpr7 (B) is favored in a strain with an Hsp82 variant lacking the
C-terminal pentapeptide that mediates interaction with TPR proteins.
Extracts were prepared from cells grown to low density. wt and 704, strains HH1a-p2HG/Hsp82 and HH1a-p2HG/Hsp82(1-704), with wild-type
Hsp82 and mutant Hsp82 lacking amino acids 705 to 709, respectively. In
panel A, Hsp104 was expressed with a Flag epitope and revealed by
immunoblotting with an anti-Flag antibody. Note that Flag.Hsp104
complements a hsp104 strain (data not shown). The
upper panel in A represents the Ponceau red-stained nitrocellulose
filter of the anti-Flag immunoblot in the lower panel.
|
|
Interaction domains of Sti1.
TPR clusters 1 and 2 of the
mammalian Sti1 homolog Hop have been shown to be required for
differential binding to Hsp70 and Hsp90, respectively (9, 27,
41). To determine the Hsp104 binding domain of Sti1, we
expressed the protein in two moieties (Fig.
4A) in yeast and performed
immunoprecipitation experiments. As a control for this experiment,
full-length Sti1 was also expressed with the Flag epitope. Figure 4B
reveals that Hsp104 binds the N-terminal moiety encompassing TPR domain
1 (TPR1) and thus shares the interaction domain with Hsp70. Hsp90
binding requires the second TPR domain (TRP2A/B), and C-terminal
truncation of Hsp90 [Hsp82(1-704)] all but abolishes this
interaction. This truncation has no effect on the constitutive
interaction of Hsp104 with the TPR1-containing moiety (lanes T1),
whereas it favors the interaction with full-length Sti1 (lanes FL).
These data prove that Sti1 uses different surfaces to interact with
Hsp90 and Hsp104 and that its interaction with Hsp104 is not mediated
by Hsp90.
View larger version (39K):
[in this window]
[in a new window]
|
FIG. 4.
Hsp104 and Hsp90 associate with different domains of
Sti1. (A) Schematic representation of the domain structure of Sti1 and
of the galactose-inducible Flag-tagged derivatives used in the
experiment in panel B. TPR clusters and the DP domain are
indicated. The latter comprises the C-terminal sequences DPEV and DPVM
and contributes with TPR1 to Hsp70 binding (10). The Flag
epitope is represented by the black boxes. (B) Hsp104 and Hsp90 binding
to Sti1 requires TPR1 and TPR2, respectively. Hsp82 wt and
Hsp82(1-704), strains with wild-type Hsp82 and the C-terminal
truncation mutant lacking the last five amino acids, respectively. The
black arrowheads indicate the bands corresponding to T1, T2, and FL.
Note that cells were grown to high density to favor interaction between
Sti1 and Hsp104. IgL, antibody light-chain band.
|
|
Interaction of Hsp104 with Sti1 is direct and dependent on
its C-terminal tail.
We assessed the interaction between
Hsp104 and the TPR protein Sti1 using recombinant protein
purified from E. coli. Sti1 was mixed with Hsp104 and
subjected to an immunoprecipitation experiment with the anti-Sti1
antibody (Fig. 5B). Hsp104 only coprecipitates with the anti-Sti1 antibody in the presence of Sti1, and
thus, Sti1 and Hsp104 interact directly.
View larger version (20K):
[in this window]
[in a new window]
|
FIG. 5.
Interaction of Hsp104 with Sti1 and Cpr7 is direct. (A)
Schematic representation of the very C-terminal sequences of Hsp104 and
Hsp82 and their corresponding truncation mutants. *, C-terminal end.
(B) In vitro interaction of purified Hsp104 and Sti1, dependent on
C-terminal tail of Hsp104; 0.2 µg of input proteins was loaded for
comparison. Note that there is unequal recognition of different
His6-tagged proteins by the anti-His6 antibody.
(C) Direct interaction of Hsp104 with Cpr7 fused to GST and competition
by Hsp90 (Hsp82). The immunoblot of the upper panel represents aliquots
of the input proteins prior to the GST pull-down. The Ponceau
red-stained filter shows that equivalent amounts of GST.Cpr7 and GST
were pulled down (data not shown).
|
|
The very C-terminal sequence of Hsp104 displays a striking sequence
similarity to that of Hsp82, which is essential for the
interaction
with TPR proteins (Fig.
