Previous Article | Next Article 
Molecular and Cellular Biology, November 2001, p. 7663-7672, Vol. 21, No. 22
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.22.7663-7672.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Peripheral Mitochondrial Inner Membrane Protein, Mss2p, Required
for Export of the Mitochondrially Coded Cox2p C Tail in
Saccharomyces cerevisiae
Sarah A.
Broadley,
Christina
M.
Demlow, and
Thomas D.
Fox*
Department of Molecular Biology and Genetics,
Cornell University, Ithaca, New York 14853
Received 22 May 2001/Returned for modification 22 June
2001/Accepted 1 August 2001
 |
ABSTRACT |
Cytochrome oxidase subunit 2 (Cox2p) is synthesized on
the matrix side of the mitochondrial inner membrane, and its N-
and C-terminal domains are exported across the inner membrane by
distinct mechanisms. The Saccharomyces cerevisiae
nuclear gene MSS2 was previously shown to be necessary
for Cox2p accumulation. We have used pulse-labeling studies and the
expression of the ARG8m reporter at
the COX2 locus in an mss2 mutant to
demonstrate that Mss2p is not required for Cox2p synthesis but rather
for its accumulation. Mutational inactivation of the proteolytic
function of the matrix-localized Yta10p (Afg3p) AAA-protease partially
stabilizes Cox2p in an mss2 mutant but does not
restore assembly of cytochrome oxidase. In the absence of Mss2p,
the Cox2p N terminus is exported, but Cox2p C-terminal export and
assembly of Cox2p into cytochrome oxidase is blocked.
Epitope-tagged Mss2p is tightly, but peripherally, associated with the
inner membrane and protected by it from externally added proteases.
Taken together, these data indicate that Mss2p plays a role in
recognizing the Cox2p C tail in the matrix and promoting its export.
 |
INTRODUCTION |
Expression of mitochondrial genes
involves protein synthesis in the mitochondrial matrix, insertion of
hydrophobic domains into the inner membrane, translocation of
hydrophilic domains across the inner membrane, and assembly into
functional respiratory complexes (18, 40). The processes
by which mitochondrially encoded proteins translocate across the inner
membrane have been difficult to study because there is no in vitro
system for the expression of translation products encoded by
mitochondrial DNA (mtDNA). We have therefore taken a genetic approach
to studying export of protein domains encoded in mtDNA.
We have focused our attention on the translocation of the
mitochondrially encoded Cox2p. The crystal structures of both bovine and Paracoccus denitrificans cytochrome oxidases have been
determined (37, 61). Based on these structures and on
other studies (42), the orientation of yeast Cox2p in the
inner membrane has been firmly established. After or during synthesis,
the amino- and carboxy-terminal tails of Cox2p are exported from the
matrix into the intermembrane space (IMS), while its two transmembrane
domains are embedded in the inner membrane.
In Saccharomyces cerevisiae, translation of the
COX2 mRNA is activated at the inner membrane by the protein
Pet111p (17, 33, 41, 46). Cox2p is synthesized as a
precursor protein whose N-terminal 15-amino-acid leader peptide is
cleaved by the Imp peptidase complex in the IMS after translocation
through the membrane (36, 43, 47, 50).
So far, two components of the Cox2p export machinery have been
reported. Oxa1p (1, 4, 7) was shown to be a component of
the export machinery (21, 23, 24, 25). In addition, PNT1 was identified in a screen for export defective mutants
and shown to encode a mitochondrial inner membrane protein
(22).
A previous report indicated that nuclearly encoded Mss2p is required
for the expression of COX2 (52). An
mss2 mutant was respiratory defective and failed to
accumulate Cox2p, even though COX2 mRNA was produced
normally. In the present study, we demonstrate that Mss2p acts within
mitochondria to posttranslationally stabilize Cox2p and is required to
translocate the C-terminal domain of Cox2p through the inner membrane.
 |
MATERIALS AND METHODS |
Strains and plasmids.
Standard yeast genetic methods were as
previously described (14, 45). Strains used in this study
are listed in Table 1. Strain SB44 is
congenic to DBY947 (35). Strains J303-1A, SB48, SB49C,
SB100, SB101, SB102, SB103, and YGS103 are congenic to W303
(59). All other strains listed in Table 1 are congenic to
D273-10B (ATCC 25627). Fermentable medium was YPD (1% yeast extract,
2% Bacto Peptone, 100 mg of adenine/liter, and 2% glucose) or YPR
(2% yeast extract, 2% Bacto Peptone, 100 mg of adenine/liter, and 2%
raffinose) and nonfermentable medium was YPEG (1% yeast extract, 2%
Bacto Peptone, 100 mg of adenine/liter, 3% ethanol, 3% glycerol). The
minimal medium was SD (0.67% yeast nitrogen base without amino acids,
2% glucose), and it was supplemented with amino acids as needed.
Transformations of plasmids and PCR products were accomplished by using
the EZ-Transformation kit (Zymo Research).
Plasmids and DNA manipulation.
To construct the
mss2
::LEU2. deletion, a disruption cassette
containing the LEU2 gene flanked by 50 bp of sequence
homologous to the MSS2 coding region was PCR amplified,
purified, and transformed into appropriate strains (HMD22, J303-1A,
SH36, TF215, and YGS103). Deletion of MSS2 was confirmed by
PCR analysis. Strains containing the yme1::URA3
deletion were constructed by using pPT45 (60) and verified
by PCR. Tagging of MSS2 was done by PCR amplifying a
HA-URA3-HA cassette (48) with the primers
TTCTTGAAAGTAGAAAAGATTCCATAAAGTTGCTGGACAAAGCACGGCTTAGGGAACAAAAGCTGG and
GGTGGAGACATGTGTCCTTATATAAATCGCAAAAAGAATCGATCAGACATCTATAGGGCGAATTGG. The resulting cassette, which targeted insertion of the hemagglutinin (HA) cassette directly before the MSS2 stop codon,
was transformed into TF215. Cells containing integration of the tagging
cassette at the MSS2 locus were identified by using PCR and
plated on medium contain 5-fluoroorotic acid to pop out the
URA3 marker.
Mitochondrial purification, fractionation, and protein
analysis.
Mitochondrial purification and membrane fractionation,
mitoplasting and protease protection, and alkaline extraction of
mitochondrial proteins were performed as previously described
(15, 16, 21, 22). Pulse-labeling of mitochondrial
translation products with [35S]methionine Trans
Label (ICN) was done essentially as described previously
(6), except that cells were labeled with 0.2 mCi [35S]methionine for 10 min in the presence of
0.2 mg of cycloheximide/ml. After pulse-labeling, cells were incubated
with 2 mM cold methionine for 50 min or immediately chilled on ice.
Samples were analyzed by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE) on a 12 or 15% gel, and a PhosphorImager
was used to detect radioactivity within the dried gels. For
steady-state analysis of proteins, total cellular protein was extracted
from cells (65) in the presence of a protease inhibitor
cocktail (Sigma) and analyzed, or purified mitochondria were analyzed.
Protein was separated on a 10% polyacryamide gel and probed with a
monoclonal antibody to Cox2p (CCO6 [provided by T. L. Mason])
(39) that recognizes an epitope in the Cox2p C tail
(21), a polyclonal antibody to cytochrome
b2, a polyclonal antibody to Arg8p, a
polyclonal antibody to glucose-6-phosphate dehydrogenase (Sigma), a
polyclonal antibody to citrate synthase (SS60 [provided by G. Schatz]), or a monoclonal antibody to the HA epitope (3F10
[Boehringer-Mannheim]). Secondary anti-mouse or anti-rabbit
antibodies were detected by using the ECL kit (Amersham Pharmacia).
 |
RESULTS |
In the absence of Mss2p, Cox2p is synthesized normally but is
destabilized.
