Previous Article | Next Article ![]()
Molecular and Cellular Biology, November 2001, p. 7587-7600, Vol. 21, No. 22
Department of Biochemistry and Molecular
Biology,1 Department of
Urology,2 and Department of
Surgery,3 Norris Comprehensive Cancer Center,
Keck School of Medicine, University of Southern California, Los
Angeles, California 90089-9176
Received 7 June 2001/Returned for modification 30 July
2001/Accepted 16 August 2001
Tumor suppressor gene inactivation is a crucial event in
oncogenesis. Gene inactivation mechanisms include events resulting in
loss of heterozygosity (LOH), gene mutation, and transcriptional silencing. The contribution of each of these different pathways varies
among tumor suppressor genes and by cancer type. The factors that
influence the relative utilization of gene inactivation pathways are
poorly understood. In this study, we describe a detailed quantitative analysis of the three major gene inactivation mechanisms for a model
gene at two different genomic integration sites in mouse embryonic stem
(ES) cells. In addition, we targeted the major DNA methyltransferase
gene, Dnmt1, to investigate the relative contribution of
DNA methylation to these various competing gene inactivation pathways.
Our data show that gene loss is the predominant mode of inactivation of
a herpes simplex virus thymidine kinase neomycin phosphotransferase
reporter gene (HSV-TKNeo) at the two integration sites
tested and that this event is significantly reduced in Dnmt1-deficient
cells. Gene silencing by promoter methylation requires Dnmt1,
suggesting that the expression of Dnmt3a and Dnmt3b alone in ES cells
is insufficient to achieve effective gene silencing. We used a novel
assay to show that missense mutation rates are also substantially
reduced in Dnmt1-deficient cells. This is the first direct
demonstration that DNA methylation affects point mutation rates in
mammalian cells. Surprisingly, the fraction of CpG transition mutations
was not reduced in Dnmt1-deficient cells. Finally, we show that methyl
group-deficient growth conditions do not cause an increase in missense
mutation rates in Dnmt1-proficient cells, as predicted by
methyltransferase-mediated mutagenesis models. We conclude that Dnmt1
deficiency and the accompanying genomic DNA hypomethylation result in a
reduction of three major pathways of gene inactivation in our model system.
The inactivation of tumor-suppressor
genes plays a crucial role in cancer (7, 19, 33, 38, 65, 77, 79,
81). Gene inactivation pathways can be subdivided into genetic
and epigenetic mechanisms. The genetic mechanisms by which a gene can
be inactivated include gene loss (19, 77, 81), gene truncation, and base pair deletions, insertions, and substitutions (33, 65). Loss of heterozygosity (LOH) is an operational
term that has gained widespread use to describe the result of various mechanisms of gene loss, including large or small deletions spanning the gene (or parts of it), as well as chromosomal loss with or without
reduplication of the other chromosome, and nonreciprocal recombination
events, such as gene conversion (19, 77, 81). Intragenic
mutations can be subdivided into truncating mutations and
frame-preserving mutations. Truncating mutations include base substitutions resulting in nonsense mutations and frameshift mutations caused by insertions and deletions. Frame-preserving mutations include
small in-frame insertions and deletions, as well as missense mutations.
A gene can also lose its functionality by epigenetic mechanisms, such
as transcriptional or posttranscriptional downregulation (7, 38,
55, 79). Promoter DNA methylation and the associated chromatin
changes are important epigenetic mechanisms of transcriptional silencing in eukaryotic cells (67, 68), but cytosine-5
methylation has also been implicated in various genetic mechanisms of
gene inactivation (12, 25, 44, 65). In this study, we have dissected the relative contribution of DNA methylation to various competing gene inactivation pathways by using gene targeting of the
predominant DNA methyltransferase, Dnmt1.
Most studies of gene inactivation have utilized either endogenous genes
such as HPRT (coding for hypoxanthine
phosphoribosyltransferase) (50, 56) or exogenously
introduced counterselectable markers, such as herpes simplex virus
thymidine kinase (HSV-TK) (10) or
HPRT (50) cDNAs. In this study, we have used a
counterselectable marker encoding a fusion protein between HSV-TK and
neomycin phosphotransferase (71). Counterselection of the
TK activity with drugs such as 1-(2-deoxy-2-fluoro- The role of DNA methylation in gene inactivation has been investigated
by Chen et al., using Dnmt1 gene targeting in embryonic stem
(ES) cells with a slightly different strategy of HPRT and HSV-TK counterselection (12). Chen et al.
conclude that DNA hypomethylation results in an increased rate of
rearrangements and gene loss by mitotic recombination
(12). We have used an approach similar to that of Chen et
al. (12), but with different results. In addition, we have
investigated alternative mechanisms of gene inactivation, including
gene silencing by promoter methylation and gene mutation. It is widely
acknowledged that methylation of promoter regions is associated with
reduced transcriptional activity and altered chromatin structure
(8, 32, 39, 67). Therefore, we expect gene silencing by
promoter methylation to be very sensitive to manipulation of DNA
methylation levels.
There is a large body of literature implicating cytosine-5 DNA
methylation in transition mutations at CpG dinucleotides in vertebrates
(17, 45, 62, 76, 85). There are four separate observations
that suggest that 5-methylcytosine undergoes mutation at a higher rate
than the 4 unmodified bases. First, organisms with CpG methylation show
evidence of evolutionary loss of the dinucleotide CpG
(84), resulting in a depletion of CpG in the genome
(76). Second, CpG transition mutations represent the single most common type of somatic point mutation of the
TP53 gene in human cancer (27, 31, 33, 65).
Third, CpG transition mutations are responsible for approximately
one-third of all human hereditary disease mutations (17).
Fourth, CpG transition mutations are the most common type of point
mutation found in mutation assays in vivo and in vitro (34, 35,
62, 63). In all four of these examples, the evidence for a role
of DNA methylation is inferred from the overrepresentation of
transition mutations observed at CpG dinucleotides, rather than from
direct experimental evidence for the involvement of DNA methylation.
However, the concept that CpG hypermutability in vertebrate genomes is
directly attributable to 5-methylcytosine is widely accepted, since it
has strong mechanistic support from the observation that spontaneous
hydrolytic deamination of 5-methylcytosine occurs at high rates in
vitro (80). yielding thymine as a result. The combination
of Dnmt1 gene targeting in ES cells and the unique missense
mutation assay that we have developed has provided the first
opportunity to directly test this hypothetical mechanism in an
experimental system. In addition, work with bacterial cytosine-5
methyltransferases has shown that the enzyme itself can contribute to
deamination of cytosines in the target recognition sequence under
conditions involving a limiting supply of the methyl donor
S-adenosylmethionine (SAM) (6, 73, 89). As part
of this study, we have investigated whether methyl group-deficient growth conditions result in Dnmt1-dependent elevated missense mutation rates.
Plasmids.
A 2.7-kb BglII-SalI
TKNeo fragment was generated from pTNFUS69 (71)
and pPGKPuro (78) and ligated into the
BamHI-SalI backbone of the pSL301 cloning vector
(Invitrogen). The puromycin marker-containing
Dnmt1-targeting vector, pMC-PURO, was constructed from the
insertion-type targeting vector pMWT-PURO (78)
by digestion of a unique ClaI site upstream of the conserved
active site and treatment with Klenow DNA polymerase (New England
Biolabs) to create a frameshift. Analysis of the resulting clone showed
that a 125-bp stretch of DNA had been duplicated at the ClaI
site, resulting in a frameshift and termination of the reading frame 46 codons downstream of the ClaI site. The hygromycin
marker-containing Dnmt1-targeting vector pMC-HYG was
constructed from pPWL512 (37) and pMWTPURO
(78), resulting in the deletion of Dnmt1
sequences downstream of the ClaI site.
ES cell culture and transfection.
ES cells were maintained
in HEPES-buffered (20 mM [pH 7.3]) Dulbecco's modified Eagle's
medium (DMEM; JRH Biosciences) supplemented with 15% fetal calf serum
(Hyclone Labs), 0.1 mM nonessential amino acids (Gibco), 0.1 mM
Gene inactivation assays.