5A). We therefore produced
a truncated version
of Hsp104, denoted Hsp104
C, lacking the last
8 amino acids. Unlike
the wild-type protein, Hsp104
C is defective
for interaction with
Sti1 both in vitro (Fig.
5B) and in vivo
(data not
shown).
Hsp104 and Hsp90 compete for direct interaction with Cpr7.
To
extend the in vitro analysis to a protein that has only one TPR
cluster, we mixed recombinant purified GST.Cpr7 with Hsp104 and
performed a GST pull-down experiment (Fig. 5C). A fraction of Hsp104
copurifies with GST.Cpr7 but not with GST alone. Thus, this interaction
is also direct. Moreover, purified Hsp82 efficiently competes with
Hsp104 for binding to GST.Cpr7, whereas the C-terminally truncated
Hsp82(1-704), which is unable to bind TPR proteins, does not. These
results further support the notion that binding of Cpr7 to these two
molecular chaperones is mutually exclusive.
Association of Sti1 with Hsp104 is induced by respiratory growth
conditions.
To begin to understand the nature of the metabolic
conditions that promote the association of Hsp90 cochaperones with
Hsp104, we examined the dependence on culture density and on carbon
source more carefully. Extracts were made from cells grown to different densities. Endogenous protein complexes were immunoprecipitated with a
monoclonal antibody against Sti1 and displayed by Coomassie blue
staining of an SDS-PAGE gel and by immunoblotting with the anti-Hsp104
antiserum (Fig. 6A). Equal gel loading
and Sti1 immunoprecipitation are apparent from the stained gel. Almost
stoichiometric amounts of Hsp90 remain associated with Sti1 throughout
exponential growth. In contrast, Sti1-associated Hsp104 only becomes
detectable above a certain density and keeps increasing thereafter.
View larger version (38K):
[in this window]
[in a new window]
|
FIG. 6.
Respiratory growth conditions induce the association of
Hsp104 with Sti1. (A) Increasing cell density coinciding with a switch
to respiration induces the association. Immunoprecipitation (IP)
experiment assessing coprecipitation of endogenous proteins with
endogenous Sti1. Note that the total amounts of coprecipitated Sti1,
Hsp90 (Hsc82/Hsp82), and Hsp70 (Ssa protein family) do not change
significantly. OD600, optical density as a measure of cell
density. The levels of Hsp104 in the input extracts can be seen in Fig.
2, where low and high culture densities correspond to an
OD600 of 0.4 to 0.5 and 20, respectively. (B)
Nonfermentable carbon sources (ethanol and glycerol) induce the
association of Sti1 with Hsp104. A representative immunoblot experiment
is shown.
|
|
This pattern suggested that the "switch" may be related to the
diauxic shift of yeast cells progressing from a fermentative
to a
respiratory growth mode. Due to the progressive depletion
of glucose
prior to this shift, yeast cells switch from fermenting
glucose as a
carbon source to a respiratory utilization of its
accumulated
metabolite ethanol. Indeed, when cells are grown directly
on
nonfermentable carbon sources such as ethanol and glycerol,
Hsp104 is
associated with Sti1 even at low cell density (Fig.
6B), whereas the
fermentable sugar galactose gives the same result
as glucose (data not
shown). Thus, in the presence of wild-type
Hsp90, reduced
concentrations of fermentable sugar and/or respiration,
not high cell
density per se, induce the association with
Hsp104.
| |
DISCUSSION |
New chaperone connection.
Hsp90 cochaperones were thought to
be dedicated to Hsp90. Among the few exceptions are the interactions of
Sti1/Hop with Hsc70 and Hsp70 (9), of Cns1 with Cpr7
(15, 30), the binding of the mammalian Sba1 homolog p23 to
some Hsp90 substrates (16, 21, 25), and the recruitment by
CHIP of the protein degradation machinery to Hsp90 substrates
(13). We were therefore surprised to discover that the
molecular chaperone Hsp104 interacts with the Hsp90 cochaperones Sti1,
Cpr7, and Cns1. Ydj1 was the only other known Hsp104 binding protein
(24), but to our knowledge, Sti1 and Cpr7 are the first
proteins for which a direct interaction with Hsp104 has been demonstrated.