Our first goal was to understand the
posttranscriptional role of Mss2p in COX2 expression. We
constructed a deletion mutant in which the MSS2 coding
region was largely replaced by the LEU2 marker. In agreement
with previous data (52), the mss2
mutant was
respiratory defective, as judged by its inability to grow on the
nonfermentable carbon source, YPEG (data not shown). We analyzed
steady-state Cox2p levels in the mss2
mutant by using Western analysis of whole-cell extract (Fig.
1A) and confirmed that Cox2p accumulation
was dramatically reduced. We next monitored Cox2p synthesis and
accumulation by using cycloheximide pulse-labeling of mitochondrial
translation products (Fig. 1B). Cells were subjected to cycloheximide
poisoning to inhibit cytoplasmic translation, and mitochondrial
translation products were pulse-labeled for 10 min with
[35S]methionine, followed with or without a
50-min chase with cold methionine, and analyzed by SDS-PAGE. After a
short pulse, followed by a long chase, Cox2p was absent in the
mss2
mutant, confirming that Mss2p is required for
accumulation of Cox2p (Fig. 1B, lane 3). In addition, the absence of
Mss2p caused a decrease in the accumulation of Cox1p, but no other
mitochondrial translation products were affected. As expected, Cox2p
was absent in the pet111 mutant (Fig. 1B, lane 2). When
mitochondrial translation products were radiolabeled for 10 min and
immediately analyzed, Cox2p was labeled at nearly the wild-type rate in
the mss2
mutant, showing that Mss2p is not required for
Cox2p synthesis (Fig. 1B, lane 6). Thus, Mss2p is required for Cox2p
stability but not for Cox2p synthesis. In the absence of either Mss2p
or the COX2 mRNA-specific translational activator Pet111p
(Fig. 1B, lanes 5 and 6), Cox1p labeling was dramatically reduced. The
decrease in Cox1p labeling caused by the absence of Cox2p is apparently
an indirect effect (41). The data in Fig. 1 indicate that
Mss2p has no role in synthesis or stability of the other mitochondrial
translation products analyzed (Fig. 1B, lanes 3 and 6). Furthermore,
spectroscopic analysis (51) of the mss2
mutant revealed the presence of cytochromes c,
c1, and b, while cytochrome
aa3 was absent (data not shown), indicating that the mutation affects cytochrome oxidase but not the
bc1 complex. Apparently the absence of
Mss2p prevents accumulation of Cox2p, which in turn prevents the
accumulation of the cytochrome oxidase complex.

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 1.
Cox2p is unstable in the absence of Mss2p. (A) Cox2p
steady-state levels are reduced in the mss2 mutant.
Whole-cell extracts were prepared from cells grown overnight in YPR
(see Materials and Methods). Extracts were analyzed by Western blotting
with anti-Cox2p and anti-glucose-6-phosphate dehydrogenase (G6P) as a
loading control. Lanes: 1, wild-type (PTH366); 2, pet111
mutant (ECS108); 3, mss2 mutant (SB12). (B) Cox2p is
synthesized but rapidly degraded in an mss2 mutant.
Cells were incubated with cycloheximide and either pulsed with
[35S]methionine for 10 min and chased with cold
methionine for 50 min or pulsed for 10 min with no chase, as indicated
(see Materials and Methods). Mitochondria were isolated, and
translation products were separated by SDS-15% PAGE and detected by
autoradiography. Lanes: 1 and 4, wild type (WT; PTH366); 2 and 5, pet111 (ECS108); 3 and 6, mss2
(SB12).
|
|
To further monitor translation at the
COX2 locus, we took
advantage of the synthetic, mitochondrially encoded
ARG8m gene. Arg8p is normally encoded in
the nucleus and imported into
the mitochondrial matrix where it
participates in arginine biosynthesis.
The synthetic
ARG8m produces the same biosynthetic
enzyme from within the mitochondrial
matrix and has been successfully
used as a reporter for mitochondrial
gene expression (
8,
17,
21,
54). To address whether Mss2p
has a role in the translation of
COX2, the
COX2 coding region
was replaced by the
ARG8m reporter gene in the
mss2
background, and the resulting cells
were spotted
onto medium lacking arginine (Fig.
2).
The
mss2
mutant was Arg
+,
indicating efficient translation of the chimeric
cox2::ARG8m mRNA. In contrast,
the
pet111 mutant was Arg

, as
expected for a mutant defective in
COX2 translation. Thus,
the experiment whose results are shown in Fig.
2 verifies that
Mss2p is
not required for translation of mRNAs coded by the
COX2 locus.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 2.
Expression of a
cox2::ARG8m reporter gene in
mtDNA is independent of Mss2p. Cells were spotted onto synthetic
complete medium lacking arginine or synthetic complete medium
containing arginine as indicated. Plates were incubated for 2 days at
30°C. Strains: WT, wild-type HMD22; mss2, SB20;
pet111, NSG192.
|
|
PET111 interacts with the 5' untranslated leader
(5'-UTL) of
COX2 and is required for targeted
translation of
COX2 (
33,
46). If
PET111 is deleted, translation cannot occur, and the
resulting cells are respiratory deficient
(Pet

). However, the requirement for
PET111 can be bypassed by replacing
the 5'-UTL of
COX2 with the 5'-UTL of
COX3 (COX3-COX2)
(
32).
In this case, pre-Cox2p can presumably be directed
to the inner
membrane by factors involved in targeted translation of
the
COX3 mRNA. We sought to determine whether Mss2p was also
interacting
with the 5'-UTL of the
COX2 mRNA to tether
translation of
COX2 to the inner membrane. To address this
question, we tested whether
the
PET111 suppressor,
COX3-COX2, bypassed the requirement of
Mss2p for respiration
(Fig.
3). A homozygous
mss2
diploid containing
the
COX3-COX2 suppressor
(


) in the presence of a functional
mitochondrial genome (
+) remained respiratory
defective (Fig.
3, upper left quandrant),
while a homozygous
pet111 diploid containing the


COX3-COX2/
+ genome was respiratory competent
(Fig.
3, lower right quandrant).
These results suggest that
MSS2 is not acting through the
COX2 5'-UTL to
promote tethered translation of
COX2 in a
PET111-like
manner.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 3.
MSS2 function cannot be bypassed by
placing the COX3 mRNA 5'-UTL on the COX2
mRNA. Haploid cells containing a synthetic  mtDNA
bearing a chimeric gene specifying a COX2 mRNA with the
5'-UTL of the COX3 mRNA (33) were patched
in horizontal stripes. Their relevant nuclear genotypes were
mss2 pet111 (SB26) and MSS2 pet111
(SB23B). Cells containing wild-type + mtDNA
were patched in vertical stripes. Their relevant nuclear genotypes were
mss2 PET111 (SB12) and MSS2 pet111
(NB39-9c). The stripes were cross-printed on complete medium, and
diploids were selected. The diploids were printed to nonfermentable
medium (YPEG) and incubated for 2 days at 30°C.
|
|
Inactivation of Yta10p (Afg3p) proteolytic activity increases Cox2p
stability in the absence of Mss2p.
There are two AAA proteases
found in the mitochondrial inner membrane that expose catalytic domains
to opposite surfaces of the membrane (30). The
i-AAA protease complex contains Yme1p subunits and is active
in the IMS, whereas the m-AAA protease comprises Yta10p
(Afg3p) and Yta12p (Rca1p) subunits and is active in the mitochondrial
matrix. Together, these proteases mediate degradation of several
mitochondrial proteins.
The Yta10p/Yta12p (
m-AAA) complex is capable of degrading a
variety of mitochondrially synthesized subunits, including subunits
I
and III of cytochrome oxidase (
3,
19). In addition to
proteolytic
activity, the
m-AAA complex has chaperone
activity required for
assembly of respiratory complexes and
respiration-dependent growth
(
2,
57,
62). Mutational
inactivation of the proteolytic
domain of Yta10p prevents proteolysis
of unassembled respiratory
subunits but does not affect assembly of
respiratory subunits
and respiratory competence (
3).