Before fluctuation analysis,
multiple parallel vials of a common culture of cells were generated for
each clone. The fraction of initial mutants present in the original
samples was determined by thawing one of the parallel vials and plating
the entire vial into medium with 2 µM FIAU for FIAU selection or with
2 µM FIAU plus 250 µg of G418 per ml for FIAU + G418
selection. Subsequently, the inadvertent inclusion of intitial mutants
in the fluctuation analyses of the other parallel vials was avoided by
choosing the number of cells plated for the expansion step to be at
least 3 orders of magnitude below the number calculated from the
initial mutant frequency to contain an average of one initial mutant. For the fluctuation analysis, one of the parallel vials of cells was
thawed, and 12 parallel cultures of 1,000 cells per well in a six-well
plate were plated onto feeders in normal medium without selection for the expansion phase of the fluctuation analysis. Counting
the day of plating as day 0, medium was changed on days 3, 6, and 9. On
day 10, the cells were trypsinized, and the concentration of live and
dead cells was determined by hemacytometer. For FIAU selection, a
defined volume (200 µl) from each of the 12 parallel expansions was
seeded into another six-well plate, without feeders, in medium with 1 µM FIAU. For the FIAU + G418 selection, a defined volume (2 ml)
from each of the 12 parallel expansions was seeded into 10-cm-diameter
dishes, without feeders, in medium with a combination of 1 µM FIAU
and 250 µg of G418 per ml. In addition, 1,000 cells were seeded in
medium without selection into six-well plates to determine plating
efficiency for selection. Counting the day of plating as day 0, medium
was changed on days 4, 8, and 12 with medium containing 2 µM FIAU
(twofold increase over initial seeding concentration) or a combination
of 2 µM FIAU and 250 µg of G418 per ml. Cells for determination of
plating efficiency were stained and counted on days 8 to 10. The number
of colonies on the selection plates was determined by a systematic
microscopic scan at a 100× magnification to ensure the validity of
each colony and to ensure that small colonies were not overlooked. The
counting was always performed on the same day for the different
genotypes or treatment categories within a single experiment, but
varied from experiment to experiment, depending on the growth rate of the colonies, and fell between days 10 and 14 for FIAU selections and
between days 13 and 19 for FIAU + G418 selections. The
Luria-Delbrück method of means equation was used to calculate
mutation rates (40, 53). The equation r = aN ln(NCa) was used, where r is the
average number of resistant clones per parallel expansion (corrected
for plating efficiency at the selection phase and corrected for the
fraction of live cells seeded for selection), a is the mutation rate, N is number of live cells seeded for
selection, and C is the number of parallel cultures. The
rates calculated from this transcendental equation were derived by a
Microsoft Excel spreadsheet-assisted approximation method.
Molecular analyses.
For Southern blot analysis, 10 µg of
genomic DNA was digested with the appropriate restriction enzyme,
separated on a 0.7% SeaKem ME agarose gel, and blotted onto a Zetabind
nylon membrane (Cuno Laboratory Products). Southern blot hybridization
was performed as described previously (15, 22). Blots were
washed at 65°C with 0.5× SSC (1× SSC is 0.15 M NaCl plus 0.015 M
sodium citrate)-1% sodium dodecyl sulfate. The following probes were
used. HV is a 0.6-kb HindIII-EcoRV fragment of genomic DNA that
includes the second intron of Dnmt1; the minor satellite
centromeric repeat probe is a 150-bp PstI fragment of pMR150
(11); and the Neo probe is a 637-bp
PstI fragment derived from the repaired neomycin phosphotransferase II sequence (88). LOH analysis of TK
was performed by PCR with the the HSV1-TK primers 5'-GCA TGC CTT
ATG CCG TGA CCG ACG-3' (TK4B) and 5'-GCC AGG CGG TCG ATG TGT
CTG TC-3' (TK5B). The Mlh1 control primers used were
5'-AGG AGC TGA TGC TGA GGC-3' (OL 117/sense) and 5'-TTT
CAT CTT GTC ACC CGA TG-3' (OL 118/anti-sense) (4).
Screening of the TKNeo gene for mutations was performed by
amplification of a 946-bp region spanning all previously described hot
spots for TK mutation (2, 9, 21, 42, 57). The primers used
for primary PCR amplification were 5'-CGA CCA GGC TGC GCG TTC
TCG-3' (TK-MC1) and 5'-CCA GGA TAA AGA CGT GCA TGG AAC GG-3'
(TKMC-2). The nested primers used for the sequencing reaction
were 5'-GGC CAT AGC AAC CGA CGT ACG G-3' (TK-MC1C/forward)
and 5'-CGT TTG GCC AAG ACG TCC AAG GC-3' (TK-MC2B/reverse). Methylation analysis of the TKNeo gene was performed by
bisulfite genomic sequencing (16). Primers
5'-CATCTACACCACACAACAC-3' (forward primer) and
5'-GGGGTTATGTTGTTTATAAGG-3' (reverse primer) were used to
amplify a 254-bp PCR product from the bottom strand of bisulfite-converted DNA, and the PCR product was cloned into plasmid vectors with the TA cloning kit (Invitrogen). Primer TA-5'
(5'-CAGTGTGCTGGAATTCGGC-3') was used to sequence DNA from
individual colonies. Methylation analysis of the Pgk1
promoter was performed by methylation-sensitive single nucleotide
primer extension (Ms-SNuPE) assay (26). The sequences of
the primers used for amplifying a 375-bp PCR product from
bisulfite-treated DNA were 5'-CAAATAAAAATAACACATCTCACTAATCT-3' (5'-Pgk) and 5'-TTATTAAGATTTAGATGGATGTAGGT-3'
(3'-Pgk). PCR products were gel purified with the Qiaquick gel
extraction kit (Qiagen), and the template was resuspended in 30 µl of
H2O. The sequences of the primers used for the Ms-SNuPE
reactions were GAGTAAAGTTGTTATTGGT (SNUPE 4) and
ATGTAGGTCGAAAGGTT (SNUPE 6). Ms-SNuPE primer extension reactions were performed in a single cycle of 2 min at 95°C, 2 min at
50°C, and 1 min at 72°C in a 10-µl total volume containing 4 µl
of Qiaquick eluent, 20 mM Tris-HCl (pH 7.5), 2.5 mM MgCl2, 100 mM KCl,
a 0.5 µM final concentration of each primer, 0.5 U of Taq
polymerase and 1 µCi of either [32P]dCTP or
[32P]dTTP. The reaction mixtures were combined with 4 µl of stop solution before being denatured at 95°C for 5 min and
loaded onto a 15% denaturing polyacrylamide gel (7 M urea).
Quantitation of methylation levels was performed on a Molecular
Dynamics PhosphorImager. All expression analyses were performed by
real-time fluorescence-based reverse transcription (RT)-PCR (TaqMan) as
described previously (20). Total RNA was isolated from a
confluent T25 flask and lysed by a single-step guanidinium
isothiocyanate method (13). Two micrograms of total RNA
was reverse transcribed with random hexamers, deoxynucleoside
triphosphates, and SuperScript II reverse transcriptase (Gibco-BRL) in
a 25-µl reaction mixture as described previously (24).
The TaqMan primer and probe sequences are listed below. In all cases,
the first primer listed is the forward PCR primer, second is the TaqMan
probe, and the third is the reverse PCR primer: Dnmt1
(GGCTTGGGCAGCCTATGAA,
6FAM5'-AGCATCTCCTCATCGATGCTCACCTTCTG-3'TAMRA, GGAATGACCGAGACGCAGTC),
histone H4 (TCTCCGGCCTCATCTACGAG,
6FAM5'-CACCTTCAGCACACCGCGGGT-3'TAMRA, CGGATCACGTTCTCCAGGA), and
TK (ATACCGACGATATGCGACCTG,
6FAM5'-CGCGCACGTTTGCCCGATC-3'TAMRA.
Model system to study gene inactivation pathways.
The
TKNeo gene encodes a fusion protein that has both HSV-TK and
neomycin phosphotransferase (Neo) functions (71) and
therefore has dually selectable and counterselectable properties. This
fusion protein formed the basis of a selection system to measure gene inactivation pathways. An overview of this selection strategy is shown
in Fig. 1A. Cells expressing the
TKNeo fusion protein are sensitive to FIAU, but resistant to G418.
Loss of the entire fusion gene, nonsense and frameshift mutations
within TK, or methylation of the phosphoglycerate-kinase
(Pgk1) promoter upstream of TK would confer FIAU
resistance and G418 sensitivity to affected cells. Missense mutation
events within TK would also confer FIAU resistance, but the
cells would remain G418 resistant. Each of these pathways was expected
to be readily detectable for single gene integrations of the
TKNeo marker. However, head-to-tail concatemeric repeats of
TKNeo were expected to result in the preferential detection of deletions spanning all copies of the marker, since point mutations and promoter methylation would require the concomitant inactivation of
all copies.