Interestingly, related domains mediate the interaction of Sti1 with
Hsp104 and Hsp90. Both types of interactions require a
TPR domain of
Sti1 and the very C-terminal peptide sequences of
Hsp90 (
9,
27,
41) and Hsp104. However, the two TPR clusters
of Sti1 display
marked differences in specificity. The N-terminal
TPR domain TPR1 binds
both Hsp70 and Hsp104, whereas Hsp90 binding
is mediated by the second
TPR cluster, TPR2A/B. The Hsp104 binding
domain of Cpr7 has yet to be
mapped, but its TPR domain may well
be involved in this
interaction.
It is important to point out that Hsp104 complexes, just like Hsp90
complexes, are heterogeneous, with any particular complex
representing
only a minor fraction at steady state. We have yet
to investigate the
stoichiometry, the relative proportions, and
the dynamics of these
novel chaperone complexes. With respect
to the stoichiometry, data
obtained by gel filtration are compatible
with a 1:1 ratio of the
components in Hsp104-Sti1 TPR1 complexes
(data not
shown).
There are no known interactions between the Hsp104 and Hsp90 chaperone
machineries, and indeed, the complexes between Hsp90
cochaperones and
Hsp104 are not mediated by Hsp90. Both Sti1 and
Cpr7 interact with
Hsp104 directly, and for Cpr7 we have even
demonstrated that Hsp104 and
Hsp90 binding is mutually exclusive.
Similarly, the formation of
Hsp104 complexes is favored in vivo
when binding of TPR proteins
to Hsp90 is impaired by truncating
Hsp90. Preliminary data indicate
that Cdc37 and Sba1 do not associate
with Hsp104 (data not shown)
suggesting that cochaperone sharing
may be restricted to a subset
of Hsp90 cochaperones. Thus, the
two "core" chaperones share
some regulatory and/or auxiliary components
as part of distinct
complexes with distinct
functions.
Hsp104 cochaperone interactions are regulated.
The most
striking finding about the new chaperone network is its regulation by
growth conditions. When cells are grown with their favorite carbon
source, glucose, Hsp90 cochaperones are not associated with
Hsp104. The TPR proteins Sti1, Cpr7, and Cns1 interact with Hsp104 when
cells are grown directly on nonfermentable carbon sources such as
ethanol and glycerol, or once the fermentable carbon source is used up
when cells have reached a certain density. Cells then begin to utilize
nonfermentable metabolites. Hence, the association of Hsp90
cochaperones with Hsp104 correlates with respiratory growth and low (or
no) concentrations of a fermentable sugar such as glucose and
galactose. Remarkably, when the interaction between Hsp90 cochaperones
and Hsp90 is reduced by truncating Hsp90, the interaction with Hsp104
occurs even in the presence of the fermentable sugar. This observation
suggests that fermentable sugar and fermentation per se do not prevent
the formation of Hsp104 complexes. If one assumes that the association
with Hsp90 is the default, it is conceivable that respiration and/or
the absence of a fermentable sugar inhibits the association with Hsp90 and, in turn, favors that to Hsp104. It is noteworthy that nitrogen starvation and classical types of stresses such as heat and high osmolarity do not induce the association of Hsp90 cochaperones with
Hsp104 (data not shown). Current knowledge on glucose and galactose
signaling (reviewed in reference 8), on the one hand, and
on the regulation of molecular chaperone activity (see, for example,
reference 32), on the other, is too limited to predict the
"signaling pathway." However, it will be interesting to explore this regulation as a paradigm of how extracellular or metabolic signals
regulate chaperone networks and their activities.
What is the function?
The newly identified interactions could
be important for Hsp104, the Hsp90 cochaperones, or both.
Unfortunately, relatively little is known about the in vivo functions
of Sti1, Cpr7, and Cns1. Therefore, we have explored potential effects
on Hsp104 functions more extensively. We initially examined whether
mutants carrying the double deletions hsp104
cpr7 and hsp104 sti1 display synthetic growth defects. However, with respect to growth at normal and moderately elevated temperatures and under both respiratory and fermentative conditions, these strains were
indistinguishable from their parent strains (data not shown).