Although Cox2p has not previously
been identified as a substrate of the
m-AAA complex, we tested
whether proteolytic inactivation of
Yta10p by the
yta10E559Q mutation
stabilized Cox2p in the
absence of
Mss2p.
We first analyzed the accumulation of newly synthesized Cox2p in the
mss2
yta10E559Q mutant by using cycloheximide
pulse-labeling.
After a 10-min pulse followed by a 50-min chase, we
found that
Cox2p was stabilized in the
mss2
yta10E559Q
double mutant (Fig.
4A, lane 8) relative
to the
mss2
single mutant (Fig.
4A, lane
6). In addition,
Western analysis of whole-cell extracts revealed
that the steady-state
level of Cox2p was increased in the
mss2
yta10E559Q double mutant relative to the
mss2
single mutant (Fig.
4B, lane 2 and lane 6), although not to wild-type
levels. These
data indicate that the Yta10p protease participates in
degradation
of Cox2p in the absence of Mss2p. Nevertheless, although
Cox2p
was more stable in the double mutant, the
yta10E559Q
mutation
did not restore any detectable respiratory growth in the
absence
of Mss2p (Fig.
4B).

View larger version (63K):
[in this window]
[in a new window]
|
FIG. 4.
Inactivation of Yta10p stabilizes Cox2p in an
mss2 mutant but does not restore respiratory
function. (A) Cells were incubated with cycloheximide, pulsed with
[35S]methionine for 10 min (lanes 1 to 4), and chased
with cold methionine for 50 min (lanes 5 to 8). Crude mitochondria were
analyzed on an SDS-15% polyacrylamide gel, followed by
autoradiography. Lanes: 1 and 4, wild type (WT; J303-1a); 2 and 6, mss2 (SB12); 3 and 7, yta10E559Q
(YGS103); 4 and 8, mss2 yta10E559Q double mutant
(SB49C). (B) Cells were grown overnight in complete medium and spotted
onto YPD and YPEG as indicated or used to prepare whole-cell extracts.
Equal amounts of extracts were analyzed by Western blotting with
anti-Cox2p and anti-glucose-6-phosphate dehydrogenase (G6PD). Lanes: 1, wild type (WT; J303-1a); 2, mss2 (SB48B); 3, yta10E559Q (YGS103); 4, yme1 (SB100);
5, mss2 yme1 (SB101); 6, mss2
yta10EQ (SB49C); 7, mss2 yta10EQ yme1
(SB103).
|
|
Yme1p is required for the degradation of Cox2p that remains unassembled
due to the absence of Cox4p (
34,
64) or cytochrome
c (
38), and was thus a likely candidate for
degrading Cox2p
in the absence of Mss2p. We constructed an
mss2
yme1
double
mutant and examined Cox2p
accumulation by using Western analysis
of whole-cell extract (Fig.
4B).
Cox2p was slightly stabilized
in the
mss2
yme1
double
mutant relative to the
mss2
single
mutant (Fig.
4B, lanes
2 and 5). However, inactivation of both
Yme1p and Yta10p proteases did
not restore Cox2p levels to a much
greater extent than inactivation of
Yta10p protease alone (Fig.
4B, lanes 6 and 7). Thus, in contrast to
its function in
MSS2 strains (
34,
38,
64),
Yme1p has only a minor role in degradation
of Cox2p in the absence of
Mss2p.
Mss2p is required for export of the Cox2p C-terminal domain.
Normally, the nuclearly encoded Arg8p is synthesized in the cytoplasm
and imported into the mitochondrial matrix where it participates in
arginine biosynthesis. The synthetic mitochondrially encoded
ARG8m produces the same functional
biosynthetic enzyme, which is able to complement a nuclear
arg8 mutation (54). When the Arg8p moiety is
fused to the C terminus of Cox2p (Cox2-Arg8p), it is translocated as a
passenger protein through the inner membrane to the IMS
(21). In this case, the exported Arg8p is unable to
participate in arginine synthesis, causing an
Arg
phenotype in certain strain backgrounds
(22). However, the Cox2p moiety of the fusion protein,
which is largely detached from Arg8p by proteolysis in the IMS, assumes
its correct membrane topology, and can assemble into active cytochrome
oxidase. Thus, the resulting cells are respiratory competent
(Pet+). We have used the Cox2-Arg8p fusion to
identify mutants which are export defective by selecting for
Arg+ Pet
phenotypes
(22; S. A. Saracco and T. D. Fox, unpublished data).
We screened transposon mutagenized yeast cells (
11)
containing the
COX2::ARG8m
fusion for the export-defective Pet

Arg
+ phenotype. Characterization of one such
mutant revealed that
the export defective phenotype was due to a
transposon insertion
at the
MSS2 locus. Sequence analysis
indicated that this allele,
mss2::Tn, would give
rise to a truncated protein lacking the C-terminal
third of Mss2p. The
mss2::Tn allele appears to retain some function
since a complete
mss2
mutation, coupled with the
COX2::ARG8m fusion, caused an
Arg

phenotype in this strain background. The
basis for the difference
in Arg growth phenotype between the
mss2::Tn and the
mss2
alleles
remains
unknown.
Previous studies suggested that the Cox2-Arg8p fusion is more difficult
for mitochondria to export than wild-type Cox2p (
22).
We
therefore first sought to determine whether the assembly of
wild-type
Cox2p was defective in the
mss2::Tn mutant.
Assembled
Cox2p is resistant to proteolysis in solubilized
mitochondria,
whereas unassembled Cox2p is not (
22).
Mitochondria from wild-type
or
mss2::Tn cells were
solubilized with detergent, subjected to
increasing amounts of
proteinase K, and analyzed by Western blotting
with anti-Cox2p. Because
steady-state levels of Cox2p are reduced
in the
mss2::Tn mutant, detection of Cox2p in
mss2::Tn extract
required a longer exposure time
than detection of Cox2p in wild-type
extract. As expected, assembled
Cox2p from wild-type mitochondria
was resistant to degradation (Fig.
5A). In contrast, Cox2p from
mss2::Tn mitochondria was highly susceptible to
degradation when
exposed to as little as 5 µg of proteinase K/ml and
was largely
abolished when incubated with 25 µg of proteinase K/ml
(Fig.
5A).
Analysis of
mss2
mitochondria yielded similar
results (data not
shown).

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 5.
Mss2p is required for export of the Cox2 C terminus. (A)
mss2 mutants are defective in assembly of Cox2p into the
proteolytically resistant cytochrome oxidase complex. Purified
mitochondria (180 µg) derived from wild type (WT; DBY947) or the
mss2::Tn mutant (SB44) were solubilized in 1%
octylglucopyranoside and incubated with proteinase K at the indicated
concentrations. Samples were analyzed by Western blotting with a
monoclonal antibody that recognizes an epitope in the Cox2p C terminus
(CCO6) (21). Because steady-state levels of Cox2p are
reduced in the mss2::Tn mutant, detection of
Cox2p in mss2::Tn extract required a longer
exposure time than detection of Cox2p in wild-type extract. (B) The
Cox2p C-terminal domain is protected from protease by the inner
membrane of mitoplasts. Mitochondria (180 µg) from wild type (WT;
DBY947) or mss2::Tn (SB44) were incubated with
or without 25 µg of proteinase K/ml or converted to mitoplasts and
incubated with or without 25 µg of proteinase K/ml, as indicated.