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.22.7587-7600.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Reduced Rates of Gene Loss, Gene Silencing, and
Gene Mutation in Dnmt1-Deficient Embryonic Stem
Cells


![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-D-arabinofuranosyl)-5-iodouracil
(FIAU) or ganciclovir should allow detection of any of the gene
inactivation events described above. In addition, the unique feature of
a fused positive selectable carboxy-terminal marker provides several
added advantages. First, selection for functional neomycin
phosphotransferase (Neo) activity with the drug G418 can serve to
exclude cells with preexisting gene inactivation events before the
start of the mutation assay. Second, simultaneous selection against TK
and for Neo provides a novel strategy for detecting missense
mutations that disrupt TK activity, but leave the Neo activity intact
(see Fig. 1A). Finally, we have further modified the basic
counterselection strategy by generating head-to-tail concatemeric
repeats of the counterselectable marker, thereby providing a
preferential detection of LOH events (Fig. 1A).
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-mercaptoethanol (Sigma), and penicillin-streptomycin (Irvine
Scientific). J1 cells (49) were grown on feeder layers of
gamma-irradiated embryonic fibroblast cells and supplemented with
leukemia inhibitory factor (LIF) (Gibco) at 106 U/ml. To
construct synthetic concatemers of PGK-TKNeo-PA, the 3-kb
SalI-XhoI fragment of pSLTKNeo was subjected to
repeated rounds of ligation and digestion with SalI and
XhoI. This reiterative procedure specifically selects for
the generation of head-to-tail concatemers, since the ligation of
SalI and XhoI compatible sticky ends results in
the destruction of the recognition sequence for either of the two
enzymes, while head-to-head (SalI-SalI) or
tail-to-tail (XhoI-XhoI) ligation results in the
regeneration of cleavable SalI or XhoI
recognition sequences. Cells were electroporated in a mixture of 20 mM
HEPES (pH 7.0), 137 mM NaCl, 5 mM KCl, 0.7 mM
Na2HPO4, 6 mM glucose, and 0.1 mM
-mercaptoethanol, with 10 to 30 µg of linearized DNA at a set
voltage of 400 V and a capacitance of 25 µF, in a 0.4-cm-diameter
cuvette with a Bio-Rad GenePulser II. Antibiotic selection was
initiated the following day and continued for 8 to 11 days before
picking. Puromycin was used at a concentration of 2µg/ml. G418
(Gibco) was used at an active concentration of 250 µg/ml. Hygromycin
B (Roche) was used at a concentration of 100 µg/ml. Cells were
expanded and frozen two days after picking. A parallel plate was
used for DNA isolation as described previously (46). Cells
for the methionine-deficient and ethionine assays were grown in DMEM
without L-methionine (Gibco; catalog no. 11970-035) supplemented with 14% dialyzed fetal bovine serum (Gibco), 0.9 mM
sodium pyruvate, HEPES (6.24-g/liter final concentration), Na2CO3 (1.2-g/liter final concentration), 0.1 mM nonessential amino acids (Gibco), 0.1 mM
-mercaptoethanol
(Sigma), penicillin-streptomycin (Irvine Scientific), and LIF (Gibco)
at 106 U/ml. This supplemented DMEM without methionine was
modified to make control medium (0.2 mM methionine [Sigma; catalog no. M2893]), ethionine medium (0.2 mM methionine plus 1 mM ethionine [Sigma; catalog no. E1260]), and homocystine medium (0.005 mM methionine plus 1 mM L-homocystine [Sigma; catalog no.
H4137]).
![]()
RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

View larger version (35K):
[in a new window]
FIG. 1.
Gene inactivation assay. (A) Schematic describing the
use of drug selection for the detection of various mechanisms of gene
inactivation at either a single-copy HSV-TKNeo or a
multicopy HSV-TKNeo concatemer. HSV-TKNeo encodes
a fusion protein between the HSV-TK gene and the
Neorgene. Cells carrying this marker (before selection) are
FIAU- sensitive (FIAUS) and G418 resistant
(G418R). Counterselection of TK with FIAU can
detect LOH, mutation, and methylation events. Simultaneous selection
with FIAU and G418 is expected to select primarily for missense
mutations in TK that leave the Neo reading frame
intact. The effects of HSV-TKNeo copy number on the expected
contribution by each of these gene inactivation pathways are indicated.
(B) Identification of single-copy or concatamerized TKNeo ES
cell clones. Restriction maps of integrated single-copy and
HSV-TKNeo concatemers show the ApaI (A) sites
within TKNeo and the flanking BamHI (B) sites.
Southern blot analysis of ApaI- and
BamHI-digested DNA from a single-copy TKNeo
integrant (BA-30) using a Neo probe (small filled
rectangles) identified single fragments in each digest.
TKNeo concatamerization in a multicopy HSV-TKNeo
clone (BA-10) was evident from an intense 2.8-kb ApaI
head-to-tail fragment and a weaker large flanking fragment.
Targeted mutation of the Dnmt1 gene.
To assess the
effect of DNA methylation on the various gene inactivation pathways,
sibling ES cell lines were generated with identical TKNeo
integrations, but with different Dnmt1 genotypes (Fig.
2). Figure 2A shows a pedigree of the
cell lines that were used in this study. First, one allele of the
Dnmt1 gene was disrupted in J1 wild-type cells
(49) by using an insertion-type vector containing a
puromycin resistance marker (P) to generate the
Dnmt1+/P cell line BA (see Materials
and Methods and reference 79). Next, the TKNeo gene
was introduced into the BA cell line either as a single-copy
integration (BA-30) or as a multicopy concatemer (BA-10). Finally, a
second gene targeting step with an insertion-type vector containing a
hygromycin resistance marker (H) gave rise to either
Dnmt1 heterozygous cells
(Dnmt1+/PH) or Dnmt1
homozygous knockout cells (Dnmt1P/H),
depending on whether the hygromycin vector had recombined at the
wild-type allele or at the previously targeted puromycin allele. Southern blot analysis was used to determine which of the two events
had taken place (Fig. 2B).
|
Effect of Dnmt1 deficiency on gene inactivation rates.
To
quantitate the effects of DNA hypomethylation on gene inactivation
rates, we performed fluctuation analyses with the Luria-Delbrück method of means equation (40, 53). We first analyzed the
effects of Dnmt1 deficiency on the combined rate of inactivation of the TKNeo gene, by subjecting ES cell clones with either a
single-copy TKNeo gene or multicopy TKNeo
concatemer to counterselection with just FIAU. In each experiment,
sibling pairs of Dnmt1+/PH and
Dnmt1P/H clones were tested side by side under
identical experimental conditions. We performed five independent
fluctuation analyses of pairs of single-copy integrant clones and four
independent fluctuation analyses of pairs of multicopy concatemers.
Each fluctuation analysis consisted of 12 parallel expansions.
Therefore, the data shown in Fig. 3B are based on a total of 216 [2 × (4 + 5) × 12] separate expansions. The average
rate of collective TKNeo inactivation by all mechanisms in
the single-copy Dnmt1+/PH cells was
found to be 4.8 × 10
4, whereas the rate measured
for the single-copy Dnmt1P/H cells was 2.6 × 10
4. The gene inactivation rates for the multicopy
concatemeric insertion were slightly lower at 1.6 × 10
4 in the Dnmt1+/PH
cells and 0.9 × 10
4 in the
Dnmt1P/H cells. The lower rate of gene
inactivation for the multicopy concatemers compared to that with the
single-copy insertion is consistent with the fact that some gene
inactivation mechanisms are not likely to result in the concomitant
inactivation of all copies of TKNeo, as outlined in Fig. 1A.
For both the single-copy and multicopy insertions, the gene
inactivation rates were consistently lower in the Dnmt1-deficient
hypomethlated cells. This difference was statistically significant
(P = 0.0326) for the single copy, and close to
significant (P = 0.0663) for the concatemer by a two-sided paired t test. The combined data for all nine
pairs of fluctuation tests of Dnmt1-proficient and Dnmt1-deficient
cells gave a P value in a paired t test of
0.0108. We conclude that Dnmt1 deficiency causes a reduction in the
rates of gene inactivation at these two loci. These results are not
consistent with the observation by Chen et al. of an enhanced rate of
gene inactivation in Dnmt1-deficient cells (12).
Analysis of TKNeo LOH.