The potential role for the Hsp90 cochaperones in modulating Hsp104
function in protein disaggregation and refolding was also
investigated
(data not shown). We found that the Hsp104-dependent
refolding of
bacterial luciferase is not affected by respiratory
growth conditions
that promote the association of Hsp104 with
Hsp90 cochaperones or by
overexpression of the Sti1 TPR1 domain,
which could be expected to
block access of wild-type Sti1 and
other TPR proteins to Hsp104, or by
deletion of the
STI1 gene.
Moreover, the frequency of the
Hsp104-modulated loss of the Sup35
prions underlying the
[
psi+] phenotype is not increased by
overexpression of TPR1 or by growing
cells on a nonfermentable carbon
source. We have noticed a reduced
competence to promote luciferase
refolding for the C-terminally
truncated Hsp104 (data not shown).
Whether there is indeed a causal
link between this reduced function and
inability to bind TPR proteins
remains to be
established.
Therefore, the biological functions of the interaction of Hsp90
cochaperones with Hsp104 remain to be identified with more
sophisticated assays and a larger array of different environmental
and
metabolic conditions. Indeed, Hsp104 has been shown to be
required for
tolerance to a large variety of stresses (
40).
It is also
conceivable that the newly described interactions reveal
a potential of
Hsp104 to associate with TPR proteins other than
the ones tested here.
TPR proteins unrelated to the Hsp90 chaperone
system are involved in a
wide range of cellular processes. Since
Hsp104-related proteins exist
in many organisms, the newly discovered
chaperone network is likely to
be of importance beyond budding
yeast.
| |
ACKNOWLEDGMENTS |
We are indebted to David Toft and Susan Lindquist for very
generous gifts of antibodies. We thank Betty Craig, Susan Lindquist, and Peter Piper for plasmids. We are grateful to Rainer Warth for the
construction of several plasmids, to Valentina Gburcik for GST, to the
Swiss-2D service (Geneva) for mass spectrometric analysis, and to Peter
Dudek for critical comments on the manuscript.
This work was supported by the Swiss National Science Foundation and
the Canton de Genève.
| |
FOOTNOTES |
*
Corresponding author. Mailing address:
Département de Biologie Cellulaire, Université de
Genève, Sciences III, 30, quai Ernest-Ansermet, CH-1211 Geneva 4, Switzerland. Phone: 41 22 702 6813. Fax: 41 22 702 6928. E-mail:
Picard{at}cellbio.unige.ch.
| |
REFERENCES |
| 1.
|
Abbas-Terki, T.,
O. Donzé, and D. Picard.
2000.
The molecular chaperone Cdc37 is required for Ste11 function and pheromone-induced cell cycle arrest.
FEBS Lett.
467:111-116[CrossRef][Medline].
|
| 2.
|
Blum, H. E.,
H. Beier, and H. J. Gross.
1987.
Improved silver staining of plant proteins, RNA and DNA in polyacrylamide gels.
Electrophoresis
8:93-99[CrossRef].
|
| 3.
|
Bohen, S. P.
1998.
Genetic and biochemical analysis of p23 and ansamycin antibiotics in the function of Hsp90-dependent signaling proteins.
Mol. Cell. Biol.
18:3330-3339[Abstract/Free Full Text].
|
| 4.
|
Borkovich, K. A.,
F. W. Farrelly,
D. B. Finkelstein,
J. Taulien, and S. Lindquist.
1989.
Hsp82 is an essential protein that is required in higher concentrations for growth of cells at higher temperatures.
Mol. Cell. Biol.
9:3919-3930[Abstract/Free Full Text].
|
| 5.
|
Bose, S.,
T. Weikl,
H. Bügl, and J. Buchner.
1996.
Chaperone function of Hsp90-associated proteins.
Science
274:1715-1717[Abstract/Free Full Text].
|
| 6.
|
Buchner, J.
1999.
Hsp90 & Co.  a holding for folding.
Trends Biochem. Sci.
24:136-141[CrossRef][Medline].
|
| 7.
|
Caplan, A. J.
1999.
Hsp90's secrets unfold: new insights from structural and functional studies.
Trends Cell Biol.
9:262-268[CrossRef][Medline].
|
| 8.
|
Carlson, M.
1999.
Glucose repression in yeast.
Curr. Opin. Microbiol.