Samples were analyzed by Western blotting with the Cox2p antibody
(CCO6), the cytochrome b2 antibody, or the
citrate synthase antibody. Cytochrome b2 is
a IMS marker which is used to assess mitoplasting efficiency. Citrate
synthase is a matrix space marker used to demonstrate that the
mitochondrial inner membrane is still intact.
|
|
We next assessed whether the Cox2p C terminus is exported across the
inner membrane in the absence of Mss2p function. If the
unassembled
Cox2p in the
mss2::Tn mutant were exported across
the inner membrane, then it would be sensitive to exogenously
added
protease in mitoplasts, lacking the outer membrane. If unassembled
Cox2p were not exported in the mutant, it would remain in the
matrix
and be protected from protease degradation by the inner
membrane.
Purified mitochondria derived from the
mss2::Tn
mutant
were converted to mitoplasts by osmotic shock. Mitochondria or
mitoplasts were subjected to 25 µg of proteinase K/ml, sufficient
to
degrade unassembled Cox2p in solubilized mitochondria. Samples
were
analyzed by Western blotting with an antibody to the Cox2p
C terminus.
In mitoplasts derived from the
mss2::Tn mutant,
the
Cox2p C terminus was protected from protease but shortened (Fig.
5B). Thus, the unassembled Cox2p was protected by the inner membrane.
The shortening of Cox2p by added protease in this experiment was
presumably due to successful export of the Cox2p N terminus in
the
absence of Mss2p (see below). Similar results were obtained
in analysis
of mitochondria from the
mss2
mutant (data not shown).
As
expected, Cox2p derived from wild-type mitoplasts was resistant
to
degradation (Fig.
5B, left), even though it is properly exported,
because it is assembled into a proteolytically resistant complex.
Analogous experiments were performed on
mss2 mutants
carrying
the Cox2-Arg8 fusion protein. Consistent with the
aforementioned
results, the Cox2p-Arg8p fusion protein was protected
from protease
by the inner membranes of the
mss2 mutants, as
previously observed
for
pnt1 mutants (
22) (data
not shown). Taken together, these
data indicate that the absence of
Mss2p inhibits assembly of Cox2p
into cytochrome oxidase, because the
Cox2p C terminus is not exported
across the inner
membrane.
In the absence of Mss2p, the Cox2 N terminus is exported
normally.
The experiment of Fig. 5 suggests that the N terminus of
Cox2p may be successfully exported in the mss2::Tn
mutant. To further examine Cox2p N-terminal export, we took advantage
of a fusion protein in which the first 67 amino acids of Cox2p,
containing the first transmembrane domain, are fused to mitochondrially
coded Arg8p. In otherwise wild-type cells, the Cox2p N-terminal domain of Cox2 (amino acids 1 to 67)-Arg8p [Cox2(1-67)-Arg8p] is
translocated through the inner membrane to the IMS, while the Arg8p
moiety remains in the matrix (21). Mitochondria or
mitoplasts from wild-type or mss2
cells containing the
Cox2(1-67)-Arg8p fusion were incubated with or without proteinase K. In
wild-type mitoplasts subjected to protease, Cox2-Arg8p was shortened by
removal of the exposed Cox2p N-tail (Fig.
6A). The fusion protein behaved similarly
in mss2
mitoplasts subjected to protease, indicating that
its Cox2p N tail is exported in the absence of Mss2p function (Fig.
6A).

View larger version (81K):
[in this window]
[in a new window]
|
FIG. 6.
Mss2p is not required for export of the Cox2 N terminus.
(A) The N tail of Cox2 (1-67)-Arg8mp is exported and
susceptible to exogenously added protease. Purified mitochondria and
mitoplasts derived from wild type (WT; SH36) or mss2
(SB35) cells were incubated with or without 75 µg of proteinase K/ml,
and samples were analyzed by Western blotting with anti-Arg8p,
anti-b2, and anti-citrate synthase (C.S.).
(B) The leader peptide of pre-Cox2p is processed normally in the
absence of Mss2p. Cells were incubated in the presence of cycloheximide
and pulsed for 10 min with [35S]methionine. Mitochondrial
translation products were separated on an SDS-12% polyacrylamide gel
and analyzed by autoradiography. (The relative mobilities of Cox2p and
cytochrome b are reversed on 12% gels relative to the
15% gels used in other figures.) Strains: wild type (WT; PTH366);
pet111, ECS108; mss2, SB12;
imp1, SH105. The mature cleaved form of Cox2p is
indicated as mCox2p, while uncleaved pre-Cox2p is indicated as
pCox2p.
|
|
Cox2p is synthesized as a precursor protein (pre-Cox2p) (
43,
50). After N-tail export, the first 15 amino acids of pre-Cox2p
are cleaved by the Imp protease complex, producing mature Cox2p
(
36,
43,
47). In an
imp1 mutant, the pre-Cox2p
leader peptide
is not processed, and the precursor can be detected as a
slower-migrating
protein after pulse-labeling in the presence of
cycloheximide.
We therefore used pulse-labeling to study the relative
size of
Cox2p in the
mss2
mutant. Wild-type,
pet111,
imp1, or
mss2
cells
were
pulse-labeled for 10 min, and mitochondrial translation products
were
analyzed on a 12% gel (Fig.
6B). As expected, no Cox2p accumulated
in
the
pet111 mutant that is unable to synthesize Cox2p.
However,
Cox2p derived from the
mss2
mutant was similar
in size to wild-type
Cox2p and shorter than Cox2p from the
imp1 mutant. These data
confirm that N-tail export and
subsequent processing occur normally
in the absence of
Mss2p.
Mss2p is a mitochondrial matrix protein that is peripherally
associated with the inner membrane.
To determine the cellular
localization of Mss2p, we tagged the protein by attaching codons for a
triple HA epitope to the chromosomal MSS2 gene (see
Materials and Methods). Cells containing the tagged protein were
respiratory competent, indicating that Mss2p-HA was functional.
Whole-cell extracts derived from cells containing MSS2-HA or
MSS2 were analyzed by Western blotting with the anti-HA
antibody (Fig. 7A). Anti-HA specifically
reacted with a doublet band of the expected size for Mss2p-HA in the
extract derived from the tagged strain (Fig. 7A). Purified mitochondria and cytosolic fractions derived from the MSS2-HA strain were
analyzed by Western blotting with the anti-HA antibody (Fig. 7B).
Mss2p-HA was found predominantly in the mitochondrial fraction (Fig.
7B, lane 1). Thus, Mss2p-HA is localized to the mitochondria.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 7.
Mss2p is a mitochondrial matrix protein that is
peripherally associated with the inner membrane. (A) Whole-cell
extracts derived from cells containing MSS2-HA or
MSS2 were analyzed by Western blotting with the antibody
against the HA epitope (3F10) and anti-Arg8p. Lanes: 1, MSS2 (TF215); 2, MSS2-HA (SB19A). (B)
Mss2p-HA copurifies with mitochondria. Purified mitochondria (see
Materials and Methods) (lane 1) or cytosol (lane 2) derived from the
MSS2-HA strain (SB19A) were analyzed by Western blotting
with anti-HA, anti-Arg8p, and anti-glucose-6-phosphate (G6PD). (C)
Mss2p-HA is a peripheral membrane protein. Purified mitochondria from
the MSS2-HA strain were sonicated and centrifuged to
separate the insoluble membrane fraction (lane 1) and the soluble
fraction (lane 2). The membrane pellet was extracted with sodium
carbonate and centrifuged to separate insoluble integral membrane
proteins (lane 3) from solubilized peripheral membrane proteins (lane
4). Samples were analyzed by using Western blotting with anti-HA,
anti-Arg8p, and anti-Cox2p. (D) Mss2p-HA is largely protected from
protease by the inner membrane. Purified mitochondria or mitoplasts
containing Mss2p-HA were subjected to digestion with proteinase K. Samples were analyzed by using Western blotting with anti-HA,
anti-cytochrome b2, and anti-Arg8p.
|
|
We next determined the submitochondrial location of Mss2p-HA.