Mechanisms of gene loss
that result in LOH collectively represent an important pathway of gene
inactivation (51, 77, 81). We used PCR analysis of a
266-bp sequence in the central region of the TK gene to
investigate what fraction of FIAU resistant clones, resulting from the
fluctuation analyses presented above, had undergone loss of
TKNeo gene sequence. Figure 3B
shows representative PCR results obtained with 10 single-copy
TKNeo and 10 multicopy TKNeo FIAU-resistant
colonies, and the data are summarized in Fig. 3C. The vast majority of
clones had lost this central section of the TKNeo gene. Of
the 384 clones analyzed that showed amplification of the
Mlh1 control gene, 367 did not amplify the TK
gene sequence. Interestingly, we found no occurrences of
TKNeo retention in Dnmt1-deficient cells, suggesting that
some cases of TKNeo gene retention could perhaps be
attributed to gene silencing by promoter DNA methylation in
Dnmt1-proficient cells. The frequency of retention of TKNeo in these cells was higher in single-copy cells than in the multicopy TKNeo cells (Fig. 3C), consistent with the expectation that
inactivation of multicopy concatemers would occur primarily by LOH
(Fig. 1A).
|
Analysis of gene silencing.
Although gene loss was the major
mechanism by which TK expression was eliminated in the
cells, the relative contributions of the other gene inactivation
pathways could be determined in the FIAU-resistant clones with
retention of TKNeo. The most likely mechanism for the
inactivation of the retained concatemers in the multicopy insertion of
TKNeo is gene silencing by promoter DNA methylation, since
concerted, linked point mutations are expected to be rare. We therefore
analyzed both TKNeo gene expression and Pgk1
promoter DNA methylation levels in all parental cell lines and in a
FIAU-resistant clone derived from one of the concatemeric lines (Fig.
4). The methylation analysis was
performed by MS-SNuPE (26) at two CpG dinucleotides: one
upstream and one immediately downstream of the transcription start
sites of the Pgk1 promoter (1) (Fig. 4). Gene
expression analysis was performed by real-time RT-PCR. The five
single-copy parental cell lines all expressed TK and all had
corresponding low levels of promoter methylation (23% or lower). Good
expression of TK and low levels of promoter methylation were
also seen in the multicopy concatemeric parental cell lines. However, a
FIAU-resistant clone derived from the BI-18 multicopy parent showed a
lack of detectable TK gene expression and an accompanying
high level of promoter DNA methylation (95%), suggesting that promoter
methylation was responsible for TK inactivation in this
particular clone.
|
Effect of Dnmt1 deficiency on missense mutation rates.
Although we were able to detect an example of a frameshift mutation in
one of the single-copy FIAU-resistant clones with TKNeo retention, the predominance of gene loss and gene silencing events in
this FIAU selection assay precluded a quantitative analysis of the
effects of Dnmt1 deficiency on point mutation rates. Therefore, we
developed a novel assay that allowed us to specifically select for
missense mutation events. The assay is based on a simultaneous selection with FIAU and G418. Clones resistant to this selection will
likely have inactivated the TK activity, yet retained a functional Neor activity. The most straightforward mechanism by which
this can be accomplished is by acquiring a missense mutation in the
TK segment of the gene, leaving the Neo reading
frame intact and unaltered. Four pairs of fluctuation analyses were
performed with the Dnmt1+/PH and
Dnmt1P/H cells carrying the single-copy
TKNeo gene, for a total of 96 independent expansions. The
Dnmt1+/PH ES cells showed an average
gene inactivation rate of 5.2 × 10
5, whereas the
Dnmt1P/H cells showed an average rate of
0.66 × 10
5 (Fig. 5A).
These results showed that DNA hypomethylation decreased missense
mutation rates by approximately eightfold. This decrease was found to
be highly statistically significant by a two-sided paired t
test (P = 0.0045). We were unable to obtain any
G418 + FIAU-resistant clones from the multicopy concatemeric
insertion clones, consistent with the prediction in Fig. 1A that
concomitant point mutations in all of the linked copies of
TKNeo are very unlikely to occur.
|
Analysis of mutation spectrum. Mutations were found scattered throughout the sequenced region in both genotypes with a cluster of Dnmt1P/H mutants in the central area of the TK open reading frame (Fig. 5B). The number of individual mutation events in each category was too small to accurately define the spectrum of mutations in cells with and without functional Dnmt1 expression (Fig. 5C). However, a high incidence of transition mutations within CpG dinucleotides (5 of 20) was found in Dnmt1-deficient cells. This result was quite unexpected, since most CpG transition mutations are thought to be attributable to deamination of 5-methylcytosine. Therefore, we investigated whether the Dnmt1 knockout had resulted in a decrease in the level of methylation in the body of the TKNeo gene. We performed bisulfite genomic sequencing of a central part of the TKNeo gene in Dnmt1+/PH and Dnmt1P/H clones (Fig. 5D). We sequenced a total of 24 subcloned bisulfite-treated PCR products for each of the two genotypes. The methylation frequency of individual CpG dinucleotides is shown in the histogram in Fig. 5D. This section of TKNeo is almost completely devoid of cytosine-5 DNA methylation in the Dnmt1-deficient Dnmt1P/H cells, which nevertheless gave rise to 5 transition mutations at CpG dinucleotides out of a total of 20 mutations. This suggests that the preferential occurrence of CpG transition mutations does not necessarily depend on the presence of cytosine-5 DNA methylation. However, it should be pointed out that since the overall mutation rate of Dnmt1P/H cells is lower, the absolute rate of mutagenesis at CpG dinucleotides is reduced in Dnmt1-deficient cells.
Effect of methyl group deficiency on mutation rates.
It is
difficult to envision why cells lacking significant CpG methylation in
the TKNeo gene would have such a high frequency of mutations
at CpG dinucleotides. One explanation could be that these mutation
events are not due to spontaneous hydrolytic deamination of
5-methylcytosine, but that they represent enzyme-dependent deamination
events mediated by one of the other DNA
(cytosine-5-)methyltransferases (Dnmt 3a, Dnmt3b, or even Dnmt2)
(6, 44, 59-61, 73, 89), with accompanying methyl transfer
to yield thymine (87) or with a block of uracil
base-excision repair (86). A prediction of this scenario
is that methionine-deficient growth conditions could enhance this
mechanism (44, 73). To test the effects of methyl group
deficiency on spontaneous mutation rates, the single-copy Dnmt1+/PH and
Dnmt1P/H cells were expanded in media with
different levels of methionine (Fig. 6).
Three different media were generated by reconstituting methionine-free
medium with either methionine (M), or with methionine plus ethionine
(an antimetabolite of methionine [ME]), or with very low levels of
methionine, but with homocystine as an amino acid replacement (H). The
effects of the two methyl group-deficient media (ME and H) on the
mutation rates, as measured with the missense mutation assay, are shown
in Fig. 6. For the Dnmt1+/PH cells,
expansion under methionine-deficient conditions reduced the mutation
rates, while mutation rates were enhanced in the Dnmt1P/H cells under the methionine-deficient
conditions. The sample sizes of both series were too small to yield
statistically significant differences. However, the prediction of
increased rates of mutagenesis caused by Dnmt1-mediated deamination in
methyl group-deficient growth conditions does not seem to be borne out
by this experiment.
|
| |
DISCUSSION |
|---|
|
|
|---|
This study describes the quantitative analysis of effects of DNA methylation on different gene inactivation pathways. We chose to use mouse ES cells as our model system, since these cells can be readily manipulated by gene targeting, allowing us to assess the effects of DNA methylation on gene inactivation rates in sibling clones with and without functional Dnmt1, but carrying identical TKNeo gene integrations. We generated clones with either a single-copy or multicopy concatemerized TKNeo integration. The purpose of including multicopy concatemers of TKNeo was to create cell lines with an enhanced detection of LOH and a reduced detection of point mutation events. Indeed, this appears to have been largely successful, since we were not able to generate any dually resistant clones of the multicopy concatemers in our missense mutation assay. In our system, loss of TKNeo formally represents loss of hemizygosity, rather than loss of heterozygosity, since the TKNeo gene is located on only one allele. However, we do not anticipate there to be mechanistic differences between these two types of events. One caveat to our experimental approach is that the Dnmt1-proficient cells are heterozygous for Dnmt1, rather than wild type. Although the heterozygous ES cells in our experiments appear to have methylation levels similar to those of wild-type cells (Fig. 2D), this point should not be entirely disregarded, since Dnmt1 heterozygosity has been shown to have phenotypic consequences in vivo (43). Nevertheless, our data suggest that the Dnmt1 heterozygous cells are much more similar to wild-type cells than to Dnmt1-deficient cells.
The results obtained with FIAU selection and with the FIAU + G418 selection suggest that gene inactivation and mutation rates are lower at the integrated TKNeo loci in Dnmt1-deficient ES cells than in Dnmt1-proficient ES cells. This does not imply that the Dnmt1-proficient ES cells are abnormally unstable. We have introduced an experimental condition of genomic hypomethylation and found an associated reduced rate of genomic instability. Presumably, this is just one phenotypic consequence of the DNA hypomethylation, and it cannot be concluded that severe genomic hypomethylation is beneficial for the cell or for the organism under normal circumstances. In addition, some mechanisms of genomic instability that were not investigated in this study, such as cytogenetic abnormalities, could show opposite consequences of DNA hypomethylation.