2:202-207[CrossRef][Medline].
|
| 9.
|
Chen, S.,
V. Prapapanich,
R. A. Rimerman,
B. Honoré, and D. F. Smith.
1996.
Interactions of p60, a mediator of progesterone receptor assembly, with heat shock proteins Hsp90 and Hsp70.
Mol. Endocrinol.
10:682-693[Abstract/Free Full Text].
|
| 10.
|
Chen, S., and D. F. Smith.
1998.
Hop as an adaptor in the heat shock protein 70 (Hsp70) and Hsp90 chaperone machinery.
J. Biol. Chem.
273:35194-35200[Abstract/Free Full Text].
|
| 11.
|
Chernoff, Y. O.,
S. L. Lindquist,
B. Ono,
S. G. Inge-Vechtomov, and S. W. Liebman.
1995.
Role of the chaperone protein Hsp104 in propagation of the yeast prion-like factor [psi+].
Science
268:880-884[Abstract/Free Full Text].
|
| 12.
|
Cheung, J., and D. F. Smith.
2000.
Molecular chaperone interactions with steroid receptors: an update.
Mol. Endocrinol.
14:939-946[Free Full Text].
|
| 13.
|
Connell, P.,
C. A. Ballinger,
J. Jiang,
Y. Wu,
L. J. Thompson,
J. Hohfeld, and C. Patterson.
2001.
The cochaperone CHIP regulates protein triage decisions mediated by heat-shock proteins.
Nat. Cell Biol.
3:93-96[CrossRef][Medline].
|
| 14.
|
Dolinski, K.,
S. Muir,
M. Cardenas, and J. Heitman.
1997.
All cyclophilins and FK506 binding proteins are, individually and collectively, dispensable for viability in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
94:13093-13098[Abstract/Free Full Text].
|
| 15.
|
Dolinski, K. J.,
M. E. Cardenas, and J. Heitman.
1998.
CNS1 encodes an essential p60/Sti1 homolog in Saccharomyces cerevisiae that suppresses cyclophilin 40 mutations and interacts with Hsp90.
Mol. Cell. Biol.
18:7344-7352[Abstract/Free Full Text].
|
| 16.
|
Donzé, O.,
T. Abbas-Terki, and D. Picard.
2001.
The Hsp90 chaperone complex is both a facilitator and a repressor of the dsRNA-dependent kinase PKR.
EMBO J.
20:3771-3780[CrossRef][Medline].
|
| 17.
|
Donzé, O., and D. Picard.
1999.
Hsp90 binds and regulates Gcn2, the ligand-inducible kinase of the  subunit of eukaryotic translation initiation factor 2.
Mol. Cell. Biol.
19:8422-8432[Abstract/Free Full Text].
|
| 18.
|
Duina, A. A.,
H.-C. J. Chang,
J. A. Marsh,
S. Lindquist, and R. F. Gaber.
1996.
A cyclophilin function in Hsp90-dependent signal transduction.
Science
274:1713-1715[Abstract/Free Full Text].
|
| 19.
|
Duina, A. A.,
J. A. Marsh, and R. F. Gaber.
1996.
Identification of two CyP-40-like cyclophilins in Saccharomyces cerevisiae, one of which is required for normal growth.
Yeast
12:943-952[CrossRef][Medline].
|
| 20.
|
Fang, Y.,
A. E. Fliss,
J. Rao, and A. J. Caplan.
1998.
SBA1 encodes a yeast hsp90 cochaperone that is homologous to vertebrate p23.
Mol. Cell. Biol.
18:3727-3734[Abstract/Free Full Text].
|
| 21.
|
Freeman, B. C.,
S. J. Felts,
D. O. Toft, and K. R. Yamamoto.
2000.
The p23 molecular chaperones act at a late step in intracellular receptor action to differentially affect ligand efficacies.
Genes Dev.
14:422-434[Abstract/Free Full Text].
|
| 22.
|
Freeman, B. C.,
D. O. Toft, and R. I. Morimoto.
1996.
Molecular chaperone machines: chaperone activities of the cyclophilin Cyp-40 and the steroid aporeceptor-associated protein p23.
Science
274:1718-1720[Abstract/Free Full Text].
|
| 23.
|
Frydman, J., and J. Höhfeld.