Mitochondria derived from
MSS2-HA cells were sonicated to
disrupt
mitochondrial membranes and centrifuged to separate insoluble
membrane proteins from soluble proteins. Western analysis revealed
that
Mss2p-HA was found in the insoluble membrane fraction (Fig.
7C, lane 1)
and not in the soluble supernatant (Fig.
7C, lane
2), indicating that
Mss2p is associated with mitochondrial membranes.
Consistent with
membrane association, Mss2p-HA was solubilized
by the addition of 1%
Triton X-100 (not shown). To determine whether
Mss2p is peripherally or
integrally associated with mitochondrial
membranes, alkaline carbonate
extraction was performed on the
insoluble membrane fraction. Peripheral
membrane proteins are
extracted from membranes by using
alkaline carbonate, while integral
membrane protein are not
(
15). Mss2p-HA was largely extracted
from the membrane
pellet (Fig.
7C, lane 4), indicating that Mss2p
is a peripheral
membrane protein. Consistent with this observation,
the hydrophobicity
profile (
29) of Mss2p does not indicate the
presence of
any membrane spanning domains (data not shown). Finally,
we analyzed
the protease sensitivity of Mss2p-HA in mitoplasts
(Fig.
7D).
Mss2p-HA was protected from degradation by the inner
membrane of
mitoplasts. Taken together, these data indicate that
Mss2p is a
mitochondrial matrix protein that is peripherally associated
with the
inner surface of the inner
membrane.
 |
DISCUSSION |
The nuclear gene MSS2 was originally identified by
mutations that prevented accumulation of mitochondrially coded Cox2p by blocking an undefined posttranscriptional step (52), and
we have set out to further elucidate its function. We found that the
gene product, Mss2p, is present in the mitochondrial matrix as a
peripherally bound inner membrane protein and thus presumably has a
direct role in mitochondrial gene expression.
Mss2p is not required for translation of the COX2 mRNA,
since Cox2p was pulse-labeled normally in an mss2
mutant.
In addition, the mss2
had no effect on expression from
the COX2 locus of the mitochondrial reporter gene
ARG8m. Despite normal synthesis in the
absence of Mss2p, pulse-labeled Cox2p was largely degraded during a
chase period, and steady-state accumulation was dramatically
decreased. Therefore, Mss2p functions to stabilize Cox2p. Proper
localization of Cox2p synthesis depends upon targeting information in
the untranslated portions of its mRNA, and incorrect targeting can lead
to degradation of the protein (46). However, the Mss2p
function could not be bypassed by synthesis of Cox2p from a chimeric
mRNA with the 5'-untranslated leader of the COX3 mRNA,
indicating that Mss2 is not involved in mRNA localization.
A key clue to the function of Mss2p was our isolation of an
mss2 mutant in a genetic screen (22) for
strains with defects in the ability to export the C-terminal domain of
a Cox2p-Arg8p fusion protein from the matrix. By examining the protease
sensitivity of Cox2p in mitochondria and mitoplasts from the
mss2 mutant, we found that it is not assembled into the
cytochrome oxidase complex and that the Cox2p C-terminal domain
remained inside the inner membrane. However, the Cox2p N-terminal
domain was exported efficiently. A previous study demonstrated that
export of the Cox2p C-terminal domain depends upon a potential across
the inner membrane, while export of the N-terminal domain does not
(21). Our observation that the mss2
blocks
C-tail export, but not N-tail export, confirms that these two processes
are mechanistically distinct.
Degradation of Cox2p in the mss2
mutant is presumably
triggered by failure to export the C tail and thus likely to initiate on the matrix side of the inner membrane. Consistent with this idea, we
found that the IMS-localized ATP-dependent i-AAA protease Yme1p plays only a minor role in degrading Cox2p in an mss2
mutant, in contrast to its role in MSS2 strains (34,
38, 64). We found instead that in vivo degradation of newly
synthesized pulse-labeled Cox2p was almost entirely blocked by
inactivation of the matrix localized m-AAA protease subunit,
Yta10p(Afg3p). However, when we examined the steady-state level of
Cox2p in an mss2
mutant lacking this proteolytic
activity, it was increased substantially relative to the
mss2
containing the protease but was still far lower than
that of the wild type. Thus, it appears that rapid degradation of Cox2p
in the absence of Mss2p is carried out largely by Yta10p, but it is not
the only protease to participate in Cox2p degradation over longer time
periods. Since proteolytic inactivation of both Yta10p and Yme1p did
not completely restore Cox2p levels, it is clear that other
mitochondrial proteases must be involved in the degradation of Cox2p in
the absence of Mss2p. Candidates include the Yta12p(Rca1p) component of
the m-AAA protease and the lon homolog Pim1p
(56, 63).
It is important to note that although Cox2p accumulation is increased
by inactivation of Yta10p, there is no detectable suppression of the
mss2
respiratory growth defect. Thus, it appears that the
primary effect of mss2
is to prevent export of the Cox2p C tail and that the stability defect is secondary. In addition to
Mss2p, three other proteins are known to have roles in exporting domains of Cox2p through the inner membrane. N-tail export requires the
activity of Oxa1p (21, 23), a conserved integral inner membrane protein (4, 7, 9, 25, 27, 49), which interacts directly with mitochondrially synthesized polypeptides
(24). Cox2p C-tail export is also dependent upon Oxa1p
(21, 23), but this could be an indirect effect if C-tail
export is dependent for other reasons upon prior translocation of the
N-tail. Pnt1p is an integral inner membrane protein required for export
of the Cox2p-Arg8p fusion protein (22). Pnt1p is not
essential for C-tail export in S. cerevisiae but is
essential in Kluyveromyces lactis (22).
Finally, Cox18p, an integral inner membrane protein required for
cytochrome oxidase assembly (53), has been found to be
necessary for C-tail but not for N-tail export (Saracco and Fox, unpublished).
The precise role of Mss2p in Cox2 C-tail export is unclear. Mss2p is
unlikely to function in establishing the inner membrane potential
necessary for Cox2 C-tail export, because inner membrane potential is
required for the essential process of protein import (40),
while MSS2 is not an essential gene. Mss2p is unlikely to
function as a translocase since it is not embedded in the inner membrane. However, Mss2p could function as a receptor and/or chaperone to deliver the Cox2p C-terminal domain to its translocation system. In
this scenario, Mss2p could either interact directly with Cox2p or
indirectly through other components. For example, it could organize other mitochondrial chaperones (mtHsp70) or
translocation machinery components (Pnt1p, Oxa1p, and Cox18p). Implicit
in this proposal is the idea that Cox2p C-tail export may be a
posttranslational process (see below), in contrast to N-tail export,
which is likely to occur during synthesis (21, 24, 42).
We selected the mss2::Tn allele owing to the fact
that it prevents export of the Cox2p-Arg8p fusion protein and thereby
causes an Arg+ growth phenotype. Surprisingly,
however, the mss2
allele in the same strain background
does not cause an Arg+ phenotype as a result of
blocking export. This is intriguing since both strains contain similar
steady-state levels of the Cox2p-Arg8p fusion protein in the
mitochondrial matrix (data not shown). Clearly the
mss2::Tn allele has a partial function lacking in
the deletion. Perhaps this partial function assists folding of the
Arg8p enzymatic domain fused to Cox2p. However, Mss2p is not absolutely
required for folding Arg8p, since in another strain background with
more robust mitochondrial gene expression, the mss2
does
not cause an Arg
phenotype in strains
expressing the Cox2-Arg8p fusion. The Pet
phenotype of mss2 mutations is not affected by strain background.
Analysis of the Mss2p sequence has not revealed any close homologs.
However, Mss2p contains at least one motif resembling a TPR sequence
(Fig. 8). The TPR motif comprises a
highly degenerate 34-amino-acid sequence which has been implicated in a
variety of protein-protein interactions (5).