The consistency of our findings across various mechanisms of gene inactivation prompted us to investigate whether these differences could in fact be attributed to some general characteristic of Dnmt1-deficient cells, such as a difference in growth rate. A difference in growth rate could theoretically affect the number of visible colonies at the time of counting. Although we made every effort to avoid an effect of growth rate on our experiments by counting both live and dead cells before and after expansion and at the time of seeding for selection, as well as by performing all colony counts by careful, microscopic scan, this possibility could not be entirely excluded. Therefore, we investigated whether there was indeed a difference in growth rate between Dnmt1+/PH and Dnmt1P/H cells under the different selection conditions and found that there was no such difference (data not shown).
One caveat to our approach is that differences observed between Dnmt1-proficient and Dnmt1-deficient cells may be attributable to the presence or absence of the Dnmt1 protein, as opposed to differences in genomic DNA methylation levels. It is becoming increasingly clear that the Dnmt1 protein has important functions separate from its DNA methylating properties (14, 23, 41, 67, 69). Another caveat is that the effects of Dnmt1 deficiency on mutation rates could be indirect. For instance, changes in DNA methylation levels could alter the expression of genes involved in DNA damage and repair. It is not obvious how one could distinguish in vivo between direct and indirect effects of DNA methylation levels.
Our novel procedure to select specifically for missense mutations combines two advantages over existing types of mutation assays. On the one hand, it is selective for point mutations and relatively resistant to detection of other events, such as deletion, a feature shared by existing single-site reversion assays (74). A drawback of these single-site reversion assays is their low sensitivity due to their small target size (a single nucleotide), whereas our assay combines the selectivity of these single-site reversion assays with the much greater target size (most of the open reading frame) of gene inactivation assays, such as HPRT and HSV-TK counterselection. This unique combination of selectivity and sensitivity allowed us to provide the first direct demonstration of the contribution of a DNA methyltransferase to an increase in the missense mutation rate in mammalian cells. Although the mutational burden of DNA methylation has often been inferred from analysis of mutation spectra, this is the first experimental corroboration that mammalian cells with reduced levels of genomic DNA methylation appear to have lower rates of mutation than their sibling cells with normal levels of DNA methylation. It is also the first time that a mammalian model system has been used to indirectly assess the role of DNA-methyltransferase-mediated mutagenesis.
The discrepancy in the frequency with which we found missense mutations in the Dnmt1P/H (59%) and Dnmt1+/PH (22%) dually resistant clones could potentially be explained by the occurrence of FIAU + G418-resistant Dnmt1+/PH clones that had acquired sufficient levels of promoter methylation to render the cells resistant to FIAU, while maintaining just enough expression to retain resistance to G418. If this were indeed the case, this would necessarily imply that the level of TKNeo protein in the cell at which a cell loses G418 resistance is lower than the level at which a cell reaches FIAU resistance. To this end, we investigated the Pgk promoter methylation levels of two Dnmt1+/PH dually resistant clones in which we had not been able to detect mutations. One such clone had promoter methylation levels of 38%, compared to 23% in the BF-14 parent before selection, while the other dually resistant clone had promoter methylation levels of 49%, compared to 7% in the BF-23 parent cell line prior to selection. This increase in promoter methylation levels to modest levels in both cases is compatible with the intermediate-expression-level hypothesis proposed above. We were unable to perform TK expression analysis of these clones to confirm this hypothesis, since they had not been cryopreserved for RNA analysis.
As expected, the absolute rate of CpG mutagenesis is reduced in Dnmt1-deficient cells. However, the relative fraction of CpG transition mutations is actually increased in Dnmt1-deficient cells. This finding is unexpected, although an elevated mutation rate of CpG dinucleotides, independent of cytosine methylation, has been proposed previously (64). This result could be a statistical aberration, given the limited number of sequenced mutations. The modest effect of Dnmt1 deficiency on the relative frequency of CpG mutagenesis may be partly due to the low levels of DNA methylation observed in the TK coding region, even in Dnmt1+/PH cells (Fig. 5D). The Dnmt1 protein could play an alternative role in protecting against cytosine deamination at CpG dinucleotides. However, this would not explain why the incidence of transition mutations in Dnmt1-deficient cells is higher at CpG dinucleotides than at other CG base pairs. Another possibility may be enzyme-mediated deamination by Dnmt3a, Dnmt3b, or Dnmt2. Enymatic deamination has been observed with the bacterial methyltransferases HpaII and EcoRII, which are able to deaminate cytosine to uracil directly when the supply of the methyl donor SAM is limiting (72, 73). The increase in missense mutation rate observed in Dnmt1P/H cells under methyl group-deficient conditions is consistent with an involvement of Dnmt3a, Dnmt3b, or Dnmt2 in enzyme-mediated deamination. If this is indeed the case, then the same events may also occur in the Dnmt1+/PH cells, but the effect may be masked by the higher rate of other mechanisms of gene inactivation in these cells. Alternatively, the Dnmt1 protein or the resulting methylation may actually protect against the proposed enzyme-mediated mutagenesis. It should be noted that the missense mutation assays were conducted in a wild-type background of uracil and thymine DNA glycosylase genes (29, 30, 58, 70). This would severely limit our ability to detect enzyme-mediated and spontaneous deamination events. Elucidation of the roles of the different DNA methyltransferases in the stimulation of or protection from cytosine deamination extends beyond the scope of this article and will require much further investigation before any firm conclusions can be drawn.
The role of DNA methylation in gene inactivation has been previously
addressed by Chen et al., using Dnmt1 gene targeting in ES
cells with a slightly different strategy of HPRT and
HSV-TK counterselection (12). Chen et al.
conclude that DNA hypomethylation results in an increased rate of
rearrangements and gene loss by mitotic recombination
(12). This observation is consistent with other studies
showing an increase in chromosome 1 pericentromeric rearrangements in
DNMT3B-deficient cells (28, 59, 83) and in
cells treated with the DNA methyltransferase inhibitor
5-aza-deoxycytidine (36). On the other hand, the
conclusion by Chen et al. (12) that Dnmt1 deficiency
increases the rate of LOH is not consistent with the observation that
reduced levels of functional Dnmt1 strongly suppress
intestinal polyp formation in
Apc+/Min mice (18, 43),
a system that requires LOH of the wild-type Apc locus
(48, 52). In this study, we followed a slightly different
strategy to measure rates of gene inactivation and arrived at
conclusions opposite to those of Chen et al. (12). This
may in part be explained by the different experimental setups of the two studies. Chen et al. used two defined loci for the genomic location
of their counterselectable markers: the X-linked HPRT gene
and a TK gene targeted to the Dnmt1 locus. Our
system relies on random integrations of single-copy or multicopy
concatemers of TKNeo. Therefore, some of the differences
between the two studies may reflect differences between chromosomal
locations, which may differ in their relative utilization of various
gene inactivation pathways. For instance, the Hprt locus
used by Chen et al. cannot sustain very large deletions or chromosomal
loss in male ES cells, since it is X linked (12). Chen et
al. reported a high frequency of counterselected clones (71% of the
Dnmt1+/
clones) that did not show evidence of
TK gene loss and for which the mechanism of gene
inactivation was unclear (12). Our results suggest that
some of these clones may have acquired promoter methylation, with an
accompanying transcriptional silencing. The study by Chen et al.
employed several different ES cell lines, including two independently
derived ES cell lines, several derivative daughter cell lines, and a
single pair of sibling cell lines (12). In contrast, we
performed only simultaneous comparisons between eight paired sibling ES
cell clones. Therefore, while the diversity of source material used by
Chen et al. provides justification for the generalization of their
results, the strength of our study lies in the fact that we used very
closely matched, multiple, pairwise measurements, which provide a more
solid basis for statistical comparisons. As a consequence, we could
perform paired t tests on 18 separate rate measurements,
whereas the Chen study used a
2 test on four rate
measurements (12). In addition, in our rate calculations,
we have used the Luria-Delbrück method of means equation, which
allows for the correction of plating efficiency (40, 53).