1997.
Chaperones get in touch: the Hip-Hop connection.
Trends Biochem. Sci.
22:87-92[CrossRef][Medline].
|
| 24.
|
Glover, J. R., and S. Lindquist.
1998.
Hsp104, Hsp70, and Hsp40: a novel chaperone system that rescues previously aggregated proteins.
Cell
94:73-82[CrossRef][Medline].
|
| 25.
|
Hu, J.,
D. O. Toft, and C. Seeger.
1997.
Hepadnavirus assembly and reverse transcription require a multicomponent chaperone complex which is incorporated into nucleocapsids.
EMBO J.
16:59-68[CrossRef][Medline].
|
| 26.
|
Kimura, Y.,
S. L. Rutherford,
Y. Miyata,
I. Yahara,
B. C. Freeman,
L. Yue,
R. I. Morimoto, and S. Lindquist.
1997.
Cdc37 is a molecular chaperone with specific functions in signal transduction.
Genes Dev.
11:1775-1785[Abstract/Free Full Text].
|
| 27.
|
Lässle, M.,
G. L. Blatch,
V. Kundra,
T. Takatori, and B. R. Zetter.
1997.
Stress-inducible, murine protein mSTI1.
J. Biol. Chem.
272:1876-1884[Abstract/Free Full Text].
|
| 28.
|
Lindquist, S., and G. Kim.
1996.
Heat-shock protein 104 expression is sufficient for thermotolerance in yeast.
Proc. Natl. Acad. Sci. USA
93:5301-5306[Abstract/Free Full Text].
|
| 29.
|
Louvion, J.-F.,
R. Warth, and D. Picard.
1996.
Two eukaryote-specific regions of Hsp82 are dispensable for its viability and signal transduction functions in yeast.
Proc. Natl. Acad. Sci. USA
93:13937-13942[Abstract/Free Full Text].
|
| 30.
|
Marsh, J. A.,
H. M. Kalton, and R. F. Gaber.
1998.
Cns1 is an essential protein associated with the hsp90 chaperone complex in Saccharomyces cerevisiae that can restore cyclophilin 40-dependent functions in cpr7 cells.
Mol. Cell. Biol.
18:7353-7359[Abstract/Free Full Text].
|
| 31.
|
Mayr, C.,
K. Richter,
H. Lilie, and J. Buchner.
2000.
Cpr6 and Cpr7, two closely related Hsp90-associated immunophilins from saccharomyces cerevisiae, differ in their functional properties.
J. Biol. Chem.
275:34140-34146[Abstract/Free Full Text].
|
| 32.
|
Morano, K. A., and D. J. Thiele.
1999.
The Sch9 protein kinase regulates Hsp90 chaperone complex signal transduction activity in vivo.
EMBO J.
18:5953-5962[CrossRef][Medline].
|
| 33.
|
Moriyama, H.,
H. K. Edskes, and R. B. Wickner.
2000.
[URE3] prion propagation in Saccharomyces cerevisiae: requirement for chaperone Hsp104 and curing by overexpressed chaperone Ydj1p.
Mol. Cell. Biol.
20:8916-8922[Abstract/Free Full Text].
|
| 34.
|
Nicolet, C. M., and E. A. Craig.
1989.
Isolation and characterization of STI1, a stress-inducible gene from Saccharomyces cerevisiae.
Mol. Cell. Biol.
9:3638-3646[Abstract/Free Full Text].
|
| 35.
|
Parsell, D. A.,
A. S. Kowal,
M. A. Singer, and S. Lindquist.
1994.
Protein disaggregation mediated by heat-shock protein Hsp104.
Nature
372:475-478[CrossRef][Medline].
|
| 36.
|
Pearl, L. H., and C. Prodromou.
2000.
Structure and in vivo function of Hsp90.
Curr. Opin. Struct. Biol.
10:46-51[CrossRef][Medline].
|
| 37.
|
Pirkl, F., and J. Buchner.
2001.
Functional analysis of the Hsp90-associated human peptidyl prolyl cis/trans isomerases FKBP51, FKBP52 and Cyp40.
J. Mol. Biol.
308:795-806[CrossRef][Medline].
|
| 38.
|
Sanchez, Y., and S. L. Lindquist.
1990.