Interestingly, the Mss2p TPR domain is very similar to one of the TPR
domains present in Tom70p, a receptor on the surface of the
mitochondrial outer membrane for certain proteins imported from the
cytoplasm (10, 26, 28, 55). The TPR motifs of Tom70p are
thought to facilitate interactions with other proteins involved in the
import process (20, 28). The Mss2p TPR-like motif is also
similar to a domain of Sti1p, a cytosolic cochaperonin
whose TPR motifs mediate interaction with Hsp90p
(44). Interestingly, the uncharacterized product of the
yeast gene PET117, which is required for cytochrome oxidase assembly (31), also contains a TPR motif similar to that
of Mss2p. We suggest that, based on these observations, the folding of
the Cox2 C tail may be obligatory for subsequent export to the IMS and
that Mss2p may function to organize this folding process on the matrix
side of the inner membrane. The export pathway for the Cox2p C tail may
be similar to several other pathways known to translocate folded
proteins across membranes (58).

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 8.
Mss2p has at least one TPR-like motif. Analysis of the
Mss2p sequence by using the ProDom protein domain database
(http://www.toulouse.inra.fr/prodom.html) indicated the presence of
a TPR-like motif (12). This region of Mss2p is aligned
with TPR motifs of Tom70p, Sti1p, and Pet117 (see Discussion). Boxed
letters represent amino acid identity with Mss2p sequence. Shaded
letters represent amino acid similarity with the Mss2p sequence. The
gray bar above the sequences delimits the TPR-like motif in Mss2p.
|
|
 |
ACKNOWLEDGMENTS |
We thank T. Langer for the yta10E559Q strains and for helpful
discourse, G. Schatz for the anti-citrate synthase, and T. L. Mason for the anti-Cox2p.
This work was supported by U.S. National Institutes of Health training
grant GM07617 and research grant GM29362.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Biology and Genetics, Cornell University, Ithaca, NY 14853. Phone: (607) 254-4835. Fax: (607) 255-6249. E-mail:
tdf1{at}cornell.edu.
 |
REFERENCES |
| 1.
|
Altamura, N.,
N. Capitanio,
N. Bonnefoy,
S. Papa, and G. Dujardin.
1996.
The Saccharomyces cerevisiae OXA1 gene is required for the correct assembly of cytochrome c oxidase and oligomycin-sensitive ATP synthase.
FEBS Lett.
382:111-115[CrossRef][Medline].
|
| 2.
|
Arlt, H.,
G. Steglich,
R. Perryman,
B. Guiard,
W. Neupert, and T. Langer.
1998.
The formation of respiratory chain complexes in mitochondria is under the proteolytic control of the m-AAA protease.
EMBO J.
17:4837-4847[CrossRef][Medline].
|
| 3.
|
Arlt, H.,
R. Tauer,
H. Feldmann,
W. Neupert, and T. Langer.
1996.
The YTA10-12 complex, an AAA protease with chaperone-like activity in the inner membrane of mitochondria.
Cell
85:875-885[CrossRef][Medline].
|
| 4.
|
Bauer, M.,
M. Behrens,
K. Esser,
G. Michaelis, and E. Pratje.
1994.
PET1402, a nuclear gene required for proteolytic processing of cytochrome oxidase subunit 2 in yeast.
Mol. Gen. Genet.
245:272-278[CrossRef][Medline].
|
| 5.
|
Blatch, G. L., and M. Lassle.
1999.
The tetratricopeptide repeat: a structural motif mediating protein-protein interactions.
Bioessays
21:932-939[CrossRef][Medline].
|
| 6.
|
Bonnefoy, N.,
N. Bsat, and T. D. Fox.
2001.
Mitochondrial translation of Saccharomyces cerevisiae COX2 mRNA is controlled by the nucleotide sequence specifying the pre-Cox2p leader peptide.
Mol. Cell. Biol.
21:2359-2372[Abstract/Free Full Text].
|
| 7.
|
Bonnefoy, N.,
F. Chalvet,
P. Hamel,
P. P. Slonimski, and G. Dujardin.
1994.
OXA1, a Saccharomyces cerevisiae nuclear gene whose sequence is conserved from prokaryotes to eukaryotes controls cytochrome oxidase biogenesis.
J. Mol. Biol.
239:201-212[CrossRef][Medline].
|
| 8.
|
Bonnefoy, N., and T. D. Fox.
2000.
In vivo analysis of mutated initiation codons in the mitochondrial COX2 gene of Saccharomyces cerevisiae fused to the reporter gene ARG8m reveals lack of downstream reinitiation.
Mol. Gen. Genet.
262:1036-1046[CrossRef][Medline].
|
| 9.
|
Bonnefoy, N.,
M. Kermorgant,
O. Groudinsky,
M. Minet,
P. P. Slonimski, and G. Dujardin.
1994.
Cloning of a human gene involved in cytochrome oxidase assembly by functional complementation of an oxa1 mutation in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
91:11978-11982[Abstract/Free Full Text].
|
| 10.
|
Brix, J.,
G. A. Ziegler,
K. Dietmeier,
J. Schneider-Mergener,
G. E. Schulz, and N. Pfanner.
2000.
The mitochondrial import receptor tom70: identification of a 25-kDa core domain with a specific binding site for preproteins.
J. Mol. Biol.
303:479-488[CrossRef][Medline].
|
| 11.
|
Burns, N.,
B. Grimwade,
P. B. Ross-Macdonald,
E.-Y. Choi,
K. Finberg,
G. S. Roeder, and M. Snyder.
1994.
Large-scale analysis of gene expression, protein localization, and gene disruption in Saccharomyces cerevisiae.
Genes Dev.
8:1087-1105[Abstract/Free Full Text].
|
| 12.
|
Corpet, F.,
F. Servant,
J. Gouzy, and D. Kahn.
2000.
ProDom and ProDom-CG: tools for protein domain analysis and whole genome comparisons.
Nucleic Acids Res.
28:267-269[Abstract/Free Full Text].
|
| 13.
|
Dunstan, H. M.,
N. S. Green-Willms, and T. D. Fox.
1997.
In vivo analysis of Saccharomyces cerevisiae COX2 mRNA 5'-untranslated leader functions in mitochondrial translation initiation and translational activation.
Genetics
147:87-100[Abstract].
|
| 14.
|
Fox, T. D.,
L. S. Folley,
J. J. Mulero,
T. W. McMullin,
P. E. Thorsness,
L. O. Hedin, and M. C. Costanzo.
1991.
Analysis and manipulation of yeast mitochondrial genes.
Methods Enzymol.
194:149-165[Medline].
|
| 15.
|
Fujiki, Y.,
A. L. Hubbard,
S. Fowler, and P. B. Lazarow.
1982.
Isolation of intracellular membranes by means of sodium carbonate treatment: application to endoplasmic reticulum.
J. Cell Biol.
93:97-102[Abstract/Free Full Text].
|
| 16.
|
Glick, B. S., and L. A. Pon.
1995.
Isolation of highly purified mitochondria from Saccharomyces cerevisiae.
Methods Enzymol.
260:213-223[Medline].
|
| 17.
|
Green-Willms, N. S.,
C. A. Butler,
H. M. Dunstan, and T. D. Fox.
2001.
Pet111p, an inner membrane-bound translational activator that limits expression of the Saccharomyces cerevisiae mitochondrial gene COX2.
J. Biol. Chem.
276:6392-6397[Abstract/Free Full Text].
|
| 18.
|
Grivell, L. A.,
M. Artal-Sanz,
G. Hakkaart,
L. de Jong,
L. G. Nijtmans,
K. van Oosterum,
M. Siep, and H. van der Spek.
1999.
Mitochondrial assembly in yeast.
FEBS Lett.