This adjustment is particularly important for ES cells, which have a
reduced efficiency of plating in the absence of feeder cells. In
contrast, the P0 method of Luria-Delbrück used by Chen et al. does not provide a method to correct for the plating efficiency (40, 53). Nevertheless, Chen et al. did adjust their final calculated rates for plating efficiency
(12). The problems associated with the application of
fluctuation analysis to mammalian cell systems have been widely noted
(3, 40). The method of means may overestimate the mutation
rate, while the P0 method may underestimate it
(40). Indeed, we arrive at substantially higher rates of
gene inactivation than those of Chen et al. (12). This
underscores the difficulty of fluctuation analysis and the necessity to
limit conclusions to side-by-side comparisons within a single study, as
we did. It is not clear which, if any, of the differences outlined
above can account for the opposite results obtained in these two
studies. Therefore, this issue will need further investigation, before
definitive and broad statements regarding the quantitative effects of
DNA methylation on gene inactivation can be reached. A reduced rate of
gene inactivation under Dnmt1-deficient conditions would be consistent
with the observation that ApcMin/+
mice with reduced levels of functional Dnmt1 expression have a substantially reduced polyp multiplicity (18, 43). LOH
of the wild-type Apc allele is a frequent event in
ApcMin/+ polyps and may be a
rate-limiting step in this model system (48, 52). Our data
are also consistent with other previous reports of oncogenic effects of
increased Dnmt1 expression (5, 75, 82) and
tumor-suppressive effects of decreased Dnmt1 expression (54, 66).
| |
ACKNOWLEDGMENTS |
|---|
Matilda F. Chan and Renée van Amerongen contributed equally to this manuscript.
We thank Binh Trinh for advice on fluctuation analysis. We are grateful to David VandenBerg for help with the TK mutation screening and bisulfite sequencing. We thank Tiffany I. Long and Cindy A. Eads for help with the expression analyses. We thank Henry Sucov for a gift of FIAU.
This work was supported in part by Public Health Service grant CA-75090 from the National Cancer Institute.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: USC/Norris Cancer Center, Room 6418, 1441 Eastlake Ave., Los Angeles, CA 90089-9176. Phone: (323) 865-0650. Fax: (323) 865-0158. E-mail: plaird{at}hsc.usc.edu.
Present address: Division of Molecular Genetics and Center of
Biomedical Genetics, The Netherlands Cancer Institute, 1066 CX
Amsterdam, The Netherlands.
Present address: Life Sciences Division, Lawrence Berkeley
National Laboratory, Berkeley, CA 94720.
§ Present address: Hubrecht Laboratory/Netherlands Institute for Developmental Biology, 3584 CT Utrecht, The Netherlands.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Adra, C. N., P. H. Boer, and M. W. McBurney. 1987. Cloning and expression of the mouse pgk-1 gene and the nucleotide sequence of its promoter. Gene 60:65-74[CrossRef][Medline]. |
| 2. | Akiyama, N., D. Alexander, Y. Aoki, and M. Noda. 1996. Characterization of mutations induced by 300 and 320 nm UV radiation in a rat fibroblast cell line Mutat. Res. 372:119-131[Medline]. |
| 3. |
Bachl, J.,
M. Dessing,
C. Olsson,
R. C. von Borstel, and C. Steinberg.
1999.
An experimental solution for the Luria-Delbruck fluctuation problem in measuring hypermutation rates.
Proc. Natl. Acad. Sci. USA
96:6847-6849 |
| 4. | Baker, S. M., A. W. Plug, T. A. Prolla, C. E. Bronner, A. C. Harris, X. Yao, D. M. Christie, C. Monell, N. Arnheim, A. Bradley, T. Ashley, and R. M. Liskay. 1996. Involvement of mouse Mlh1 in DNA mismatch repair and meiotic crossing over. Nat. Genet. 13:336-342[CrossRef][Medline]. |
| 5. |
Bakin, A. V., and T. Curran.
1999.
Role of DNA 5-methylcytosine transferase in cell transformation by fos.
Science
283:387-390 |
| 6. |
Bandaru, B.,
J. Gopal, and A. S. Bhagwat.
1996.
Overproduction of DNA cytosine methyltransferases causes methylation and C T mutations at non-canonical sites.
J. Biol. Chem.
271:7851-7859 |
| 7. | Baylin, S. B., and J. G. Herman. 2000. DNA hypermethylation in tumorigenesis: epigenetics joins genetics. Trends Genet. 16:168-174[CrossRef][Medline]. |
| 8. |
Bird, A. P., and A. P. Wolffe.
1999.
Methylation-induced repression belts, braces, and chromatin.
Cell
99:451-454[CrossRef][Medline].
|
| 9. | Black, M. E., and L. A. Loeb. 1993. Identification of important residues within the putative nucleoside binding site of HSV-1 thymidine kinase by random sequence selection: analysis of selected mutants in vitro. Biochemistry 32:11618-11626[CrossRef][Medline]. |
| 10. | Brisebois, J. J., and M. S. DuBow. 1993. Selection for spontaneous null mutations in a chromosomally-integrated HSV-1 thymidine kinase gene yields deletions and a mutation caused by intragenic illegitimate recombination. Mutat. Res. 287:191-205[Medline]. |
| 11. | Chapman, V., L. Forrester, J. Sanford, N. Hastie, and J. Rossant. 1984. Cell lineage-specific undermethylation of mouse repetitive DNA. Nature 307:284-286[CrossRef][Medline]. |
| 12. | Chen, R. Z., U. Pettersson, C. Beard, L. Jackson-Grusby, and R. Jaenisch. 1998. DNA hypomethylation leads to elevated mutation rates. Nature 395:89-93[CrossRef][Medline]. |
| 13. | Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156-159[Medline]. |
| 14. |
Chuang, L. S.,
H. I. Ian,
T. W. Koh,
H. H. Ng,
G. Xu, and B. F. Li.
1997.
Human DNA-(cytosine-5) methyltransferase-PCNA complex as a target for p21WAF1.
Science
277:1996-2000 |
| 15. |
Church, G. M., and W. Gilbert.
1984.
Genomic sequencing.
Proc. Natl. Acad. Sci. USA
81:1991-1995 |
| 16. |
Clark, S. J.,
J. Harrison,
C. L. Paul, and M. Frommer.
1994.
High sensitivity mapping of methylated cytosines.
Nucleic Acids Res.
22:2990-2997 |
| 17. | Cooper, D. N., and M. Krawczak. 1990. The mutational spectrum of single base-pair substitutions causing human genetic disease: patterns and predictions. Hum. Genet. 85:55-74[Medline]. |
| 18. |
Cormier, R. T., and W. F. Dove.
2000.
Dnmt1N/+ reduces the net growth rate and multiplicity of intestinal adenomas in C57BL/6-multiple intestinal neoplasia (Min)/+ mice independently of p53 but demonstrates strong synergy with the modifier of Min 1(AKR) resistance allele.
Cancer Res.
60:3965-3970 |
| 19. | de Nooij-van Dalen, A. G., V. H. van Buuren-van Seggelen, P. H. Lohman, and M. Giphart-Gassler. 1998. Chromosome loss with concomitant duplication and recombination both contribute most to loss of heterozygosity in vitro. Genes Chromosomes Cancer 21:30-38[CrossRef][Medline]. |
| 20. |
Eads, C. A.,
K. D. Danenberg,
K. Kawakami,
L. B. Saltz,
P. V. Danenberg, and P. W. Laird.
1999.
CpG island hypermethylation in human colorectal tumors is not associated with DNA methyltransferase overexpression.
Cancer Res.
59:2302-2306 |
| 21. | Eckert, K. A., C. A. Ingle, D. K. Klinedinst, and N. R. Drinkwater. 1988. Molecular analysis of mutations induced in human cells by N-ethyl-N-nitrosourea. Mol. Carcinog. 1:50-56[Medline]. |
| 22. | Feinberg, A. P., and B. Vogelstein. 1983. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132:6-13[CrossRef][Medline]. |
| 23. | Fuks, F., W. A. Burgers, A. Brehm, L. Hughes-Davies, and T. Kouzarides. 2000. DNA methyltransferase Dnmt1 associates with histone deacetylase activity. Nat. Genet. 24:88-91[CrossRef][Medline]. |
| 24. |
Gonzalez-Zuleta, M.,
C. M. Bender,
A. S. Yang,
T. Nguyen,
R. W. Beart,
J. M. van Tornout, and P. A. Jones.
1995.
Methylation of the 5' CpG island of the p16/CDKN2 tumor suppressor gene in normal and transformed human tissues correlates with gene silencing.
Cancer Res.
55:4531-4535 |
| 25. | Gonzalgo, M. L., and P. A. Jones. 1997. Mutagenic and epigenetic effects of DNA methylation. Mutat. Res. 386:107-118[CrossRef][Medline]. |
| 26. |
Gonzalgo, M. L., and P. A. Jones.