HSP104 required for induced thermotolerance.
Science
248:1112-1115[Abstract/Free Full Text].
|
| 39.
|
Sanchez, Y.,
D. A. Parsell,
J. Taulien,
J. L. Vogel,
E. A. Craig, and S. Lindquist.
1993.
Genetic evidence for a functional relationship between Hsp104 and Hsp70.
J. Bacteriol.
175:6484-6491[Abstract/Free Full Text].
|
| 40.
|
Sanchez, Y.,
J. Taulien,
K. A. Borkovich, and S. Lindquist.
1992.
Hsp104 is required for tolerance to many forms of stress.
EMBO J.
11:2357-2364[Medline].
|
| 41.
|
Scheufler, C.,
A. Brinker,
G. Bourenkov,
S. Pegoraro,
L. Moroder,
H. Bartunik,
F. U. Hartl, and I. Moarefi.
2000.
Structure of TPR domain-peptide complexes: critical elements in the assembly of the Hsp70-Hsp90 multichaperone machine.
Cell
101:199-210[CrossRef][Medline].
|
| 42.
|
Schirmer, E. C.,
J. R. Glover,
M. A. Singer, and S. Lindquist.
1996.
HSP100/Clp proteins: a common mechanism explains diverse functions.
Trends Biochem. Sci.
21:289-296[CrossRef][Medline].
|
| 43.
|
Serio, T. R., and S. L. Lindquist.
2000.
Protein-only inheritance in yeast: something to get [PSI+]-ched about.
Trends Cell Biol.
10:98-105[CrossRef][Medline].
|
| 44.
|
Shevchenko, A.,
M. Wilm,
O. Vorm, and M. Mann.
1996.
Mass spectrometric sequencing of proteins from silver-stained polyacrylamide gels.
Anal. Chem.
68:850-858[Medline].
|
| 45.
|
Warth, R.,
P.-A. Briand, and D. Picard.
1997.
Functional analysis of the yeast 40 kDa cyclophilin Cyp40 and its role for viability and steroid receptor regulation.
Biol. Chem.
378:381-391[Medline].
|
| 46.
|
Weikl, T.,
K. Abelmann, and J. Buchner.
1999.
An unstructured C-terminal region of the Hsp90 cochaperone p23 is important for its chaperone function.
J. Mol. Biol.
293:685-691[CrossRef][Medline].
|
Molecular and Cellular Biology, November 2001, p. 7569-7575, Vol. 21, No. 22
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.22.7569-7575.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Echeverria, P. C., Mazaira, G., Erlejman, A., Gomez-Sanchez, C., Pilipuk, G. P., Galigniana, M. D.
(2009). Nuclear Import of the Glucocorticoid Receptor-hsp90 Complex through the Nuclear Pore Complex Is Mediated by Its Interaction with Nup62 and Importin {beta}. Mol. Cell. Biol.
29: 4788-4797
[Abstract]
[Full Text]
-
Mir, S. S., Fiedler, D., Cashikar, A. G.
(2009). Ssd1 Is Required for Thermotolerance and Hsp104-Mediated Protein Disaggregation in Saccharomyces cerevisiae. Mol. Cell. Biol.
29: 187-200
[Abstract]
[Full Text]
-
Forafonov, F., Toogun, O. A., Grad, I., Suslova, E., Freeman, B. C., Picard, D.
(2008). p23/Sba1p Protects against Hsp90 Inhibitors Independently of Its Intrinsic Chaperone Activity. Mol. Cell. Biol.
28: 3446-3456
[Abstract]
[Full Text]
-
Fan, Q., Park, K.-W., Du, Z., Morano, K. A., Li, L.
(2007). The Role of Sse1 in the de Novo Formation and Variant Determination of the [PSI+] Prion. Genetics
177: 1583-1593
[Abstract]
[Full Text]
-
Bedard, J., Kubis, S., Bimanadham, S., Jarvis, P.
(2007). Functional Similarity between the Chloroplast Translocon Component, Tic40, and the Human Co-chaperone, Hsp70-interacting Protein (Hip). J. Biol. Chem.
282: 21404-21414
[Abstract]
[Full Text]
-
Travers, S. A. A., Fares, M. A.