452:57-60[CrossRef][Medline].
|
| 19.
|
Guélin, E.,
M. Rep, and L. A. Grivell.
1996.
Afg3p, a mitochondrial ATP-dependent metalloprotease is involved in degradation of mitochondrially encoded Cox1, Cox3, Cob, Su6, Su8, and Su9 subunits of the inner membrane complexes III, IV, and V.
FEBS Lett.
381:42-46[CrossRef][Medline].
|
| 20.
|
Haucke, V.,
M. Horst,
G. Schatz, and T. Lithgow.
1996.
The Mas20p and Mas70p subunits of the protein import receptor of yeast mitochondria interact via the tetratricopeptide repeat motif in Mas20p: evidence for a single hetero-oligomeric receptor.
EMBO J.
15:1231-1237[Medline].
|
| 21.
|
He, S., and T. D. Fox.
1997.
Membrane translocation of mitochondrially coded Cox2p: distinct requirements for export of amino- and carboxy-termini, and dependence on the conserved protein Oxa1p.
Mol. Biol. Cell
8:1449-1460[Abstract].
|
| 22.
|
He, S., and T. D. Fox.
1999.
Mutations affecting a yeast mitochondrial inner membrane protein, Pnt1p, block export of a mitochondrially synthesized fusion protein from the matrix.
Mol. Cell. Biol.
19:6598-6607[Abstract/Free Full Text].
|
| 23.
|
Hell, K.,
J. Herrmann,
E. Pratje,
W. Neupert, and R. A. Stuart.
1997.
Oxa1p mediates the export of the N- and C-termini of pCoxII from the mitochondrial matrix to the intermembrane space.
FEBS Lett.
418:367-370[CrossRef][Medline].
|
| 24.
|
Hell, K.,
J. M. Herrmann,
E. Pratje,
W. Neupert, and R. A. Stuart.
1998.
Oxa1p, an essential component of the N-tail protein export machinery in mitochondria.
Proc. Natl. Acad. Sci. USA
95:2250-2255[Abstract/Free Full Text].
|
| 25.
|
Herrmann, J. M.,
W. Neupert, and R. A. Stuart.
1997.
Insertion into the mitochondrial inner membrane of a polytopic protein, the nuclear-encoded Oxa1p.
EMBO J.
16:2217-2226[CrossRef][Medline].
|
| 26.
|
Hines, V.,
A. Brandt,
G. Griffiths,
H. Horstmann,
H. Brütsch, and G. Schatz.
1990.
Protein import into yeast mitochondria is accelerated by the outer membrane protein MAS70.
EMBO J.
9:3191-3200[Medline].
|
| 27.
|
Kermorgant, M.,
N. Bonnefoy, and G. Dujardin.
1997.
Oxa1p, which is required for cytochrome c oxidase and ATP synthase complex formation, is embedded in the mitochondrial inner membrane.
Curr. Genet.
31:302-307[CrossRef][Medline].
|
| 28.
|
Komiya, T.,
S. Rospert,
G. Schatz, and K. Mihara.
1997.
Binding of mitochondrial precursor proteins to the cytoplasmic domains of the import receptors Tom70 and Tom20 is determined by cytoplasmic chaperones.
EMBO J.
16:4267-4275[CrossRef][Medline].
|
| 29.
|
Kyte, J., and R. F. Doolittle.
1982.
A simple method for displaying the hydropathic character of a protein.
J. Mol. Biol.
157:105-132[CrossRef][Medline].
|
| 30.
|
Leonhard, K.,
J. M. Herrmann,
R. A. Stuart,
G. Mannhaupt,
W. Neupert, and T. Langer.
1996.
AAA proteases with catalytic sites on opposite membrane surfaces comprise a proteolytic system for the ATP-dependent degradation of inner membrane proteins in mitochondria.
EMBO J.
15:4218-4229[Medline].
|
| 31.
|
McEwen, J. E.,
K. H. Hong,
S. Park, and G. T. Preciado.
1993.
Sequence and chromosomal localization of two PET genes required for cytochrome c oxidase assembly in Saccharomyces cerevisiae.
Curr. Genet.
23:9-14[CrossRef][Medline].
|
| 32.
|
Mulero, J. J., and T. D. Fox.
1993.
Alteration of the Saccharomyces cerevisiae COX2 5'-untranslated leader by mitochondrial gene replacement and functional interaction with the translational activator protein PET111.
Mol. Biol. Cell
4:1327-1335[Abstract].
|
| 33.
|
Mulero, J. J., and T. D. Fox.
1993.
PET111 acts in the 5'-leader of the Saccharomyces cerevisiae mitochondrial COX2 mRNA to promote its translation.
Genetics
133:509-516[Abstract].
|
| 34.
|
Nakai, T.,
T. Yasuhara,
Y. Fujiki, and A. Ohashi.
1995.
Multiple genes, including a member of the AAA family, are essential for degradation of unassembled subunit 2 of cytochrome c oxidase in yeast mitochondria.
Mol. Cell. Biol.
15:4441-4452[Abstract].
|
| 35.
|
Neff, N. F.,
J. H. Thomas,
P. Grisafi, and D. Botstein.
1983.
Isolation of the -tubulin gene from yeast and demonstration of its essential function in vivo.
Cell
33:211-219[CrossRef][Medline].
|
| 36.
|
Nunnari, J.,
T. D. Fox, and P. Walter.
1993.
A mitochondrial protease with two catalytic subunits of nonoverlapping specificities.
Science
262:1997-2004[Abstract/Free Full Text].
|
| 37.
|
Ostermeier, C.,
A. Harrenga,
U. Ermler, and H. Michel.
1997.
Structure at 2.7 Å resolution of the Paracoccus denitrificans two-subunit cytochrome c oxidase complexed with an antibody FV fragment.
Proc. Natl. Acad. Sci. USA
94:10547-10553[Abstract/Free Full Text].
|
| 38.
|
Pearce, D. A., and F. Sherman.
1995.
Degradation of cytochrome oxidase subunits in mutants of yeast lacking cytochrome c and suppression of the degradation by mutation of yme1.
J. Biol. Chem.
270:20879-20882[Abstract/Free Full Text].
|
| 39.
|
Pinkham, J. L.,
A. M. Dudley, and T. L. Mason.
1994.
T7 RNA polymerase-dependent expression of COXII in yeast mitochondria.
Mol. Cell. Biol.
14:4643-4652[Abstract/Free Full Text].
|
| 40.
|
Pon, L., and G. Schatz.
1991.
Biogenesis of yeast mitochondria, p. 333-406.
In
J. R. Broach, J. R. Pringle, and E. W. Jones (ed.), The molecular and cellular biology of the yeast Saccharomyces: genome dynamics, protein synthesis, and energetics, vol. 1. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 41.
|
Poutre, C. G., and T. D. Fox.
1987.
PET111, a Saccharomyces cerevisiae nuclear gene required for translation of the mitochondrial mRNA encoding cytochrome c oxidase subunit II.
Genetics
115:637-647[Abstract/Free Full Text].
|
| 42.
|
Poyton, R. O.,
D. M. J. Duhl, and G. H. D. Clarkson.
1992.
Protein export from the mitochondrial matrix.
Trends Cell Biol.
2:369-375[CrossRef][Medline].
|
| 43.
|
Pratje, E.,
G. Mannhaupt,
G. Michaelis, and K. Beyreuther.
1983.
A nuclear mutation prevents processing of a mitochondrially encoded membrane protein in Saccharomyces cerevisiae.
EMBO J.
2:1049-1054[Medline].
|
| 44.
|
Prodromou, C.,
G. Siligardi,
R. O'Brien,
D. N. Woolfson,
L. Regan,
B. Panaretou,
J. E. Ladbury,
P. W. Piper, and L. H. Pearl.
1999.