1997.
Rapid quantitation of methylation differences at specific sites using methylation-sensitive single nucleotide primer extension (Ms-SNuPE).
Nucleic Acids Res.
25:2529-2531 |
| 27. |
Greenblatt, M. S.,
W. P. Bennett,
M. Hollstein, and C. C. Harris.
1994.
Mutations in the p53 tumor suppressor gene: clues to cancer etiology and molecular pathogenesis.
Cancer Res.
54:4855-4878 |
| 28. |
Hansen, R. S.,
C. Wijmenga,
P. Luo,
A. M. Stanek,
T. K. Canfield,
C. M. Weemaes, and S. M. Gartler.
1999.
The DNMT3B DNA methyltransferase gene is mutated in the ICF immunodeficiency syndrome.
Proc. Natl. Acad. Sci. USA
96:14412-14417 |
| 29. | Haug, T., F. Skorpen, K. Kvaloy, I. Eftedal, H. Lund, and H. E. Krokan. 1996. Human uracil-DNA glycosylase gene: sequence organization, methylation pattern, and mapping to chromosome 12q23-q24.1. Genomics 36:408-416[CrossRef][Medline]. |
| 30. | Hendrich, B., U. Hardeland, H. H. Ng, J. Jiricny, and A. Bird. 1999. The thymine glycosylase MBD4 can bind to the product of deamination at methylated CpG sites. Nature 401:301-304[CrossRef][Medline]. |
| 31. | Hollstein, M., K. Rice, M. S. Greenblatt, T. Soussi, R. Fuchs, T. Sorlie, E. Hovig, B. Smith-Sorensen, R. Montesano, and C. C. Harris. 1994. Database of p53 gene somatic mutations in human tumors and cell lines. Nucleic Acids Res. 22:3551-3555. |
| 32. |
Hsieh, C.-L.
1994.
Dependence of transcriptional repression on CpG methylation density.
Mol. Cell. Biol.
14:5487-5494 |
| 33. | Hussain, S. P., and C. C. Harris. 1999. p53 mutation spectrum and load: the generation of hypotheses linking the exposure of endogenous or exogenous carcinogens to human cancer. Mutat. Res. 428:23-32[Medline]. |
| 34. |
Ikehata, H.,
M. Takatsu,
Y. Saito, and T. Ono.
2000.
Distribution of spontaneous CpG-associated G:C A:T mutations in the lacZ gene of Muta mice: effects of CpG methylation, the sequence context of CpG sites, and severity of mutations on the activity of the lacZ gene product.
Environ. Mol. Mutagen.
36:301-311[CrossRef][Medline].
|
| 35. |
Jackson-Grusby, L.,
P. W. Laird,
S. N. Magge,
B. J. Moeller, and R. Jaenisch.
1997.
Mutagenicity of 5-aza-2'-deoxycytidine is mediated by the mammalian DNA methyltransferase.
Proc. Natl. Acad. Sci. USA
94:4681-4685 |
| 36. | Ji, W., R. Hernandez, X. Y. Zhang, G. Z. Qu, A. Frady, M. Varela, and M. Ehrlich. 1997. DNA demethylation and pericentromeric rearrangements of chromosome 1. Mutat. Res. 379:33-41[Medline]. |
| 37. |
Johnson, K. A.,
C. P. Lerner,
L. C. Di Lacio,
P. W. Laird,
A. H. Sharpe, and E. M. Simpson.
1995.
Transgenic mice for the preparation of hygromycin-resistant primary embryonic fibroblast feeder layers for embryonic stem cell selections.
Nucleic Acids Res.
23:1273-1275 |
| 38. | Jones, P. A., and P. W. Laird. 1999. Cancer epigenetics comes of age. Nat. Genet. 21:163-167[CrossRef][Medline]. |
| 39. | Kass, S. U., D. Pruss, and A. P. Wolffe. 1997. How does DNA methylation repress transcription? Trends Genet. 13:444-449[CrossRef][Medline]. |
| 40. |
Kendal, W. S., and P. Frost.
1988.
Pitfalls and practice of Luria-Delbruck fluctuation analysis: a review.
Cancer Res.
48:1060-1065 |
| 41. |
Knox, J. D.,
F. D. Araujo,
P. Bigey,
A. D. Slack,
G. B. Price,
M. Zannis-Hadjopoulos, and M. Szyf.
2000.
Inhibition of DNA methyltransferase inhibits DNA replication.
J. Biol. Chem.
275:17986-17990 |
| 42. |
Kussmann-Gerber, S.,
O. Kuonen,
G. Folkers,
B. D. Pilger, and L. Scapozza.
1998.
Drug resistance of herpes simplex virus type 1 structural considerations at the molecular level of the thymidine kinase.
Eur. J. Biochem.
255:472-481[Medline].
|
| 43. | Laird, P. W., L. Jackson-Grusby, A. Fazeli, S. L. Dickinson, W. E. Jung, E. Li, R. A. Weinberg, and R. Jaenisch. 1995. Suppression of intestinal neoplasia by DNA hypomethylation. Cell 81:197-205[CrossRef][Medline]. |
| 44. | Laird, P. W., and R. Jaenisch. 1994. DNA methylation and cancer. Hum. Mol. Genet. 3:1487-1495[Abstract]. |
| 45. | Laird, P. W., and R. Jaenisch. 1996. The role of DNA methylation in cancer genetics and epigenetics. Annu. Rev. Genet. 30:441-464[CrossRef][Medline]. |
| 46. |
Laird, P. W.,
A. Zijderveld,
K. Linders,
M. A. Rudnicki,
R. Jaenisch, and A. Berns.
1991.
Simplified mammalian DNA isolation procedure.
Nucleic Acids Res.
19:4293 |
| 47. | Lei, H., S. P. Oh, M. Okano, R. Juttermann, K. A. Goss, R. Jaenisch, and E. Li. 1996. De novo DNA cytosine methyltransferase activities in mouse embryonic stem cells. Development 122:3195-3205[Abstract]. |
| 48. |
Levy, D. B.,
K. J. Smith,
Y. Beazer-Barclay,
S. R. Hamilton,
B. Vogelstein, and K. W. Kinzler.
1994.
Inactivation of both APC alleles in human and mouse tumors.
Cancer Res.
54:5953-5958 |
| 49. | Li, E., T. H. Bestor, and R. Jaenisch. 1992. Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell 69:915-926[CrossRef][Medline]. |
| 50. | Lichtenauer-Kaligis, E. G., J. Thijssen, H. den Dulk, P. van de Putte, J. G. Tasseron-de Jong, and M. Giphart-Gassler. 1996. Comparison of spontaneous hprt mutation spectra at the nucleotide sequence level in the endogenous hprt gene and five other genomic positions. Mutat. Res. 351:147-155[CrossRef][Medline]. |
| 51. |
Lichtenauer-Kaligis, E. G.,
J. C. Thijssen,
H. den Dulk,
P. van de Putte,
M. Giphart-Gassler, and J. G. Tasseron-de Jong.
1995.
Spontaneous mutation spectrum in the hprt gene in human lymphoblastoid TK6 cells.
Mutagenesis
10:137-143 |
| 52. |
Luongo, C.,
A. R. Moser,
S. Gledhill, and W. F. Dove.
1994.
Loss of Apc+ in intestinal adenomas from Min mice.
Cancer Res.
54:5947-5952 |
| 53. |
Luria, S. E., and M. Delbrück.
1943.
Mutations of bacteria from virus sensitivity to virus resistance.
Genetics
28:491-511 |
| 54. |
MacLeod, A. R., and M. Szyf.
1995.
Expression of antisense to DNA methyltransferase mRNA induces DNA demethylation and inhibits tumorigenesis.
J. Biol. Chem.
270:8037-8043 |
| 55. | McBurney, M. W. 1999. Gene silencing in the development of cancer. Exp. Cell Res. 248:25-29[CrossRef][Medline]. |
| 56. |
Monnat, R. J., Jr.
1989.
Molecular analysis of spontaneous hypoxanthine phosphoribosyltransferase mutations in thioguanine-resistant HL-60 human leukemia cells.
Cancer Res.
49:81-87 |
| 57. |
Munir, K. M.,
D. C. French,
D. K. Dube, and L. A. Loeb.
1992.
Permissible amino acid substitutions within the putative nucleoside binding site of herpes simplex virus type 1 encoded thymidine kinase established by random sequence mutagenesis.
J. Biol. Chem.
267:6584-6589 |
| 58. |
Neddermann, P.,
P. Gallinari,
T. Lettieri,
D. Schmid,
O. Truong,
J. J. Hsuan,
K. Wiebauer, and J. Jiricny.
1996.