(2007). Functional Coevolutionary Networks of the Hsp70-Hop-Hsp90 System Revealed through Computational Analyses. Mol Biol Evol
24: 1032-1044
[Abstract]
[Full Text]
-
Johnson, J. L., Halas, A., Flom, G.
(2007). Nucleotide-Dependent Interaction of Saccharomyces cerevisiae Hsp90 with the Cochaperone Proteins Sti1, Cpr6, and Sba1. Mol. Cell. Biol.
27: 768-776
[Abstract]
[Full Text]
-
Zenthon, J. F., Ness, F., Cox, B., Tuite, M. F.
(2006). The [PSI+] Prion of Saccharomyces cerevisiae Can Be Propagated by an Hsp104 Orthologue from Candida albicans. Eukaryot Cell
5: 217-225
[Abstract]
[Full Text]
-
Flom, G., Weekes, J., Williams, J. J., Johnson, J. L.
(2006). Effect of Mutation of the Tetratricopeptide Repeat and Asparatate-Proline 2 Domains of Sti1 on Hsp90 Signaling and Interaction in Saccharomyces cerevisiae. Genetics
172: 41-51
[Abstract]
[Full Text]
-
Gong, W. J., Golic, K. G.
(2006). Loss of Hsp70 in Drosophila Is Pleiotropic, With Effects on Thermotolerance, Recovery From Heat Shock and Neurodegeneration. Genetics
172: 275-286
[Abstract]
[Full Text]
-
Song, Y., Masison, D. C.
(2005). Independent Regulation of Hsp70 and Hsp90 Chaperones by Hsp70/Hsp90-organizing Protein Sti1 (Hop1). J. Biol. Chem.
280: 34178-34185
[Abstract]
[Full Text]
-
Bedard, J., Jarvis, P.
(2005). Recognition and envelope translocation of chloroplast preproteins. J Exp Bot
56: 2287-2320
[Abstract]
[Full Text]
-
Lum, R., Tkach, J. M., Vierling, E., Glover, J. R.
(2004). Evidence for an Unfolding/Threading Mechanism for Protein Disaggregation by Saccharomyces cerevisiae Hsp104. J. Biol. Chem.
279: 29139-29146
[Abstract]
[Full Text]
-
Jones, G., Song, Y., Chung, S., Masison, D. C.
(2004). Propagation of Saccharomyces cerevisiae [PSI+] Prion Is Impaired by Factors That Regulate Hsp70 Substrate Binding. Mol. Cell. Biol.
24: 3928-3937
[Abstract]
[Full Text]
-
Borkovich, K. A., Alex, L. A., Yarden, O., Freitag, M., Turner, G. E., Read, N. D., Seiler, S., Bell-Pedersen, D., Paietta, J., Plesofsky, N., Plamann, M., Goodrich-Tanrikulu, M., Schulte, U., Mannhaupt, G., Nargang, F. E., Radford, A., Selitrennikoff, C., Galagan, J. E., Dunlap, J. C., Loros, J. J., Catcheside, D., Inoue, H., Aramayo, R., Polymenis, M., Selker, E. U., Sachs, M. S., Marzluf, G. A., Paulsen, I., Davis, R., Ebbole, D. J., Zelter, A., Kalkman, E. R., O'Rourke, R., Bowring, F., Yeadon, J., Ishii, C., Suzuki, K., Sakai, W., Pratt, R.
(2004). Lessons from the Genome Sequence of Neurospora crassa: Tracing the Path from Genomic Blueprint to Multicellular Organism. Microbiol. Mol. Biol. Rev.
68: 1-108
[Abstract]
[Full Text]
-
Tesic, M., Marsh, J. A., Cullinan, S. B., Gaber, R. F.
(2003). Functional Interactions between Hsp90 and the Co-chaperones Cns1 and Cpr7 in Saccharomyces cerevisiae. J. Biol. Chem.
278: 32692-32701
[Abstract]
[Full Text]
-
Gallie, D. R., Fortner, D., Peng, J., Puthoff, D.
(2002). ATP-dependent Hexameric Assembly of the Heat Shock Protein Hsp101 Involves Multiple Interaction Domains and a Functional C-proximal Nucleotide-binding Domain. J. Biol. Chem.
277: 39617-39626
[Abstract]
[Full Text]
Top
Abstract
Introduction