Regulation of Hsp90 ATPase activity by tetratricopeptide repeat (TPR)-domain cochaperones.
EMBO J.
18:754-762[CrossRef][Medline].
|
| 45.
|
Rose, M. D.,
F. Winston, and P. Hieter.
1988.
Methods in yeast genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 46.
|
Sanchirico, M. E.,
T. D. Fox, and T. L. Mason.
1998.
Accumulation of mitochondrially synthesized Saccharomyces cerevisiae Cox2p and Cox3p depends on targeting information in untranslated portions of their mRNAs.
EMBO J.
17:5796-5804[CrossRef][Medline].
|
| 47.
|
Schneider, A.,
M. Behrens,
P. Scherer,
E. Pratje,
G. Michaelis, and G. Schatz.
1991.
Inner membrane protease I, an enzyme mediating intramitochondrial protein sorting in yeast.
EMBO J.
10:247-254[Medline].
|
| 48.
|
Schneider, B. L.,
W. Seufert,
B. Steiner,
Q. H. Yang, and A. B. Futcher.
1995.
Use of polymerase chain reaction epitope tagging for protein tagging in Saccharomyces cerevisiae.
Yeast
11:1265-1274[CrossRef][Medline].
|
| 49.
|
Scotti, P. A.,
M. L. Urbanus,
J. Brunner,
J. W. de Gier,
G. von Heijne,
C. van Der Does,
A. J. Driessen,
B. Oudega, and J. Luirink.
2000.
YidC, the Escherichia coli homologue of mitochondrial Oxa1p, is a component of the Sec translocase.
EMBO J.
19:542-549[CrossRef][Medline].
|
| 50.
|
Sevarino, K. A., and R. O. Poyton.
1980.
Mitochondrial biogenesis: identification of a precursor to yeast cytochrome c oxidase subunit II, an integral polypeptide.
Proc. Natl. Acad. Sci. USA
77:142-146[Abstract/Free Full Text].
|
| 51.
|
Sherman, F.,
G. R. Fink, and C. W. Lawrence.
1974.
Methods in yeast genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 52.
|
Simon, M.,
B. Séraphin, and G. Faye.
1995.
The nuclear-encoded MSS2 gene is involved in the expression of the mitochondrial cytochrome c oxidase subunit 2(Cox2).
Biochim. Biophys. Acta
1228:95-98[Medline].
|
| 53.
|
Souza, R. L.,
N. S. Green-Willms,
T. D. Fox,
A. Tzagoloff, and F. G. Nobrega.
2000.
Cloning and characterization of COX18, a Saccharomyces cerevisiae pet gene required for the assembly of cytochrome oxidase.
J. Biol. Chem.
275:14898-14902[Abstract/Free Full Text].
|
| 54.
|
Steele, D. F.,
C. A. Butler, and T. D. Fox.
1996.
Expression of a recoded nuclear gene inserted into yeast mitochondrial DNA is limited by mRNA-specific translational activation.
Proc. Natl. Acad. Sci. USA
93:5253-5257[Abstract/Free Full Text].
|
| 55.
|
Steger, H. F.,
T. Sollner,
M. Kiebler,
K. A. Dietmeier,
R. Pfaller,
K. S. Trulzsch,
M. Tropschug,
W. Neupert, and N. Pfanner.
1990.
Import of ADP/ATP carrier into mitochondria: two receptors act in parallel.
J. Cell Biol.
111:2353-2363[Abstract/Free Full Text].
|
| 56.
|
Suzuki, C. K.,
K. Suda,
N. Wang, and G. Schatz.
1994.
Requirement for the yeast gene LON in intramitochondrial proteolysis and maintenance of respiration.
Science
264:273-276[Abstract/Free Full Text].
|
| 57.
|
Tauer, R.,
G. Mannhaupt,
R. Schnall,
A. Pajic,
T. Langer, and H. Feldmann.
1994.
Yta10p, a member of a novel ATPase family in yeast, is essential for mitochondrial function.
FEBS Lett.
353:197-200[CrossRef][Medline].
|
| 58.
|
Teter, S. A., and D. J. Klionsky.
1999.
How to get a folded protein across a membrane.
Trends Cell Biol.
9:428-431[CrossRef][Medline].
|
| 59.
|
Thomas, B. J., and R. Rothstein.
1989.
Elevated recombination rates in transcriptionally active DNA.
Cell
56:619-630[CrossRef][Medline].
|
| 60.
|
Thorsness, P. E.,
K. H. White, and T. D. Fox.
1993.
Inactivation of YME1, a member of the ftsH-SEC18-PAS1-CDC48 family of putative ATPase-encoding genes, causes increased escape of DNA from mitochondria in Saccharomyces cerevisiae.
Mol. Cell. Biol.
13:5418-5426[Abstract/Free Full Text].
|
| 61.
|
Tsukihara, T.,
H. Aoyama,
E. Yamashita,
T. Tomizaki,
H. Yamaguchi,
K. Shinzawa-Itoh,
R. Nakashima,
R. Yaono, and S. Yoshikawa.
1996.
The whole structure of the 13-subunit oxidized cytochrome c oxidase at 2.8 Å.
Science
272:1136-1144[Abstract].
|
| 62.
|
Tzagoloff, A.,
J. Yue,
J. Jang, and M. F. Paul.
1994.
A new member of a family of ATPases is essential for assembly of mitochondrial respiratory chain and ATP synthetase complexes in Saccharomyces cerevisiae.
J. Biol. Chem.
269:26144-26151[Abstract/Free Full Text].
|
| 63.
|
Van Dyck, L.,
D. A. Pearce, and F. Sherman.
1994.
PIM1 encodes a mitochondrial ATP-dependent protease that is required for mitochondrial function in the yeast Saccharomyces cerevisiae.
J. Biol. Chem.
269:238-242[Abstract/Free Full Text].
|
| 64.
|
Weber, E. R.,
T. Hanekamp, and P. E. Thorsness.
1996.
Biochemical and functional analysis of the YME1 gene product, an ATP and zinc-dependent mitochondrial protease from S. cerevisiae.
Mol. Biol. Cell
7:307-317[Abstract].
|
| 65.
|
Yaffe, M. P.
1991.
Organelle inheritance in the yeast cell cycle.
Trends Cell Biol.
1:160-164[CrossRef][Medline].
|
Molecular and Cellular Biology, November 2001, p. 7663-7672, Vol. 21, No. 22
0270-7306/01/$04.00+0 DOI: 10.1128/MCB.21.22.7663-7672.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Fiumera, H. L., Dunham, M. J., Saracco, S. A., Butler, C. A., Kelly, J. A., Fox, T. D.
(2009). Translocation and Assembly of Mitochondrially Coded Saccharomyces cerevisiae Cytochrome c Oxidase Subunit Cox2 by Oxa1 and Yme1 in the Absence of Cox18. Genetics
182: 519-528
[Abstract]
[Full Text]
-
Fiumera, H. L., Broadley, S. A., Fox, T. D.
(2007). Translocation of Mitochondrially Synthesized Cox2 Domains from the Matrix to the Intermembrane Space. Mol. Cell. Biol.
27: 4664-4673
[Abstract]
[Full Text]
-
Cardol, P., Gonzalez-Halphen, D., Reyes-Prieto, A., Baurain, D., Matagne, R. F., Remacle, C.
(2005). The Mitochondrial Oxidative Phosphorylation Proteome of Chlamydomonas reinhardtii Deduced from the Genome Sequencing Project. Plant Physiol.
137: 447-459
[Full Text]
-
Saracco, S. A., Fox, T. D.
(2002). Cox18p Is Required for Export of the Mitochondrially Encoded Saccharomyces cerevisiae Cox2p C-Tail and Interacts with Pnt1p and Mss2p in the Inner Membrane. Mol. Biol. Cell
13: 1122-1131
[Abstract]
[Full Text]