Cloning and expression of human G/T mismatch-specific thymine-DNA glycosylase.
J. Biol. Chem.
271:12767-12774 |
| 59. | Okano, M., D. W. Bell, D. A. Haber, and E. Li. 1999. DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 99:247-257[CrossRef][Medline]. |
| 60. | Okano, M., S. Xie, and E. Li. 1998. Cloning and characterization of a family of novel mammalian DNA (cytosine-5) methyltransferases. Nat. Genet. 19:219-220[CrossRef][Medline]. |
| 61. |
Okano, M.,
S. Xie, and E. Li.
1998.
Dnmt2 is not required for de novo and maintenance methylation of viral DNA in embryonic stem cells.
Nucleic Acids Res.
26:2536-2540 |
| 62. | O'Neill, J. P., and B. A. Finette. 1998. Transition mutations at CpG dinucleotides are the most frequent in vivo spontaneous single-based substitution mutation in the human HPRT gene. Environ. Mol. Mutagen. 32:188-191[CrossRef][Medline]. |
| 63. | Ono, T., H. Ikehata, S. Nakamura, Y. Saito, Y. Hosoi, Y. Takai, S. Yamada, J. Onodera, and K. Yamamoto. 2000. Age-associated increase of spontaneous mutant frequency and molecular nature of mutation in newborn and old lacZ-transgenic mouse. Mutat. Res. 447:165-177[Medline]. |
| 64. |
Perutz, M. F.
1990.
Frequency of abnormal human haemoglobins caused by C T transitions in CpG dinucleotides.
J. Mol. Biol.
213:203-206[CrossRef][Medline].
|
| 65. | Pfeifer, G. P. 2000. p53 mutational spectra and the role of methylated CpG sequences. Mutat. Res. 450:155-166[Medline]. |
| 66. |
Ramchandani, S.,
A. R. MacLeod,
M. Pinard,
E. von Hofe, and M. Szyf.
1997.
Inhibition of tumorigenesis by a cytosine-DNA, methyltransferase, antisense oligodeoxynucleotide.
Proc. Natl. Acad. Sci. USA
94:684-689 |
| 67. | Robertson, K. D., S. Ait-Si-Ali, T. Yokochi, P. A. Wade, P. L. Jones, and A. P. Wolffe. 2000. DNMT1 forms a complex with Rb, E2F1 and HDAC1 and represses transcription from E2F-responsive promoters. Nat. Genet. 25:338-342[CrossRef][Medline]. |
| 68. | Robertson, K. D., and A. P. Wolffe. 2000. DNA methylation in health and disease. Nat. Rev. Genet. 1:11-19[Medline]. |
| 69. | Rountree, M. R., K. E. Bachman, and S. B. Baylin. 2000. DNMT1 binds HDAC2 and a new co-repressor, DMAP1, to form a complex at replication foci. Nat. Genet. 25:269-277[CrossRef][Medline]. |
| 70. |
Schmutte, C.,
R. Baffa,
L. M. Veronese,
Y. Murakumo, and R. Fishel.
1997.
Human thymine-DNA glycosylase maps at chromosome 12q22-q24.1: a region of high loss of heterozygosity in gastric cancer.
Cancer Res.
57:3010-3015 |
| 71. |
Schwartz, F.,
N. Maeda,
O. Smithies,
R. Hickey,
W. Edelmann,
A. Skoultchi, and R. Kucherlapati.
1991.
A dominant positive and negative selectable gene for use in mammalian cells.
Proc. Natl. Acad. Sci. USA
88:10416-10420 |
| 72. | Sharath, A. N., E. Weinhold, and A. S. Bhagwat. 2000. Reviving a dead enzyme: cytosine deaminations promoted by an inactive DNA methyltransferase and an S-adenosylmethionine analogue. Biochemistry 39:14611-14616[CrossRef][Medline]. |
| 73. | Shen, J. C., W. M. Rideout III, and P. A. Jones. 1992. High frequency mutagenesis by a DNA methyltransferase. Cell 71:1073-1080[CrossRef][Medline]. |
| 74. |
Shen, J. C.,
W. M. Rideout III, and P. A. Jones.
1994.
The rate of hydrolytic deamination of 5-methylcytosine in double-stranded DNA.
Nucleic Acids Res.
22:972-976 |
| 75. |
Slack, A.,
N. Cervoni,
M. Pinard, and M. Szyf.
1999.
DNA methyltransferase is a downstream effector of cellular transformation triggered by simian virus 40 large T antigen.
J. Biol. Chem.
274:10105-10112 |
| 76. |
Sved, J., and A. Bird.
1990.
The expected equilibrium of the CpG dinucleotide in vertebrate genomes under a mutation model.
Proc. Natl. Acad. Sci. USA
87:4692-4696 |
| 77. |
Thiagalingam, S.,
S. Laken,
J. K. Willson,
S. D. Markowitz,
K. W. Kinzler,
B. Vogelstein, and C. Lengauer.
2001.
Mechanisms underlying losses of heterozygosity in human colorectal cancers.
Proc. Natl. Acad. Sci. USA
98:2698-2702 |
| 78. |
Tucker, K. L.,
C. Beard,
J. Dausmann,
L. Jackson-Grusby,
P. W. Laird,
H. Lei,
E. Li, and R. Jaenisch.
1996.
Germ-line passage is required for establishment of methylation and expression patterns of imprinted but not of nonimprinted genes.
Genes Dev.
10:1008-1020 |
| 79. | Tycko, B. 2000. Epigenetic gene silencing in cancer. J. Clin. Investig. 105:401-407[Medline]. |
| 80. | Wang, R. Y., K. C. Kuo, C. W. Gehrke, L. H. Huang, and M. Ehrlich. 1982. Heat- and alkali-induced deamination of 5-methylcytosine and cytosine residues in DNA. Biochim. Biophys. Acta 697:371-377[Medline]. |
| 81. | Wijnhoven, S. W., H. J. Kool, C. M. van Teijlingen, A. A. van Zeeland, and H. Vrieling. 2001. Loss of heterozygosity in somatic cells of the mouse. An important step in cancer initiation? Mutat. Res. 473:23-36[Medline]. |
| 82. |
Wu, J.,
J. P. Issa,
J. Herman,
D. E. Bassett, Jr.,
B. D. Nelkin, and S. B. Baylin.
1993.
Expression of an exogenous eukaryotic DNA methyltransferase gene induces transformation of NIH 3T3 cells.
Proc. Natl. Acad. Sci. USA
90:8891-8895 |
| 83. | Xu, G. L., T. H. Bestor, D. Bourc'his, C. L. Hsieh, N. Tommerup, M. Bugge, M. Hulten, X. Qu, J. J. Russo, and E. Viegas-Pequignot. 1999. Chromosome instability and immunodeficiency syndrome caused by mutations in a DNA methyltransferase gene. Nature 402:187-191[CrossRef][Medline]. |
| 84. | Yang, A. S., M. L. Gonzalgo, J. M. Zingg, R. P. Millar, J. D. Buckley, and P. A. Jones. 1996. The rate of CpG mutation in Alu repetitive elements within the p53 tumor suppressor gene in the primate germline. J. Mol. Biol. 258:240-250[CrossRef][Medline]. |
| 85. | Yang, A. S., P. A. Jones, and A. Shibata. 1996. The mutational burden of 5-methylcytosine, p. 77-94. In A. D. Riggs, R. A. Martienssen, and V. E. A. Russo (ed.), Epigenetic mechanisms of gene regulation. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 86. |
Yang, A. S.,
J. C. Shen,
J. M. Zingg,
S. Mi, and P. A. Jones.
1995.
HhaI and HpaII DNA methyltransferases bind DNA mismatches, methylate uracil and block DNA repair.
Nucleic Acids Res.
23:1380-1387 |
| 87. | Yebra, M. J., and A. S. Bhagwat. 1995. A cytosine methyltransferase converts 5-methylcytosine in DNA to thymine. Biochemistry 34:14752-14757[CrossRef][Medline]. |
| 88. |
Yenofsky, R. L.,
M. Fine, and J. W. Pellow.
1990.
A mutant neomycin phosphotransferase II gene reduces the resistance of transformants to antibiotic selection pressure.
Proc. Natl. Acad. Sci. USA
87:3435-3439 |
| 89. |
Zingg, J. M.,
J. C. Shen,
A. S. Yang,
H. Rapoport, and P. A. Jones.
1996.
Methylation inhibitors can increase the rate of cytosine deamination by (cytosine-5)-DNA methyltransferase.
Nucleic Acids Res.
24:3267-3275 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»